#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
RUNX3	864	mdanderson.org	37	1	25228682	25228682	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:25228682G>T	ENST00000308873.6	-	5	1187	c.1179C>A	c.(1177-1179)agC>agA	p.S393R	RUNX3_ENST00000540420.1_Missense_Mutation_p.S300R|RUNX3_ENST00000338888.3_Missense_Mutation_p.S407R|RUNX3_ENST00000496967.1_5'Flank|RUNX3_ENST00000399916.1_Missense_Mutation_p.S407R	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	393	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		AGTTGCTGTGGCTGCCGTCGG	0.706																																					p.S407R													.	.			0			c.C1221A												10.0	10.0	10.0					1																	25228682		2112	4151	6263	SO:0001583	missense	864	exon6			GCTGTGGCTGCCG	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.1179C>A	1.37:g.25228682G>T	ENSP00000308051:p.Ser393Arg		40	0	0		42	0.07	3	NM_001031680	43	0.00	0	B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000308873.6	37	CCDS257.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385569	0.61956	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000540420;ENST00000428150	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	4.15	1.15	0.20763	Runx inhibition (1);	0.000000	0.85682	D	0.000000	T	0.49643	0.1569	M	0.64997	1.995	0.44643	D	0.997621	D;D;D	0.61697	0.99;0.984;0.966	D;P;P	0.64321	0.924;0.81;0.773	T	0.46992	-0.9151	10	0.72032	D	0.01	-31.8311	9.6601	0.39950	0.2284:0.0:0.7716:0.0	.	340;407;393	E9PH34;B1AJV5;Q13761	.;.;RUNX3_HUMAN	R	407;393;407;300;340	ENSP00000382800:S407R;ENSP00000308051:S393R;ENSP00000343477:S407R;ENSP00000444872:S300R	ENSP00000308051:S393R	S	-	3	2	RUNX3	25101269	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.486000	0.35530	0.146000	0.19002	0.462000	0.41574	AGC			0.706	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000009284.1		NM_004350	
LOC101927209	101927209	broad.mit.edu	37	1	142699482	142699483	+	lincRNA	INS	-	-	TG	rs370254241		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:142699482_142699483insTG	ENST00000610091.1	-	0	3130																											AACCTAATTATTATGTTTGTTG	0.252																																					.													.	.			0			.																																											0	.			TAATTATTATGTT																													1.37:g.142699482_142699483insTG			14	0	0		18	0.11	2	.	0		0		RNA	INS	ENST00000610091.1	37																																																																																						0.252	RP11-417J8.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000037265.2			
IVL	3713	broad.mit.edu	37	1	152883011	152883011	+	Silent	SNP	T	T	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:152883011T>A	ENST00000368764.3	+	2	802	c.738T>A	c.(736-738)tcT>tcA	p.S246S	IVL_ENST00000392667.2_Silent_p.S100S			P07476	INVO_HUMAN	involucrin	246	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			tggagctctctgagcagcagg	0.672																																					p.S246S													.	IVL	100		0			c.T738A												6.0	7.0	7.0					1																	152883011		1910	3809	5719	SO:0001819	synonymous_variant	3713	exon2			GCTCTCTGAGCAG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.738T>A	1.37:g.152883011T>A			65	0	0		76	0.07	5	NM_005547	0		0	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																					0.672	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034664.1		NM_005547	
THBS3	7059	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155172077	155172077	+	Missense_Mutation	SNP	A	A	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:155172077A>G	ENST00000368378.3	-	9	1093	c.1073T>C	c.(1072-1074)aTt>aCt	p.I358T	THBS3_ENST00000457183.2_Missense_Mutation_p.I238T|RP11-263K19.4_ENST00000436772.1_RNA|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000541576.1_5'Flank|RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000422665.1_RNA|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000447623.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	358					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGCATAGTCAATGCCCACACC	0.602																																					p.I358T													.	THBS3	70		0			c.T1073C												92.0	85.0	87.0					1																	155172077		2203	4300	6503	SO:0001583	missense	7059	exon9			TAGTCAATGCCCA	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.1073T>C	1.37:g.155172077A>G	ENSP00000357362:p.Ile358Thr		58	0.0172413793	1		117	0.15	18	NM_007112	18	0.22	4	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.572458	0.45798	.	.	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000428962	T;D;D	0.87887	-1.49;-1.58;-2.31	5.44	5.44	0.79542	EGF-like calcium-binding (1);	0.304822	0.34245	N	0.004124	T	0.72391	0.3454	L	0.37850	1.14	0.28224	N	0.926393	B;B;B;B	0.16396	0.017;0.017;0.017;0.017	B;B;B;B	0.19946	0.027;0.018;0.018;0.018	T	0.65105	-0.6249	10	0.42905	T	0.14	-11.8776	13.502	0.61462	1.0:0.0:0.0:0.0	.	238;358;358;358	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	T	358;238;208	ENSP00000357362:I358T;ENSP00000392207:I238T;ENSP00000404040:I208T	ENSP00000357362:I358T	I	-	2	0	THBS3	153438701	0.037000	0.19845	0.960000	0.40013	0.996000	0.88848	3.134000	0.50538	2.288000	0.76882	0.533000	0.62120	ATT			0.602	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086856.1		NM_007112	
GPATCH4	54865	hgsc.bcm.edu	37	1	156568272	156568272	+	Silent	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:156568272G>T	ENST00000438976.2	-	3	139	c.109C>A	c.(109-111)Cgg>Agg	p.R37R	GPATCH4_ENST00000334588.7_Intron|GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000368232.4_Silent_p.R32R			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	32	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.						poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTCTCCTTCCGGCCGAGGCCT	0.562																																					p.R37R													.	.			0			c.C109A												226.0	203.0	211.0					1																	156568272		2203	4300	6503	SO:0001819	synonymous_variant	54865	exon3			CCTTCCGGCCGAG	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.109C>A	1.37:g.156568272G>T			83	0	0		92	0.04	4	NM_015590	212	0.00	0	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Silent	SNP	ENST00000438976.2	37	CCDS44245.1																																																																																					0.562	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386947.1		NM_017725	
SMG7	9887	broad.mit.edu	37	1	183514071	183514071	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:183514071C>T	ENST00000347615.2	+	16	2113	c.1994C>T	c.(1993-1995)cCg>cTg	p.P665L	SMG7_ENST00000456731.2_Missense_Mutation_p.P577L|SMG7_ENST00000507469.1_Missense_Mutation_p.P619L|SMG7_ENST00000508461.1_Missense_Mutation_p.P623L|SMG7_ENST00000515829.2_Missense_Mutation_p.P619L|SMG7_ENST00000367537.3_Missense_Mutation_p.P648L	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	665	Gln/Pro-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.P665L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GAAGGGTTTCCGCCCCCAACA	0.438																																					p.P665L													SMG7,colon,carcinoma,0,1	SMG7	165	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1994T												85.0	90.0	88.0					1																	183514071		2203	4300	6503	SO:0001583	missense	9887	exon16			GGTTTCCGCCCCC	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1994C>T	1.37:g.183514071C>T	ENSP00000340766:p.Pro665Leu		117	0	0		129	0.02	3	NM_173156	210	0.00	1	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	37	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218021	0.79352	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16;0.16;0.16	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.68439	0.3001	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.998;0.997;0.997;0.998;0.998;0.997	T	0.69942	-0.5008	10	0.59425	D	0.04	-11.3529	19.7629	0.96329	0.0:1.0:0.0:0.0	.	623;648;577;619;665;619	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	L	577;648;623;577;665;619;619	ENSP00000407629:P577L;ENSP00000356507:P648L;ENSP00000426915:P623L;ENSP00000388390:P577L;ENSP00000340766:P665L;ENSP00000425133:P619L;ENSP00000421358:P619L	ENSP00000340766:P665L	P	+	2	0	SMG7	181780694	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.123000	0.77176	2.666000	0.90696	0.561000	0.74099	CCG			0.438	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000085432.1		NM_014837	
CCDC185	164127	mdanderson.org	37	1	223566845	223566845	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:223566845C>T	ENST00000366875.3	+	1	131	c.28C>T	c.(28-30)Ccg>Tcg	p.P10S		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		10										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		CTTCTCCCAGCCGCCCTACCG	0.726																																					p.P10S													.	.			0			c.C28T												4.0	5.0	4.0					1																	223566845		1957	3936	5893	SO:0001583	missense	164127	exon1			TCCCAGCCGCCCT																												ENST00000366875.3:c.28C>T	1.37:g.223566845C>T	ENSP00000355840:p.Pro10Ser		34	0	0		47	0.06	3	NM_152610	0		0	Q8N746|Q8NA93	Missense_Mutation	SNP	ENST00000366875.3	37	CCDS1537.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246949	0.22796	.	.	ENSG00000178395	ENST00000366875	T	0.16743	2.32	3.81	0.668	0.17912	.	.	.	.	.	T	0.08758	0.0217	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.16289	0.015	T	0.32851	-0.9891	9	0.45353	T	0.12	.	9.3757	0.38281	0.5598:0.4402:0.0:0.0	.	10	Q8N715	CA065_HUMAN	S	10	ENSP00000355840:P10S	ENSP00000355840:P10S	P	+	1	0	C1orf65	221633468	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.148000	0.10219	-0.046000	0.13446	0.563000	0.77884	CCG			0.726	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092718.1			
SDE2	163859	broad.mit.edu	37	1	226186983	226186983	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr1:226186983G>T	ENST00000272091.7	-	1	49	c.31C>A	c.(31-33)Cgc>Agc	p.R11S		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	11																	CCAGGGCCGCGAATCCACACC	0.657																																					p.R11S													.	.			0			c.C31A												31.0	39.0	37.0					1																	226186983		2038	4177	6215	SO:0001583	missense	163859	exon1			GGCCGCGAATCCA	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.31C>A	1.37:g.226186983G>T	ENSP00000272091:p.Arg11Ser		75	0	0		107	0.04	4	NM_152608	32	0.00	0	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	37	CCDS41473.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822141	0.50739	.	.	ENSG00000143751	ENST00000272091;ENST00000366818	T	0.50277	0.75	5.34	3.34	0.38264	.	0.222293	0.42682	D	0.000667	T	0.54886	0.1886	M	0.69823	2.125	0.80722	D	1	D;D	0.69078	0.997;0.961	D;P	0.63703	0.917;0.67	T	0.59542	-0.7435	10	0.07644	T	0.81	-10.337	6.6014	0.22703	0.2132:0.0:0.7868:0.0	.	11;11	Q6IQ49-2;Q6IQ49	.;CA055_HUMAN	S	11	ENSP00000272091:R11S	ENSP00000272091:R11S	R	-	1	0	C1orf55	224253606	0.896000	0.30565	0.999000	0.59377	0.343000	0.28985	0.912000	0.28597	1.490000	0.48466	0.655000	0.94253	CGC			0.657	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091310.1		NM_152608	
DNAJC12	56521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	69571358	69571358	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr10:69571358C>T	ENST00000225171.2	-	3	373	c.221G>A	c.(220-222)cGc>cAc	p.R74H	RNU6-1250P_ENST00000391218.1_RNA|DNAJC12_ENST00000339758.7_Missense_Mutation_p.R74H|DNAJC12_ENST00000483798.2_Missense_Mutation_p.R104H	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	74	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.									breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						GTGGTCATAGCGGGCTCGACT	0.507																																					p.R74H													.	.			0			c.G221A												151.0	127.0	135.0					10																	69571358		2203	4300	6503	SO:0001583	missense	56521	exon3			TCATAGCGGGCTC	AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.221G>A	10.37:g.69571358C>T	ENSP00000225171:p.Arg74His		140	0	0		173	0.11	19	NM_021800	5	0.00	0	Q5JVQ1|Q9UKB2	Missense_Mutation	SNP	ENST00000225171.2	37	CCDS7271.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366838	0.41902	.	.	ENSG00000108176	ENST00000225171;ENST00000339758	T;T	0.29655	1.56;1.56	5.72	2.85	0.33270	Heat shock protein DnaJ, N-terminal (4);	0.150747	0.64402	D	0.000012	T	0.18002	0.0432	N	0.25485	0.75	0.39274	D	0.96444	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.07927	-1.0747	10	0.33940	T	0.23	-10.4551	5.5424	0.17045	0.1394:0.6409:0.0:0.2197	.	74;74	Q9UKB3-2;Q9UKB3	.;DJC12_HUMAN	H	74	ENSP00000225171:R74H;ENSP00000343575:R74H	ENSP00000225171:R74H	R	-	2	0	DNAJC12	69241364	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.348000	0.44045	0.335000	0.23614	-0.254000	0.11334	CGC			0.507	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048291.1		NM_021800	
VENTX	27287	mdanderson.org	37	10	135051634	135051634	+	Silent	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr10:135051634G>T	ENST00000325980.9	+	1	727	c.216G>T	c.(214-216)ctG>ctT	p.L72L		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	72					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		CCTCAAATCTGCCTGCGCCGG	0.721																																					p.L72L													.	.			0			c.G216T												6.0	9.0	8.0					10																	135051634		1877	3870	5747	SO:0001819	synonymous_variant	27287	exon1			AAATCTGCCTGCG	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.216G>T	10.37:g.135051634G>T			50	0	0		44	0.07	3	NM_014468	439	0.00	2	Q32MZ3	Silent	SNP	ENST00000325980.9	37	CCDS7675.1																																																																																					0.721	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051116.4		NM_014468	
CHID1	66005	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	903029	903029	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:903029C>T	ENST00000449825.1	-	3	550	c.194G>A	c.(193-195)cGc>cAc	p.R65H	CHID1_ENST00000436108.2_Missense_Mutation_p.R65H|CHID1_ENST00000429789.2_Missense_Mutation_p.R65H|CHID1_ENST00000528581.1_Missense_Mutation_p.R90H|CHID1_ENST00000323541.7_Missense_Mutation_p.R95H|CHID1_ENST00000336845.5_Missense_Mutation_p.R90H|CHID1_ENST00000323578.8_Missense_Mutation_p.R65H|CHID1_ENST00000454838.2_Missense_Mutation_p.R90H|CHID1_ENST00000526714.1_5'UTR	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	65					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)			endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		GCAGTAGCTGCGATGCTCAAG	0.542																																					p.R90H	Pancreas(117;992 2327 5172 41921)												.	CHID1	29		0			c.G269A												106.0	93.0	98.0					11																	903029		2203	4299	6502	SO:0001583	missense	66005	exon4			TAGCTGCGATGCT	AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.194G>A	11.37:g.903029C>T	ENSP00000391255:p.Arg65His		40	0	0		52	0.10	5	NM_001142676	227	0.00	0	B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Missense_Mutation	SNP	ENST00000449825.1	37	CCDS7722.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444087	0.43429	.	.	ENSG00000177830	ENST00000323541;ENST00000449825;ENST00000454838;ENST00000323578;ENST00000429789;ENST00000528581;ENST00000336845;ENST00000436108;ENST00000531859;ENST00000533056;ENST00000533059;ENST00000530939;ENST00000525225	T;T;T;T;T;T;T;T	0.32515	1.45;1.48;1.89;1.48;1.46;1.89;1.89;1.48	4.79	3.86	0.44501	.	0.048815	0.85682	D	0.000000	T	0.46756	0.1409	M	0.68952	2.095	0.41534	D	0.988476	P;P;D;P;P	0.89917	0.762;0.762;1.0;0.846;0.528	B;B;P;B;B	0.62184	0.061;0.061;0.899;0.129;0.036	T	0.43782	-0.9370	10	0.51188	T	0.08	-36.0922	10.2696	0.43475	0.0:0.8445:0.0:0.1555	.	126;95;65;90;65	B4DN31;B7Z705;Q9BWS9-3;Q9BWS9-2;Q9BWS9	.;.;.;.;CHID1_HUMAN	H	95;65;90;65;65;90;90;65;65;65;65;65;65	ENSP00000324821:R95H;ENSP00000391255:R65H;ENSP00000398722:R90H;ENSP00000325055:R65H;ENSP00000416034:R65H;ENSP00000435503:R90H;ENSP00000338838:R90H;ENSP00000388156:R65H	ENSP00000324821:R95H	R	-	2	0	CHID1	893029	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	1.272000	0.33109	2.393000	0.81446	0.462000	0.41574	CGC			0.542	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257112.1		NM_023947	
NAT10	55226	broad.mit.edu	37	11	34149080	34149080	+	Missense_Mutation	SNP	T	T	C			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:34149080T>C	ENST00000257829.3	+	12	1384	c.1178T>C	c.(1177-1179)aTc>aCc	p.I393T	NAT10_ENST00000531159.2_Missense_Mutation_p.I321T|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	393						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GCTGCCGCCATCCCCCTCCCC	0.502																																					p.I393T													.	NAT10	78		0			c.T1178C												177.0	161.0	167.0					11																	34149080		2202	4298	6500	SO:0001583	missense	55226	exon12			CCGCCATCCCCCT	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.1178T>C	11.37:g.34149080T>C	ENSP00000257829:p.Ile393Thr		135	0.0222222222	3		174	0.02	3	NM_024662	92	0.00	0	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.860396	0.91433	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.59638	0.25;0.25	5.99	5.99	0.97316	Domain of unknown function DUF699, exodeoxyribonuclease V alpha chain (1);	0.000000	0.85682	D	0.000000	D	0.84920	0.5579	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90266	0.4304	10	0.87932	D	0	-23.1049	16.4943	0.84223	0.0:0.0:0.0:1.0	.	393	Q9H0A0	NAT10_HUMAN	T	393;321	ENSP00000257829:I393T;ENSP00000433011:I321T	ENSP00000257829:I393T	I	+	2	0	NAT10	34105656	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.581000	0.82535	2.291000	0.77112	0.533000	0.62120	ATC			0.502	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388693.1		NM_024662	
RAPSN	5913	mdanderson.org	37	11	47469559	47469559	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:47469559C>T	ENST00000298854.2	-	2	549	c.336G>A	c.(334-336)ctG>ctA	p.L112L	RAPSN_ENST00000529341.1_Silent_p.L112L|RAPSN_ENST00000352508.3_Silent_p.L112L|RAPSN_ENST00000524487.1_Silent_p.L112L	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	112				L -> V (in Ref. 1; CAA83954). {ECO:0000305}.	positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						TGGTACCAGGCAGCCCAAGGC	0.617																																					p.L112L													.	.			0			c.G336A												76.0	58.0	64.0					11																	47469559		2201	4298	6499	SO:0001819	synonymous_variant	5913	exon2			ACCAGGCAGCCCA		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.336G>A	11.37:g.47469559C>T			43	0	0		55	0.05	3	NM_005055	0		0	Q8TDF3|Q9BTD9	Silent	SNP	ENST00000298854.2	37	CCDS7936.1																																																																																					0.617	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391726.1			
Unknown	0	bcgsc.ca	37	11	62815368	62815368	+	IGR	SNP	G	G	A	rs150679703|rs374048942|rs7125680|rs372143980	byFrequency	TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:62815368G>A								SLC22A8 (32057 upstream) : SLC22A24 (32043 downstream)																							CCAAGGTGCAGCATGCCATGT	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGCAGCATGCC																													11.37:g.62815368G>A			22	0	0		40	0.18	7	.	0		0		RNA	SNP		37																																																																																					0	0.562										
SLC22A24	283238	hgsc.bcm.edu	37	11	62848443	62848443	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:62848443G>T	ENST00000417740.1	-	9	1988	c.1547C>A	c.(1546-1548)cCa>cAa	p.P516Q		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	274					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						CCTGGTTTCTGGAAGGAGGAG	0.507																																					p.P516Q													SLC22A24_ENST00000417740,NS,carcinoma,-2,1	SLC22A24_ENST00000417740	-2	1	0			c.C1547A												153.0	131.0	137.0					11																	62848443		692	1591	2283	SO:0001583	missense	283238	exon9			GTTTCTGGAAGGA		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1547C>A	11.37:g.62848443G>T	ENSP00000396586:p.Pro516Gln		90	0	0		78	0.05	4	NM_001136506	0		0		Missense_Mutation	SNP	ENST00000417740.1	37		.	.	.	.	.	.	.	.	.	.	G	15.21	2.766040	0.49574	.	.	ENSG00000197658	ENST00000417740	T	0.79940	-1.32	3.49	3.49	0.39957	.	.	.	.	.	D	0.93164	0.7823	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95091	0.8222	9	0.87932	D	0	.	13.0383	0.58885	0.0:0.0:1.0:0.0	.	516	C9JC66	.	Q	516	ENSP00000396586:P516Q	ENSP00000396586:P516Q	P	-	2	0	SLC22A24	62605019	1.000000	0.71417	0.996000	0.52242	0.468000	0.32798	4.402000	0.59722	1.970000	0.57323	0.590000	0.80494	CCA			0.507	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000383747.1		NM_173586	
TBX10	347853	mdanderson.org	37	11	67399845	67399845	+	Missense_Mutation	SNP	C	C	T	rs146079895		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr11:67399845C>T	ENST00000335385.3	-	7	899	c.812G>A	c.(811-813)cGg>cAg	p.R271Q	NUDT8_ENST00000301490.4_5'Flank|NUDT8_ENST00000376693.2_5'Flank	NM_005995.4	NP_005986.2	O75333	TBX10_HUMAN	T-box 10	271					anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|lung(4)|ovary(1)	7						GCTGTGACTCCGGGCTGGGAC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18653	0.0		0.001	False		,,,				2504	0.0				p.R271Q													.	.			0			c.G812A							C	GLN/ARG	2,4398	4.2+/-10.8	0,2,2198	69.0	64.0	66.0		812	2.0	0.3	11	dbSNP_134	66	0,8588		0,0,4294	no	missense	TBX10	NM_005995.4	43	0,2,6492	TT,TC,CC		0.0,0.0455,0.0154	possibly-damaging	271/386	67399845	2,12986	2200	4294	6494	SO:0001583	missense	347853	exon7			TGACTCCGGGCTG	AH006177	CCDS31621.1	11q13.2	2005-10-11	2004-10-05		ENSG00000167800	ENSG00000167800		"""T-boxes"""	11593	protein-coding gene	gene with protein product		604648	"""T-box 7"""	TBX7		9545502	Standard	NM_005995		Approved	TBX13	uc001omp.3	O75333	OTTHUMG00000167291	ENST00000335385.3:c.812G>A	11.37:g.67399845C>T	ENSP00000335191:p.Arg271Gln		35	0	0		38	0.08	3	NM_005995	2	0.00	0	Q14D64|Q86XS3	Missense_Mutation	SNP	ENST00000335385.3	37	CCDS31621.1	.	.	.	.	.	.	.	.	.	.	C	9.728	1.161587	0.21538	4.55E-4	0.0	ENSG00000167800	ENST00000335385	D	0.86366	-2.11	4.96	1.99	0.26369	.	1.705140	0.03236	N	0.179662	T	0.79862	0.4519	L	0.27053	0.805	0.19300	N	0.999976	B	0.25772	0.134	B	0.15052	0.012	T	0.64296	-0.6441	10	0.39692	T	0.17	.	7.038	0.25004	0.0:0.5749:0.3338:0.0913	.	271	O75333	TBX10_HUMAN	Q	271	ENSP00000335191:R271Q	ENSP00000335191:R271Q	R	-	2	0	TBX10	67156421	0.000000	0.05858	0.335000	0.25508	0.070000	0.16714	-1.927000	0.01561	0.266000	0.21894	-1.087000	0.02190	CGG	0		0.617	TBX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394034.1		NM_005995	
KMT2D	8085	broad.mit.edu	37	12	49435162	49435162	+	Missense_Mutation	SNP	T	T	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr12:49435162T>G	ENST00000301067.7	-	31	6390	c.6391A>C	c.(6391-6393)Acc>Ccc	p.T2131P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2131	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCGGCGGGGGTAGTGGGGCTG	0.701																																					p.T2131P													.	MLL2	1173		0			c.A6391C												8.0	11.0	10.0					12																	49435162		1778	3980	5758	SO:0001583	missense	8085	exon31			CGGGGGTAGTGGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6391A>C	12.37:g.49435162T>G	ENSP00000301067:p.Thr2131Pro		50	0.24	12		82	0.20	16	NM_003482	25	0.12	3	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	7.328	0.618351	0.14129	.	.	ENSG00000167548	ENST00000301067	T	0.79454	-1.27	3.83	-0.15	0.13416	.	0.528712	0.14289	N	0.329016	T	0.55625	0.1932	N	0.08118	0	0.26200	N	0.979458	B	0.02656	0.0	B	0.01281	0.0	T	0.49844	-0.8896	10	0.87932	D	0	.	8.1002	0.30852	0.0:0.0903:0.5785:0.3312	.	2131	O14686	MLL2_HUMAN	P	2131	ENSP00000301067:T2131P	ENSP00000301067:T2131P	T	-	1	0	MLL2	47721429	0.039000	0.19947	0.969000	0.41365	0.958000	0.62258	-0.079000	0.11357	-0.032000	0.13758	0.459000	0.35465	ACC			0.701	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390183.2			
KRT79	338785	mdanderson.org	37	12	53227722	53227722	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr12:53227722G>T	ENST00000330553.5	-	1	357	c.323C>A	c.(322-324)gCt>gAt	p.A108D		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	108	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGGAGGACAAGCAGGCCCAAA	0.652																																					p.A108D													.	.			0			c.C323A												50.0	52.0	51.0					12																	53227722		2203	4300	6503	SO:0001583	missense	338785	exon1			GGACAAGCAGGCC	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.323C>A	12.37:g.53227722G>T	ENSP00000328358:p.Ala108Asp		69	0	0		108	0.05	5	NM_175834	0		0	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	G	4.452	0.083740	0.08533	.	.	ENSG00000185640	ENST00000330553	T	0.75704	-0.96	4.28	-1.24	0.09435	.	0.685537	0.12741	N	0.443024	T	0.62060	0.2397	L	0.35854	1.095	0.09310	N	1	B	0.26845	0.161	B	0.28553	0.091	T	0.54337	-0.8309	10	0.59425	D	0.04	.	9.1145	0.36748	0.665:0.0:0.335:0.0	.	108	Q5XKE5	K2C79_HUMAN	D	108	ENSP00000328358:A108D	ENSP00000328358:A108D	A	-	2	0	KRT79	51513989	0.001000	0.12720	0.029000	0.17559	0.114000	0.19823	0.051000	0.14141	-0.250000	0.09555	0.591000	0.81541	GCT			0.652	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406376.1		NM_175834	
CKAP4	10970	broad.mit.edu;mdanderson.org	37	12	106641269	106641269	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr12:106641269C>T	ENST00000378026.4	-	1	497	c.361G>A	c.(361-363)Gct>Act	p.A121T	CKAP4_ENST00000552828.1_Intron|RP11-651L5.2_ENST00000552486.1_RNA	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	121	Poly-Ala.					cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						CCCGAGAAAGCGGCCGCCGCC	0.731																																					p.A121T													.	CKAP4	49		0			c.G361A												4.0	6.0	5.0					12																	106641269		2007	4023	6030	SO:0001583	missense	10970	exon1			AGAAAGCGGCCGC	X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.361G>A	12.37:g.106641269C>T	ENSP00000367265:p.Ala121Thr		13	0	0		22	0.18	4	NM_006825	111	0.01	1	Q504S5|Q53ES6	Missense_Mutation	SNP	ENST00000378026.4	37	CCDS9103.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042267	0.55003	.	.	ENSG00000136026	ENST00000378026	T	0.34072	1.38	3.34	2.44	0.29823	.	0.486738	0.19471	N	0.113458	T	0.31734	0.0806	M	0.63843	1.955	0.38705	D	0.953071	P	0.47106	0.89	B	0.38683	0.279	T	0.26780	-1.0093	10	0.66056	D	0.02	-12.3479	8.3512	0.32303	0.0:0.8841:0.0:0.1159	.	121	Q07065	CKAP4_HUMAN	T	121	ENSP00000367265:A121T	ENSP00000367265:A121T	A	-	1	0	CKAP4	105165399	1.000000	0.71417	0.981000	0.43875	0.499000	0.33736	3.174000	0.50847	0.593000	0.29745	0.393000	0.25936	GCT			0.731	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407196.1			
HECTD4	283450	mdanderson.org	37	12	112664471	112664471	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr12:112664471G>T	ENST00000430131.2	-	43	6825	c.5680C>A	c.(5680-5682)Cta>Ata	p.L1894I	HECTD4_ENST00000377560.5_Missense_Mutation_p.L2144I|HECTD4_ENST00000550722.1_Missense_Mutation_p.L2170I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1894					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGGGCTACTAGGTTAAGAACT	0.403																																					p.L2182I													.	.			0			c.C6544A												90.0	87.0	88.0					12																	112664471		1896	4132	6028	SO:0001583	missense	283450	exon44			CTACTAGGTTAAG	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.5680C>A	12.37:g.112664471G>T	ENSP00000404379:p.Leu1894Ile		26	0	0		46	0.07	3	NM_001109662	33	0.00	0	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	G	13.20	2.167425	0.38315	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.46063	0.88;0.88;0.88	5.24	5.24	0.73138	.	.	.	.	.	T	0.38348	0.1037	N	0.08118	0	0.42816	D	0.993979	P	0.52842	0.956	P	0.62184	0.899	T	0.26643	-1.0097	9	0.28530	T	0.3	.	11.2587	0.49069	0.093:0.0:0.907:0.0	.	1894	Q9Y4D8	K0614_HUMAN	I	2144;1894;2170	ENSP00000366783:L2144I;ENSP00000404379:L1894I;ENSP00000449784:L2170I	ENSP00000366783:L2144I	L	-	1	2	C12orf51	111148854	1.000000	0.71417	0.997000	0.53966	0.884000	0.51177	5.389000	0.66255	2.444000	0.82710	0.467000	0.42956	CTA			0.403	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
SPERT	220082	broad.mit.edu;mdanderson.org	37	13	46288213	46288213	+	Silent	SNP	C	C	T	rs528252989	byFrequency	TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr13:46288213C>T	ENST00000310521.1	+	3	1133	c.1053C>T	c.(1051-1053)gaC>gaT	p.D351D	SPERT_ENST00000378966.3_Silent_p.D315D	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	351						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		GCCTGCCCGACGGCTGCCAGC	0.692													c|||	3	0.000599042	0.0008	0.0	5008	,	,		15670	0.0		0.002	False		,,,				2504	0.0				p.D351D													.	SPERT	54		0			c.C1053T												5.0	6.0	5.0					13																	46288213		2122	4160	6282	SO:0001819	synonymous_variant	220082	exon3			GCCCGACGGCTGC	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.1053C>T	13.37:g.46288213C>T			33	0	0		25	0.12	3	NM_152719	0		0	A8K8I5|Q8NHV2	Silent	SNP	ENST00000310521.1	37	CCDS9399.1																																																																																					0.692	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044786.2		NM_152719	
ERCC5	2073	mdanderson.org	37	13	103528227	103528227	+	Missense_Mutation	SNP	G	G	T	rs55843971		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr13:103528227G>T	ENST00000355739.4	+	15	4958	c.3535G>T	c.(3535-3537)Gcg>Tcg	p.A1179S	ERCC5_ENST00000472247.1_3'UTR|ERCC5_ENST00000375954.1_Missense_Mutation_p.A412S	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	1179					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ACTAAGACGTGCGAGGGGAAG	0.393			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.A1633S			yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	ERCC5,NS,carcinoma,-2,1	ERCC5	-2	1	0			c.G4897T												36.0	39.0	38.0					13																	103528227		2200	4297	6497	SO:0001583	missense	0	exon23	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AGACGTGCGAGGG	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.3535G>T	13.37:g.103528227G>T	ENSP00000347978:p.Ala1179Ser		20	0	0		21	0.10	2	NM_001204425	64	0.00	0	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	8.070	0.769973	0.15983	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.06849	3.55;3.25	5.35	-1.08	0.09936	.	2.065180	0.01750	N	0.029850	T	0.04452	0.0122	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.36890	-0.9729	10	0.09590	T	0.72	2.7802	7.3592	0.26737	0.5887:0.1212:0.29:0.0	rs55843971	1179	P28715	ERCC5_HUMAN	S	1604;1179;1011;412	ENSP00000347978:A1179S;ENSP00000365121:A412S	ENSP00000347978:A1179S	A	+	1	0	ERCC5	102326228	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.915000	0.04033	-0.440000	0.07211	0.650000	0.86243	GCG			0.393	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045708.1			
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24878059	24878059	+	Silent	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr14:24878059G>A	ENST00000382554.3	+	4	1377	c.1059G>A	c.(1057-1059)ggG>ggA	p.G353G		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	353					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGACCCCGGGGCCAGCCTTTG	0.582																																					p.G353G													.	.			0			c.G1059A												30.0	31.0	31.0					14																	24878059		1883	4106	5989	SO:0001819	synonymous_variant	57523	exon4			CCCGGGGCCAGCC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.1059G>A	14.37:g.24878059G>A			104	0	0		130	0.18	23	NM_025081	15	0.33	5	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	37	CCDS45090.1																																																																																					0.582	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412939.1			
FOXA1	3169	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	38060906	38060906	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr14:38060906G>T	ENST00000250448.2	-	2	1144	c.1083C>A	c.(1081-1083)agC>agA	p.S361R	FOXA1_ENST00000540786.1_Missense_Mutation_p.S328R|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	361					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CGGGCCCGGAGCTTATGGGGG	0.711																																					p.S361R													.	.			0			c.C1083A												8.0	9.0	8.0					14																	38060906		2179	4267	6446	SO:0001583	missense	3169	exon2			CCCGGAGCTTATG	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1083C>A	14.37:g.38060906G>T	ENSP00000250448:p.Ser361Arg		24	0	0		53	0.19	10	NM_004496	0		0	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	37	CCDS9665.1	.	.	.	.	.	.	.	.	.	.	G	6.000	0.368398	0.11352	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.91843	-2.92;-2.92	4.08	3.18	0.36537	.	0.685470	0.14392	N	0.322460	T	0.80773	0.4687	N	0.19112	0.55	0.41182	D	0.986245	B	0.34015	0.435	B	0.29524	0.103	T	0.71965	-0.4433	10	0.15499	T	0.54	.	4.148	0.10225	0.2142:0.1955:0.5903:0.0	.	361	P55317	FOXA1_HUMAN	R	361;328	ENSP00000250448:S361R;ENSP00000440178:S328R	ENSP00000250448:S361R	S	-	3	2	FOXA1	37130657	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	2.354000	0.44098	0.923000	0.37045	0.400000	0.26472	AGC			0.711	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276735.1			
SEL1L	6400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81969081	81969081	+	Missense_Mutation	SNP	G	G	C			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr14:81969081G>C	ENST00000336735.4	-	6	877	c.761C>G	c.(760-762)tCt>tGt	p.S254C	SEL1L_ENST00000555824.1_Missense_Mutation_p.S254C	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	254	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TCCCTTGGGAGAGCCTTCCTC	0.433																																					p.S254C													.	.			0			c.C761G												252.0	238.0	243.0					14																	81969081		2203	4300	6503	SO:0001583	missense	6400	exon6			TTGGGAGAGCCTT		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.761C>G	14.37:g.81969081G>C	ENSP00000337053:p.Ser254Cys		48	0	0		102	0.12	12	NM_001244984	25	0.08	2	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	37	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.499202	0.85069	.	.	ENSG00000071537	ENST00000336735;ENST00000555824	T;T	0.53423	0.62;0.65	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.69333	0.3099	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.922;0.996	T	0.66850	-0.5819	10	0.40728	T	0.16	.	19.6558	0.95837	0.0:0.0:1.0:0.0	.	254;254	Q9UBV2;Q9UBV2-2	SE1L1_HUMAN;.	C	254	ENSP00000337053:S254C;ENSP00000450709:S254C	ENSP00000337053:S254C	S	-	2	0	SEL1L	81038834	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.105000	0.94246	2.719000	0.93026	0.655000	0.94253	TCT			0.433	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413325.1		NM_005065	
GOLGA6L2	283685	broad.mit.edu	37	15	23685749	23685751	+	In_Frame_Del	DEL	CTC	CTC	-	rs147373023		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr15:23685749_23685751delCTC	ENST00000567107.1	-	8	1923_1925	c.1871_1873delGAG	c.(1870-1875)ggagaa>gaa	p.G624del	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ctcgcatcttctcctcctggtcc	0.586																																					.													.	.			0			.																																									SO:0001651	inframe_deletion	283685	.			CATCTTCTCCTCC	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1871_1873delGAG	15.37:g.23685752_23685754delCTC	ENSP00000454407:p.Gly624del		16	0	0		19	0.37	7	.	0		0	A1L301	In_Frame_Del	DEL	ENST00000567107.1	37																																																																																						0.586	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000431937.1		NM_182561	
MEF2A	4205	hgsc.bcm.edu	37	15	100211846	100211846	+	Missense_Mutation	SNP	G	G	A	rs75705863		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr15:100211846G>A	ENST00000354410.5	+	5	1009	c.380G>A	c.(379-381)cGg>cAg	p.R127Q	MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000557942.1_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	127					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			AATATGATGCGGAATCATAAA	0.353																																					p.R127Q													MEF2A_ENST00000354410,NS,carcinoma,+1,1	MEF2A_ENST00000354410	1	1	0			c.G380A												23.0	21.0	22.0					15																	100211846		1829	4075	5904	SO:0001583	missense	4205	exon5			TGATGCGGAATCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.380G>A	15.37:g.100211846G>A	ENSP00000346389:p.Arg127Gln		20	0	0		40	0.10	4	NM_005587	5	0.00	0	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210988	0.39102	.	.	ENSG00000068305	ENST00000354410	T	0.53640	0.61	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.388740	0.29028	N	0.013366	T	0.33731	0.0873	N	0.10916	0.065	0.80722	D	1	B;B	0.29301	0.241;0.203	B;B	0.37422	0.249;0.135	T	0.11916	-1.0568	10	0.05833	T	0.94	-16.9184	19.5673	0.95398	0.0:0.0:1.0:0.0	.	127;127	Q02078;Q02078-5	MEF2A_HUMAN;.	Q	127	ENSP00000346389:R127Q	ENSP00000346389:R127Q	R	+	2	0	MEF2A	98029369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.420000	0.97426	2.706000	0.92434	0.462000	0.41574	CGG			0.353	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000415980.1			
NPW	283869	mdanderson.org	37	16	2070149	2070149	+	Missense_Mutation	SNP	G	G	A	rs543718628	byFrequency	TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:2070149G>A	ENST00000566435.1	+	1	604	c.91G>A	c.(91-93)Gca>Aca	p.A31T	NPW_ENST00000329610.4_Missense_Mutation_p.A83T			Q8N729	NPW_HUMAN	neuropeptide W	83					feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				kidney(1)	1						CCCCGAACCCGCAGCCCGCGA	0.751													G|||	6	0.00119808	0.0	0.0	5008	,	,		9969	0.0		0.0	False		,,,				2504	0.0061				p.A83T													.	.			0			c.G247A												8.0	8.0	8.0					16																	2070149		1405	3339	4744	SO:0001583	missense	283869	exon1			GAACCCGCAGCCC	AB084276	CCDS42102.1	16p13.3	2013-02-26			ENSG00000183971	ENSG00000183971		"""Endogenous ligands"""	30509	protein-coding gene	gene with protein product	"""prepro-neuropeptide W"""	607997				12118011, 12401809	Standard	NM_001099456		Approved	PPL8	uc002coh.4	Q8N729	OTTHUMG00000176914	ENST00000566435.1:c.91G>A	16.37:g.2070149G>A	ENSP00000456974:p.Ala31Thr		9	0	0		16	0.13	2	NM_001099456	3	0.00	0		Missense_Mutation	SNP	ENST00000566435.1	37		.	.	.	.	.	.	.	.	.	.	g	13.18	2.161555	0.38119	.	.	ENSG00000183971	ENST00000329610	T	0.47528	0.84	3.08	-1.23	0.09465	.	2.314070	0.02074	N	0.051782	T	0.27098	0.0664	N	0.19112	0.55	0.09310	N	1	P	0.36874	0.572	B	0.27608	0.081	T	0.16600	-1.0397	10	0.51188	T	0.08	.	2.6594	0.05021	0.2723:0.0:0.3913:0.3364	.	83	Q8N729	NPW_HUMAN	T	83	ENSP00000330070:A83T	ENSP00000330070:A83T	A	+	1	0	NPW	2010150	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.079000	0.14782	-0.148000	0.11234	0.400000	0.26472	GCA			0.751	NPW-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000434312.1		NM_001099456	
PKD1	5310	mdanderson.org	37	16	2160443	2160443	+	Silent	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:2160443G>T	ENST00000262304.4	-	15	4933	c.4725C>A	c.(4723-4725)ggC>ggA	p.G1575G	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.G1575G	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1575	PKD 11. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCACATCACTGCCGGCCTCCA	0.642																																					p.G1575G													.	.			0			c.C4725A												47.0	45.0	46.0					16																	2160443		2191	4293	6484	SO:0001819	synonymous_variant	5310	exon15			ATCACTGCCGGCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.4725C>A	16.37:g.2160443G>T			51	0	0		51	0.06	3	NM_001009944	25	0.00	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																					0.642	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
ZNF205	7755	mdanderson.org	37	16	3169513	3169513	+	Missense_Mutation	SNP	G	G	T	rs369182482		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:3169513G>T	ENST00000382192.3	+	7	1057	c.852G>T	c.(850-852)gaG>gaT	p.E284D	ZNF205_ENST00000219091.4_Missense_Mutation_p.E284D|RP11-473M20.14_ENST00000575139.1_RNA|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	284					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E284E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						AGCCCAACGAGGAGGAGAAGG	0.706																																					p.E284D													ZNF205,NS,carcinoma,0,1	ZNF205	0	1	1	Substitution - coding silent(1)	lung(1)	c.G852T												18.0	24.0	22.0					16																	3169513		2191	4295	6486	SO:0001583	missense	7755	exon7			CAACGAGGAGGAG	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.852G>T	16.37:g.3169513G>T	ENSP00000371627:p.Glu284Asp		33	0	0		20	0.10	2	NM_001042428	54	0.00	0	A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	ENST00000382192.3	37	CCDS10494.2	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824963	0.50739	.	.	ENSG00000122386	ENST00000382192;ENST00000219091	T;T	0.08102	3.13;3.13	3.5	-0.871	0.10642	.	0.887861	0.09511	N	0.792293	T	0.12305	0.0299	L	0.57536	1.79	0.09310	N	1	D	0.61697	0.99	P	0.51701	0.677	T	0.18967	-1.0320	10	0.52906	T	0.07	-15.6101	2.7968	0.05403	0.3536:0.0:0.4437:0.2027	.	284	O95201	ZN205_HUMAN	D	284	ENSP00000371627:E284D;ENSP00000219091:E284D	ENSP00000219091:E284D	E	+	3	2	ZNF205	3109514	0.022000	0.18835	0.005000	0.12908	0.077000	0.17291	0.787000	0.26858	-0.112000	0.11979	0.462000	0.41574	GAG			0.706	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309057.1		NM_003456	
ITPRIPL2	162073	mdanderson.org	37	16	19127279	19127279	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:19127279C>T	ENST00000381440.3	+	1	2026	c.1496C>T	c.(1495-1497)aCg>aTg	p.T499M	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	499						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						TTGCTGTCCACGTGGCAAAGG	0.697																																					p.T499M													.	.			0			c.C1496T												45.0	51.0	49.0					16																	19127279		2197	4299	6496	SO:0001583	missense	162073	exon1			TGTCCACGTGGCA		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.1496C>T	16.37:g.19127279C>T	ENSP00000370849:p.Thr499Met		31	0	0		46	0.07	3	NM_001034841	29	0.00	0		Missense_Mutation	SNP	ENST00000381440.3	37	CCDS32395.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934440	0.52866	.	.	ENSG00000205730	ENST00000381440	T	0.14893	2.47	5.22	5.22	0.72569	.	0.129559	0.31989	U	0.006749	T	0.27663	0.0680	L	0.29908	0.895	0.41912	D	0.99047	D	0.89917	1.0	D	0.65987	0.94	T	0.02676	-1.1125	10	0.19590	T	0.45	-8.7154	16.9486	0.86237	0.0:1.0:0.0:0.0	.	499	Q3MIP1	IPIL2_HUMAN	M	499	ENSP00000370849:T499M	ENSP00000370849:T499M	T	+	2	0	ITPRIPL2	19034780	0.999000	0.42202	0.998000	0.56505	0.948000	0.59901	4.154000	0.58125	2.409000	0.81822	0.561000	0.74099	ACG			0.697	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435827.3		NM_001034841	
SEPT1	1731	broad.mit.edu	37	16	30389139	30389139	+	IGR	SNP	T	T	C			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:30389139T>C	ENST00000571393.1	-	0	1589				MYLPF_ENST00000322861.7_Missense_Mutation_p.F143S			Q8WYJ6	SEPT1_HUMAN	septin 1						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			TGGGCGGCCTTCCCCCCCGAC	0.672																																					p.F143S													.	MYLPF	12		0			c.T428C												50.0	50.0	50.0					16																	30389139		2197	4300	6497	SO:0001628	intergenic_variant	29895	exon7			CGGCCTTCCCCCC	AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984		16.37:g.30389139T>C			142	0	0		172	0.03	5	NM_013292	2	0.00	0	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	ENST00000571393.1	37		.	.	.	.	.	.	.	.	.	.	T	18.24	3.580734	0.65992	.	.	ENSG00000180209	ENST00000322861	T	0.79141	-1.24	5.58	5.58	0.84498	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83055	0.5171	L	0.43923	1.385	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	T	0.81400	-0.0950	10	0.31617	T	0.26	.	14.7247	0.69336	0.0:0.0:0.0:1.0	.	143	Q96A32	MLRS_HUMAN	S	143	ENSP00000325239:F143S	ENSP00000325239:F143S	F	+	2	0	MYLPF	30296640	1.000000	0.71417	0.998000	0.56505	0.058000	0.15608	5.626000	0.67777	2.110000	0.64415	0.482000	0.46254	TTC			0.672	SEPT1-201	KNOWN	basic	protein_coding	protein_coding				NM_052838	
RNF40	9810	ucsc.edu	37	16	30778100	30778100	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:30778100G>T	ENST00000324685.6	+	11	1767	c.1332G>T	c.(1330-1332)gaG>gaT	p.E444D	RNF40_ENST00000563683.1_Missense_Mutation_p.E404D|RNF40_ENST00000357890.5_Missense_Mutation_p.E344D|RNF40_ENST00000402121.3_Missense_Mutation_p.E136D	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	444					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			TACGCACAGAGGTCATTCAGC	0.587																																					p.E444D													.	RNF40	83		0			c.G1332T												71.0	49.0	57.0					16																	30778100		2197	4300	6497	SO:0001583	missense	9810	exon11			CACAGAGGTCATT	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1332G>T	16.37:g.30778100G>T	ENSP00000325677:p.Glu444Asp		29	0	0		41	0.10	4	NM_014771	130	0.00	0	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114252	0.77210	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.32272	1.46;1.46;1.46	6.07	3.02	0.34903	.	0.000000	0.85682	D	0.000000	T	0.48909	0.1526	M	0.69185	2.1	0.58432	D	0.999994	P;D;D;D	0.76494	0.886;0.999;0.999;0.999	P;D;D;D	0.83275	0.647;0.995;0.996;0.996	T	0.43925	-0.9361	10	0.52906	T	0.07	-14.654	8.9702	0.35901	0.2991:0.0:0.7009:0.0	.	136;344;444;444	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	D	444;344;136	ENSP00000325677:E444D;ENSP00000350563:E344D;ENSP00000384942:E136D	ENSP00000325677:E444D	E	+	3	2	RNF40	30685601	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.326000	0.52037	0.880000	0.35969	-0.150000	0.13652	GAG			0.587	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255524.2		NM_014771	
IGHV1OR16-3	28313	broad.mit.edu	37	16	32070612	32070612	+	RNA	SNP	A	A	C	rs368458790		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:32070612A>C	ENST00000566806.1	-	0	499																											GGTCTCCTGCAAGGCTTCTGG	0.552																																					.													.	.			0			.																																											0	.			TCCTGCAAGGCTT																													16.37:g.32070612A>C			21	0	0		48	0.19	9	.	0		0		RNA	SNP	ENST00000566806.1	37																																																																																						0.552	RP11-1166P10.6-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000432459.1			
GFOD2	81577	mdanderson.org	37	16	67709571	67709571	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:67709571C>T	ENST00000268797.7	-	3	990	c.645G>A	c.(643-645)cgG>cgA	p.R215R	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	215					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TAGTGACGTGCCGGATGCCAC	0.587																																					p.R215R													.	.			0			c.G645A												80.0	70.0	73.0					16																	67709571		2198	4300	6498	SO:0001819	synonymous_variant	81577	exon3			GACGTGCCGGATG	AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.645G>A	16.37:g.67709571C>T			23	0	0		30	0.10	3	NM_030819	24	0.00	0	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Silent	SNP	ENST00000268797.7	37	CCDS10845.1																																																																																					0.587	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268868.2		NM_030819	
PRMT7	54496	broad.mit.edu	37	16	68358698	68358698	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr16:68358698C>T	ENST00000339507.5	+	5	1075	c.245C>T	c.(244-246)gCg>gTg	p.A82V	PRMT7_ENST00000348497.4_Missense_Mutation_p.A82V|PRMT7_ENST00000564441.1_3'UTR|PRMT7_ENST00000441236.1_Intron|PRMT7_ENST00000449359.3_Intron			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	82	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.A82V(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		TCAATGATGGCGGTCACAGCA	0.557																																					p.A82V													PRMT7,colon,carcinoma,0,1	PRMT7	51	1	1	Substitution - Missense(1)	large_intestine(1)	c.C245T												134.0	111.0	119.0					16																	68358698		2198	4300	6498	SO:0001583	missense	54496	exon5			TGATGGCGGTCAC	AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.245C>T	16.37:g.68358698C>T	ENSP00000343103:p.Ala82Val		153	0	0		188	0.02	4	NM_019023	67	0.01	1	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	ENST00000339507.5	37	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	C	36	5.869540	0.97049	.	.	ENSG00000132600	ENST00000348497;ENST00000339507	T;T	0.28666	1.6;1.6	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.91354	3.2	0.44745	D	0.997747	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.71830	-0.4474	10	0.56958	D	0.05	-22.6925	16.993	0.86359	0.0:1.0:0.0:0.0	.	82;82;82	Q9NVM4-2;Q9NVM4;Q9NVM4-4	.;ANM7_HUMAN;.	V	82	ENSP00000345775:A82V;ENSP00000343103:A82V	ENSP00000343103:A82V	A	+	2	0	PRMT7	66916199	1.000000	0.71417	0.964000	0.40570	0.985000	0.73830	7.720000	0.84759	2.599000	0.87857	0.655000	0.94253	GCG			0.557	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268892.3		NM_019023	
CAMKK1	84254	ucsc.edu	37	17	3788920	3788920	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:3788920G>A	ENST00000348335.2	-	2	210	c.62C>T	c.(61-63)gCa>gTa	p.A21V	CAMKK1_ENST00000158166.5_Missense_Mutation_p.A21V|CAMKK1_ENST00000381771.2_Missense_Mutation_p.A21V|CAMKK1_ENST00000381769.2_Missense_Mutation_p.A48V	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	21					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		ATCGATGGCTGCCACCCGTTC	0.612																																					p.A21V													.	CAMKK1	70		0			c.C62T												52.0	52.0	52.0					17																	3788920		2203	4300	6503	SO:0001583	missense	84254	exon2			ATGGCTGCCACCC	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.62C>T	17.37:g.3788920G>A	ENSP00000323118:p.Ala21Val		33	0	0		43	0.09	4	NM_032294	6	0.00	0	Q9BQH3	Missense_Mutation	SNP	ENST00000348335.2	37	CCDS11038.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445369	0.83993	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.79141	-0.54;-0.5;-1.24;-1.19	4.84	4.84	0.62591	.	0.080407	0.50627	D	0.000114	D	0.83188	0.5200	L	0.43152	1.355	0.45205	D	0.998213	D;P	0.71674	0.998;0.941	D;P	0.80764	0.994;0.534	T	0.82226	-0.0562	10	0.39692	T	0.17	-11.8901	15.4825	0.75539	0.0:0.0:1.0:0.0	.	21;21	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	V	48;21;21;21	ENSP00000371188:A48V;ENSP00000323118:A21V;ENSP00000371190:A21V;ENSP00000158166:A21V	ENSP00000158166:A21V	A	-	2	0	CAMKK1	3735669	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	7.044000	0.76578	2.529000	0.85273	0.561000	0.74099	GCA			0.612	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207456.1		NM_032294, NM_172206, NM_172207	
DLG4	1742	mdanderson.org	37	17	7100103	7100103	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:7100103C>T	ENST00000399506.2	-	9	1247	c.1056G>A	c.(1054-1056)gaG>gaA	p.E352E	DLG4_ENST00000399510.2_Silent_p.E395E|DLG4_ENST00000302955.6_Silent_p.E349E			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	352	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CCTTCCGCAGCTCCCCACTGA	0.672																																					p.E395E													.	.			0			c.G1185A												14.0	18.0	17.0					17																	7100103		2034	4199	6233	SO:0001819	synonymous_variant	1742	exon11			CCGCAGCTCCCCA	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1056G>A	17.37:g.7100103C>T			41	0	0		38	0.08	3	NM_001365	16	0.00	0	B7Z1S1|G5E939|Q92941|Q9UKK8	Silent	SNP	ENST00000399506.2	37																																																																																						0.672	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000259419.2		NM_001365	
SENP3	26168	broad.mit.edu;mdanderson.org	37	17	7466636	7466636	+	Silent	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:7466636G>A	ENST00000429205.2	+	2	292	c.243G>A	c.(241-243)gaG>gaA	p.E81E	SENP3_ENST00000578868.1_3'UTR|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_Silent_p.E81E			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	81	Glu-rich.					cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				aggaagaagaggaggaggagg	0.622																																					p.E81E													.	SENP3	18		0			c.G243A																																									SO:0001819	synonymous_variant	26168	exon2			AGAAGAGGAGGAG	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.243G>A	17.37:g.7466636G>A			75	0	0		94	0.04	4	NM_015670	124	0.00	0	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Silent	SNP	ENST00000429205.2	37																																																																																						0.622	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015670	
RAB34	83871	hgsc.bcm.edu	37	17	27041699	27041699	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:27041699G>T	ENST00000395245.3	-	10	1368	c.742C>A	c.(742-744)Cta>Ata	p.L248I	RAB34_ENST00000395243.3_Missense_Mutation_p.L240I|RAB34_ENST00000450529.1_Missense_Mutation_p.L240I|PROCA1_ENST00000301039.2_5'Flank|PROCA1_ENST00000581289.1_5'Flank|RAB34_ENST00000453384.3_Intron|RAB34_ENST00000447716.1_Missense_Mutation_p.L305I|RAB34_ENST00000395242.2_Missense_Mutation_p.L249I|RAB34_ENST00000301043.6_Missense_Mutation_p.L248I|RAB34_ENST00000415040.2_Missense_Mutation_p.L226I|RAB34_ENST00000436730.3_Missense_Mutation_p.L248I	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family	248					antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)	p.L248V(1)		endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CTGGCAGTTAGGTAGAGGTTG	0.552																																					p.L305I	Pancreas(175;216 2049 29940 32498 41589)												RAB34,NS,carcinoma,0,1	RAB34	0	1	1	Substitution - Missense(1)	lung(1)	c.C913A												104.0	92.0	96.0					17																	27041699		2203	4300	6503	SO:0001583	missense	83871	exon11			CAGTTAGGTAGAG	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000395245.3:c.742C>A	17.37:g.27041699G>T	ENSP00000378666:p.Leu248Ile		80	0	0		74	0.04	3	NM_001144943	137	0.00	0	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000395245.3	37	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.319296	0.23994	.	.	ENSG00000109113	ENST00000447716;ENST00000301043;ENST00000395243;ENST00000415040;ENST00000450529;ENST00000395242;ENST00000395245	T;T;T;T;T;T	0.70516	-0.08;-0.04;-0.49;0.28;-0.04;-0.04	5.62	3.64	0.41730	.	0.510419	0.20530	N	0.090531	T	0.52565	0.1742	N	0.14661	0.345	0.23249	N	0.998049	B;B;B;B;B	0.11235	0.001;0.004;0.004;0.003;0.003	B;B;B;B;B	0.11329	0.001;0.006;0.004;0.003;0.001	T	0.55848	-0.8076	9	0.37606	T	0.19	-0.5301	11.1833	0.48642	0.1505:0.0:0.8495:0.0	.	226;240;263;249;248	E9PEJ9;Q9BZG1-2;B4DNC0;A8MYQ9;Q9BZG1	.;.;.;.;RAB34_HUMAN	I	305;248;240;226;263;249;248	ENSP00000410403:L305I;ENSP00000301043:L248I;ENSP00000378664:L240I;ENSP00000410279:L226I;ENSP00000378663:L249I;ENSP00000378666:L248I	ENSP00000301043:L248I	L	-	1	2	RAB34	24065826	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.338000	0.43957	0.738000	0.32606	-0.253000	0.11424	CTA			0.552	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000345906.1		NM_031934	
GFAP	2670	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	42989136	42989136	+	Silent	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:42989136G>T	ENST00000253408.5	-	5	875	c.810C>A	c.(808-810)cgC>cgA	p.R270R	GFAP_ENST00000586793.1_Silent_p.R270R|GFAP_ENST00000588735.1_Intron|GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000435360.2_Silent_p.R270R	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	270	Coil 2B.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				GCTCCGCGTTGCGGGCAGCAG	0.657																																					p.R270R													.	GFAP	88		0			c.C810A												46.0	46.0	46.0					17																	42989136		2203	4300	6503	SO:0001819	synonymous_variant	2670	exon5			CGCGTTGCGGGCA	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.810C>A	17.37:g.42989136G>T			33	0	0		41	0.10	4	NM_001131019	0		0	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Silent	SNP	ENST00000253408.5	37	CCDS11491.1																																																																																					0.657	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448701.1		NM_002055	
COG1	9382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71193472	71193472	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:71193472C>T	ENST00000299886.4	+	4	930	c.850C>T	c.(850-852)Cca>Tca	p.P284S	RP11-143K11.5_ENST00000580671.1_RNA	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	284					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GCTGCCAGATCCAGCCCTGCC	0.512																																					p.P284S													.	.			0			c.C850T												122.0	112.0	115.0					17																	71193472		2203	4300	6503	SO:0001583	missense	9382	exon4			CCAGATCCAGCCC		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.850C>T	17.37:g.71193472C>T	ENSP00000299886:p.Pro284Ser		55	0	0		66	0.33	22	NM_018714	80	0.63	50	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	37	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.484872	0.26598	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.21932	1.98;1.99	5.5	5.5	0.81552	.	0.114968	0.64402	D	0.000009	T	0.21718	0.0523	L	0.47716	1.5	0.48185	D	0.999606	B;B;B	0.24533	0.105;0.105;0.105	B;B;B	0.25140	0.058;0.039;0.058	T	0.07712	-1.0758	10	0.09590	T	0.72	-13.9712	19.7422	0.96237	0.0:1.0:0.0:0.0	.	284;284;284	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	S	284	ENSP00000400111:P284S;ENSP00000299886:P284S	ENSP00000299886:P284S	P	+	1	0	COG1	68705067	0.990000	0.36364	0.620000	0.29132	0.369000	0.29798	3.511000	0.53400	2.743000	0.94032	0.655000	0.94253	CCA			0.512	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441638.1			
KIF19	124602	mdanderson.org	37	17	72350514	72350514	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:72350514C>T	ENST00000389916.4	+	18	2660	c.2522C>T	c.(2521-2523)gCc>gTc	p.A841V	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	841					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CAGCATGCTGCCAGTGAGGAC	0.697																																					p.A841V													.	.			0			c.C2522T												11.0	14.0	13.0					17																	72350514		1946	4116	6062	SO:0001583	missense	124602	exon18			ATGCTGCCAGTGA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2522C>T	17.37:g.72350514C>T	ENSP00000374566:p.Ala841Val		27	0	0		35	0.09	3	NM_153209	3	0.00	0	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	C	10.62	1.401224	0.25291	.	.	ENSG00000196169	ENST00000389916	T	0.71222	-0.55	5.06	1.43	0.22495	.	.	.	.	.	T	0.56587	0.1995	L	0.47716	1.5	0.24179	N	0.995593	B	0.06786	0.001	B	0.04013	0.001	T	0.37865	-0.9687	9	0.12766	T	0.61	.	6.2301	0.20730	0.0:0.5277:0.1384:0.3339	.	841	Q2TAC6	KIF19_HUMAN	V	841	ENSP00000374566:A841V	ENSP00000374566:A841V	A	+	2	0	KIF19	69862109	0.998000	0.40836	0.976000	0.42696	0.901000	0.52897	1.189000	0.32114	0.525000	0.28522	0.556000	0.70494	GCC			0.697	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319644.2		NM_153209	
UNK	85451	mdanderson.org	37	17	73808667	73808667	+	Splice_Site	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr17:73808667G>T	ENST00000589666.1	+	4	732		c.e4+1		UNK_ENST00000293218.3_Splice_Site	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger								poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGTGGCAAGGTACAGGCATC	0.627																																					.													.	.			0			c.622+1G>T												39.0	44.0	42.0					17																	73808667		2078	4215	6293	SO:0001630	splice_region_variant	85451	exon4			GGCAAGGTACAGG	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.622+1G>T	17.37:g.73808667G>T			43	0	0		50	0.06	3	NM_001080419	0		0		Splice_Site	SNP	ENST00000589666.1	37	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192820	0.78902	.	.	ENSG00000132478	ENST00000293218	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8899	0.86084	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNK	71320262	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	9.495000	0.97964	2.230000	0.72887	0.603000	0.83216	.			0.627	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448835.1		NM_001080419	Intron
MBD1	4152	mdanderson.org	37	18	47800070	47800070	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr18:47800070G>T	ENST00000591416.1	-	12	1741	c.1310C>A	c.(1309-1311)gCt>gAt	p.A437D	MBD1_ENST00000398488.1_Missense_Mutation_p.A381D|MBD1_ENST00000347968.3_Missense_Mutation_p.A381D|MBD1_ENST00000585595.1_Missense_Mutation_p.A462D|MBD1_ENST00000591535.1_Missense_Mutation_p.A414D|MBD1_ENST00000424334.2_Missense_Mutation_p.A488D|MBD1_ENST00000269471.5_Missense_Mutation_p.A414D|MBD1_ENST00000349085.2_Missense_Mutation_p.A381D|MBD1_ENST00000398495.2_Missense_Mutation_p.A406D|MBD1_ENST00000436910.1_Missense_Mutation_p.A414D|MBD1_ENST00000587605.1_Missense_Mutation_p.A381D|MBD1_ENST00000398493.1_Missense_Mutation_p.A381D|MBD1_ENST00000382948.5_Missense_Mutation_p.A437D|MBD1_ENST00000590208.1_Missense_Mutation_p.A437D|MBD1_ENST00000585672.1_Missense_Mutation_p.A387D|MBD1_ENST00000588937.1_Missense_Mutation_p.A414D|MBD1_ENST00000269468.5_Missense_Mutation_p.A437D|MBD1_ENST00000353909.3_Missense_Mutation_p.A388D|MBD1_ENST00000339998.6_Missense_Mutation_p.A437D|MBD1_ENST00000457839.2_Missense_Mutation_p.A462D			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	437					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CTTCGTTGGAGCCTGGGTATG	0.622																																					p.A462D													.	.			0			c.C1385A												103.0	88.0	93.0					18																	47800070		2203	4300	6503	SO:0001583	missense	4152	exon13			GTTGGAGCCTGGG	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1310C>A	18.37:g.47800070G>T	ENSP00000467017:p.Ala437Asp		52	0	0		33	0.09	3	NM_001204137	106	0.00	0	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	G	0.325	-0.959818	0.02267	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D	0.95518	-3.66;-3.66;-3.61;-3.66;-3.62;-3.72;-3.73;-3.65;-3.69;-3.65;-3.62;-3.61	4.32	1.47	0.22746	.	1.343710	0.04759	N	0.425951	D	0.85948	0.5816	N	0.02539	-0.55	0.09310	N	1	B;P;B;B;B;B;B;P;B;B;B;B	0.42203	0.009;0.756;0.001;0.0;0.002;0.008;0.002;0.773;0.0;0.005;0.0;0.005	B;B;B;B;B;B;B;B;B;B;B;B	0.39465	0.004;0.287;0.003;0.002;0.006;0.005;0.004;0.3;0.002;0.005;0.002;0.005	T	0.82456	-0.0448	10	0.33940	T	0.23	1.6828	3.6484	0.08194	0.2098:0.0:0.5868:0.2034	.	381;488;414;437;437;414;388;381;437;381;462;381	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	D	437;388;381;437;381;414;414;488;437;437;462;381;381	ENSP00000372407:A437D;ENSP00000269469:A388D;ENSP00000342531:A381D;ENSP00000269468:A437D;ENSP00000285102:A381D;ENSP00000409561:A414D;ENSP00000269471:A414D;ENSP00000408846:A488D;ENSP00000339546:A437D;ENSP00000405268:A462D;ENSP00000381506:A381D;ENSP00000381502:A381D	ENSP00000269468:A437D	A	-	2	0	MBD1	46054068	0.025000	0.19082	0.002000	0.10522	0.028000	0.11728	1.117000	0.31234	0.315000	0.23110	0.555000	0.69702	GCT			0.622	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255926.3		NM_015846	
ZNRF4	148066	mdanderson.org	37	19	5455516	5455516	+	Missense_Mutation	SNP	G	G	T	rs375127837	byFrequency	TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr19:5455516G>T	ENST00000222033.4	+	1	91	c.14G>T	c.(13-15)cGt>cTt	p.R5L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	5						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CCGCTCTGCCGTCCGGAGCAC	0.637																																					p.R5L													.	.			0			c.G14T												36.0	42.0	40.0					19																	5455516		2140	4248	6388	SO:0001583	missense	148066	exon1			TCTGCCGTCCGGA	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.14G>T	19.37:g.5455516G>T	ENSP00000222033:p.Arg5Leu		40	0	0		42	0.07	3	NM_181710	0		0	A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	37	CCDS42475.1	.	.	.	.	.	.	.	.	.	.	G	8.819	0.937130	0.18206	.	.	ENSG00000105428	ENST00000222033	T	0.04809	3.55	2.78	-5.57	0.02521	.	.	.	.	.	T	0.02767	0.0083	N	0.14661	0.345	0.09310	N	1	B	0.21309	0.054	B	0.18561	0.022	T	0.43766	-0.9371	9	0.87932	D	0	.	6.727	0.23363	0.1631:0.2652:0.5716:0.0	.	5	Q8WWF5	ZNRF4_HUMAN	L	5	ENSP00000222033:R5L	ENSP00000222033:R5L	R	+	2	0	ZNRF4	5406516	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.398000	0.00240	-1.861000	0.01153	0.313000	0.20887	CGT			0.637	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450924.1		NM_181710	
WDR87	83889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	38385792	38385792	+	Missense_Mutation	SNP	A	A	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr19:38385792A>G	ENST00000303868.5	-	4	658	c.434T>C	c.(433-435)cTc>cCc	p.L145P	WDR87_ENST00000447313.2_Missense_Mutation_p.L184P	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	145										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGCTATTTGGAGGCCCGTGCC	0.582																																					p.L145P													.	.			0			c.T434C												47.0	49.0	48.0					19																	38385792		692	1591	2283	SO:0001583	missense	83889	exon4			ATTTGGAGGCCCG	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.434T>C	19.37:g.38385792A>G	ENSP00000368025:p.Leu145Pro		104	0	0		114	0.09	10	NM_031951	2	0.00	0	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	A	10.25	1.297386	0.23650	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.78364	-1.17;-1.17	5.77	5.77	0.91146	.	0.000000	0.49916	D	0.000136	D	0.85678	0.5752	M	0.62723	1.935	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86937	0.2077	10	0.87932	D	0	-26.7898	12.4613	0.55733	1.0:0.0:0.0:0.0	.	145;184	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	P	184;145	ENSP00000405012:L184P;ENSP00000368025:L145P	ENSP00000368025:L145P	L	-	2	0	WDR87	43077632	0.997000	0.39634	1.000000	0.80357	0.295000	0.27426	5.339000	0.65953	2.202000	0.70862	0.523000	0.50628	CTC			0.582	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000314628.2		XM_940478	
CCDC155	147872	mdanderson.org	37	19	49920743	49920743	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr19:49920743C>T	ENST00000447857.3	+	20	1870	c.1665C>T	c.(1663-1665)tgC>tgT	p.C555C		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	555						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TCCAGCTCTGCTACCTCCAGC	0.632																																					p.C555C													.	.			0			c.C1665T												33.0	35.0	35.0					19																	49920743		2065	4129	6194	SO:0001819	synonymous_variant	147872	exon20			GCTCTGCTACCTC		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1665C>T	19.37:g.49920743C>T			27	0	0		37	0.08	3	NM_144688	10	0.00	0	Q96MC3	Silent	SNP	ENST00000447857.3	37	CCDS46140.1																																																																																					0.632	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465436.2		NM_144688	
BIRC6	57448	broad.mit.edu;mdanderson.org	37	2	32718725	32718725	+	Nonsense_Mutation	SNP	C	C	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr2:32718725C>G	ENST00000421745.2	+	45	8593	c.8459C>G	c.(8458-8460)tCa>tGa	p.S2820*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2820					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CATATACTTTCAACTGAAAGG	0.299																																					p.S2820X	Pancreas(94;175 1509 16028 18060 45422)												.	BIRC6	838		0			c.C8459G												88.0	86.0	86.0					2																	32718725		2203	4298	6501	SO:0001587	stop_gained	57448	exon45			TACTTTCAACTGA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8459C>G	2.37:g.32718725C>G	ENSP00000393596:p.Ser2820*		47	0	0		63	0.10	6	NM_016252	100	0.24	24	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	50	17.197292	0.99881	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.36	5.36	0.76844	.	0.073792	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	19.4604	0.94915	0.0:1.0:0.0:0.0	.	.	.	.	X	2820	.	ENSP00000393596:S2820X	S	+	2	0	BIRC6	32572229	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.336000	0.79245	2.678000	0.91216	0.460000	0.39030	TCA			0.299	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318769.3		NM_016252	
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			111	0.027027027	3		171	0.07	12	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
FASTKD1	79675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170403079	170403079	+	Silent	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr2:170403079G>A	ENST00000453153.2	-	8	1696	c.1350C>T	c.(1348-1350)aaC>aaT	p.N450N	FASTKD1_ENST00000453929.2_Silent_p.N450N	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	450					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						AACTACTCAGGTTATTTAGGT	0.418																																					p.N450N													.	.			0			c.C1350T												80.0	80.0	80.0					2																	170403079		2203	4300	6503	SO:0001819	synonymous_variant	79675	exon8			ACTCAGGTTATTT	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.1350C>T	2.37:g.170403079G>A			266	0	0		348	0.13	44	NM_024622	70	0.16	11	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Silent	SNP	ENST00000453153.2	37	CCDS33318.1																																																																																					0.418	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337788.2		NM_024622	
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	171687483	171687483	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr2:171687483G>A	ENST00000358196.3	+	5	878	c.328G>A	c.(328-330)Gag>Aag	p.E110K	GAD1_ENST00000375272.1_Missense_Mutation_p.E110K|GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000344257.5_Missense_Mutation_p.E110K	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	110					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TAAGAACGGTGAGGAGCAAAC	0.473																																					p.E110K													.	.			0			c.G328A												82.0	74.0	77.0					2																	171687483		2203	4300	6503	SO:0001583	missense	2571	exon5			AACGGTGAGGAGC		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.328G>A	2.37:g.171687483G>A	ENSP00000350928:p.Glu110Lys		87	0	0		121	0.10	12	NM_000817	0		0	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559995	0.86335	.	.	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257;ENST00000455008;ENST00000456864	T;T;T;D;D	0.86030	2.28;0.36;0.36;-2.06;-1.79	5.9	5.9	0.94986	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.83959	0.5367	L	0.60845	1.875	0.80722	D	1	B;P	0.36249	0.07;0.545	B;B	0.33454	0.02;0.164	D	0.83422	0.0033	10	0.49607	T	0.09	-25.1994	20.2673	0.98463	0.0:0.0:1.0:0.0	.	110;110	Q99259;Q99259-3	DCE1_HUMAN;.	K	110	ENSP00000350928:E110K;ENSP00000364421:E110K;ENSP00000341167:E110K;ENSP00000405917:E110K;ENSP00000394255:E110K	ENSP00000341167:E110K	E	+	1	0	GAD1	171395729	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.476000	0.97823	2.786000	0.95864	0.643000	0.83706	GAG			0.473	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000102664.2			
STK11IP	114790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	220467428	220467428	+	Splice_Site	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr2:220467428G>A	ENST00000456909.1	+	7	638	c.548G>A	c.(547-549)cGc>cAc	p.R183H	STK11IP_ENST00000459692.1_3'UTR|STK11IP_ENST00000295641.10_Splice_Site_p.R194H			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	194					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCTCTCAGCGCCTCTTGTCA	0.552																																					p.R194H													.	.			0			c.G581A												136.0	137.0	136.0					2																	220467428		2054	4190	6244	SO:0001630	splice_region_variant	114790	exon7			CTCAGCGCCTCTT	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.547-1G>A	2.37:g.220467428G>A			118	0	0		195	0.07	14	NM_052902	64	0.13	8	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		.	.	.	.	.	.	.	.	.	.	G	13.25	2.181008	0.38511	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.22336	1.96;1.96	4.39	2.41	0.29592	.	0.537822	0.20014	N	0.101054	T	0.10680	0.0261	N	0.21448	0.665	0.29158	N	0.877961	B;B;B;B	0.27823	0.011;0.018;0.004;0.19	B;B;B;B	0.15484	0.004;0.003;0.003;0.013	T	0.10660	-1.0620	10	0.39692	T	0.17	-1.7066	4.6014	0.12356	0.4101:0.0:0.5899:0.0	.	194;194;194;194	B4DUE4;B4DII2;Q8N1F8-2;Q8N1F8	.;.;.;S11IP_HUMAN	H	183;194;194	ENSP00000389383:R183H;ENSP00000295641:R194H	ENSP00000295641:R194H	R	+	2	0	STK11IP	220175672	0.991000	0.36638	0.965000	0.40720	0.916000	0.54674	0.595000	0.24029	1.064000	0.40671	0.650000	0.86243	CGC			0.552	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000131432.1		NM_052902	Missense_Mutation
FRG1B	284802	mdanderson.org	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																					.													.	.			2	Substitution - Missense(2)	endometrium(2)	.																																									SO:0001583	missense	284802	.			AGAGAACCAAATT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr		139	0.0071942446	1		261	0.04	11	.	36	0.00	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA			0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
SLC2A10	81031	ucsc.edu;bcgsc.ca	37	20	45362413	45362413	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr20:45362413C>T	ENST00000359271.2	+	5	1816	c.1566C>T	c.(1564-1566)ggC>ggT	p.G522G		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	522					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				TGAGCTTTGGCCACAGGCAGA	0.612																																					p.G522G													.	SLC2A10	75		0			c.C1566T												113.0	96.0	102.0					20																	45362413		2203	4300	6503	SO:0001819	synonymous_variant	81031	exon5			CTTTGGCCACAGG	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1566C>T	20.37:g.45362413C>T			53	0	0		37	0.11	4	NM_030777	28	0.00	0	A8K4J6|Q3MIX5|Q9H4I6	Silent	SNP	ENST00000359271.2	37	CCDS13402.1																																																																																					0.612	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079578.2			
LAMA5	3911	mdanderson.org	37	20	60922017	60922017	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr20:60922017G>T	ENST00000252999.3	-	7	1090	c.1024C>A	c.(1024-1026)Cag>Aag	p.Q342K	LAMA5_ENST00000370677.3_Missense_Mutation_p.Q342K|LAMA5_ENST00000370692.3_Missense_Mutation_p.Q342K	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	342	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CACGGCTGCTGATTGAAGCCG	0.662																																					p.Q342K													.	.			0			c.C1024A												52.0	51.0	51.0					20																	60922017		2203	4295	6498	SO:0001583	missense	3911	exon7			GCTGCTGATTGAA	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.1024C>A	20.37:g.60922017G>T	ENSP00000252999:p.Gln342Lys		58	0	0		39	0.08	3	NM_005560	22	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549661	0.86127	.	.	ENSG00000130702	ENST00000252999;ENST00000370692;ENST00000370677	T;T;T	0.62788	0.0;0.0;0.0	4.67	4.67	0.58626	EGF-like, laminin (4);	0.000000	0.85682	U	0.000000	D	0.82462	0.5042	M	0.88241	2.94	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86052	0.1526	10	0.56958	D	0.05	.	17.5786	0.87958	0.0:0.0:1.0:0.0	.	342	O15230	LAMA5_HUMAN	K	342	ENSP00000252999:Q342K;ENSP00000359726:Q342K;ENSP00000359711:Q342K	ENSP00000252999:Q342K	Q	-	1	0	LAMA5	60355412	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	7.712000	0.84684	2.129000	0.65627	0.555000	0.69702	CAG			0.662	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
KRTAP10-4	386672	ucsc.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																					p.C72C													.	KRTAP10-4	44		0			c.C216T												20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672	exon1			GACCTGCGAGCCC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T			13	0.1538461538	2		33	0.27	9	NM_198687	0		0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																					0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128045.1		NM_198687	
CARD10	29775	mdanderson.org	37	22	37887324	37887324	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr22:37887324G>T	ENST00000403299.1	-	21	3188	c.2972C>A	c.(2971-2973)gCc>gAc	p.A991D	CARD10_ENST00000251973.5_Missense_Mutation_p.A991D|CARD10_ENST00000406271.3_Missense_Mutation_p.A705D			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	991					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CCACTCATGGGCGGGCACCTG	0.726																																					p.A991D													.	.			0			c.C2972A												7.0	9.0	8.0					22																	37887324		2130	4229	6359	SO:0001583	missense	29775	exon20			TCATGGGCGGGCA	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2972C>A	22.37:g.37887324G>T	ENSP00000384570:p.Ala991Asp		14	0	0		13	0.15	2	NM_014550	94	0.00	0	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256717	0.39896	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973	T;T;T	0.43688	0.94;1.63;0.94	5.16	0.442	0.16582	.	0.437819	0.22701	N	0.056694	T	0.32285	0.0824	L	0.43152	1.355	0.09310	N	1	B;B	0.32245	0.361;0.321	B;B	0.31751	0.068;0.135	T	0.21586	-1.0241	10	0.66056	D	0.02	-6.2489	9.6862	0.40100	0.0751:0.3832:0.5417:0.0	.	991;705	Q9BWT7;Q8NC81	CAR10_HUMAN;.	D	991;705;991	ENSP00000384570:A991D;ENSP00000385799:A705D;ENSP00000251973:A991D	ENSP00000251973:A991D	A	-	2	0	CARD10	36217270	0.174000	0.23070	0.001000	0.08648	0.969000	0.65631	2.864000	0.48404	-0.061000	0.13110	0.455000	0.32223	GCC			0.726	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318997.1		NM_014550	
PHLDB2	90102	broad.mit.edu	37	3	111603922	111603922	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr3:111603922C>T	ENST00000431670.2	+	2	1409	c.998C>T	c.(997-999)gCc>gTc	p.A333V	PHLDB2_ENST00000481953.1_Missense_Mutation_p.A333V|PHLDB2_ENST00000478922.1_Missense_Mutation_p.A333V|PHLDB2_ENST00000412622.1_Missense_Mutation_p.A333V|PHLDB2_ENST00000393925.3_Missense_Mutation_p.A333V|PHLDB2_ENST00000393923.3_Missense_Mutation_p.A360V|PHLDB2_ENST00000477695.1_Missense_Mutation_p.A333V	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	333						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AGTGTCCCTGCCAGTCCACGA	0.483																																					p.A360V													.	PHLDB2	449		0			c.C1079T												67.0	70.0	69.0					3																	111603922		2203	4300	6503	SO:0001583	missense	90102	exon3			TCCCTGCCAGTCC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.998C>T	3.37:g.111603922C>T	ENSP00000405405:p.Ala333Val		102	0	0		158	0.03	4	NM_001134437	10	0.00	0	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184668	0.78677	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.33216	1.42;1.44;1.43;1.43;1.44;1.43	5.78	4.9	0.64082	.	0.240452	0.42964	D	0.000639	T	0.37156	0.0993	L	0.47716	1.5	0.37210	D	0.904762	B;P;P;B;B	0.50272	0.009;0.787;0.933;0.277;0.277	B;P;P;B;B	0.49226	0.006;0.603;0.599;0.157;0.157	T	0.46005	-0.9222	10	0.62326	D	0.03	.	14.1938	0.65656	0.0:0.833:0.167:0.0	.	333;333;333;333;360	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	V	360;360;333;333;333;333;333;333;333	ENSP00000377500:A360V;ENSP00000405405:A333V;ENSP00000405292:A333V;ENSP00000418296:A333V;ENSP00000377502:A333V;ENSP00000418319:A333V	ENSP00000352764:A360V	A	+	2	0	PHLDB2	113086612	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	3.824000	0.55723	1.548000	0.49413	0.655000	0.94253	GCC			0.483	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354337.1		NM_145753	
TM4SF19	116211	hgsc.bcm.edu	37	3	196043134	196043134	+	Intron	SNP	G	G	C			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr3:196043134G>C	ENST00000442633.1	-	6	814				TM4SF19-AS1_ENST00000420226.1_RNA|TCTEX1D2_ENST00000325318.5_Intron|RP11-447L10.1_ENST00000431391.1_Intron|TM4SF19-AS1_ENST00000444939.1_RNA|TM4SF19-AS1_ENST00000452051.1_RNA			Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(5)	12	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CATCCAGTCGGTGACTCCACA	0.403																																					.													.	.			0			.												60.0	53.0	55.0					3																	196043134		2203	4300	6503	SO:0001627	intron_variant	0	.			CAGTCGGTGACTC	BC013113	CCDS3316.1, CCDS56299.1	3q29	2005-08-09			ENSG00000145107	ENSG00000145107			25167	protein-coding gene	gene with protein product						12477932	Standard	NM_138461		Approved		uc021xjs.1	Q96DZ7	OTTHUMG00000155675	ENST00000442633.1:c.628-32C>G	3.37:g.196043134G>C			44	0	0		59	0.31	18	.	2	0.00	0	B2RV20|E9PH22|Q336K7	RNA	SNP	ENST00000442633.1	37	CCDS3316.1																																																																																					0.403	TM4SF19-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding		OTTHUMT00000473197.1		NM_138461	
DGKQ	1609	mdanderson.org	37	4	961070	961070	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr4:961070G>T	ENST00000273814.3	-	9	1140	c.1067C>A	c.(1066-1068)gCc>gAc	p.A356D	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	356					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGCGTCACAGGCCTGAGAGGA	0.711																																					p.A356D	Esophageal Squamous(17;537 645 4447 26373)												.	.			0			c.C1067A												7.0	10.0	9.0					4																	961070		2059	4044	6103	SO:0001583	missense	1609	exon9			TCACAGGCCTGAG	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.1067C>A	4.37:g.961070G>T	ENSP00000273814:p.Ala356Asp		8	0	0		19	0.11	2	NM_001347	6	0.00	0	Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	37	CCDS3342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.189|9.189	1.025622|1.025622	0.19512|0.19512	.|.	.|.	ENSG00000145214|ENSG00000145214	ENST00000273814|ENST00000509465	T|.	0.80566|.	-1.39|.	4.92|4.92	2.24|2.24	0.28232|0.28232	.|.	1.252900|.	0.05228|.	N|.	0.509779|.	T|T	0.16896|0.16896	0.0406|0.0406	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;P|.	0.42409|.	0.309;0.779|.	B;B|.	0.31191|.	0.08;0.125|.	T|T	0.25502|0.25502	-1.0130|-1.0130	10|5	0.14252|.	T|.	0.57|.	.|.	6.3255|6.3255	0.21240|0.21240	0.3099:0.0:0.6901:0.0|0.3099:0.0:0.6901:0.0	.|.	356;356|.	E9KL49;P52824|.	.;DGKQ_HUMAN|.	D|T	356|303	ENSP00000273814:A356D|.	ENSP00000273814:A356D|.	A|P	-|-	2|1	0|0	DGKQ|DGKQ	951070|951070	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.009000|0.009000	0.06853|0.06853	0.793000|0.793000	0.26944|0.26944	0.500000|0.500000	0.27991|0.27991	0.650000|0.650000	0.86243|0.86243	GCC|CCT			0.711	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000200888.1			
RUFY3	22902	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	71659590	71659590	+	IGR	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr4:71659590C>T	ENST00000226328.4	+	0	4233				RUFY3_ENST00000381006.3_Nonsense_Mutation_p.Q476*|RUFY3_ENST00000502653.1_Nonsense_Mutation_p.Q423*	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			CAACAGTCTGCAGCTGGAAGT	0.547																																					p.Q476X													.	.			0			c.C1426T												47.0	43.0	44.0					4																	71659590		2203	4300	6503	SO:0001628	intergenic_variant	22902	exon13			AGTCTGCAGCTGG	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910		4.37:g.71659590C>T			153	0	0		226	0.10	23	NM_001037442	42	0.12	5	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Nonsense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	C	40	8.100359	0.98654	.	.	ENSG00000018189	ENST00000381006;ENST00000502653	.	.	.	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-18.3914	20.1991	0.98252	0.0:1.0:0.0:0.0	.	.	.	.	X	476;423	.	ENSP00000370394:Q476X	Q	+	1	0	RUFY3	71878454	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.461000	0.80834	2.775000	0.95449	0.650000	0.86243	CAG			0.547	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252161.2		NM_014961	
ATOH1	474	broad.mit.edu	37	4	94750181	94750181	+	Missense_Mutation	SNP	C	C	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr4:94750181C>A	ENST00000306011.3	+	1	140	c.104C>A	c.(103-105)cCg>cAg	p.P35Q		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	35	Poly-Pro.				auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CCGCCGCCGCCGCAGCCACCT	0.672																																					p.P35Q													ATOH1,rectum,carcinoma,0,1	ATOH1	40	1	0			c.C104A												23.0	26.0	25.0					4																	94750181		2197	4289	6486	SO:0001583	missense	474	exon1			CGCCGCCGCAGCC	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.104C>A	4.37:g.94750181C>A	ENSP00000302216:p.Pro35Gln		156	0.0064102564	1		172	0.02	4	NM_005172	0		0	Q14CT9	Missense_Mutation	SNP	ENST00000306011.3	37	CCDS3638.1	.	.	.	.	.	.	.	.	.	.	C	9.110	1.006290	0.19199	.	.	ENSG00000172238	ENST00000306011	D	0.99089	-5.41	4.2	4.2	0.49525	.	.	.	.	.	D	0.95733	0.8612	N	0.08118	0	0.27740	N	0.944506	P	0.42039	0.769	B	0.39738	0.308	D	0.92211	0.5776	9	0.35671	T	0.21	-8.1124	14.1101	0.65115	0.0:1.0:0.0:0.0	.	35	Q92858	ATOH1_HUMAN	Q	35	ENSP00000302216:P35Q	ENSP00000302216:P35Q	P	+	2	0	ATOH1	94969204	0.036000	0.19791	0.408000	0.26446	0.011000	0.07611	0.804000	0.27098	2.173000	0.68751	0.573000	0.79308	CCG			0.672	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253585.1		NM_005172	
POU4F2	5458	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	147560512	147560512	+	Missense_Mutation	SNP	A	A	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr4:147560512A>T	ENST00000281321.3	+	1	468	c.220A>T	c.(220-222)Agc>Tgc	p.S74C	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	74	Poly-Ser.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					cagcagctccagcagcagtgg	0.721																																					p.S74C													POU4F2,NS,carcinoma,0,1	POU4F2	0	1	0			c.A220T												9.0	12.0	11.0					4																	147560512		1924	3841	5765	SO:0001583	missense	5458	exon1			AGCTCCAGCAGCA	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.220A>T	4.37:g.147560512A>T	ENSP00000281321:p.Ser74Cys		70	0	0		75	0.11	8	NM_004575	0		0	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.106109	0.56291	.	.	ENSG00000151615	ENST00000281321	T	0.25579	1.79	5.21	2.46	0.29980	.	0.320898	0.24703	N	0.036287	T	0.10380	0.0254	N	0.14661	0.345	0.28424	N	0.917602	P	0.41214	0.742	B	0.28553	0.091	T	0.13335	-1.0513	10	0.51188	T	0.08	.	6.7672	0.23573	0.783:0.0:0.217:0.0	.	74	Q12837	PO4F2_HUMAN	C	74	ENSP00000281321:S74C	ENSP00000281321:S74C	S	+	1	0	POU4F2	147779962	1.000000	0.71417	0.997000	0.53966	0.917000	0.54804	3.052000	0.49893	0.835000	0.34877	0.459000	0.35465	AGC			0.721	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367020.1		NM_004575	
ZRSR1	7310	ucsc.edu	37	5	112228215	112228215	+	Silent	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr5:112228215C>T	ENST00000391338.1	+	1	903	c.879C>T	c.(877-879)aaC>aaT	p.N293N	REEP5_ENST00000545426.1_3'UTR|REEP5_ENST00000379638.4_Intron|REEP5_ENST00000474542.2_Intron|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000504247.1_Intron|CTC-487M23.8_ENST00000506997.1_3'UTR|CTC-487M23.5_ENST00000602872.1_RNA|REEP5_ENST00000513339.1_Intron	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	293	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						CTCTGTTTAACGGACGATGGT	0.463																																					.													.	SRP19	12		0			.																																									SO:0001819	synonymous_variant	7905	.			GTTTAACGGACGA	D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.879C>T	5.37:g.112228215C>T			242	0	0		282	0.01	2	.	24	0.67	16	B2R901|Q13570|Q2M3R8	Silent	SNP	ENST00000391338.1	37																																																																																						0.463	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000371801.1	rescued with RNA-seq	NM_005083	
IK	3550	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140032730	140032730	+	Splice_Site	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr5:140032730G>A	ENST00000417647.2	+	5	543		c.e5+1			NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II						cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.?(1)		large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTGAGGCGTGAGTACTGA	0.502																																					.													IK_ENST00000417647,NS,carcinoma,0,1	IK	46	1	1	Unknown(1)	lung(1)	c.404+1G>A												80.0	79.0	79.0					5																	140032730		1953	4147	6100	SO:0001630	splice_region_variant	3550	exon5			TGAGGCGTGAGTA	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.404+1G>A	5.37:g.140032730G>A			30	0	0		34	0.12	4	NM_006083	22	0.09	2	Q6IPD8	Splice_Site	SNP	ENST00000417647.2	37	CCDS47280.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876737	0.91664	.	.	ENSG00000113141	ENST00000417647;ENST00000508301;ENST00000261812;ENST00000502899	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9686	0.97276	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IK	140012914	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.575000	0.98187	2.820000	0.97059	0.650000	0.86243	.			0.502	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372897.1		NM_006083	Intron
RGS14	10636	mdanderson.org	37	5	176793307	176793307	+	Missense_Mutation	SNP	T	T	C			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr5:176793307T>C	ENST00000408923.3	+	3	385	c.197T>C	c.(196-198)cTg>cCg	p.L66P		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	66					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTGGGCCCTGTCCTTCGAG	0.687																																					p.L66P	NSCLC(47;353 1896 28036)												.	.			0			c.T197C												7.0	12.0	11.0					5																	176793307		1922	4083	6005	SO:0001583	missense	10636	exon3			GGGCCCTGTCCTT	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.197T>C	5.37:g.176793307T>C	ENSP00000386229:p.Leu66Pro		59	0	0		49	0.06	3	NM_006480	28	0.00	0	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	ENST00000408923.3	37	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.624805	0.46840	.	.	ENSG00000169220	ENST00000408923	T	0.02472	4.28	3.91	2.69	0.31865	Regulator of G protein signalling (1);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.188723	0.34986	N	0.003531	T	0.04770	0.0129	L	0.54323	1.7	0.49582	D	0.999807	B	0.26400	0.148	B	0.37047	0.24	T	0.38067	-0.9678	10	0.39692	T	0.17	-6.9246	7.9703	0.30124	0.4133:0.0:0.0:0.5867	.	66	O43566	RGS14_HUMAN	P	66	ENSP00000386229:L66P	ENSP00000386229:L66P	L	+	2	0	RGS14	176725913	0.964000	0.33143	0.999000	0.59377	0.994000	0.84299	3.025000	0.49681	0.523000	0.28482	0.363000	0.22086	CTG			0.687	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372676.1		NM_006480	
TTBK1	84630	mdanderson.org	37	6	43251731	43251731	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:43251731C>T	ENST00000259750.4	+	14	3336	c.3253C>T	c.(3253-3255)Ccg>Tcg	p.P1085S		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1085					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GCGGGCTCGGCCGCAGCAGGA	0.697																																					p.P1085S													.	.			0			c.C3253T												9.0	11.0	10.0					6																	43251731		2161	4213	6374	SO:0001583	missense	84630	exon14			GCTCGGCCGCAGC	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3253C>T	6.37:g.43251731C>T	ENSP00000259750:p.Pro1085Ser		36	0	0		33	0.09	3	NM_032538	2	0.00	0	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285485	0.23478	.	.	ENSG00000146216	ENST00000259750	T	0.48522	0.81	5.15	4.25	0.50352	.	0.952941	0.08573	N	0.925709	T	0.17959	0.0431	L	0.34521	1.04	0.80722	D	1	B	0.26672	0.156	B	0.21917	0.037	T	0.11717	-1.0576	10	0.22109	T	0.4	.	8.1255	0.30997	0.2944:0.5547:0.1509:0.0	.	1085	Q5TCY1	TTBK1_HUMAN	S	1085	ENSP00000259750:P1085S	ENSP00000259750:P1085S	P	+	1	0	TTBK1	43359709	0.977000	0.34250	0.959000	0.39883	0.257000	0.26127	0.860000	0.27871	1.096000	0.41439	0.555000	0.69702	CCG			0.697	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040584.3			
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E													RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2_ENST00000352853	0	2	0			c.C211G												6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu		18	0.0555555556	1		26	0.15	4	NM_001024630	1	0.00	0	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG			0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
BAI3	577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	69723993	69723993	+	Missense_Mutation	SNP	C	C	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:69723993C>A	ENST00000370598.1	+	12	2814	c.1993C>A	c.(1993-1995)Caa>Aaa	p.Q665K		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	665					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GGAAGATGCACAACAGGTAAG	0.294																																					p.Q665K													.	.			0			c.C1993A												65.0	68.0	67.0					6																	69723993		2203	4300	6503	SO:0001583	missense	577	exon12			GATGCACAACAGG	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1993C>A	6.37:g.69723993C>A	ENSP00000359630:p.Gln665Lys		273	0	0		369	0.22	80	NM_001704	0		0	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.729052	0.89390	.	.	ENSG00000135298	ENST00000370598	T	0.11277	2.79	5.76	5.76	0.90799	Domain of unknown function DUF3497 (1);	0.060473	0.64402	D	0.000002	T	0.23886	0.0578	M	0.68317	2.08	0.80722	D	1	D	0.61697	0.99	P	0.61722	0.893	T	0.00529	-1.1687	10	0.87932	D	0	.	19.952	0.97200	0.0:1.0:0.0:0.0	.	665	O60242	BAI3_HUMAN	K	665	ENSP00000359630:Q665K	ENSP00000359630:Q665K	Q	+	1	0	BAI3	69780714	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.949000	0.75971	2.728000	0.93425	0.655000	0.94253	CAA			0.294	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041120.1			
COL9A1	1297	mdanderson.org	37	6	70978539	70978539	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:70978539G>T	ENST00000357250.6	-	17	1413	c.1255C>A	c.(1255-1257)Cgc>Agc	p.R419S	COL9A1_ENST00000320755.7_Missense_Mutation_p.R176S|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.R176S	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	419	Collagen-like 4.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R419G(1)|p.R176G(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TATCCTGAGCGACCTGGTGGA	0.458																																					p.R419S													COL9A1_ENST00000320755,NS,carcinoma,0,2	COL9A1_ENST00000320755	0	2	2	Substitution - Missense(2)	lung(2)	c.C1255A												86.0	87.0	87.0					6																	70978539		2203	4300	6503	SO:0001583	missense	1297	exon17			CTGAGCGACCTGG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1255C>A	6.37:g.70978539G>T	ENSP00000349790:p.Arg419Ser		36	0	0		47	0.06	3	NM_001851	0		0	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142644	0.57044	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.92647	-3.08;-3.08;-3.08	5.54	5.54	0.83059	.	0.179276	0.52532	D	0.000063	T	0.81631	0.4863	N	0.10874	0.06	0.48571	D	0.999671	P;P	0.47350	0.894;0.677	P;B	0.49421	0.61;0.198	T	0.82250	-0.0550	10	0.09590	T	0.72	.	16.4154	0.83732	0.0:0.0:1.0:0.0	.	419;176	P20849;P20849-2	CO9A1_HUMAN;.	S	419;176;176	ENSP00000349790:R419S;ENSP00000315252:R176S;ENSP00000359530:R176S	ENSP00000315252:R176S	R	-	1	0	COL9A1	71035260	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	5.120000	0.64685	2.598000	0.87819	0.650000	0.86243	CGC			0.458	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041131.2			
SLC22A16	85413	ucsc.edu	37	6	110752416	110752416	+	Silent	SNP	C	C	T	rs142454497		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:110752416C>T	ENST00000368919.3	-	7	1545	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	SLC22A16_ENST00000330550.4_Silent_p.P459P|SLC22A16_ENST00000439654.1_Silent_p.P493P	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	493					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	CCACAGAGAACGGCGCCAGGA	0.572																																					p.P493P													.	SLC22A16	81		0			c.G1479A							C		0,4406		0,0,2203	95.0	86.0	89.0		1479	-10.8	0.0	6	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC22A16	NM_033125.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		493/578	110752416	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	85413	exon7			AGAGAACGGCGCC		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1479G>A	6.37:g.110752416C>T			32	0	0		37	0.11	4	NM_033125	0		0	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	37	CCDS5084.1																																																																																					0.572	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043428.1		NM_033125	
SHPRH	257218	mdanderson.org	37	6	146248330	146248330	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr6:146248330G>T	ENST00000367505.2	-	15	3460	c.3196C>A	c.(3196-3198)Ctt>Att	p.L1066I	SHPRH_ENST00000438092.2_Missense_Mutation_p.L1075I|SHPRH_ENST00000367503.3_Missense_Mutation_p.L1075I|SHPRH_ENST00000275233.7_Missense_Mutation_p.L1066I			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1066					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CTTACTTGAAGTGAATCAGTT	0.333																																					p.L1075I													.	.			0			c.C3223A												159.0	134.0	141.0					6																	146248330		1833	4084	5917	SO:0001583	missense	257218	exon15			CTTGAAGTGAATC	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3196C>A	6.37:g.146248330G>T	ENSP00000356475:p.Leu1066Ile		29	0	0		47	0.06	3	NM_173082	11	0.00	0	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994540	0.74703	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.78707	-1.2;-1.14;-1.15;-1.2	5.55	4.45	0.53987	.	0.000000	0.56097	D	0.000021	T	0.80319	0.4601	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.87578	0.994;0.998	T	0.80502	-0.1354	10	0.42905	T	0.14	-17.1556	4.0965	0.09993	0.3162:0.0:0.6838:0.0	.	1066;1075	Q149N8;Q149N8-4	SHPRH_HUMAN;.	I	1066;1075;1075;1066	ENSP00000356475:L1066I;ENSP00000356473:L1075I;ENSP00000412797:L1075I;ENSP00000275233:L1066I	ENSP00000275233:L1066I	L	-	1	0	SHPRH	146290023	0.999000	0.42202	0.950000	0.38849	0.977000	0.68977	2.885000	0.48570	2.767000	0.95098	0.557000	0.71058	CTT			0.333	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000042571.2		NM_173082	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			92	0.0108695652	1		141	0.03	4	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
CDK14	5218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	90585027	90585027	+	Missense_Mutation	SNP	A	A	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:90585027A>T	ENST00000380050.3	+	9	973	c.842A>T	c.(841-843)aAa>aTa	p.K281I	CDK14_ENST00000265741.3_Missense_Mutation_p.K263I|CDK14_ENST00000406263.1_Missense_Mutation_p.K235I|CDK14_ENST00000436577.2_Missense_Mutation_p.K152I			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	281	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GCAAGAGCAAAATCCGTCCCT	0.418																																					p.K263I	GBM(83;1228 1256 8311 16577 31299)												.	.			0			c.A788T												168.0	145.0	153.0					7																	90585027		2203	4300	6503	SO:0001583	missense	5218	exon8			GAGCAAAATCCGT		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.842A>T	7.37:g.90585027A>T	ENSP00000369390:p.Lys281Ile		59	0	0		99	0.11	11	NM_012395	6	0.00	0	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.047132	0.75846	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	N	0.01146	-0.985	0.80722	D	1	D;P;D	0.76494	0.997;0.724;0.999	D;B;D	0.87578	0.996;0.348;0.998	T	0.71543	-0.4561	10	0.40728	T	0.16	-17.1798	16.6512	0.85203	1.0:0.0:0.0:0.0	.	152;263;281	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	I	281;263;235;152	ENSP00000369390:K281I;ENSP00000265741:K263I;ENSP00000385034:K235I;ENSP00000398936:K152I	ENSP00000265741:K263I	K	+	2	0	CDK14	90422963	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.333000	0.79357	0.482000	0.46254	AAA			0.418	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000059970.5		NM_012395	
RBM48	84060	broad.mit.edu	37	7	92164020	92164021	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:92164020_92164021delTT	ENST00000265732.5	+	4	794_795	c.753_754delTT	c.(751-756)tctttgfs	p.L252fs	RBM48_ENST00000481551.1_Frame_Shift_Del_p.L252fs	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	252						nucleus (GO:0005634)	RNA binding (GO:0003723)										AGATAAACTCTTTGAAAAACTC	0.446																																					p.251_252del													.	.			0			c.753_754del																																									SO:0001589	frameshift_variant	84060	exon4			AAACTCTTTGAAA	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.753_754delTT	7.37:g.92164020_92164021delTT	ENSP00000265732:p.Leu252fs		46	0	0		92	0.09	8	NM_032120	82	0.00	0	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Frame_Shift_Del	DEL	ENST00000265732.5	37	CCDS43615.1																																																																																					0.446	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356076.1		NM_032120	
LAMB4	22798	mdanderson.org	37	7	107717416	107717416	+	Missense_Mutation	SNP	G	G	T	rs144579218		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:107717416G>T	ENST00000388781.3	-	17	2180	c.2097C>A	c.(2095-2097)caC>caA	p.H699Q	LAMB4_ENST00000414450.2_Missense_Mutation_p.H699Q|LAMB4_ENST00000205386.4_Missense_Mutation_p.H699Q|LAMB4_ENST00000388780.3_Missense_Mutation_p.H699Q|LAMB4_ENST00000418464.1_Missense_Mutation_p.H699Q	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	699	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GTGAATGAGCGTGGGACTCTC	0.418																																					p.H699Q													.	.			0			c.C2097A												114.0	116.0	116.0					7																	107717416		2203	4300	6503	SO:0001583	missense	22798	exon17			ATGAGCGTGGGAC	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2097C>A	7.37:g.107717416G>T	ENSP00000373433:p.His699Gln		18	0	0		49	0.06	3	NM_007356	2	0.00	0	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	0.136	-1.107831	0.01813	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.30448	1.55;1.55;1.57;1.53;1.56	5.3	-7.95	0.01148	Laminin IV (1);	1.180180	0.06147	N	0.673462	T	0.19366	0.0465	L	0.48642	1.525	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21484	-1.0244	10	0.25751	T	0.34	.	4.1981	0.10453	0.4541:0.2172:0.2534:0.0753	.	699	A4D0S4	LAMB4_HUMAN	Q	699	ENSP00000205386:H699Q;ENSP00000373433:H699Q;ENSP00000373432:H699Q;ENSP00000402353:H699Q;ENSP00000402265:H699Q	ENSP00000205386:H699Q	H	-	3	2	LAMB4	107504652	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.807000	0.04520	-1.427000	0.01992	-0.122000	0.15005	CAC			0.418	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337442.1		XM_209857	
KCP	375616	broad.mit.edu	37	7	128548305	128548308	+	RNA	DEL	AAGA	AAGA	-	rs370991615|rs10565205|rs200276693		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	AAGA	AAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:128548305_128548308delAAGA	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						agaaagaaagaagaaagaaagaaa	0.368																																					.													.	KCP	16		0			.																																											375616	.			AGAAAGAAGAAAG	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548313_128548316delAAGA			4	0	0		10	0.50	5	.	0		0	Q8NBE0	RNA	DEL	ENST00000476647.2	37																																																																																						0.368	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
ZBED6CL	113763	mdanderson.org	37	7	150027654	150027654	+	Missense_Mutation	SNP	G	G	A	rs371078860		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr7:150027654G>A	ENST00000343855.4	+	1	717	c.161G>A	c.(160-162)cGg>cAg	p.R54Q	LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron|LRRC61_ENST00000323078.7_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	54																	GGGTTGGCCCGGCAGCTCTGC	0.607																																					p.R54Q													.	.			0			c.G161A												98.0	102.0	101.0					7																	150027654		2203	4300	6503	SO:0001583	missense	113763	exon1			TGGCCCGGCAGCT	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.161G>A	7.37:g.150027654G>A	ENSP00000343242:p.Arg54Gln		40	0	0		50	0.06	3	NM_138434	29	0.00	0		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690915	0.29962	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.93	2.76	0.32466	.	0.000000	0.35013	U	0.003502	T	0.21881	0.0527	N	0.08118	0	0.23036	N	0.998392	B	0.17038	0.02	B	0.08055	0.003	T	0.19910	-1.0291	9	0.72032	D	0.01	.	9.0509	0.36376	0.0:0.0:0.187:0.813	.	54	Q96FA7	CG029_HUMAN	Q	54	.	ENSP00000343242:R54Q	R	+	2	0	C7orf29	149658587	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	2.550000	0.45811	0.523000	0.28482	-0.385000	0.06624	CGG			0.607	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350702.1		NM_138434	
XKR9	389668	mdanderson.org	37	8	71646627	71646627	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr8:71646627G>T	ENST00000408926.3	+	5	1624	c.1090G>T	c.(1090-1092)Gaa>Taa	p.E364*	XKR9_ENST00000520030.1_Nonsense_Mutation_p.E364*|XKR9_ENST00000520273.1_Intron	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	364						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			AGTTCTAAGAGAATGTAGAAT	0.274																																					p.E364X													.	.			0			c.G1090T												36.0	38.0	37.0					8																	71646627		2189	4289	6478	SO:0001587	stop_gained	389668	exon5			CTAAGAGAATGTA	AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.1090G>T	8.37:g.71646627G>T	ENSP00000386141:p.Glu364*		29	0	0		49	0.06	3	NM_001011720	3	0.00	0	B2RNS9|B9EH74	Nonsense_Mutation	SNP	ENST00000408926.3	37	CCDS34905.1	.	.	.	.	.	.	.	.	.	.	G	33	5.249337	0.95305	.	.	ENSG00000221947	ENST00000408926;ENST00000520030	.	.	.	4.98	0.897	0.19258	.	1.012730	0.07895	N	0.971662	.	.	.	.	.	.	0.51233	D	0.999915	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-0.1361	2.0611	0.03592	0.1885:0.1182:0.4517:0.2416	.	.	.	.	X	364	.	ENSP00000386141:E364X	E	+	1	0	XKR9	71809181	0.897000	0.30589	0.527000	0.27925	0.489000	0.33432	1.973000	0.40550	-0.016000	0.14127	0.557000	0.71058	GAA			0.274	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378752.1		NM_001011720	
SCRIB	23513	mdanderson.org	37	8	144886905	144886905	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr8:144886905G>A	ENST00000320476.3	-	21	2848	c.2842C>T	c.(2842-2844)Cgg>Tgg	p.R948W	SCRIB_ENST00000377533.3_Missense_Mutation_p.R867W|SCRIB_ENST00000356994.2_Missense_Mutation_p.R948W	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	948	Interaction with ARHGEF7.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCAGCCTCCCGCTCCAACAGC	0.662																																					p.R948W	Pancreas(51;966 1133 10533 14576 29674)												.	.			0			c.C2842T												24.0	24.0	24.0					8																	144886905		2197	4298	6495	SO:0001583	missense	23513	exon21			CCTCCCGCTCCAA	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.2842C>T	8.37:g.144886905G>A	ENSP00000322938:p.Arg948Trp		25	0	0		27	0.11	3	NM_182706	228	0.00	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989520	0.53934	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539	T;T;T	0.55588	0.51;0.51;0.51	4.09	3.1	0.35709	PDZ/DHR/GLGF (3);	.	.	.	.	T	0.76219	0.3957	H	0.95187	3.635	0.46131	D	0.998888	D;D	0.89917	1.0;1.0	P;D	0.70935	0.908;0.971	T	0.77563	-0.2541	9	0.87932	D	0	.	7.5463	0.27768	0.0:0.1393:0.3133:0.5474	.	948;948	Q14160;Q14160-3	SCRIB_HUMAN;.	W	948;948;867;317	ENSP00000349486:R948W;ENSP00000322938:R948W;ENSP00000366756:R867W	ENSP00000322938:R948W	R	-	1	2	SCRIB	144958893	1.000000	0.71417	0.988000	0.46212	0.460000	0.32559	2.017000	0.40981	0.699000	0.31761	0.448000	0.29417	CGG			0.662	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000382215.1		NM_015356	
EPPK1	83481	broad.mit.edu	37	8	144940690	144940690	+	Silent	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr8:144940690G>A	ENST00000525985.1	-	2	6803	c.6732C>T	c.(6730-6732)agC>agT	p.S2244S				P58107	EPIPL_HUMAN	epiplakin 1	2244						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGGTAGATGCTCATCTTCT	0.711																																					p.S2244S													.	EPPK1	199		0			c.C6732T												63.0	61.0	61.0					8																	144940690		2185	4252	6437	SO:0001819	synonymous_variant	83481	exon1			GTAGATGCTCATC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6732C>T	8.37:g.144940690G>A			41	0.0243902439	1		58	0.07	4	NM_031308	103	0.12	12	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.711	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
OPLAH	26873	broad.mit.edu	37	8	145108284	145108284	+	Missense_Mutation	SNP	G	G	T	rs186909122		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr8:145108284G>T	ENST00000426825.1	-	20	2780	c.2699C>A	c.(2698-2700)gCc>gAc	p.A900D	CTD-3065J16.6_ENST00000561181.1_RNA|OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000528912.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	900					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCGCAGGGCCTCCGTCAC	0.647																																					p.A900D													.	OPLAH	78		0			c.C2699A												44.0	52.0	50.0					8																	145108284		2081	4210	6291	SO:0001583	missense	26873	exon20			CGCAGGGCCTCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2699C>A	8.37:g.145108284G>T	ENSP00000475943:p.Ala900Asp		38	0	0		70	0.09	6	NM_017570	14	0.00	0	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	G	14.54	2.564475	0.45694	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.56	3.44	0.39384	.	0.106428	0.64402	D	0.000007	T	0.48132	0.1483	.	.	.	0.52099	D	0.999941	B	0.18863	0.031	B	0.25405	0.06	T	0.61317	-0.7087	7	0.62326	D	0.03	.	10.7882	0.46417	0.1156:0.0:0.8844:0.0	.	900	O14841	OPLA_HUMAN	D	900	.	ENSP00000412071:A900D	A	-	2	0	OPLAH	145180272	1.000000	0.71417	0.999000	0.59377	0.867000	0.49689	3.294000	0.51787	2.069000	0.61940	0.448000	0.29417	GCC			0.647	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017570	
JAK2	3717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5080316	5080316	+	Missense_Mutation	SNP	G	G	T	rs368219482		TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr9:5080316G>T	ENST00000381652.3	+	17	2713	c.2219G>T	c.(2218-2220)gGt>gTt	p.G740V	JAK2_ENST00000544510.1_Missense_Mutation_p.G591V|AL161450.1_ENST00000601793.1_Intron|JAK2_ENST00000539801.1_Missense_Mutation_p.G740V	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	740	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TGGAGTTTTGGTACCACTTTG	0.353		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.G740V				Dom	yes		9	9p24	3717	Janus kinase 2		L	.	.			0			c.G2219T												159.0	181.0	173.0					9																	5080316		2203	4300	6503	SO:0001583	missense	3717	exon17	Familial Cancer Database		GTTTTGGTACCAC		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.2219G>T	9.37:g.5080316G>T	ENSP00000371067:p.Gly740Val		145	0	0		151	0.21	32	NM_004972	8	0.50	4	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687926	0.88639	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.80653	-1.4;-1.4;-1.4	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95127	0.8421	H	0.99475	4.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96575	0.9426	10	0.87932	D	0	-16.7004	20.6397	0.99537	0.0:0.0:1.0:0.0	.	740	O60674	JAK2_HUMAN	V	740;740;591	ENSP00000440387:G740V;ENSP00000371067:G740V;ENSP00000443103:G591V	ENSP00000371067:G740V	G	+	2	0	JAK2	5070316	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.459000	0.97638	2.880000	0.98712	0.650000	0.86243	GGT			0.353	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051609.1			
GAS1	2619	mdanderson.org	37	9	89560990	89560990	+	Silent	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr9:89560990G>T	ENST00000298743.7	-	1	1114	c.705C>A	c.(703-705)gtC>gtA	p.V235V	RP11-276H19.1_ENST00000415801.1_lincRNA	NM_002048.2	NP_002039.2	P54826	GAS1_HUMAN	growth arrest-specific 1	235					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cerebellum morphogenesis (GO:0021587)|developmental growth (GO:0048589)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|eye morphogenesis (GO:0048592)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein processing (GO:0010955)|negative regulation of smoothened signaling pathway (GO:0045879)|odontogenesis (GO:0042476)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|programmed cell death (GO:0012501)|regulation of apoptotic process (GO:0042981)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|regulation of smoothened signaling pathway (GO:0008589)	anchored component of plasma membrane (GO:0046658)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|lung(2)|skin(1)	4						TGTTCTCCTTGACCGACTCGC	0.672																																					p.V235V													.	.			0			c.C705A												20.0	21.0	21.0					9																	89560990		2200	4295	6495	SO:0001819	synonymous_variant	2619	exon1			CTCCTTGACCGAC		CCDS6674.1	9q21.3-q22	2008-07-21			ENSG00000180447	ENSG00000180447			4165	protein-coding gene	gene with protein product	"""Growth arrest-specific gene-1"""	139185				8307588	Standard	NM_002048		Approved		uc004aox.4	P54826	OTTHUMG00000020141	ENST00000298743.7:c.705C>A	9.37:g.89560990G>T			17	0	0		17	0.18	3	NM_002048	13	0.00	0	B9EGM4|Q6B086	Silent	SNP	ENST00000298743.7	37	CCDS6674.1																																																																																					0.672	GAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052928.1		NM_002048	
LOC100132077	100132077	broad.mit.edu	37	9	97108463	97108464	+	lincRNA	INS	-	-	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr9:97108463_97108464insT	ENST00000454869.1	+	0	698					NR_033937.1																						gaaaaaCAATCttttttttttg	0.436																																					.													.	.			0			.																																											0	.			AACAATCTTTTTT																													9.37:g.97108473_97108473dupT			7	0	0		9	0.33	3	.	0		0		RNA	INS	ENST00000454869.1	37																																																																																						0.436	RP11-307E17.8-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000053177.1			
C5	727	hgsc.bcm.edu;mdanderson.org	37	9	123751989	123751989	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chr9:123751989G>T	ENST00000223642.1	-	24	3040	c.3011C>A	c.(3010-3012)cCc>cAc	p.P1004H		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1004					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	ACTCCCTTTGGGGAGGTGGGT	0.433																																					p.P1004H													.	.			0			c.C3011A												74.0	71.0	72.0					9																	123751989		2203	4300	6503	SO:0001583	missense	727	exon24			CCTTTGGGGAGGT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3011C>A	9.37:g.123751989G>T	ENSP00000223642:p.Pro1004His		53	0	0		79	0.05	4	NM_001735	4	0.00	0	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515107	0.85389	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.71817	-0.6	6.06	6.06	0.98353	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	D	0.85712	0.5760	M	0.82630	2.6	0.53688	D	0.999976	D	0.89917	1.0	D	0.91635	0.999	D	0.86734	0.1950	10	0.87932	D	0	.	17.3401	0.87293	0.0:0.0:1.0:0.0	.	1004	P01031	CO5_HUMAN	H	1004;1075	ENSP00000223642:P1004H	ENSP00000223642:P1004H	P	-	2	0	C5	122791810	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.802000	0.75175	2.882000	0.98803	0.655000	0.94253	CCC			0.433	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053844.1		NM_001735	
PDHA1	5160	broad.mit.edu	37	X	19369427	19369427	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A6J6-01A-11D-A435-10	TCGA-SB-A6J6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	fdfd4ff8-15a9-45b4-b360-def8726d63f1	f490534e-6bd1-4887-89fb-1eb9c49c2ca5	g.chrX:19369427G>A	ENST00000422285.2	+	4	425	c.320G>A	c.(319-321)gGc>gAc	p.G107D	PDHA1_ENST00000379806.5_Missense_Mutation_p.G145D|PDHA1_ENST00000540249.1_Missense_Mutation_p.G107D|PDHA1_ENST00000379805.3_Missense_Mutation_p.G107D|PDHA1_ENST00000545074.1_Missense_Mutation_p.G114D			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	107					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					CTGGAGGCCGGCATCAACCCC	0.507																																					p.G145D													.	PDHA1	85		0			c.G434A												102.0	94.0	97.0					X																	19369427		2203	4300	6503	SO:0001583	missense	5160	exon5			AGGCCGGCATCAA		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.320G>A	X.37:g.19369427G>A	ENSP00000394382:p.Gly107Asp		265	0	0		429	0.01	6	NM_001173454	171	0.00	0	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	ENST00000422285.2	37	CCDS14192.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770754	0.69992	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000423505;ENST00000422285;ENST00000355808;ENST00000379805	D;D;D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25;-4.25;-4.25	5.42	5.42	0.78866	Dehydrogenase, E1 component (1);	0.222797	0.44688	D	0.000430	D	0.97356	0.9135	L	0.49640	1.575	0.37880	D	0.93034	P;P;P;P;P	0.51537	0.464;0.9;0.946;0.46;0.946	B;D;P;P;P	0.63877	0.219;0.919;0.824;0.753;0.824	D	0.99107	1.0845	10	0.72032	D	0.01	-10.0855	13.15	0.59484	0.0:0.307:0.693:0.0	.	107;114;107;145;107	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	D	145;114;107;145;107;114;107	ENSP00000369134:G145D;ENSP00000438550:G114D;ENSP00000440761:G107D;ENSP00000406473:G145D;ENSP00000394382:G107D;ENSP00000348062:G114D;ENSP00000369133:G107D	ENSP00000348062:G114D	G	+	2	0	PDHA1	19279348	1.000000	0.71417	0.749000	0.31150	0.954000	0.61252	4.260000	0.58835	2.419000	0.82065	0.529000	0.55759	GGC			0.507	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055977.1			
