#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PARK7	11315	mdanderson.org	37	1	8037729	8037729	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:8037729G>T	ENST00000493678.1	+	6	407	c.340G>T	c.(340-342)Gct>Tct	p.A114S	PARK7_ENST00000338639.5_Missense_Mutation_p.A114S|PARK7_ENST00000377491.1_Missense_Mutation_p.A114S|PARK7_ENST00000377493.5_Missense_Mutation_p.A94S|PARK7_ENST00000377488.1_Missense_Mutation_p.A114S			Q99497	PARK7_HUMAN	parkinson protein 7	114					adult locomotory behavior (GO:0008344)|autophagy (GO:0006914)|cellular response to glyoxal (GO:0036471)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to oxidative stress (GO:0034599)|dopamine uptake involved in synaptic transmission (GO:0051583)|glycolate biosynthetic process (GO:0046295)|glyoxal catabolic process (GO:1903190)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|lactate biosynthetic process (GO:0019249)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|methylglyoxal catabolic process to D-lactate (GO:0019243)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of death-inducing signaling complex assembly (GO:1903073)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein acetylation (GO:1901984)|negative regulation of protein binding (GO:0032091)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein K48-linked deubiquitination (GO:1903094)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of TRAIL-activated apoptotic signaling pathway (GO:1903122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|negative regulation of ubiquitin-specific protease activity (GO:2000157)|positive regulation of androgen receptor activity (GO:2000825)|positive regulation of dopamine biosynthetic process (GO:1903181)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of L-dopa biosynthetic process (GO:1903197)|positive regulation of L-dopa decarboxylase activity (GO:1903200)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of oxidative phosphorylation uncoupler activity (GO:2000277)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of pyrroline-5-carboxylate reductase activity (GO:1903168)|positive regulation of superoxide dismutase activity (GO:1901671)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine 3-monooxygenase activity (GO:1903178)|protein stabilization (GO:0050821)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of fibril organization (GO:1902903)|regulation of inflammatory response (GO:0050727)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of neuron apoptotic process (GO:0043523)|single fertilization (GO:0007338)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|cupric ion binding (GO:1903135)|cuprous ion binding (GO:1903136)|cytokine binding (GO:0019955)|enzyme binding (GO:0019899)|glyoxalase (glycolic acid-forming) activity (GO:1990422)|glyoxalase III activity (GO:0019172)|identical protein binding (GO:0042802)|L-dopa decarboxylase activator activity (GO:0036478)|mRNA binding (GO:0003729)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|peptidase activity (GO:0008233)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|repressing transcription factor binding (GO:0070491)|RNA binding (GO:0003723)|scaffold protein binding (GO:0097110)|small protein activating enzyme binding (GO:0044388)|small protein conjugating enzyme binding (GO:0044390)|superoxide dismutase copper chaperone activity (GO:0016532)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|tyrosine 3-monooxygenase activator activity (GO:0036470)|ubiquitin-specific protease binding (GO:1990381)			large_intestine(1)	1	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;1.28e-70)|GBM - Glioblastoma multiforme(8;3.05e-36)|Colorectal(212;6.83e-08)|COAD - Colon adenocarcinoma(227;7.51e-06)|Kidney(185;5.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000414)|KIRC - Kidney renal clear cell carcinoma(229;0.000967)|STAD - Stomach adenocarcinoma(132;0.00102)|READ - Rectum adenocarcinoma(331;0.0649)		TGCTCTGTTGGCTCATGAAAT	0.358																																					p.A114S													.	.			0			c.G340T												124.0	117.0	119.0					1																	8037729		2203	4300	6503	SO:0001583	missense	11315	exon6			CTGTTGGCTCATG	D61380	CCDS93.1	1p36.23	2014-04-11	2011-07-21		ENSG00000116288	ENSG00000116288		"""Parkinson disease"""	16369	protein-coding gene	gene with protein product			"""Parkinson disease (autosomal recessive, early onset) 7"""			11462174, 9070310	Standard	NM_007262		Approved	DJ-1, DJ1	uc001aox.4	Q99497	OTTHUMG00000001210	ENST00000493678.1:c.340G>T	1.37:g.8037729G>T	ENSP00000418770:p.Ala114Ser		65	0	0		40	0.08	3	NM_001123377	950	0.00	0	B2R4Z1|O14805|Q6DR95|Q7LFU2	Missense_Mutation	SNP	ENST00000493678.1	37	CCDS93.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135986	0.56936	.	.	ENSG00000116288	ENST00000338639;ENST00000493678;ENST00000377491;ENST00000377488	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.92	5.92	0.95590	ThiJ/PfpI (1);	0.044618	0.85682	D	0.000000	T	0.75679	0.3882	L	0.31526	0.94	0.80722	D	1	B	0.13145	0.007	B	0.22601	0.04	T	0.68644	-0.5354	10	0.14252	T	0.57	.	17.8151	0.88630	0.0:0.0:1.0:0.0	.	114	Q99497	PARK7_HUMAN	S	114	ENSP00000340278:A114S;ENSP00000418770:A114S;ENSP00000366711:A114S;ENSP00000366708:A114S	ENSP00000340278:A114S	A	+	1	0	PARK7	7960316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.167000	0.94773	2.810000	0.96702	0.650000	0.86243	GCT			0.358	PARK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000003577.1		NM_007262	
TMEM201	199953	mdanderson.org	37	1	9656058	9656058	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:9656058G>A	ENST00000340381.6	+	2	233	c.224G>A	c.(223-225)gGc>gAc	p.G75D	TMEM201_ENST00000340305.5_Missense_Mutation_p.G75D|TMEM201_ENST00000377376.4_Missense_Mutation_p.G75D	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	75					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		CAGTACAACGGCTTCCAGGAG	0.627																																					p.G75D													.	.			0			c.G224A												71.0	59.0	63.0					1																	9656058		2203	4300	6503	SO:0001583	missense	199953	exon2			ACAACGGCTTCCA		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.224G>A	1.37:g.9656058G>A	ENSP00000344503:p.Gly75Asp		68	0	0		32	0.09	3	NM_001010866	12	0.00	0	B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	37	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	G	31	5.093297	0.94149	.	.	ENSG00000188807	ENST00000377376;ENST00000340305;ENST00000340381	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.80701	0.4673	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83386	0.0015	9	0.66056	D	0.02	-39.388	15.9746	0.80054	0.0:0.0:1.0:0.0	.	75;75	E9PBR6;Q5SNT2-2	.;.	D	75	.	ENSP00000344772:G75D	G	+	2	0	TMEM201	9578645	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.748000	0.91615	2.448000	0.82819	0.655000	0.94253	GGC			0.627	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127672.1		NM_001010866	
KAZN	23254	hgsc.bcm.edu	37	1	15439098	15439098	+	Intron	SNP	C	C	T	rs114844404		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:15439098C>T	ENST00000376030.2	+	14	2457					NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CTTTTTTTCTCCTCCCGGGAG	0.587																																					.													.	.			0			.																																									SO:0001627	intron_variant	200197	.			TTTTCTCCTCCCG	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2163+61C>T	1.37:g.15439098C>T			102	0	0		84	0.08	7	.	10	0.00	0	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	RNA	SNP	ENST00000376030.2	37	CCDS152.2																																																																																					0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005690.2		NM_001017999	
EPHB2	2048	mdanderson.org	37	1	23111037	23111037	+	Silent	SNP	G	G	T	rs371651342		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:23111037G>T	ENST00000400191.3	+	3	297	c.279G>T	c.(277-279)tcG>tcT	p.S93S	EPHB2_ENST00000544305.1_Silent_p.S93S|EPHB2_ENST00000374632.3_Silent_p.S93S|EPHB2_ENST00000374627.1_Silent_p.S87S|EPHB2_ENST00000374630.3_Silent_p.S93S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	93	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TGAAGTTTTCGGTGCGTGACT	0.567																																					p.S93S													.	.			0			c.G279T												63.0	57.0	59.0					1																	23111037		2203	4300	6503	SO:0001819	synonymous_variant	2048	exon3			GTTTTCGGTGCGT	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.279G>T	1.37:g.23111037G>T			80	0	0		52	0.06	3	NM_004442	5	0.00	0	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	ENST00000400191.3	37																																																																																						0.567	EPHB2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000008060.2		NM_017449	
PHC2	1912	mdanderson.org	37	1	33796984	33796984	+	Silent	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:33796984A>G	ENST00000257118.5	-	11	2021	c.1968T>C	c.(1966-1968)cgT>cgC	p.R656R	PHC2_ENST00000431992.1_Silent_p.R627R|PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373416.1_Silent_p.R121R|PHC2_ENST00000373422.3_Silent_p.R262R|PHC2_ENST00000419414.2_Silent_p.R657R|MIR3605_ENST00000583214.1_RNA|PHC2_ENST00000373418.3_Silent_p.R121R	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	656					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGCGCTTGGAACGCTTGAACT	0.522																																					p.R656R													PHC2,colon,carcinoma,-2,1	PHC2	-2	1	0			c.T1968C												124.0	133.0	130.0					1																	33796984		2203	4300	6503	SO:0001819	synonymous_variant	1912	exon11			CTTGGAACGCTTG	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1968T>C	1.37:g.33796984A>G			76	0	0		43	0.07	3	NM_198040	29	0.00	0	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	ENST00000257118.5	37	CCDS378.1																																																																																					0.522	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000011895.1		NM_198040	
HIAT1	64645	broad.mit.edu	37	1	100525455	100525455	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:100525455G>T	ENST00000370152.3	+	4	401	c.265G>T	c.(265-267)Gcc>Tcc	p.A89S	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	89					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		ATTCCTTAGTGCCCCGCTTAT	0.368																																					p.A89S													HIAT1,colon,carcinoma,-1,1	HIAT1	46	1	0			c.G265T												192.0	178.0	183.0					1																	100525455		2203	4300	6503	SO:0001583	missense	64645	exon4			CTTAGTGCCCCGC	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.265G>T	1.37:g.100525455G>T	ENSP00000359171:p.Ala89Ser		310	0	0		303	0.02	6	NM_033055	206	0.00	0	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Missense_Mutation	SNP	ENST00000370152.3	37	CCDS763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.399687|4.399687	0.83120|0.83120	.|.	.|.	ENSG00000156875|ENSG00000156875	ENST00000370152|ENST00000421661	T|.	0.80824|.	-1.42|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69753|0.69753	0.3146|0.3146	M|M	0.67569|0.67569	2.06|2.06	0.80722|0.80722	D|D	1|1	P|.	0.46220|.	0.874|.	P|.	0.53760|.	0.734|.	T|T	0.67313|0.67313	-0.5702|-0.5702	10|5	0.35671|.	T|.	0.21|.	-19.2777|-19.2777	19.5927|19.5927	0.95522|0.95522	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	89|.	Q96MC6|.	HIAT1_HUMAN|.	S|F	89|27	ENSP00000359171:A89S|.	ENSP00000359171:A89S|.	A|C	+|+	1|2	0|0	HIAT1|HIAT1	100298043|100298043	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.924000|0.924000	0.55760|0.55760	9.869000|9.869000	0.99810|0.99810	2.618000|2.618000	0.88619|0.88619	0.557000|0.557000	0.71058|0.71058	GCC|TGC			0.368	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000029657.1		NM_033055	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115258747	115258747	+	Missense_Mutation	SNP	C	C	T	rs121913237		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:115258747C>T	ENST00000369535.4	-	2	288	c.35G>A	c.(34-36)gGt>gAt	p.G12D	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(375)|p.G12V(59)|p.G12A(42)|p.G12N(2)|p.G12E(1)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCAACACCACCTGCTCCAAC	0.493	G12D(697_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC151_ENDOMETRIUM)|G12D(KE37_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(THP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12D				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,0,861	NRAS	0	861	481	Substitution - Missense(481)	haematopoietic_and_lymphoid_tissue(375)|skin(59)|large_intestine(21)|testis(5)|thyroid(4)|central_nervous_system(3)|endometrium(3)|biliary_tract(3)|ovary(3)|soft_tissue(2)|lung(2)|prostate(1)	c.G35A							C	ASP/GLY	0,4406		0,0,2203	206.0	184.0	191.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	35	5.6	1.0	1	dbSNP_133	191	1,8599	1.2+/-3.3	0,1,4299	no	missense	NRAS	NM_002524.4	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	12/190	115258747	1,13005	2203	4300	6503	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ACACCACCTGCTC	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.35G>A	1.37:g.115258747C>T	ENSP00000358548:p.Gly12Asp		281	0	0		222	0.17	38	NM_002524	64	0.25	16	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	35	5.524414	0.96431	0.0	1.16E-4	ENSG00000213281	ENST00000369535	T	0.78595	-1.19	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	D	0.85252	0.5654	M	0.92604	3.325	0.80722	D	1	B	0.32467	0.372	B	0.42827	0.399	D	0.86173	0.1601	10	0.87932	D	0	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	D	12	ENSP00000358548:G12D	ENSP00000358548:G12D	G	-	2	0	NRAS	115060270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT			0.493	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
CFHR3	10878	hgsc.bcm.edu	37	1	196759345	196759345	+	Missense_Mutation	SNP	C	C	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:196759345C>A	ENST00000367425.4	+	5	876	c.784C>A	c.(784-786)Cca>Aca	p.P262T	CFHR3_ENST00000391985.3_Missense_Mutation_p.P201T	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	262	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						GTCGGAACCACCAAGATGCAT	0.358																																					p.P262T													CFHR3,brain,primitive_neuroectodermal_tumour-medulloblastoma,-2,1	CFHR3	-2	1	0			c.C784A												30.0	42.0	38.0					1																	196759345		1530	3869	5399	SO:0001583	missense	10878	exon5			GAACCACCAAGAT	X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.784C>A	1.37:g.196759345C>A	ENSP00000356395:p.Pro262Thr		466	0	0		345	0.05	17	NM_021023	0		0	B4DPR0|Q9UJ16	Missense_Mutation	SNP	ENST00000367425.4	37	CCDS30958.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451585	0.43531	.	.	ENSG00000116785	ENST00000367425;ENST00000391985	T;T	0.77489	-1.1;-1.1	3.27	3.27	0.37495	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.91294	0.7255	H	0.97240	3.965	0.22719	N	0.998811	D;D	0.89917	1.0;0.999	D;D	0.80764	0.982;0.994	T	0.82299	-0.0526	9	0.87932	D	0	.	10.3659	0.44024	0.0:1.0:0.0:0.0	.	201;262	B4DPR0;Q02985	.;FHR3_HUMAN	T	262;201	ENSP00000356395:P262T;ENSP00000375845:P201T	ENSP00000356395:P262T	P	+	1	0	CFHR3	195025968	0.521000	0.26258	0.292000	0.24919	0.018000	0.09664	3.272000	0.51616	1.527000	0.49086	0.184000	0.17185	CCA			0.358	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087505.2		NM_021023	
CFHR2	3080	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	196884256	196884256	+	Intron	SNP	C	C	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:196884256C>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000367416.2_Missense_Mutation_p.P509T|CFHR4_ENST00000608469.1_Missense_Mutation_p.P133T|CFHR4_ENST00000367418.2_Missense_Mutation_p.P263T|CFHR4_ENST00000251424.4_Missense_Mutation_p.P263T			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						GTCGGAACCACCAAGATGCAT	0.353																																					p.P510T													CFHR4_ENST00000367416,right_lower_lobe,carcinoma,-1,2	CFHR4_ENST00000367416	-1	2	0			c.C1528A												71.0	73.0	72.0					1																	196884256		2199	4295	6494	SO:0001627	intron_variant	10877	exon9			GAACCACCAAGAT	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-34329C>A	1.37:g.196884256C>A			881	0	0		699	0.13	93	NM_001201550	0		0	Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367421.3	37		.	.	.	.	.	.	.	.	.	.	C	13.78	2.340069	0.41398	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	T;T;T	0.77489	-1.1;-1.1;-1.1	3.33	3.33	0.38152	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.90521	0.7030	H	0.95539	3.685	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.81226	-0.1029	9	0.87932	D	0	.	10.4539	0.44539	0.0:1.0:0.0:0.0	.	509;510;263	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	T	509;263;263;263	ENSP00000356386:P509T;ENSP00000356388:P263T;ENSP00000251424:P263T	ENSP00000251424:P263T	P	+	1	0	CFHR4	195150879	0.371000	0.25056	0.012000	0.15200	0.195000	0.23768	3.192000	0.50989	1.569000	0.49696	0.436000	0.28706	CCA			0.353	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_005666	
PIK3C2B	5287	broad.mit.edu	37	1	204401431	204401431	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:204401431G>T	ENST00000367187.3	-	28	4608	c.4052C>A	c.(4051-4053)aCc>aAc	p.T1351N	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.T1323N	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1351					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			AAAGGAGAGGGTCAGCCGGTC	0.517																																					p.T1351N													.	PIK3C2B	142		0			c.C4052A												120.0	113.0	115.0					1																	204401431		2203	4300	6503	SO:0001583	missense	5287	exon28			GAGAGGGTCAGCC	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4052C>A	1.37:g.204401431G>T	ENSP00000356155:p.Thr1351Asn		178	0	0		154	0.04	6	NM_002646	43	0.00	0	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	g	19.88	3.908663	0.72868	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.61392	0.11;0.26	6.07	6.07	0.98685	.	0.239623	0.42821	D	0.000657	T	0.50616	0.1626	L	0.36672	1.1	0.32556	N	0.531719	P;D	0.56035	0.647;0.974	P;P	0.44860	0.452;0.462	T	0.61048	-0.7141	10	0.35671	T	0.21	.	13.4575	0.61208	0.0718:0.0:0.9282:0.0	.	1323;1351	F5GWN5;O00750	.;P3C2B_HUMAN	N	1351;1323	ENSP00000356155:T1351N;ENSP00000400561:T1323N	ENSP00000356155:T1351N	T	-	2	0	PIK3C2B	202668054	0.823000	0.29233	1.000000	0.80357	0.996000	0.88848	2.758000	0.47565	2.891000	0.99171	0.651000	0.88453	ACC			0.517	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087965.1		NM_002646	
NUCKS1	64710	bcgsc.ca	37	1	205688682	205688686	+	Frame_Shift_Del	DEL	TTTTC	TTTTC	-			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	TTTTC	TTTTC					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:205688682_205688686delTTTTC	ENST00000367142.4	-	6	803_807	c.501_505delGAAAA	c.(499-507)aagaaaatgfs	p.KKM167fs	NUCKS1_ENST00000464938.1_5'UTR	NM_022731.4	NP_073568.2	Q9H1E3	NUCKS_HUMAN	nuclear casein kinase and cyclin-dependent kinase substrate 1	167	Lys-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(1)|lung(9)	14	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GGTTTGGGCATTTTCTTTTCTTTTC	0.312																																					p.167_169del													.	NUCKS1	28		0			c.501_505del																																									SO:0001589	frameshift_variant	64710	exon6			TGGGCATTTTCTT		CCDS30987.1	1q32.1	2008-02-05			ENSG00000069275	ENSG00000069275			29923	protein-coding gene	gene with protein product		611912				11298763	Standard	NM_022731		Approved	NUCKS	uc001hdb.3	Q9H1E3	OTTHUMG00000035996	ENST00000367142.4:c.501_505delGAAAA	1.37:g.205688692_205688696delTTTTC	ENSP00000356110:p.Lys167fs		276	0.0036231884	1		244	0.02	5	NM_022731	311	0.00	0	Q54AC0|Q5PXE7|Q9H1D6|Q9H723	Frame_Shift_Del	DEL	ENST00000367142.4	37	CCDS30987.1																																																																																					0.312	NUCKS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087729.1		NM_022731	
SMYD2	56950	mdanderson.org	37	1	214491483	214491483	+	Splice_Site	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr1:214491483G>T	ENST00000366957.5	+	4	431		c.e4+1		SMYD2_ENST00000491455.1_Splice_Site|SMYD2_ENST00000415093.2_Splice_Site	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		TTTGAATCACGTAAGTCTTTC	0.468																																					.													.	.			0			c.409+1G>T												96.0	98.0	97.0					1																	214491483		2203	4300	6503	SO:0001630	splice_region_variant	56950	exon4			AATCACGTAAGTC	AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.409+1G>T	1.37:g.214491483G>T			62	0	0		51	0.06	3	NM_020197	0		0	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Splice_Site	SNP	ENST00000366957.5	37	CCDS31022.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858357	0.91433	.	.	ENSG00000143499	ENST00000366957;ENST00000415093	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6596	0.95859	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMYD2	212558106	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.583000	0.90794	2.648000	0.89879	0.561000	0.74099	.			0.468	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000089998.1		NM_020197	Intron
MCM10	55388	mdanderson.org	37	10	13240709	13240709	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr10:13240709G>T	ENST00000484800.2	+	16	2246	c.2143G>T	c.(2143-2145)Gcc>Tcc	p.A715S	MCM10_ENST00000378694.1_Missense_Mutation_p.A714S|MCM10_ENST00000378714.3_Missense_Mutation_p.A714S			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	715					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						ATTGGAGCCTGCCAGGAAAAA	0.448																																					p.A715S													.	.			0			c.G2143T												103.0	103.0	103.0					10																	13240709		2203	4300	6503	SO:0001583	missense	55388	exon16			GAGCCTGCCAGGA	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2143G>T	10.37:g.13240709G>T	ENSP00000418268:p.Ala715Ser		43	0	0		29	0.10	3	NM_182751	34	0.00	0	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356565	0.61293	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.32753	1.44;1.44;1.44	5.13	3.14	0.36123	Replication factor Mcm10 (1);	0.095390	0.64402	D	0.000001	T	0.33847	0.0877	L	0.43152	1.355	0.58432	D	0.999996	B;P;P	0.44139	0.412;0.793;0.827	B;P;P	0.52386	0.214;0.571;0.697	T	0.03403	-1.1040	10	0.28530	T	0.3	-7.6411	8.5052	0.33184	0.074:0.0:0.6727:0.2532	.	714;714;715	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	S	714;715;715;714	ENSP00000367986:A714S;ENSP00000418268:A715S;ENSP00000367966:A714S	ENSP00000354945:A715S	A	+	1	0	MCM10	13280715	1.000000	0.71417	0.972000	0.41901	0.823000	0.46562	3.655000	0.54460	1.300000	0.44818	0.655000	0.94253	GCC			0.448	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000356853.1		NM_182751	
FRMPD2	143162	mdanderson.org	37	10	49409307	49409307	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr10:49409307G>T	ENST00000374201.3	-	15	2220	c.1918C>A	c.(1918-1920)Cag>Aag	p.Q640K	FRMPD2_ENST00000407470.4_Missense_Mutation_p.Q608K|FRMPD2_ENST00000305531.3_Missense_Mutation_p.Q615K	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	640	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GAGCCCATCTGTGCATTAAAC	0.418																																					p.Q640K													.	.			0			c.C1918A												104.0	91.0	95.0					10																	49409307		2203	4300	6503	SO:0001583	missense	143162	exon15			CCATCTGTGCATT	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1918C>A	10.37:g.49409307G>T	ENSP00000363317:p.Gln640Lys		99	0	0		63	0.06	4	NM_001018071	0		0	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310848	0.60414	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	D;D;D	0.86432	-2.12;-2.12;-2.12	5.16	3.26	0.37387	FERM, C-terminal PH-like domain (1);FERM domain (1);	.	.	.	.	T	0.77850	0.4192	L	0.39245	1.2	0.27926	N	0.938072	B;B;B	0.17038	0.01;0.02;0.01	B;B;B	0.20384	0.006;0.029;0.006	T	0.61227	-0.7105	9	0.02654	T	1	.	8.5451	0.33417	0.0818:0.0:0.7644:0.1538	.	615;640;608	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	K	640;615;608	ENSP00000363317:Q640K;ENSP00000307079:Q615K;ENSP00000384339:Q608K	ENSP00000307079:Q615K	Q	-	1	0	FRMPD2	49079313	1.000000	0.71417	0.006000	0.13384	0.911000	0.54048	4.151000	0.58105	1.310000	0.45006	0.655000	0.94253	CAG			0.418	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047923.3		NM_152428	
BTRC	8945	broad.mit.edu	37	10	103221770	103221770	+	Silent	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr10:103221770C>T	ENST00000370187.3	+	3	307	c.189C>T	c.(187-189)ggC>ggT	p.G63G	BTRC_ENST00000393441.4_Intron|BTRC_ENST00000408038.2_Silent_p.G27G	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	63					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		GTAATAATGGCGAACCCCCTA	0.353																																					p.G63G													.	BTRC	64		0			c.C189T												95.0	101.0	99.0					10																	103221770		2203	4300	6503	SO:0001819	synonymous_variant	8945	exon3			TAATGGCGAACCC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.189C>T	10.37:g.103221770C>T			178	0	0		179	0.03	6	NM_033637	82	0.00	0	B5MD49|Q5W141|Q5W142|Q9Y213	Silent	SNP	ENST00000370187.3	37	CCDS7512.1																																																																																					0.353	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049936.1		NM_033637	
PSD	5662	mdanderson.org	37	10	104176225	104176225	+	Missense_Mutation	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr10:104176225A>G	ENST00000020673.5	-	2	1097	c.571T>C	c.(571-573)Tct>Cct	p.S191P	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Missense_Mutation_p.S191P	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	191					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TTGGGGAGAGAGGAGTAAAGG	0.657																																					p.S191P													.	.			0			c.T571C												17.0	22.0	20.0					10																	104176225		2201	4296	6497	SO:0001583	missense	5662	exon3			GGAGAGAGGAGTA	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.571T>C	10.37:g.104176225A>G	ENSP00000020673:p.Ser191Pro		66	0	0		52	0.06	3	NM_001270965	2	0.00	0	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164838	0.78339	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.19532	2.14;2.14	5.27	5.27	0.74061	.	0.192944	0.36815	N	0.002381	T	0.25717	0.0626	N	0.08118	0	0.36489	D	0.868298	D	0.65815	0.995	D	0.72982	0.979	T	0.42749	-0.9433	10	0.72032	D	0.01	.	12.5792	0.56381	1.0:0.0:0.0:0.0	.	191	A5PKW4	PSD1_HUMAN	P	191;94;191	ENSP00000020673:S191P;ENSP00000384830:S191P	ENSP00000020673:S191P	S	-	1	0	PSD	104166215	0.995000	0.38212	1.000000	0.80357	0.878000	0.50629	1.756000	0.38390	2.006000	0.58801	0.459000	0.35465	TCT			0.657	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050041.2			
MUC15	143662	mdanderson.org	37	11	26587436	26587436	+	5'UTR	SNP	A	A	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:26587436A>T	ENST00000455601.2	-	0	88				ANO3_ENST00000256737.3_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.F17L|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000527569.1_Missense_Mutation_p.F17L|MUC15_ENST00000529533.1_Missense_Mutation_p.F17L|MUC15_ENST00000281268.8_Missense_Mutation_p.F17L|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000531568.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						GTTTTTTTTTAAAGGAATCTG	0.294																																					p.F17L													.	.			0			c.T51A												26.0	26.0	26.0					11																	26587436		2147	4255	6402	SO:0001623	5_prime_UTR_variant	143662	exon3			TTTTTTAAAGGAA	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.-31T>A	11.37:g.26587436A>T			63	0	0		45	0.07	3	NM_001135092	0		0	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	37	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.267158	0.40095	.	.	ENSG00000169550	ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T	0.23147	1.96;1.92;1.96;1.92	4.61	-1.08	0.09936	.	.	.	.	.	T	0.12646	0.0307	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.27020	-1.0086	9	0.87932	D	0	.	3.9855	0.09514	0.3753:0.0:0.101:0.5238	.	17;17	F8W945;E9PII6	.;.	L	17	ENSP00000416753:F17L;ENSP00000281268:F17L;ENSP00000431983:F17L;ENSP00000431945:F17L	ENSP00000281268:F17L	F	-	3	2	MUC15	26544012	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.601000	0.24119	0.007000	0.14760	0.454000	0.30748	TTT			0.294	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387866.1		NM_145650	
DAK	26007	mdanderson.org	37	11	61113862	61113862	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:61113862G>T	ENST00000394900.3	+	18	1844	c.1615G>T	c.(1615-1617)Gct>Tct	p.A539S	CYB561A3_ENST00000540317.1_5'Flank	NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	539	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						GAATATGGAAGCTGGAGCCGG	0.647																																					p.A539S													.	.			0			c.G1615T												65.0	76.0	72.0					11																	61113862		2203	4299	6502	SO:0001583	missense	26007	exon18			ATGGAAGCTGGAG		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1615G>T	11.37:g.61113862G>T	ENSP00000378360:p.Ala539Ser		44	0	0		33	0.09	3	NM_015533	47	0.00	0	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	35	5.451387	0.96205	.	.	ENSG00000149476	ENST00000394900	T	0.51071	0.72	5.52	5.52	0.82312	Dak phosphatase (3);	0.000000	0.85682	D	0.000000	T	0.75627	0.3875	M	0.91249	3.19	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.81219	-0.1032	10	0.72032	D	0.01	-12.5849	17.6186	0.88074	0.0:0.0:1.0:0.0	.	539	Q3LXA3	DHAK_HUMAN	S	539	ENSP00000378360:A539S	ENSP00000378360:A539S	A	+	1	0	DAK	60870438	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	8.861000	0.92277	2.606000	0.88127	0.561000	0.74099	GCT			0.647	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394425.4		NM_015533	
MIR192	406967	mdanderson.org	37	11	64658659	64658659	+	lincRNA	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:64658659G>T	ENST00000601517.1	-	0	0				MIR194-2_ENST00000384864.1_lincRNA|MIR192_ENST00000384915.1_RNA																							GCAGCCAGAGGGGAGACGAGA	0.627																																					.													.	.			0			.												20.0	22.0	21.0					11																	64658659		1553	3552	5105			406967	.			CCAGAGGGGAGAC																													11.37:g.64658659G>T			33	0	0		34	0.09	3	.	1	0.00	0		RNA	SNP	ENST00000601517.1	37																																																																																						0.627	RP11-665N17.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000464673.1			
SSH3	54961	mdanderson.org	37	11	67074580	67074580	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:67074580G>T	ENST00000308127.4	+	5	710	c.532G>T	c.(532-534)Gac>Tac	p.D178Y	SSH3_ENST00000532181.1_3'UTR|SSH3_ENST00000308298.7_Missense_Mutation_p.D178Y|SSH3_ENST00000376757.5_Missense_Mutation_p.D178Y	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	178					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CTTAGATGGAGACGGGTAAGC	0.602																																					p.D178Y													.	.			0			c.G532T												65.0	67.0	67.0					11																	67074580		2200	4295	6495	SO:0001583	missense	54961	exon5			GATGGAGACGGGT	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.532G>T	11.37:g.67074580G>T	ENSP00000312081:p.Asp178Tyr		26	0	0		27	0.11	3	NM_017857	2	0.00	0	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	g	23.2	4.391261	0.82902	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757	T;T;T	0.51817	0.69;0.69;0.69	4.76	4.76	0.60689	.	0.650380	0.12894	N	0.430350	T	0.70736	0.3258	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.963	T	0.72130	-0.4383	10	0.72032	D	0.01	-17.3302	15.5729	0.76354	0.0:0.0:1.0:0.0	.	32;178	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	Y	178	ENSP00000312081:D178Y;ENSP00000310055:D178Y;ENSP00000365948:D178Y	ENSP00000312081:D178Y	D	+	1	0	SSH3	66831156	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	9.363000	0.97131	2.174000	0.68829	0.651000	0.88453	GAC			0.602	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393167.1		NM_018276	
AAMDC	28971	broad.mit.edu	37	11	77580816	77580816	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:77580816G>T	ENST00000526415.1	+	4	354	c.181G>T	c.(181-183)Ggt>Tgt	p.G61C	AAMDC_ENST00000393427.2_Missense_Mutation_p.G61C|RP11-91P24.7_ENST00000525594.1_RNA|AAMDC_ENST00000532481.1_Missense_Mutation_p.G61C|AAMDC_ENST00000525034.1_Missense_Mutation_p.G80C|AAMDC_ENST00000527134.1_Missense_Mutation_p.G61C|AAMDC_ENST00000525409.1_Intron|AAMDC_ENST00000533193.1_Missense_Mutation_p.G107C|RP11-91P24.6_ENST00000530972.1_RNA|AAMDC_ENST00000304716.8_Missense_Mutation_p.G61C			Q9H7C9	AAMDC_HUMAN	adipogenesis associated, Mth938 domain containing	61	MTH138-like domain. {ECO:0000250}.				negative regulation of apoptotic process (GO:0043066)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)											TGTTGAGAAGGGTGTACAGAC	0.512																																					p.G61C													.	.			0			c.G181T												353.0	327.0	336.0					11																	77580816		2200	4292	6492	SO:0001583	missense	28971	exon3			GAGAAGGGTGTAC	BC016854	CCDS8254.1	11q14.1	2012-10-08	2012-10-08	2012-10-08	ENSG00000087884	ENSG00000087884			30205	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 67"""	C11orf67		12477932	Standard	NM_024684		Approved	PTD015, FLJ21035, CK067	uc001oyq.3	Q9H7C9	OTTHUMG00000166651	ENST00000526415.1:c.181G>T	11.37:g.77580816G>T	ENSP00000431808:p.Gly61Cys		215	0	0		150	0.03	5	NM_024684	68	0.00	0	Q96AQ4|Q9Y6B1	Missense_Mutation	SNP	ENST00000526415.1	37	CCDS8254.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841582	0.91197	.	.	ENSG00000087884	ENST00000532481;ENST00000526415;ENST00000393427;ENST00000527134;ENST00000304716;ENST00000533193;ENST00000525034	T;T;T;T;T;T;T	0.77229	-1.08;0.84;0.84;0.84;0.84;0.84;0.84	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.999	D	0.88331	0.2968	10	0.87932	D	0	-12.6787	19.2713	0.94011	0.0:0.0:1.0:0.0	.	61;61;61	E9PLK9;Q9H7C9;Q9H7C9-3	.;CK067_HUMAN;.	C	61;61;61;61;61;107;80	ENSP00000433293:G61C;ENSP00000431808:G61C;ENSP00000377078:G61C;ENSP00000433281:G61C;ENSP00000307254:G61C;ENSP00000436086:G107C;ENSP00000432830:G80C	ENSP00000307254:G61C	G	+	1	0	C11orf67	77258464	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.234000	0.89801	2.890000	0.99128	0.650000	0.86243	GGT			0.512	AAMDC-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390976.1		NM_024684	
SLC25A1P1	100131457	bcgsc.ca	37	11	85646423	85646423	+	IGR	SNP	C	C	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:85646423C>A								RP11-90K17.2 (11698 upstream) : PICALM (22303 downstream)																							CCCAACAAGCCCATGAACCCG	0.582																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100131457	.			ACAAGCCCATGAA																													11.37:g.85646423C>A			19	0	0		9	0.33	3	.	0		0		RNA	SNP		37																																																																																					0	0.582										
FAT3	120114	mdanderson.org	37	11	92577510	92577510	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:92577510G>T	ENST00000298047.6	+	18	10994	c.10977G>T	c.(10975-10977)gaG>gaT	p.E3659D	FAT3_ENST00000409404.2_Missense_Mutation_p.E3659D|FAT3_ENST00000525166.1_Missense_Mutation_p.E3509D|FAT3_ENST00000533797.1_5'UTR			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3659					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTCCCCTGAGGACTTCGTGG	0.582										TCGA Ovarian(4;0.039)																											p.E3659D													.	.			0			c.G10977T												63.0	67.0	66.0					11																	92577510		2130	4256	6386	SO:0001583	missense	120114	exon18			CCCTGAGGACTTC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10977G>T	11.37:g.92577510G>T	ENSP00000298047:p.Glu3659Asp		98	0	0		32	0.09	3	NM_001008781	0		0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	18.91	3.723517	0.68959	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.08807	3.05;3.05;3.05	5.94	5.94	0.96194	.	.	.	.	.	T	0.15825	0.0381	M	0.62016	1.91	0.80722	D	1	D;P	0.53151	0.958;0.643	P;B	0.51777	0.679;0.318	T	0.00160	-1.1973	9	0.66056	D	0.02	.	7.8014	0.29176	0.1887:0.0:0.8113:0.0	.	3659;3659	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	D	3659;3659;3509	ENSP00000298047:E3659D;ENSP00000387040:E3659D;ENSP00000432586:E3509D	ENSP00000298047:E3659D	E	+	3	2	FAT3	92217158	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	0.566000	0.23593	2.816000	0.96949	0.561000	0.74099	GAG			0.582	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	
GRIA4	2893	mdanderson.org	37	11	105481779	105481779	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr11:105481779G>T	ENST00000530497.1	+	1	55	c.55G>T	c.(55-57)Gcc>Tcc	p.A19S	GRIA4_ENST00000393125.2_Missense_Mutation_p.A19S|GRIA4_ENST00000527669.1_Missense_Mutation_p.A19S|GRIA4_ENST00000525187.1_Missense_Mutation_p.A19S|GRIA4_ENST00000282499.5_Missense_Mutation_p.A19S|GRIA4_ENST00000428631.2_Missense_Mutation_p.A19S|GRIA4_ENST00000393127.2_Missense_Mutation_p.A19S			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	19					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TTGGGGACTCGCCATGGGAGC	0.498																																					p.A19S													GRIA4_ENST00000393127,NS,carcinoma,0,3	GRIA4_ENST00000393127	0	3	0			c.G55T												128.0	117.0	121.0					11																	105481779		2202	4299	6501	SO:0001583	missense	2893	exon2			GGACTCGCCATGG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.55G>T	11.37:g.105481779G>T	ENSP00000435775:p.Ala19Ser		142	0.0070422535	1		60	0.05	3	NM_001077243	0		0	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047775	0.36085	.	.	ENSG00000152578	ENST00000527177;ENST00000393125;ENST00000531986;ENST00000282499;ENST00000393127;ENST00000527669;ENST00000525921;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.18810	2.19;2.78;2.62;2.19;2.78;2.62	4.91	4.91	0.64330	.	0.000000	0.56097	D	0.000035	T	0.15435	0.0372	N	0.21373	0.66	0.50632	D	0.999887	B;B;B;B;B	0.27013	0.005;0.004;0.006;0.008;0.166	B;B;B;B;B	0.23275	0.006;0.015;0.007;0.012;0.045	T	0.07888	-1.0749	10	0.15499	T	0.54	.	18.6535	0.91440	0.0:0.0:1.0:0.0	.	19;19;49;19;19	P48058;G3V164;Q59GL7;Q86XE8;E9PQN1	GRIA4_HUMAN;.;.;.;.	S	19	ENSP00000376833:A19S;ENSP00000282499:A19S;ENSP00000376835:A19S;ENSP00000415551:A19S;ENSP00000435775:A19S;ENSP00000432180:A19S	ENSP00000282499:A19S	A	+	1	0	GRIA4	104986989	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.735000	0.68587	2.710000	0.92621	0.563000	0.77884	GCC			0.498	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000388593.1			
KRAS	3845	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	G	rs121913529		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr12:25398284C>G	ENST00000256078.4	-	2	98	c.35G>C	c.(34-36)gGt>gCt	p.G12A	KRAS_ENST00000557334.1_Missense_Mutation_p.G12A|KRAS_ENST00000311936.3_Missense_Mutation_p.G12A|KRAS_ENST00000556131.1_Missense_Mutation_p.G12A	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12A	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,25136	KRAS	30930	25136	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35C												91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>C	12.37:g.25398284C>G	ENSP00000256078:p.Gly12Ala		279	0	0		361	0.03	10	NM_004985	54	0.00	0	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996285	0.93167	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	M	0.74546	2.27	0.80722	D	1	P;P	0.52842	0.898;0.956	P;P	0.55303	0.658;0.773	D	0.87064	0.2155	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	A	12	ENSP00000308495:G12A;ENSP00000452512:G12A;ENSP00000256078:G12A;ENSP00000451856:G12A	ENSP00000256078:G12A	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
SOAT2	8435	mdanderson.org	37	12	53497424	53497424	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr12:53497424G>T	ENST00000301466.3	+	1	123	c.63G>T	c.(61-63)gaG>gaT	p.E21D		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	21					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GGGAGCGGGAGCGCCAACCCT	0.701																																					p.E21D													.	.			0			c.G63T												12.0	15.0	14.0					12																	53497424		1835	3499	5334	SO:0001583	missense	8435	exon1			GCGGGAGCGCCAA	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.63G>T	12.37:g.53497424G>T	ENSP00000301466:p.Glu21Asp		25	0	0		27	0.11	3	NM_003578	0		0	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Missense_Mutation	SNP	ENST00000301466.3	37	CCDS8847.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614165	0.28712	.	.	ENSG00000167780	ENST00000551896;ENST00000301466	T;T	0.54279	0.58;1.85	4.76	1.9	0.25705	.	0.762691	0.11662	N	0.541747	T	0.47284	0.1437	M	0.63428	1.95	0.09310	N	1	B	0.29766	0.256	B	0.24701	0.055	T	0.38243	-0.9670	10	0.52906	T	0.07	-21.3241	9.1162	0.36760	0.2655:0.0:0.7345:0.0	.	21	O75908	SOAT2_HUMAN	D	21	ENSP00000450120:E21D;ENSP00000301466:E21D	ENSP00000301466:E21D	E	+	3	2	SOAT2	51783691	0.001000	0.12720	0.014000	0.15608	0.008000	0.06430	0.178000	0.16820	0.329000	0.23460	-1.119000	0.02030	GAG			0.701	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405817.1			
SLC8B1	80024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113770646	113770646	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr12:113770646C>T	ENST00000552014.1	-	3	553	c.38G>A	c.(37-39)aGt>aAt	p.S13N	SLC8B1_ENST00000546737.1_Missense_Mutation_p.S13N|SLC8B1_ENST00000202831.3_Missense_Mutation_p.S13N|SLC8B1_ENST00000553238.1_5'UTR			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	13					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										ACAAAGCACACTCAGTGCCCA	0.582																																					p.S13N													.	.			0			c.G38A												70.0	65.0	67.0					12																	113770646		2203	4300	6503	SO:0001583	missense	80024	exon2			AGCACACTCAGTG	AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.38G>A	12.37:g.113770646C>T	ENSP00000447091:p.Ser13Asn		80	0	0		69	0.29	20	NM_024959	48	0.27	13	A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Missense_Mutation	SNP	ENST00000552014.1	37	CCDS31909.1	.	.	.	.	.	.	.	.	.	.	C	4.308	0.056538	0.08291	.	.	ENSG00000089060	ENST00000552014;ENST00000202831;ENST00000377458;ENST00000546737;ENST00000549181;ENST00000548186;ENST00000549372	T;T;T;T	0.60171	0.21;0.21;0.21;1.89	2.51	0.514	0.17007	.	0.759158	0.10670	U	0.647657	T	0.40040	0.1101	L	0.36672	1.1	0.09310	N	1	B	0.23650	0.089	B	0.17098	0.017	T	0.21449	-1.0245	10	0.20046	T	0.44	.	4.9269	0.13898	0.2432:0.5197:0.2372:0.0	.	13	Q6J4K2	NCKX6_HUMAN	N	13	ENSP00000447091:S13N;ENSP00000202831:S13N;ENSP00000450081:S13N;ENSP00000448703:S13N	ENSP00000202831:S13N	S	-	2	0	SLC24A6	112255029	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.453000	0.21811	0.124000	0.18369	-0.499000	0.04595	AGT			0.582	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404830.3		NM_024959	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000457266.2_Splice_Site_p.M41V|TPTE2_ENST00000400103.2_Splice_Site_p.M41V|TPTE2_ENST00000382975.4_Splice_Site_p.M41V|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382977.4_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V													.	TPTE2	225		0			c.A121G												47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C			688	0.0087209302	6		510	0.03	15	NM_199254	2	0.00	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG			0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	Missense_Mutation
ATP11A	23250	mdanderson.org	37	13	113526062	113526062	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr13:113526062G>T	ENST00000487903.1	+	26	3093	c.3005G>T	c.(3004-3006)tGg>tTg	p.W1002L	ATP11A_ENST00000375645.3_Missense_Mutation_p.W1002L|ATP11A_ENST00000375630.2_Missense_Mutation_p.W1002L|ATP11A_ENST00000283558.8_Missense_Mutation_p.W1002L			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1002					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TTTGGAAACTGGACGTTTGGA	0.423																																					p.W1002L													.	.			0			c.G3005T												162.0	162.0	162.0					13																	113526062		2203	4300	6503	SO:0001583	missense	23250	exon26			GAAACTGGACGTT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3005G>T	13.37:g.113526062G>T	ENSP00000420387:p.Trp1002Leu		107	0	0		49	0.06	3	NM_032189	9	0.00	0	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983056	0.53827	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	4.15	4.15	0.48705	.	0.064020	0.64402	D	0.000002	T	0.41581	0.1165	L	0.51422	1.61	0.80722	D	1	B;B	0.32829	0.386;0.344	B;B	0.37267	0.175;0.245	T	0.30937	-0.9961	10	0.25751	T	0.34	.	16.8014	0.85615	0.0:0.0:1.0:0.0	.	1002;1002	E9PEJ6;P98196	.;AT11A_HUMAN	L	1002	ENSP00000420387:W1002L;ENSP00000364781:W1002L;ENSP00000364796:W1002L;ENSP00000283558:W1002L	ENSP00000283558:W1002L	W	+	2	0	ATP11A	112574063	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	8.935000	0.92923	2.002000	0.58637	0.462000	0.41574	TGG			0.423	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000045834.3		NM_015205	
ZFYVE21	79038	mdanderson.org	37	14	104182264	104182264	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr14:104182264C>T	ENST00000311141.2	+	1	120	c.86C>T	c.(85-87)gCc>gTc	p.A29V	XRCC3_ENST00000352127.7_5'Flank|XRCC3_ENST00000554974.1_5'Flank|XRCC3_ENST00000445556.1_5'Flank|XRCC3_ENST00000555055.1_5'Flank|RP11-73M18.9_ENST00000602383.1_lincRNA|ZFYVE21_ENST00000216602.6_Missense_Mutation_p.A29V|XRCC3_ENST00000554913.1_5'Flank	NM_024071.3	NP_076976.1	Q9BQ24	ZFY21_HUMAN	zinc finger, FYVE domain containing 21	29						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(2)	8		Melanoma(154;0.226)		Epithelial(152;0.245)		GAACACCGCGCCTTCGGAAGC	0.761																																					p.A29V													.	.			0			c.C86T												5.0	6.0	6.0					14																	104182264		1983	3930	5913	SO:0001583	missense	79038	exon1			ACCGCGCCTTCGG	AK057816	CCDS9985.1, CCDS55948.1	14q32.33	2011-09-07						"""Zinc fingers, FYVE domain containing"""	20760	protein-coding gene	gene with protein product		613504				21768110	Standard	NM_024071		Approved	MGC2550, ZF21	uc001yod.3	Q9BQ24		ENST00000311141.2:c.86C>T	14.37:g.104182264C>T	ENSP00000310543:p.Ala29Val		27	0	0		19	0.16	3	NM_024071	369	0.00	0	A8K3A4|Q86T05|Q96LT1	Missense_Mutation	SNP	ENST00000311141.2	37	CCDS9985.1	.	.	.	.	.	.	.	.	.	.	c	22.3	4.269181	0.80469	.	.	ENSG00000100711	ENST00000216602;ENST00000311141	T;T	0.73681	-0.77;-0.76	3.37	3.37	0.38596	.	0.221403	0.37012	U	0.002285	T	0.74581	0.3735	L	0.29908	0.895	0.46521	D	0.999085	D;D	0.59767	0.982;0.986	P;P	0.58331	0.837;0.722	T	0.75048	-0.3455	10	0.37606	T	0.19	-1.0786	14.9747	0.71261	0.0:1.0:0.0:0.0	.	29;29	Q9BQ24-2;Q9BQ24	.;ZFY21_HUMAN	V	29	ENSP00000216602:A29V;ENSP00000310543:A29V	ENSP00000216602:A29V	A	+	2	0	ZFYVE21	103252017	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.854000	0.62918	1.744000	0.51775	0.580000	0.79431	GCC			0.761	ZFYVE21-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000414616.1		NM_024071	
ELL3	80237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	44066684	44066684	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr15:44066684C>T	ENST00000319359.3	-	8	1497	c.856G>A	c.(856-858)Gac>Aac	p.D286N	ELL3_ENST00000497465.1_5'UTR|RP11-296A16.1_ENST00000417761.2_3'UTR|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	286					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		AGGAGGTAGTCTGGTATATCT	0.413																																					p.D286N													.	.			0			c.G856A												129.0	136.0	134.0					15																	44066684		2198	4298	6496	SO:0001583	missense	80237	exon8			GGTAGTCTGGTAT	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.856G>A	15.37:g.44066684C>T	ENSP00000320346:p.Asp286Asn		175	0	0		168	0.23	38	NM_025165	3	0.00	0	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	ENST00000319359.3	37	CCDS10102.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253826	0.59212	.	.	ENSG00000128886	ENST00000319359	T	0.47177	0.85	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000005	T	0.70360	0.3215	M	0.81682	2.555	0.50813	D	0.999896	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.994;0.994	T	0.73398	-0.3995	10	0.72032	D	0.01	-20.0611	15.5166	0.75830	0.0:1.0:0.0:0.0	.	286;286;240	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	N	286	ENSP00000320346:D286N	ENSP00000320346:D286N	D	-	1	0	ELL3	41853976	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	3.549000	0.53681	2.740000	0.93945	0.455000	0.32223	GAC			0.413	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000133236.2		NM_025165	
ISLR2	57611	mdanderson.org	37	15	74426776	74426776	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr15:74426776G>T	ENST00000361742.3	+	4	2450	c.1681G>T	c.(1681-1683)Ggt>Tgt	p.G561C	ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000453268.2_Missense_Mutation_p.G561C|ISLR2_ENST00000419208.1_Missense_Mutation_p.G561C|ISLR2_ENST00000565159.1_Missense_Mutation_p.G561C|ISLR2_ENST00000445793.1_Missense_Mutation_p.G561C|ISLR2_ENST00000565540.1_Missense_Mutation_p.G561C|ISLR2_ENST00000435464.1_Missense_Mutation_p.G561C	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	561					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						CCTGCGGCCGGGTACCAACTA	0.657																																					p.G561C													.	.			0			c.G1681T												11.0	14.0	13.0					15																	74426776		2139	4202	6341	SO:0001583	missense	57611	exon4			CGGCCGGGTACCA		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1681G>T	15.37:g.74426776G>T	ENSP00000355402:p.Gly561Cys		64	0	0		56	0.07	4	NM_001130136	1	0.00	0	A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858943	0.71834	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000419208	T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.19208	0.0461	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.01988	-1.1234	10	0.87932	D	0	.	16.4299	0.83839	0.0:0.0:1.0:0.0	.	561	Q6UXK2	ISLR2_HUMAN	C	561	ENSP00000403244:G561C;ENSP00000355402:G561C;ENSP00000411443:G561C;ENSP00000411834:G561C;ENSP00000408872:G561C	ENSP00000355402:G561C	G	+	1	0	ISLR2	72213829	1.000000	0.71417	0.980000	0.43619	0.769000	0.43574	9.387000	0.97232	2.166000	0.68216	0.313000	0.20887	GGT			0.657	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269046.1		NM_020851	
WDR90	197335	mdanderson.org	37	16	717445	717445	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:717445G>T	ENST00000293879.4	+	41	5103	c.5103G>T	c.(5101-5103)agG>agT	p.R1701S	RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000547944.1_Missense_Mutation_p.R300S|WDR90_ENST00000315764.4_Missense_Mutation_p.R252S|WDR90_ENST00000549091.1_Missense_Mutation_p.R1703S			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1701										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GCATGCTGAGGCTGGTAGACT	0.647																																					p.R1701S													.	.			0			c.G5103T												43.0	51.0	49.0					16																	717445		2131	4218	6349	SO:0001583	missense	197335	exon41			GCTGAGGCTGGTA	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.5103G>T	16.37:g.717445G>T	ENSP00000293879:p.Arg1701Ser		62	0	0		43	0.07	3	NM_145294	19	0.00	0	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449367	0.26074	.	.	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.67523	3.39;1.32;-0.27;1.47	5.14	0.501	0.16925	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.068282	0.53938	U	0.000049	T	0.55305	0.1912	M	0.80616	2.505	0.38230	D	0.94101	B;B;P	0.36874	0.218;0.019;0.572	B;B;B	0.26202	0.067;0.018;0.052	T	0.52487	-0.8569	10	0.51188	T	0.08	.	2.8273	0.05489	0.1569:0.3124:0.4025:0.1283	.	252;300;1701	Q96KV7-7;G3V201;Q96KV7	.;.;WDR90_HUMAN	S	1703;1701;300;252	ENSP00000448122:R1703S;ENSP00000293879:R1701S;ENSP00000449576:R300S;ENSP00000322808:R252S	ENSP00000293879:R1701S	R	+	3	2	WDR90	657446	0.972000	0.33761	0.614000	0.29051	0.134000	0.20937	0.730000	0.26043	0.111000	0.17947	0.609000	0.83330	AGG			0.647	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000404335.1		NM_145294	
ZSCAN10	84891	mdanderson.org	37	16	3142569	3142569	+	Missense_Mutation	SNP	G	G	A	rs543656828		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:3142569G>A	ENST00000252463.2	-	1	292	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	ZSCAN10_ENST00000575108.1_Intron|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.P76L|ZSCAN10_ENST00000572548.1_Intron	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	69	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						CTGGGCTCCCGGTGGATGCCC	0.697																																					p.R69W													.	.			0			c.C205T																																									SO:0001583	missense	84891	exon1			GCTCCCGGTGGAT	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.205C>T	16.37:g.3142569G>A	ENSP00000252463:p.Arg69Trp		38	0.0263157895	1		19	0.11	2	NM_032805	15	0.00	0	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	CCDS10493.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.34|17.34	3.364932|3.364932	0.61513|0.61513	.|.	.|.	ENSG00000130182|ENSG00000130182	ENST00000538082|ENST00000252463	T|T	0.08546|0.04862	3.08|3.54	5.4|5.4	-1.2|-1.2	0.09554|0.09554	.|Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.|0.601756	.|0.15793	.|N	.|0.244380	T|T	0.10165|0.10165	0.0249|0.0249	M|M	0.82323|0.82323	2.585|2.585	0.09310|0.09310	N|N	1|1	B|P	0.27853|0.48640	0.191|0.913	B|B	0.15052|0.43990	0.012|0.438	T|T	0.10474|0.10474	-1.0628|-1.0628	9|10	0.34782|0.87932	T|D	0.22|0	-9.78|-9.78	4.9072|4.9072	0.13804|0.13804	0.0:0.2782:0.3075:0.4143|0.0:0.2782:0.3075:0.4143	.|.	91|69	Q1WWM2|Q96SZ4	.|ZSC10_HUMAN	L|W	91|69	ENSP00000440047:P91L|ENSP00000252463:R69W	ENSP00000440047:P91L|ENSP00000252463:R69W	P|R	-|-	2|1	0|2	ZSCAN10|ZSCAN10	3082570|3082570	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	-1.329000|-1.329000	0.02677|0.02677	-0.195000|-0.195000	0.10382|0.10382	-0.397000|-0.397000	0.06425|0.06425	CCG|CGG			0.697	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437124.2		NM_032805	
FUS	2521	broad.mit.edu;bcgsc.ca	37	16	31202397	31202398	+	Frame_Shift_Del	DEL	AG	AG	-	rs10684		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:31202397_31202398delAG	ENST00000254108.7	+	14	1612_1613	c.1507_1508delAG	c.(1507-1509)agafs	p.R503fs	FUS_ENST00000568685.1_Frame_Shift_Del_p.R504fs|FUS_ENST00000380244.3_Frame_Shift_Del_p.R502fs|FUS_ENST00000474990.1_3'UTR	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	503	Arg/Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		TGGTGGGGACAGAGGTGGCTTT	0.579			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																p.503_503del				Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	.	FUS	52		0			c.1507_1508del																																									SO:0001589	frameshift_variant	2521	exon14			GGGGACAGAGGTG	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.1507_1508delAG	16.37:g.31202399_31202400delAG	ENSP00000254108:p.Arg503fs		60	0	0		34	0.26	9	NM_004960	100	0.00	0	Q9H4A8	Frame_Shift_Del	DEL	ENST00000254108.7	37	CCDS10707.1																																																																																					0.579	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255526.2		NM_004960	
TGFB1I1	7041	mdanderson.org	37	16	31484834	31484834	+	Missense_Mutation	SNP	C	C	T	rs142826505	byFrequency	TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:31484834C>T	ENST00000394863.3	+	2	216	c.86C>T	c.(85-87)gCg>gTg	p.A29V	TGFB1I1_ENST00000361773.3_Missense_Mutation_p.A12V|TGFB1I1_ENST00000567607.1_Missense_Mutation_p.A12V|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.A12V	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	29	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						GAGCGCCCTGCGGAGCCTCTC	0.642																																					p.A29V													.	.			0			c.C86T							C	VAL/ALA,VAL/ALA,VAL/ALA	2,4392	4.2+/-10.8	0,2,2195	40.0	46.0	44.0		86,35,35	3.4	1.0	16	dbSNP_134	44	0,8600		0,0,4300	no	missense,missense,missense	TGFB1I1	NM_001042454.2,NM_001164719.1,NM_015927.4	64,64,64	0,2,6495	TT,TC,CC		0.0,0.0455,0.0154	benign,benign,benign	29/462,12/445,12/445	31484834	2,12992	2197	4300	6497	SO:0001583	missense	7041	exon2			GCCCTGCGGAGCC	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.86C>T	16.37:g.31484834C>T	ENSP00000378332:p.Ala29Val		59	0	0		39	0.08	3	NM_001042454	18	0.00	0	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319253	0.23994	4.55E-4	0.0	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	T;T;T	0.55588	0.51;0.53;0.53	4.43	3.41	0.39046	.	0.213488	0.38959	N	0.001512	T	0.32526	0.0832	N	0.14661	0.345	0.19300	N	0.999972	B	0.13145	0.007	B	0.04013	0.001	T	0.13229	-1.0517	10	0.29301	T	0.29	.	11.3196	0.49412	0.193:0.807:0.0:0.0	.	29	O43294	TGFI1_HUMAN	V	29;12;12	ENSP00000378332:A29V;ENSP00000355117:A12V;ENSP00000378327:A12V	ENSP00000355117:A12V	A	+	2	0	TGFB1I1	31392335	0.001000	0.12720	0.955000	0.39395	0.165000	0.22458	1.293000	0.33353	2.289000	0.77006	0.484000	0.47621	GCG	0		0.642	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255630.3			
CDH16	1014	mdanderson.org	37	16	66949135	66949135	+	Missense_Mutation	SNP	G	G	T	rs2271024	byFrequency	TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:66949135G>T	ENST00000299752.4	-	6	764	c.571C>A	c.(571-573)Ctc>Atc	p.L191I	CDH16_ENST00000394055.3_Missense_Mutation_p.L191I|CDH16_ENST00000565796.1_Missense_Mutation_p.L191I|CDH16_ENST00000570262.1_Missense_Mutation_p.L111I|CDH16_ENST00000568632.1_Intron	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	191	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		L -> F (in dbSNP:rs2271024).		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TTGGGGCTGAGGGCCAGAGCC	0.617																																					p.L191I													.	.			0			c.C571A												30.0	35.0	33.0					16																	66949135		2199	4298	6497	SO:0001583	missense	1014	exon6			GGCTGAGGGCCAG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.571C>A	16.37:g.66949135G>T	ENSP00000299752:p.Leu191Ile		44	0	0		31	0.10	3	NM_004062	0		0	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373568	0.42105	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.53206	0.63;0.63	5.12	5.12	0.69794	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000009	T	0.64972	0.2647	M	0.62209	1.925	0.54753	D	0.999981	D;D	0.89917	0.999;1.0	D;D	0.91635	0.983;0.999	T	0.65228	-0.6219	10	0.48119	T	0.1	-16.4267	14.0719	0.64865	0.0:0.0:1.0:0.0	.	191;191	O75309-2;O75309	.;CAD16_HUMAN	I	191;191;155	ENSP00000377619:L191I;ENSP00000299752:L191I	ENSP00000299752:L191I	L	-	1	0	CDH16	65506636	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	3.834000	0.55798	2.382000	0.81193	0.563000	0.77884	CTC			0.617	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268839.2		NM_004062	
FBXO31	79791	mdanderson.org	37	16	87369022	87369022	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr16:87369022C>T	ENST00000311635.7	-	7	896	c.884G>A	c.(883-885)cGc>cAc	p.R295H	RP11-178L8.4_ENST00000568879.1_5'Flank	NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	295					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		GTCGTCGGGGCGGCTGGGCGG	0.657																																					p.R295H													FBXO31_ENST00000311635,NS,carcinoma,-1,2	FBXO31_ENST00000311635	-1	2	0			c.G884A												68.0	55.0	59.0					16																	87369022		2196	4300	6496	SO:0001583	missense	79791	exon7			TCGGGGCGGCTGG	BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.884G>A	16.37:g.87369022C>T	ENSP00000310841:p.Arg295His		112	0	0		43	0.07	3	NM_024735	63	0.00	0	Q5K680|Q8WYV1|Q96D73|Q9UFV4	Missense_Mutation	SNP	ENST00000311635.7	37	CCDS32501.1	.	.	.	.	.	.	.	.	.	.	c	0.011	-1.700041	0.00725	.	.	ENSG00000103264	ENST00000311635	.	.	.	5.07	-5.63	0.02474	.	1.400130	0.03938	N	0.286340	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.22906	-1.0203	9	0.18276	T	0.48	-13.7884	15.0251	0.71663	0.0:0.6498:0.0:0.3502	.	295;187	Q5XUX0;Q5XUX0-2	FBX31_HUMAN;.	H	295	.	ENSP00000310841:R295H	R	-	2	0	FBXO31	85926523	0.000000	0.05858	0.781000	0.31783	0.006000	0.05464	-1.503000	0.02277	-1.028000	0.03321	-1.049000	0.02347	CGC			0.657	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430799.2		NM_024735	
C17orf97	400566	bcgsc.ca	37	17	263726	263726	+	Silent	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr17:263726C>T	ENST00000360127.6	+	2	1108	c.1092C>T	c.(1090-1092)ggC>ggT	p.G364G	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	394	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCTCAAGGGCTTCCACACTG	0.672																																					p.G364G													.	C17orf97	76		0			c.C1092T												41.0	48.0	45.0					17																	263726		2203	4300	6503	SO:0001819	synonymous_variant	400566	exon2			CAAGGGCTTCCAC	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1092C>T	17.37:g.263726C>T			350	0.02	7		277	0.05	15	NM_001013672	43	0.02	1	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000360127.6	37	CCDS32519.2																																																																																					0.672	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255648.4		NM_001013672	
KIAA0100	9703	mdanderson.org	37	17	26941125	26941125	+	IGR	SNP	G	G	T	rs143987420		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr17:26941125G>T	ENST00000528896.2	-	0	7407				SGK494_ENST00000469832.3_5'UTR|SGK494_ENST00000301037.5_Silent_p.R19R|SPAG5-AS1_ENST00000554154.1_RNA|KIAA0100_ENST00000579924.2_5'Flank|SPAG5-AS1_ENST00000414744.1_RNA|SPAG5-AS1_ENST00000424210.1_RNA|RP11-192H23.4_ENST00000577790.1_Silent_p.R19R|RP11-192H23.4_ENST00000534850.1_Silent_p.R19R	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ACAGCCACCCGGGTGTGTTCC	0.612																																					p.R19R													.	.			0			c.C55A												67.0	62.0	64.0					17																	26941125		2203	4300	6503	SO:0001628	intergenic_variant	0	exon1			CCACCCGGGTGTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26941125G>T			48	0	0		33	0.09	3	NM_001174103	41	0.00	0	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	37	CCDS32595.1																																																																																					0.612	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390571.3		NM_014680	
TTYH2	94015	mdanderson.org	37	17	72218737	72218737	+	Silent	SNP	C	C	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr17:72218737C>A	ENST00000269346.4	+	2	317	c.243C>A	c.(241-243)acC>acA	p.T81T	TTYH2_ENST00000529107.1_Silent_p.T60T	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	81						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CGGTGCAGACCAAGCAGCACC	0.657																																					p.T81T													.	.			0			c.C243A												87.0	70.0	75.0					17																	72218737		2203	4300	6503	SO:0001819	synonymous_variant	94015	exon2			GCAGACCAAGCAG		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.243C>A	17.37:g.72218737C>A			48	0	0		37	0.08	3	NM_032646	16	0.00	0	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	ENST00000269346.4	37	CCDS32717.1																																																																																					0.657	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000387459.1			
KCTD2	23510	mdanderson.org	37	17	73043556	73043556	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr17:73043556G>A	ENST00000322444.6	+	1	217	c.211G>A	c.(211-213)Gcc>Acc	p.A71T	ATP5H_ENST00000344546.4_5'Flank|ATP5H_ENST00000301587.4_5'Flank|KCTD2_ENST00000584767.1_Intron|KCTD2_ENST00000581589.1_Intron	NM_015353.1	NP_056168.1	Q14681	KCTD2_HUMAN	potassium channel tetramerization domain containing 2	71					protein homooligomerization (GO:0051260)		protein complex binding (GO:0032403)			kidney(1)|lung(2)	3	all_lung(278;0.226)					cggcggcgcggcccgcTGGGT	0.751																																					p.A71T													.	.			0			c.G211A												12.0	14.0	13.0					17																	73043556		2200	4294	6494	SO:0001583	missense	23510	exon1			GGCGCGGCCCGCT	BC033329	CCDS32728.1	17q25.2	2013-06-20	2013-06-20			ENSG00000180901			21294	protein-coding gene	gene with protein product		613422	"""potassium channel tetramerisation domain containing 2"""			12620391	Standard	XR_248405		Approved	KIAA0176	uc002jmp.3	Q14681		ENST00000322444.6:c.211G>A	17.37:g.73043556G>A	ENSP00000312814:p.Ala71Thr		25	0	0		22	0.14	3	NM_015353	18	0.00	0		Missense_Mutation	SNP	ENST00000322444.6	37	CCDS32728.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773212	0.69992	.	.	ENSG00000180901	ENST00000322444;ENST00000375286	T	0.49720	0.77	3.48	2.46	0.29980	BTB/POZ fold (1);	0.652028	0.14765	N	0.299749	T	0.28001	0.0690	N	0.14661	0.345	0.33149	D	0.545368	B	0.18461	0.028	B	0.10450	0.005	T	0.28586	-1.0039	10	0.27785	T	0.31	.	9.0873	0.36590	0.0:0.2276:0.7724:0.0	.	71	Q14681	KCTD2_HUMAN	T	71;53	ENSP00000312814:A71T	ENSP00000312814:A71T	A	+	1	0	KCTD2	70555151	1.000000	0.71417	0.987000	0.45799	0.923000	0.55619	5.181000	0.65054	0.706000	0.31912	0.442000	0.29010	GCC			0.751	KCTD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445538.1			
PLIN3	10226	broad.mit.edu	37	19	4839419	4839419	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:4839419G>T	ENST00000221957.4	-	8	1266	c.1090C>A	c.(1090-1092)Cgc>Agc	p.R364S	PLIN3_ENST00000585479.1_Missense_Mutation_p.R363S|CTC-518P12.6_ENST00000591657.1_RNA|PLIN3_ENST00000592528.1_Missense_Mutation_p.R352S	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	364					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TCCACCTGGCGGCGGGCCTGC	0.657																																					p.R364S													.	PLIN3	36		0			c.C1090A												39.0	33.0	35.0					19																	4839419		2203	4300	6503	SO:0001583	missense	10226	exon8			CCTGGCGGCGGGC	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.1090C>A	19.37:g.4839419G>T	ENSP00000221957:p.Arg364Ser		125	0	0		113	0.04	4	NM_005817	193	0.00	0	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	G	0.119	-1.128638	0.01756	.	.	ENSG00000105355	ENST00000221957	T	0.05925	3.37	4.96	-0.578	0.11724	.	1.939470	0.02303	N	0.071390	T	0.04588	0.0125	N	0.17723	0.515	0.09310	N	1	B;B;B	0.12630	0.005;0.006;0.006	B;B;B	0.11329	0.003;0.004;0.006	T	0.39272	-0.9622	10	0.09084	T	0.74	-29.4679	7.4754	0.27374	0.1457:0.0:0.5988:0.2555	.	363;181;364	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	S	364	ENSP00000221957:R364S	ENSP00000221957:R364S	R	-	1	0	PLIN3	4790419	0.001000	0.12720	0.008000	0.14137	0.029000	0.11900	0.796000	0.26986	0.116000	0.18110	0.555000	0.69702	CGC			0.657	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000450436.1		NM_005817	
ZNF763	284390	mdanderson.org	37	19	12089265	12089265	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:12089265G>T	ENST00000358987.3	+	4	653	c.526G>T	c.(526-528)Gaa>Taa	p.E176*	ZNF763_ENST00000343949.5_Nonsense_Mutation_p.E179*|ZNF763_ENST00000538752.1_Nonsense_Mutation_p.E196*|ZNF763_ENST00000590798.1_Nonsense_Mutation_p.E196*|ZNF763_ENST00000545530.1_Nonsense_Mutation_p.E54*			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E178K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						TGCTTGTAAAGAATGTGGAAA	0.418																																					p.E179X													ZNF763,NS,carcinoma,0,2	ZNF763	0	2	1	Substitution - Missense(1)	kidney(1)	c.G535T												107.0	112.0	111.0					19																	12089265		2201	4300	6501	SO:0001587	stop_gained	284390	exon4			TGTAAAGAATGTG	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.526G>T	19.37:g.12089265G>T	ENSP00000402017:p.Glu176*		122	0	0		100	0.05	5	NM_001012753	4	0.00	0	B3KRU3|B4DRE7	Nonsense_Mutation	SNP	ENST00000358987.3	37		.	.	.	.	.	.	.	.	.	.	g	13.91	2.378993	0.42207	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	.	.	.	1.16	-2.32	0.06745	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	4.0701	0.09879	0.208:0.2387:0.5533:0.0	.	.	.	.	X	196;179;54;176	.	ENSP00000369774:E179X	E	+	1	0	ZNF763	11950265	0.000000	0.05858	0.014000	0.15608	0.110000	0.19582	-0.034000	0.12225	-0.340000	0.08388	0.195000	0.17529	GAA			0.418	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000344158.1		NM_001012753	
FCGBP	8857	mdanderson.org	37	19	40421328	40421328	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:40421328G>T	ENST00000221347.6	-	5	2600	c.2593C>A	c.(2593-2595)Cag>Aag	p.Q865K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	865	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCGGACCCCTGGCAGGTCCCG	0.682																																					p.Q865K													.	.			0			c.C2593A												20.0	21.0	21.0					19																	40421328		2199	4298	6497	SO:0001583	missense	8857	exon5			ACCCCTGGCAGGT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2593C>A	19.37:g.40421328G>T	ENSP00000221347:p.Gln865Lys		77	0	0		53	0.06	3	NM_003890	4	0.00	0	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	9.703	1.154979	0.21371	.	.	ENSG00000090920	ENST00000221347	T	0.58060	0.36	4.59	0.808	0.18719	von Willebrand factor, type D domain (3);	0.536258	0.16871	N	0.196126	T	0.36552	0.0971	N	0.25890	0.77	0.24688	N	0.993323	P	0.37500	0.597	B	0.42882	0.401	T	0.13926	-1.0491	10	0.33141	T	0.24	.	3.1664	0.06538	0.0873:0.1454:0.32:0.4473	.	865	Q9Y6R7	FCGBP_HUMAN	K	865	ENSP00000221347:Q865K	ENSP00000221347:Q865K	Q	-	1	0	FCGBP	45113168	0.000000	0.05858	0.998000	0.56505	0.406000	0.30931	-1.121000	0.03270	0.454000	0.26884	0.491000	0.48974	CAG			0.682	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462507.1		NM_003890	
CEACAM5	1048	mdanderson.org	37	19	42212685	42212685	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:42212685G>A	ENST00000221992.6	+	1	149	c.35G>A	c.(34-36)tGc>tAc	p.C12Y	CEACAM7_ENST00000599715.1_5'Flank|CEACAM5_ENST00000398599.4_Missense_Mutation_p.C12Y|CEA_ENST00000598976.1_Missense_Mutation_p.C12Y|CEACAM5_ENST00000405816.1_Missense_Mutation_p.C12Y	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	12					homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CACAGATGGTGCATCCCCTGG	0.607																																					p.C12Y													.	.			0			c.G35A												46.0	38.0	41.0					19																	42212685		2203	4300	6503	SO:0001583	missense	1048	exon1			GATGGTGCATCCC	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.35G>A	19.37:g.42212685G>A	ENSP00000221992:p.Cys12Tyr		66	0	0		37	0.08	3	NM_004363	0		0	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	-	10.34	1.323500	0.24080	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.38077	1.16;1.16	3.01	0.767	0.18482	.	.	.	.	.	T	0.49525	0.1562	M	0.84511	2.7	0.09310	N	1	P;P;P	0.48230	0.588;0.907;0.907	B;P;P	0.53490	0.356;0.727;0.636	T	0.36383	-0.9750	9	0.45353	T	0.12	.	4.7958	0.13272	0.3283:0.0:0.6717:0.0	.	12;12;12	Q8N4D0;P06731;Q53G30	.;CEAM5_HUMAN;.	Y	12	ENSP00000221992:C12Y;ENSP00000385072:C12Y	ENSP00000221992:C12Y	C	+	2	0	CEACAM5	46904525	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-2.202000	0.01235	0.127000	0.18452	0.313000	0.20887	TGC			0.607	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000321132.2		NM_004363	
ZNF649	65251	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52394804	52394804	+	Silent	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:52394804C>T	ENST00000354957.3	-	5	869	c.585G>A	c.(583-585)gaG>gaA	p.E195E	ZNF649_ENST00000600738.1_Silent_p.E195E|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TTCTCTTATGCTCAGTGAGCT	0.448																																					p.E195E													.	ZNF649	72		0			c.G585A												161.0	151.0	155.0					19																	52394804		2203	4300	6503	SO:0001819	synonymous_variant	65251	exon5			CTTATGCTCAGTG	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.585G>A	19.37:g.52394804C>T			234	0.0042735043	1		167	0.23	38	NM_023074	90	0.38	34	A8MYJ5|B2RDC4|Q9H9N2	Silent	SNP	ENST00000354957.3	37	CCDS12843.1																																																																																					0.448	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461097.1		NM_023074	
ZNF836	162962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52658148	52658148	+	Missense_Mutation	SNP	G	G	C			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:52658148G>C	ENST00000322146.8	-	5	3309	c.2788C>G	c.(2788-2790)Ctc>Gtc	p.L930V	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Missense_Mutation_p.L930V	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	930					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GAAGTTAGGAGAACATCTAAA	0.343																																					p.L930V													.	.			0			c.C2788G												42.0	41.0	41.0					19																	52658148		1991	4179	6170	SO:0001583	missense	162962	exon5			TTAGGAGAACATC	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2788C>G	19.37:g.52658148G>C	ENSP00000325038:p.Leu930Val		112	0	0		94	0.23	22	NM_001102657	25	0.56	14		Missense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.415233	0.01136	.	.	ENSG00000196267	ENST00000322146	T	0.05447	3.44	1.02	-2.03	0.07365	.	.	.	.	.	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47433	-0.9118	9	0.17832	T	0.49	.	3.669	0.08266	0.0:0.4385:0.2249:0.3366	.	930	Q6ZNA1	ZN836_HUMAN	V	930	ENSP00000325038:L930V	ENSP00000325038:L930V	L	-	1	0	ZNF836	57349960	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.904000	0.01593	-0.539000	0.06273	-1.081000	0.02215	CTC			0.343	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462456.1		NM_001102657	
ZNF776	284309	mdanderson.org	37	19	58265468	58265468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr19:58265468G>T	ENST00000317178.5	+	3	1233	c.970G>T	c.(970-972)Gaa>Taa	p.E324*	ZNF776_ENST00000489376.1_3'UTR	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TGAATGTGACGAATGTGGGAA	0.433																																					p.E324X													.	.			0			c.G970T												92.0	86.0	88.0					19																	58265468		2203	4300	6503	SO:0001587	stop_gained	284309	exon3			TGTGACGAATGTG	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.970G>T	19.37:g.58265468G>T	ENSP00000321812:p.Glu324*		81	0	0		52	0.06	3	NM_173632	42	0.00	0	Q6ZS36|Q8N968	Nonsense_Mutation	SNP	ENST00000317178.5	37	CCDS12962.2	.	.	.	.	.	.	.	.	.	.	G	38	6.787281	0.97837	.	.	ENSG00000152443	ENST00000317178	.	.	.	1.86	0.513	0.17000	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	8.5114	0.33220	0.0:0.3994:0.6006:0.0	.	.	.	.	X	324	.	ENSP00000321812:E324X	E	+	1	0	ZNF776	62957280	0.000000	0.05858	0.236000	0.24074	0.730000	0.41778	-0.685000	0.05167	1.027000	0.39758	0.313000	0.20887	GAA			0.433	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346722.2		NM_173632	
OTOF	9381	mdanderson.org	37	2	26690000	26690000	+	Silent	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr2:26690000G>T	ENST00000272371.2	-	35	4455	c.4329C>A	c.(4327-4329)tcC>tcA	p.S1443S	OTOF_ENST00000339598.3_Silent_p.S676S|OTOF_ENST00000402415.3_Silent_p.S753S|OTOF_ENST00000403946.3_Silent_p.S1443S|OTOF_ENST00000338581.6_Silent_p.S676S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1443					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCTCGGTGGAGCCATCCT	0.612																																					p.S1443S	GBM(102;732 1451 20652 24062 31372)												.	.			0			c.C4329A												62.0	56.0	58.0					2																	26690000		2203	4300	6503	SO:0001819	synonymous_variant	9381	exon35			CTCGGTGGAGCCA	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4329C>A	2.37:g.26690000G>T			30	0.0333333333	1		35	0.09	3	NM_194248	4	0.00	0	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	ENST00000272371.2	37	CCDS1725.1																																																																																					0.612	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000214047.3			
COL5A2	1290	mdanderson.org	37	2	189927992	189927992	+	Missense_Mutation	SNP	G	G	A	rs145169816	byFrequency	TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr2:189927992G>A	ENST00000374866.3	-	27	2049	c.1775C>T	c.(1774-1776)gCg>gTg	p.A592V		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	592					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TTCCCCTGGCGCACCCTATAG	0.507																																					p.A592V													COL5A2,NS,carcinoma,+1,2	COL5A2	1	2	0			c.C1775T												48.0	54.0	52.0					2																	189927992		2203	4300	6503	SO:0001583	missense	1290	exon27			CCTGGCGCACCCT	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1775C>T	2.37:g.189927992G>A	ENSP00000364000:p.Ala592Val		32	0	0		38	0.08	3	NM_000393	14	0.00	0	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911301	0.72983	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.94457	-3.43	4.82	4.82	0.62117	.	0.147776	0.31071	N	0.008302	D	0.94331	0.8178	L	0.31476	0.935	0.58432	D	0.999997	P;D	0.76494	0.905;0.999	B;D	0.63488	0.304;0.915	D	0.93493	0.6837	9	.	.	.	.	15.4437	0.75213	0.0:0.1388:0.8612:0.0	.	232;592	Q5PR22;P05997	.;CO5A2_HUMAN	V	592;232	ENSP00000364000:A592V	.	A	-	2	0	COL5A2	189636237	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	5.274000	0.65569	2.377000	0.81083	0.460000	0.39030	GCG			0.507	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313523.1		NM_000393	
CPXM1	56265	mdanderson.org	37	20	2781176	2781176	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr20:2781176C>T	ENST00000380605.2	-	1	107	c.43G>A	c.(43-45)Gtc>Atc	p.V15I		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	15					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GCCGGGCCGACGGCCGGCGCG	0.766																																					p.V15I													.	.			0			c.G43A												1.0	2.0	2.0					20																	2781176		1050	2425	3475	SO:0001583	missense	56265	exon1			GGCCGACGGCCGG	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.43G>A	20.37:g.2781176C>T	ENSP00000369979:p.Val15Ile		14	0	0		10	0.20	2	NM_001184699	9	0.00	0	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934618	0.34189	.	.	ENSG00000088882	ENST00000380605	D	0.95724	-3.79	4.45	3.44	0.39384	.	0.263174	0.20039	N	0.100559	D	0.89114	0.6623	N	0.24115	0.695	0.09310	N	1	B;B	0.24368	0.102;0.102	B;B	0.15052	0.012;0.012	T	0.79584	-0.1743	10	0.34782	T	0.22	-7.4882	8.7072	0.34363	0.2444:0.7556:0.0:0.0	.	15;15	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	I	15	ENSP00000369979:V15I	ENSP00000369979:V15I	V	-	1	0	CPXM1	2729176	0.014000	0.17966	0.230000	0.23976	0.205000	0.24178	-0.016000	0.12613	2.305000	0.77605	0.491000	0.48974	GTC			0.766	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077643.2		NM_019609	
EFCAB8	388795	bcgsc.ca	37	20	31547966	31547966	+	IGR	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr20:31547966A>G								EFCAB8 (39941 upstream) : SUN5 (23612 downstream)																							ATGAAGCATCAGGTAAGGTGG	0.602																																					.													.	.			0			.												33.0	37.0	36.0					20																	31547966		692	1591	2283	SO:0001628	intergenic_variant	388795	.			AGCATCAGGTAAG																													20.37:g.31547966A>G			208	0.0048076923	1		176	0.03	6	.	0		0		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	A	9.922	1.212506	0.22289	.	.	ENSG00000215529	ENST00000457731	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	T	0.59636	0.2208	.	.	.	0.21967	N	0.999442	.	.	.	.	.	.	T	0.72218	-0.4357	4	0.87932	D	0	.	9.5526	0.39319	1.0:0.0:0.0:0.0	.	.	.	.	R	79	.	ENSP00000413387:Q79R	Q	+	2	0	EFCAB8	31011627	1.000000	0.71417	0.996000	0.52242	0.158000	0.22134	3.487000	0.53222	2.025000	0.59659	0.459000	0.35465	CAG		0	0.602										
KCNS1	3787	mdanderson.org	37	20	43726516	43726516	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr20:43726516G>T	ENST00000306117.1	-	4	1293	c.897C>A	c.(895-897)aaC>aaA	p.N299K	KCNS1_ENST00000537075.1_Missense_Mutation_p.N299K	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	299					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				GGCAGAAGAAGTTGCGCGTAC	0.642																																					p.N299K													.	.			0			c.C897A												62.0	50.0	54.0					20																	43726516		2202	4300	6502	SO:0001583	missense	3787	exon4			GAAGAAGTTGCGC	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.897C>A	20.37:g.43726516G>T	ENSP00000307694:p.Asn299Lys		53	0	0		39	0.08	3	NM_002251	19	0.00	0	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	37	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	G	2.742	-0.262024	0.05791	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.97209	-4.29;-4.29	5.11	2.88	0.33553	Ion transport (1);	0.300020	0.39687	N	0.001290	T	0.80681	0.4669	N	0.00101	-2.135	0.40235	D	0.977899	B	0.09022	0.002	B	0.14023	0.01	T	0.81446	-0.0929	10	0.02654	T	1	.	9.1084	0.36712	0.0:0.3398:0.5409:0.1193	.	299	Q96KK3	KCNS1_HUMAN	K	299	ENSP00000307694:N299K;ENSP00000445595:N299K	ENSP00000307694:N299K	N	-	3	2	KCNS1	43159930	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.166000	0.31834	2.383000	0.81215	0.561000	0.74099	AAC			0.642	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080507.3		NM_002251	
NCOA5	57727	mdanderson.org	37	20	44690957	44690957	+	Silent	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr20:44690957A>G	ENST00000290231.6	-	8	1886	c.1722T>C	c.(1720-1722)tcT>tcC	p.S574S		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	574	Transcription activation.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				GCCTCTGGTAAGATCCCATGG	0.552																																					p.S574S													.	.			0			c.T1722C												42.0	39.0	40.0					20																	44690957		2203	4300	6503	SO:0001819	synonymous_variant	57727	exon8			CTGGTAAGATCCC		CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.1722T>C	20.37:g.44690957A>G			63	0	0		51	0.06	3	NM_020967	120	0.00	0	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Silent	SNP	ENST00000290231.6	37	CCDS13392.1																																																																																					0.552	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079559.1		NM_020967	
ADARB1	104	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	46604964	46604964	+	Missense_Mutation	SNP	G	G	C			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr21:46604964G>C	ENST00000360697.3	+	7	1658	c.1643G>C	c.(1642-1644)gGg>gCg	p.G548A	ADARB1_ENST00000389863.4_Missense_Mutation_p.G548A|ADARB1_ENST00000348831.4_Missense_Mutation_p.G508A|ADARB1_ENST00000539173.1_Missense_Mutation_p.G548A|ADARB1_ENST00000437626.1_3'UTR			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	548	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		GTGCTGCAAGGGGAGCGGCTG	0.587																																					p.G548A													.	ADARB1	81		0			c.G1643C												123.0	115.0	118.0					21																	46604964		2203	4300	6503	SO:0001583	missense	104	exon9			TGCAAGGGGAGCG	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.1643G>C	21.37:g.46604964G>C	ENSP00000353920:p.Gly548Ala		77	0	0		101	0.05	5	NM_015834	7	0.00	0	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113542	0.94339	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	5.42	5.42	0.78866	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.96513	0.8862	M	0.78344	2.41	0.80722	D	1	P;B;B;D	0.59767	0.624;0.309;0.409;0.986	P;B;B;P	0.58130	0.512;0.342;0.292;0.833	D	0.96747	0.9551	10	0.72032	D	0.01	-40.7817	17.0803	0.86597	0.0:0.0:1.0:0.0	.	548;508;536;548	P78563;Q4AE77;G5E9B4;P78563-3	RED1_HUMAN;.;.;.	A	548;548;548;508;548	ENSP00000441897:G548A;ENSP00000374513:G548A;ENSP00000015877:G508A;ENSP00000353920:G548A	ENSP00000015877:G508A	G	+	2	0	ADARB1	45429392	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	9.404000	0.97306	2.712000	0.92718	0.563000	0.77884	GGG			0.587	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000206648.2		NM_015833	
CSF2RB	1439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37326718	37326718	+	Silent	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr22:37326718G>A	ENST00000403662.3	+	8	1080	c.858G>A	c.(856-858)gaG>gaA	p.E286E	CSF2RB_ENST00000406230.1_Silent_p.E292E|CSF2RB_ENST00000536485.1_Silent_p.E233E|CSF2RB_ENST00000262825.5_Silent_p.E292E			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	286					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	TCCTCAGGGAGGAAGAGTGCT	0.682																																					p.E286E													.	.			0			c.G858A												34.0	33.0	33.0					22																	37326718		2203	4300	6503	SO:0001819	synonymous_variant	1439	exon8			CAGGGAGGAAGAG	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.858G>A	22.37:g.37326718G>A			67	0	0		45	0.47	21	NM_000395	2	0.50	1	Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	37	CCDS13936.1																																																																																					0.682	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318854.1		NM_000395	
EP300	2033	broad.mit.edu	37	22	41531831	41531831	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr22:41531831G>T	ENST00000263253.7	+	7	2762	c.1543G>T	c.(1543-1545)Gga>Tga	p.G515*		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	515					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.G515*(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TAGTCCTATGGGAGTAAATGG	0.348			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.G515X				Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	EP300,NS,carcinoma,0,1	EP300	367	1	1	Substitution - Nonsense(1)	endometrium(1)	c.G1543T												134.0	130.0	131.0					22																	41531831		2203	4300	6503	SO:0001587	stop_gained	2033	exon7	Familial Cancer Database	Broad Thumb-Hallux syndrome	CCTATGGGAGTAA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1543G>T	22.37:g.41531831G>T	ENSP00000263253:p.Gly515*		263	0	0		249	0.02	4	NM_001429	77	0.00	0	B1AKC2	Nonsense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	G	50	16.203231	0.99857	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.98	5.98	0.97165	.	0.000000	0.47455	D	0.000225	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-6.7031	20.4581	0.99154	0.0:0.0:1.0:0.0	.	.	.	.	X	515	.	ENSP00000263253:G515X	G	+	1	0	EP300	39861777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.270000	0.95690	2.835000	0.97688	0.650000	0.86243	GGA			0.348	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320600.1		NM_001429	
CSDC2	27254	broad.mit.edu	37	22	41968126	41968126	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr22:41968126C>T	ENST00000306149.7	+	2	701	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_014460.3	NP_055275.1	Q9Y534	CSDC2_HUMAN	cold shock domain containing C2, RNA binding	53					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			prostate(2)|upper_aerodigestive_tract(1)	3						GCCCACCAAGCGGACCAGGAC	0.657																																					p.R53W	NSCLC(181;294 2110 12667 14717 31090)												.	CSDC2	15		0			c.C157T												43.0	35.0	38.0					22																	41968126		2201	4298	6499	SO:0001583	missense	27254	exon2			ACCAAGCGGACCA	AL834417	CCDS14019.1	22q13.2	2006-02-24			ENSG00000172346	ENSG00000172346			30359	protein-coding gene	gene with protein product						8573167, 12767259	Standard	NM_014460		Approved	PIPPin	uc003bak.1	Q9Y534	OTTHUMG00000150967	ENST00000306149.7:c.157C>T	22.37:g.41968126C>T	ENSP00000302485:p.Arg53Trp		252	0	0		232	0.02	5	NM_014460	1	0.00	0	Q8ND37	Missense_Mutation	SNP	ENST00000306149.7	37	CCDS14019.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747093	0.69418	.	.	ENSG00000172346	ENST00000306149;ENST00000460790	.	.	.	4.89	2.63	0.31362	.	0.055938	0.64402	D	0.000002	T	0.75939	0.3918	M	0.76170	2.325	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.78170	-0.2308	9	0.87932	D	0	.	11.2049	0.48762	0.6365:0.3635:0.0:0.0	.	53	Q9Y534	CSDC2_HUMAN	W	53;36	.	ENSP00000302485:R53W	R	+	1	2	CSDC2	40298072	0.987000	0.35691	0.985000	0.45067	0.982000	0.71751	2.191000	0.42640	1.031000	0.39867	0.549000	0.68633	CGG			0.657	CSDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320689.1		NM_014460	
TPRXL	348825	broad.mit.edu	37	3	14106026	14106037	+	In_Frame_Del	DEL	CCAGCAGTAGCT	CCAGCAGTAGCT	-	rs529316068	byFrequency	TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	CCAGCAGTAGCT	CCAGCAGTAGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr3:14106026_14106037delCCAGCAGTAGCT	ENST00000424053.1	+	3	897_908	c.350_361delCCAGCAGTAGCT	c.(349-363)cccagcagtagctcc>ccc	p.SSSS122del	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_In_Frame_Del_p.SSSS122del|TPRXL_ENST00000429201.1_In_Frame_Del_p.SSSS122del			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						agcagcagccccagcagtagctccagcagcag	0.66														316	0.063099	0.034	0.0778	5008	,	,		12072	0.002		0.1302	False		,,,				2504	0.0859				.													.	TPRXL	10		0			.																																									SO:0001651	inframe_deletion	0	.			GCAGCCCCAGCAG	AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.350_361delCCAGCAGTAGCT	3.37:g.14106026_14106037delCCAGCAGTAGCT	ENSP00000400448:p.Ser122_Ser125del		5	0	0		6	0.33	2	.	0		0	Q8NAM5	In_Frame_Del	DEL	ENST00000424053.1	37																																																																																						0.660	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000340436.1		NR_002223	
ADAMTS9	56999	mdanderson.org	37	3	64633628	64633628	+	Silent	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr3:64633628G>A	ENST00000498707.1	-	11	2040	c.1698C>T	c.(1696-1698)tgC>tgT	p.C566C	ADAMTS9_ENST00000295903.4_Silent_p.C538C	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	566	Disintegrin.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTCCAGGCTCGCACTCCGTCC	0.512																																					p.C566C													.	.			0			c.C1698T												127.0	115.0	119.0					3																	64633628		2203	4300	6503	SO:0001819	synonymous_variant	56999	exon11			AGGCTCGCACTCC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.1698C>T	3.37:g.64633628G>A			64	0	0		41	0.07	3	NM_182920	0		0	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1																																																																																					0.512	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351891.1			
LRIT3	345193	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	110788886	110788886	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr4:110788886G>T	ENST00000594814.1	+	3	679	c.679G>T	c.(679-681)Gat>Tat	p.D227Y	LRIT3_ENST00000409621.2_Missense_Mutation_p.D44Y|LRIT3_ENST00000379920.3_Missense_Mutation_p.D182Y|LRIT3_ENST00000327908.3_Missense_Mutation_p.D44Y	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	227	LRRCT.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		AGTGCTTCTGGATCCACTGAT	0.453																																					p.D227Y													.	.			0			c.G679T												144.0	121.0	129.0					4																	110788886		2203	4300	6503	SO:0001583	missense	345193	exon3			CTTCTGGATCCAC	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.679G>T	4.37:g.110788886G>T	ENSP00000469759:p.Asp227Tyr		157	0	0		82	0.07	6	NM_198506	0		0	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525143	0.85600	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.60040	0.22;0.66;0.22	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.79941	0.4533	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81437	-0.0933	10	0.87932	D	0	.	20.2228	0.98330	0.0:0.0:1.0:0.0	.	182;44	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	Y	44;182;44	ENSP00000328222:D44Y;ENSP00000369252:D182Y;ENSP00000386734:D44Y	ENSP00000328222:D44Y	D	+	1	0	LRIT3	111008335	1.000000	0.71417	0.827000	0.32855	0.760000	0.43138	9.476000	0.97823	2.789000	0.95967	0.655000	0.94253	GAT			0.453	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335270.2		NM_198506	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140208298	140208298	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr5:140208298C>T	ENST00000529310.1	+	1	736	c.622C>T	c.(622-624)Cac>Tac	p.H208Y	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.H208Y|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	208	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTCCTGCACACAACTTATT	0.458																																					p.H208Y													.	.			0			c.C622T												69.0	70.0	70.0					5																	140208298		2203	4300	6503	SO:0001583	missense	56142	exon1			CCTGCACACAACT	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.622C>T	5.37:g.140208298C>T	ENSP00000433378:p.His208Tyr		161	0	0		119	0.22	26	NM_018909	1	1.00	1	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	4.758	0.140900	0.09083	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.24723	1.84;1.84	3.7	3.7	0.42460	Cadherin (4);Cadherin-like (1);	0.212321	0.22770	U	0.055860	T	0.22627	0.0546	L	0.31752	0.955	0.09310	N	1	B;B;B	0.16802	0.019;0.013;0.007	B;B;B	0.25884	0.038;0.064;0.02	T	0.27502	-1.0072	10	0.56958	D	0.05	.	15.9817	0.80114	0.0:1.0:0.0:0.0	.	208;208;208	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	Y	208	ENSP00000433378:H208Y;ENSP00000434113:H208Y	ENSP00000434113:H208Y	H	+	1	0	PCDHA6	140188482	0.021000	0.18746	0.304000	0.25085	0.494000	0.33585	2.491000	0.45303	2.055000	0.61198	0.313000	0.20887	CAC			0.458	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372829.3		NM_018909	
PPP2R2B	5521	hgsc.bcm.edu	37	5	146017851	146017851	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr5:146017851G>T	ENST00000394413.3	-	6	1323	c.753C>A	c.(751-753)gaC>gaA	p.D251E	PPP2R2B_ENST00000453001.1_Missense_Mutation_p.D251E|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.D309E|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.D251E|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.D254E|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.D257E|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.D251E|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.D317E|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.D240E|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.D240E			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	251					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGCCCGCATGTCACACAGCC	0.597																																					p.D357E													.	.			0			c.C1071A												143.0	107.0	119.0					5																	146017851		2203	4300	6503	SO:0001583	missense	5521	exon7			CCGCATGTCACAC	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.753C>A	5.37:g.146017851G>T	ENSP00000377935:p.Asp251Glu		117	0	0		89	0.04	4	NM_181675	2	0.00	0	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000394413.3	37	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339561	0.81911	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.4	3.63	0.41609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67173	0.2865	M	0.88105	2.93	0.80722	D	1	P;P;P;P;P;P	0.45827	0.7;0.7;0.7;0.7;0.867;0.7	B;B;B;P;P;B	0.56563	0.431;0.431;0.431;0.568;0.801;0.431	T	0.71034	-0.4709	10	0.87932	D	0	-0.7207	10.9151	0.47131	0.2089:0.0:0.7911:0.0	.	309;257;240;317;254;251	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	E	251;240;317;251;251;251;240;254;257;309	ENSP00000377935:D251E;ENSP00000431320:D240E;ENSP00000377936:D317E;ENSP00000377933:D251E;ENSP00000349283:D251E;ENSP00000398779:D251E;ENSP00000377932:D240E;ENSP00000336591:D254E;ENSP00000421396:D257E;ENSP00000377931:D309E	ENSP00000336591:D254E	D	-	3	2	AC011357.1	145998044	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.455000	0.60075	0.667000	0.31107	0.650000	0.86243	GAC			0.597	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251893.2		NM_181678	
F12	2161	bcgsc.ca;mdanderson.org	37	5	176836088	176836088	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr5:176836088G>T	ENST00000253496.3	-	2	122	c.74C>A	c.(73-75)gCc>gAc	p.A25D		NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	25					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CTCCTTGGGGGCTTCCCAAGG	0.547									Hereditary Angioedema																												p.A25D													.	F12	35		0			c.C74A												86.0	82.0	83.0					5																	176836088		2106	4048	6154	SO:0001583	missense	2161	exon2	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	TTGGGGGCTTCCC	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.74C>A	5.37:g.176836088G>T	ENSP00000253496:p.Ala25Asp		110	0	0		65	0.08	5	NM_000505	0		0	P78339	Missense_Mutation	SNP	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	G	4.857	0.159298	0.09236	.	.	ENSG00000131187	ENST00000253496	D	0.89270	-2.49	4.09	-4.1	0.03940	.	1.478870	0.04373	N	0.359414	T	0.71558	0.3354	N	0.05230	-0.09	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57590	-0.7785	10	0.30854	T	0.27	.	1.0031	0.01481	0.1681:0.2476:0.207:0.3772	.	25	P00748	FA12_HUMAN	D	25	ENSP00000253496:A25D	ENSP00000253496:A25D	A	-	2	0	F12	176768694	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-2.287000	0.01151	-0.958000	0.03622	-0.150000	0.13652	GCC			0.547	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000373217.1			
ECI2	10455	broad.mit.edu	37	6	4133832	4133832	+	Missense_Mutation	SNP	T	T	C			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr6:4133832T>C	ENST00000380118.3	-	2	200	c.164A>G	c.(163-165)aAg>aGg	p.K55R	RP3-400B16.4_ENST00000527831.1_RNA|ECI2_ENST00000361538.2_Missense_Mutation_p.K25R|ECI2_ENST00000413766.2_5'UTR|RP3-400B16.1_ENST00000427049.2_lincRNA|ECI2_ENST00000380125.2_Missense_Mutation_p.K25R|ECI2_ENST00000465828.1_Missense_Mutation_p.K25R			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	55	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						TCCTGGATCCTTTTTCAAGAG	0.398																																					p.K55R													ECI2_ENST00000380118,NS,malignant_melanoma,0,2	ECI2	59	2	0			c.A164G												217.0	201.0	206.0					6																	4133832		2203	4300	6503	SO:0001583	missense	10455	exon2			GGATCCTTTTTCA	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.164A>G	6.37:g.4133832T>C	ENSP00000369461:p.Lys55Arg		176	0	0		110	0.03	3	NM_206836	182	0.00	0	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.191753	0.78902	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.98	5.98	0.97165	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	21.516500	0.00166	N	0.000000	T	0.31796	0.0808	M	0.78223	2.4	0.80722	D	1	B	0.20988	0.05	B	0.35899	0.213	T	0.34850	-0.9812	10	0.54805	T	0.06	.	14.4143	0.67139	0.0:0.0:0.0:1.0	.	55	O75521	ECI2_HUMAN	R	55;25;25;25;102	ENSP00000369461:K55R;ENSP00000369468:K25R;ENSP00000354737:K25R;ENSP00000420309:K25R;ENSP00000417459:K102R	ENSP00000354737:K25R	K	-	2	0	ECI2	4078831	0.659000	0.27411	0.999000	0.59377	0.997000	0.91878	3.003000	0.49505	2.289000	0.77006	0.533000	0.62120	AAG			0.398	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039716.4		NM_006117	
BTN2A2	10385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26385530	26385530	+	Missense_Mutation	SNP	C	C	A	rs555925050	byFrequency	TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr6:26385530C>A	ENST00000356709.4	+	3	493	c.382C>A	c.(382-384)Cgc>Agc	p.R128S	BTN2A2_ENST00000469230.1_Missense_Mutation_p.R128S|BTN2A2_ENST00000416795.2_Missense_Mutation_p.R128S|BTN2A2_ENST00000482536.1_Intron|BTN2A2_ENST00000432533.2_Missense_Mutation_p.R128S|BTN2A2_ENST00000352867.2_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	128	Ig-like V-type.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TGGGATCTACCGCTGTTACTT	0.517																																					p.R128S													BTN2A2_ENST00000432533,colon,carcinoma,-1,2	BTN2A2_ENST00000432533	-1	2	0			c.C382A												109.0	90.0	97.0					6																	26385530		2203	4300	6503	SO:0001583	missense	10385	exon3			ATCTACCGCTGTT	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.382C>A	6.37:g.26385530C>A	ENSP00000349143:p.Arg128Ser		128	0	0		117	0.19	22	NM_001197238	6	0.17	1	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	t	12.59	1.983391	0.35036	.	.	ENSG00000124508	ENST00000469230;ENST00000356709;ENST00000493275;ENST00000432533;ENST00000416795	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	3.75	0.899	0.19271	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.363710	0.04587	N	0.395975	T	0.36580	0.0972	L	0.33710	1.025	0.09310	N	1	P;P;P	0.42357	0.677;0.484;0.777	B;B;P	0.50378	0.308;0.311;0.639	T	0.22661	-1.0210	10	0.22109	T	0.4	.	3.2301	0.06745	0.184:0.4865:0.0:0.3296	.	128;128;128	B4DQ01;Q8WVV5-2;Q8WVV5	.;.;BT2A2_HUMAN	S	128	ENSP00000417472:R128S;ENSP00000349143:R128S;ENSP00000418857:R128S;ENSP00000394241:R128S;ENSP00000399308:R128S	ENSP00000349143:R128S	R	+	1	0	BTN2A2	26493509	0.000000	0.05858	0.823000	0.32752	0.782000	0.44232	-0.575000	0.05861	-0.156000	0.11079	-0.384000	0.06662	CGC			0.517	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040117.1			
PPP2R5D	5528	broad.mit.edu	37	6	42974822	42974822	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr6:42974822G>T	ENST00000485511.1	+	4	675	c.496G>T	c.(496-498)Gcc>Tcc	p.A166S	PPP2R5D_ENST00000394110.3_Missense_Mutation_p.A134S|PPP2R5D_ENST00000472118.1_Missense_Mutation_p.A158S|PPP2R5D_ENST00000461010.1_Missense_Mutation_p.A60S	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	166					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGTCACTGAGGCCATTTACCC	0.577																																					p.A166S	Melanoma(63;587 1613 29742 31770)												.	PPP2R5D	47		0			c.G496T												112.0	103.0	106.0					6																	42974822		2203	4300	6503	SO:0001583	missense	5528	exon4			ACTGAGGCCATTT	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.496G>T	6.37:g.42974822G>T	ENSP00000417963:p.Ala166Ser		137	0	0		91	0.04	4	NM_006245	100	0.00	0	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	ENST00000485511.1	37	CCDS4878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.98|12.98	2.099888|2.099888	0.37048|0.37048	.|.	.|.	ENSG00000112640|ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610;ENST00000461010|ENST00000470467	T;T;T;T|.	0.43688|.	0.94;0.96;0.95;0.95|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Armadillo-type fold (1);|.	0.247967|.	0.39909|.	N|.	0.001221|.	T|T	0.26448|0.26448	0.0646|0.0646	N|N	0.11560|0.11560	0.145|0.145	0.39569|0.39569	D|D	0.969254|0.969254	B;B;B;B|.	0.14805|.	0.001;0.011;0.008;0.011|.	B;B;B;B|.	0.21151|.	0.005;0.004;0.033;0.004|.	T|T	0.12863|0.12863	-1.0531|-1.0531	10|5	0.31617|.	T|.	0.26|.	-17.5793|-17.5793	14.5673|14.5673	0.68185|0.68185	0.0:0.1458:0.8542:0.0|0.0:0.1458:0.8542:0.0	.|.	60;166;166;134|.	Q14738-3;F5GYS1;Q14738;Q14738-2|.	.;.;2A5D_HUMAN;.|.	S|V	166;134;158;166;60|85	ENSP00000417963:A166S;ENSP00000377669:A134S;ENSP00000420550:A158S;ENSP00000420674:A60S|.	ENSP00000377669:A134S|.	A|G	+|+	1|2	0|0	PPP2R5D|PPP2R5D	43082800|43082800	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	1.819000|1.819000	0.39022|0.39022	2.713000|2.713000	0.92767|0.92767	0.655000|0.655000	0.94253|0.94253	GCC|GGC			0.577	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040573.3		NM_006245	
MTO1	25821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	74171583	74171583	+	Missense_Mutation	SNP	C	C	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr6:74171583C>G	ENST00000370300.4	+	1	96	c.6C>G	c.(4-6)ttC>ttG	p.F2L	MTO1_ENST00000415954.2_Missense_Mutation_p.F2L|MTO1_ENST00000370305.1_Intron|RNU6-975P_ENST00000384296.1_RNA|MTO1_ENST00000498286.1_Missense_Mutation_p.F2L	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	2					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						CCAGCATGTTCTACTTCCGAG	0.552																																					p.F2L													.	.			0			c.C6G												65.0	63.0	64.0					6																	74171583		2203	4300	6503	SO:0001583	missense	25821	exon1			CATGTTCTACTTC	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.6C>G	6.37:g.74171583C>G	ENSP00000359323:p.Phe2Leu		242	0	0		181	0.24	43	NM_133645	48	0.38	18	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	ENST00000370300.4	37	CCDS4979.1	.	.	.	.	.	.	.	.	.	.	C	9.560	1.118152	0.20877	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370300	.	.	.	4.79	0.918	0.19386	.	0.246149	0.31697	N	0.007218	T	0.05823	0.0152	N	0.12182	0.205	0.19575	N	0.999967	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.002;0.004;0.001	T	0.39143	-0.9628	9	0.28530	T	0.3	-7.9363	6.6301	0.22851	0.0:0.5813:0.0:0.4187	.	2;2;2	Q9Y2Z2-6;Q9Y2Z2-4;Q9Y2Z2	.;.;MTO1_HUMAN	L	2	.	ENSP00000350506:F2L	F	+	3	2	MTO1	74228304	0.050000	0.20438	0.155000	0.22561	0.126000	0.20510	-0.127000	0.10547	-0.021000	0.14009	0.555000	0.69702	TTC			0.552	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000041215.2		NM_012123	
AQP1	358	broad.mit.edu	37	7	30963100	30963100	+	Silent	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr7:30963100G>T	ENST00000311813.4	+	4	721	c.666G>T	c.(664-666)ctG>ctT	p.L222L	AQP1_ENST00000434909.2_Silent_p.L282L|AQP1_ENST00000409899.1_Silent_p.L107L|AQP1_ENST00000441328.2_Silent_p.L139L|AQP1_ENST00000509504.1_Silent_p.L399L|AQP1_ENST00000482461.1_3'UTR|AQP1_ENST00000409611.1_Silent_p.L171L	NM_198098.2	NP_932766.1	P29972	AQP1_HUMAN	aquaporin 1 (Colton blood group)	222					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|camera-type eye morphogenesis (GO:0048593)|carbon dioxide transmembrane transport (GO:0035378)|carbon dioxide transport (GO:0015670)|cation transmembrane transport (GO:0098655)|cell volume homeostasis (GO:0006884)|cellular homeostasis (GO:0019725)|cellular hyperosmotic response (GO:0071474)|cellular response to cAMP (GO:0071320)|cellular response to copper ion (GO:0071280)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to inorganic substance (GO:0071241)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mercury ion (GO:0071288)|cellular response to nitric oxide (GO:0071732)|cellular response to retinoic acid (GO:0071300)|cellular response to salt stress (GO:0071472)|cellular response to stress (GO:0033554)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|cGMP biosynthetic process (GO:0006182)|corticotropin secretion (GO:0051458)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|glomerular filtration (GO:0003094)|glycerol transport (GO:0015793)|hyperosmotic salinity response (GO:0042538)|lateral ventricle development (GO:0021670)|lipid digestion (GO:0044241)|maintenance of symbiont-containing vacuole by host (GO:0085018)|metanephric descending thin limb development (GO:0072220)|metanephric glomerulus vasculature development (GO:0072239)|metanephric proximal convoluted tubule segment 2 development (GO:0072232)|metanephric proximal straight tubule development (GO:0072230)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|nitric oxide transport (GO:0030185)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|positive regulation of angiogenesis (GO:0045766)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of saliva secretion (GO:0046878)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|renal water absorption (GO:0070295)|renal water transport (GO:0003097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|secretory granule organization (GO:0033363)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)|transepithelial water transport (GO:0035377)|transmembrane transport (GO:0055085)|water transport (GO:0006833)|wound healing (GO:0042060)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|symbiont-containing vacuole (GO:0020003)	ammonium transmembrane transporter activity (GO:0008519)|carbon dioxide transmembrane transporter activity (GO:0035379)|glycerol transmembrane transporter activity (GO:0015168)|intracellular cGMP activated cation channel activity (GO:0005223)|nitric oxide transmembrane transporter activity (GO:0030184)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)|transmembrane transporter activity (GO:0022857)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(1)|large_intestine(2)|lung(9)	12		Melanoma(862;0.16)			Acetazolamide(DB00819)	GGGGAGCCCTGGCTGTACTCA	0.597																																					p.L222L													.	AQP1	38		0			c.G666T												53.0	47.0	49.0					7																	30963100		2203	4300	6503	SO:0001819	synonymous_variant	358	exon4			AGCCCTGGCTGTA	M77829	CCDS5431.1, CCDS55096.1, CCDS55097.1, CCDS55098.1	7p14	2014-07-19	2014-01-02		ENSG00000240583	ENSG00000240583		"""Ion channels / Aquaporins"", ""Blood group antigens"""	633	protein-coding gene	gene with protein product		107776	"""Colton blood group"", ""aquaporin 1 (channel-forming integral protein, 28kDa)"", ""aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group)"", ""aquaporin 1"""	CO		1722319, 3166547	Standard	NM_198098		Approved	CHIP28		P29972	OTTHUMG00000023944	ENST00000311813.4:c.666G>T	7.37:g.30963100G>T			154	0	0		213	0.02	4	NM_198098	94	0.00	0	B5BU39|E7EM69|E9PC21|F5GY19|Q8TBI5|Q8TDC1	Silent	SNP	ENST00000311813.4	37	CCDS5431.1																																																																																					0.597	AQP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215002.3		NM_000385	
DDC	1644	mdanderson.org	37	7	50544328	50544328	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr7:50544328G>T	ENST00000444124.2	-	11	1235	c.1035C>A	c.(1033-1035)gaC>gaA	p.D345E	DDC_ENST00000431062.1_Missense_Mutation_p.D252E|DDC_ENST00000357936.5_Missense_Mutation_p.D345E|DDC_ENST00000426377.1_Missense_Mutation_p.D267E	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	345					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	TTACCCGGTAGTCAGTGATAA	0.448																																					p.D345E													.	.			0			c.C1035A												68.0	64.0	65.0					7																	50544328		2203	4300	6503	SO:0001583	missense	1644	exon11			CCGGTAGTCAGTG		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.1035C>A	7.37:g.50544328G>T	ENSP00000403644:p.Asp345Glu		31	0	0		40	0.08	3	NM_001082971	0		0	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.03|14.03	2.412729|2.412729	0.42817|0.42817	.|.	.|.	ENSG00000132437|ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124|ENST00000430300	T;T;T;T|.	0.56275|.	0.47;0.47;0.47;0.47|.	5.4|5.4	3.57|3.57	0.40892|0.40892	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.882848|.	0.09961|.	N|.	0.733384|.	T|T	0.73969|0.73969	0.3655|0.3655	M|M	0.87971|0.87971	2.92|2.92	0.80722|0.80722	D|D	1|1	B;B|.	0.27679|.	0.185;0.185|.	B;B|.	0.19148|.	0.024;0.024|.	T|T	0.75286|0.75286	-0.3371|-0.3371	10|5	0.87932|.	D|.	0|.	-12.396|-12.396	6.6187|6.6187	0.22790|0.22790	0.2643:0.0:0.7357:0.0|0.2643:0.0:0.7357:0.0	.|.	345;345|.	Q53Y41;P20711|.	.;DDC_HUMAN|.	E|N	345;252;267;345|226	ENSP00000350616:D345E;ENSP00000399184:D252E;ENSP00000395069:D267E;ENSP00000403644:D345E|.	ENSP00000350616:D345E|.	D|T	-|-	3|2	2|0	DDC|DDC	50511822|50511822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.648000|0.648000	0.38561|0.38561	0.879000|0.879000	0.28146|0.28146	1.400000|1.400000	0.46741|0.46741	0.650000|0.650000	0.86243|0.86243	GAC|ACT			0.448	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342593.1			
SCARA5	286133	mdanderson.org	37	8	27779486	27779486	+	Missense_Mutation	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr8:27779486C>T	ENST00000354914.3	-	4	1003	c.518G>A	c.(517-519)cGc>cAc	p.R173H	SCARA5_ENST00000380385.2_Intron|SCARA5_ENST00000518030.1_Missense_Mutation_p.R130H|SCARA5_ENST00000301906.4_Missense_Mutation_p.R130H|SCARA5_ENST00000524352.1_Missense_Mutation_p.R173H	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	173					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CTGGCCCGTGCGGTCCCGCAG	0.741																																					p.R173H													.	.			0			c.G518A												4.0	5.0	5.0					8																	27779486		1860	3835	5695	SO:0001583	missense	286133	exon4			CCCGTGCGGTCCC	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.518G>A	8.37:g.27779486C>T	ENSP00000346990:p.Arg173His		22	0	0		17	0.18	3	NM_173833	0		0	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	8.985	0.976407	0.18736	.	.	ENSG00000168079	ENST00000354914;ENST00000524352;ENST00000518030;ENST00000301906	D;D;D;D	0.91011	-2.39;-2.77;-2.68;-2.68	4.56	1.72	0.24424	.	0.544743	0.19105	N	0.122612	T	0.82042	0.4951	L	0.38531	1.155	0.20489	N	0.999898	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.002;0.002;0.0	T	0.63033	-0.6727	10	0.13853	T	0.58	.	7.2781	0.26296	0.0:0.6346:0.0:0.3654	.	173;130;173	Q6ZMJ2-2;Q6ZMJ2-3;Q6ZMJ2	.;.;SCAR5_HUMAN	H	173;173;130;130	ENSP00000346990:R173H;ENSP00000428663:R173H;ENSP00000430713:R130H;ENSP00000301906:R130H	ENSP00000301906:R130H	R	-	2	0	SCARA5	27835405	0.462000	0.25791	0.869000	0.34112	0.885000	0.51271	0.315000	0.19451	0.052000	0.16007	0.462000	0.41574	CGC			0.741	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255223.2		NM_173833	
OTUD6B	51633	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	92096281	92096284	+	Frame_Shift_Del	DEL	CAGG	CAGG	-			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	CAGG	CAGG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr8:92096281_92096284delCAGG	ENST00000285420.4	+	6	925_928	c.826_829delCAGG	c.(826-831)caggcafs	p.QA276fs	OTUD6B_ENST00000404789.3_Frame_Shift_Del_p.QA145fs	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	246	His-loop. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.						cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AGAGATAATACAGGCAGATTCTCC	0.294																																					p.275_276del													.	OTUD6B	28		0			c.825_828del																																									SO:0001589	frameshift_variant	51633	exon6			ATAATACAGGCAG		CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.826_829delCAGG	8.37:g.92096281_92096284delCAGG	ENSP00000285420:p.Gln276fs		332	0	0		320	0.00	0	NM_016023	36	0.00	0	A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Frame_Shift_Del	DEL	ENST00000285420.4	37	CCDS6253.2																																																																																					0.294	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000319968.1		NM_016023	
RBM12B	389677	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	94746362	94746362	+	Silent	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr8:94746362G>T	ENST00000399300.2	-	3	2490	c.2277C>A	c.(2275-2277)ccC>ccA	p.P759P	RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Silent_p.P639P|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	759							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AGTGCTCTGGGGGTGGCCGCC	0.682																																					p.P759P													.	RBM12B	78		0			c.C2277A												31.0	37.0	35.0					8																	94746362		1795	4037	5832	SO:0001819	synonymous_variant	389677	exon3			CTCTGGGGGTGGC		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2277C>A	8.37:g.94746362G>T			93	0	0		76	0.07	5	NM_203390	67	0.00	0	A8MYB5	Silent	SNP	ENST00000399300.2	37	CCDS43755.1																																																																																					0.682	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383603.1		NM_203390	
COL14A1	7373	broad.mit.edu	37	8	121219207	121219207	+	Silent	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr8:121219207G>T	ENST00000297848.3	+	10	1335	c.1065G>T	c.(1063-1065)ccG>ccT	p.P355P	COL14A1_ENST00000247781.3_Silent_p.P260P|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Silent_p.P355P|COL14A1_ENST00000537875.1_Silent_p.P355P	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TCACTGGGCCGCCTACGGAGT	0.398																																					p.P355P													.	COL14A1	292		0			c.G1065T												60.0	56.0	58.0					8																	121219207		2203	4300	6503	SO:0001819	synonymous_variant	7373	exon10			TGGGCCGCCTACG		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1065G>T	8.37:g.121219207G>T			116	0	0		130	0.04	5	NM_021110	5	0.00	0		Silent	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	8.737	0.917998	0.17982	.	.	ENSG00000187955	ENST00000523142	.	.	.	5.64	-11.3	0.00108	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51466	-0.8702	4	.	.	.	.	6.2333	0.20747	0.1503:0.0749:0.5425:0.2323	.	.	.	.	S	112	.	.	A	+	1	0	COL14A1	121288388	0.454000	0.25728	0.648000	0.29521	0.937000	0.57800	-0.360000	0.07622	-2.431000	0.00556	-0.469000	0.05056	GCC			0.398	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313657.2		NM_021110	
PCSK5	5125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	78973480	78973480	+	Missense_Mutation	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr9:78973480A>G	ENST00000545128.1	+	37	5763	c.5225A>G	c.(5224-5226)aAg>aGg	p.K1742R		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1742					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GAGCATTTCAAGACAGCTCTG	0.517																																					p.K1742R													.	.			0			c.A5225G												93.0	83.0	86.0					9																	78973480		876	1991	2867	SO:0001583	missense	5125	exon37			ATTTCAAGACAGC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.5225A>G	9.37:g.78973480A>G	ENSP00000446280:p.Lys1742Arg		301	0	0		259	0.05	12	NM_001190482	4	0.00	0	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	A	9.015	0.983416	0.18889	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.49139	0.79;1.64	5.88	2.19	0.27852	.	0.396443	0.24583	N	0.037287	T	0.47710	0.1460	M	0.64997	1.995	0.36217	D	0.851722	.	.	.	.	.	.	T	0.46898	-0.9158	8	0.15066	T	0.55	-16.646	9.2279	0.37418	0.7885:0.0:0.2115:0.0	.	.	.	.	R	1742;1472;1442	ENSP00000446280:K1742R;ENSP00000411654:K1442R	ENSP00000365945:K1472R	K	+	2	0	PCSK5	78163300	0.999000	0.42202	0.856000	0.33681	0.152000	0.21847	1.842000	0.39250	0.131000	0.18576	0.454000	0.30748	AAG			0.517	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
CENPP	401541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95094481	95094481	+	Missense_Mutation	SNP	A	A	G			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr9:95094481A>G	ENST00000375587.3	+	2	652	c.137A>G	c.(136-138)aAt>aGt	p.N46S		NM_001012267.1	NP_001012267.1	Q6IPU0	CENPP_HUMAN	centromere protein P	46					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(1)	16						CACCAATTCAATTTGGAAGGA	0.323																																					p.N46S													.	.			0			c.A137G												66.0	64.0	64.0					9																	95094481		2203	4299	6502	SO:0001583	missense	401541	exon2			AATTCAATTTGGA	AK091247	CCDS35063.1, CCDS69618.1	9q22.31	2013-11-05			ENSG00000188312	ENSG00000188312			32933	protein-coding gene	gene with protein product		611505				16622419, 16622420	Standard	NM_001286969		Approved	RP11-19J3.3, CENP-P	uc004arz.3	Q6IPU0	OTTHUMG00000020228	ENST00000375587.3:c.137A>G	9.37:g.95094481A>G	ENSP00000364737:p.Asn46Ser		202	0	0		165	0.16	27	NM_001012267	23	0.35	8	B3KRA5|B3KS17|Q5T9F8|Q5T9F9	Missense_Mutation	SNP	ENST00000375587.3	37	CCDS35063.1	.	.	.	.	.	.	.	.	.	.	A	0.654	-0.808461	0.02819	.	.	ENSG00000188312	ENST00000375587	.	.	.	4.71	2.32	0.28847	.	0.933386	0.08937	N	0.872105	T	0.28400	0.0702	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24693	-1.0153	9	0.38643	T	0.18	-1.3979	7.0713	0.25179	0.7632:0.1499:0.0869:0.0	.	46	Q6IPU0	CENPP_HUMAN	S	46	.	ENSP00000364737:N46S	N	+	2	0	CENPP	94134302	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.343000	0.33930	0.049000	0.15920	-2.946000	0.00085	AAT			0.323	CENPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053098.1		NM_001012267	
CARD9	64170	mdanderson.org	37	9	139262098	139262098	+	Silent	SNP	C	C	T	rs142757984		TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr9:139262098C>T	ENST00000371732.5	-	8	1425	c.1260G>A	c.(1258-1260)acG>acA	p.T420T	CARD9_ENST00000371734.3_Silent_p.T420T|CARD9_ENST00000460290.1_5'Flank	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	420					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		CCAGGACGAGCGTCTCCAGCT	0.726																																					p.T420T													.	.			0			c.G1260A							C	,	0,4350		0,0,2175	20.0	20.0	20.0		1260,1260	-3.7	0.0	9	dbSNP_134	20	2,8576		0,2,4287	no	coding-synonymous,coding-synonymous	CARD9	NM_052813.4,NM_052814.3	,	0,2,6462	TT,TC,CC		0.0233,0.0,0.0155	,	420/537,420/493	139262098	2,12926	2175	4289	6464	SO:0001819	synonymous_variant	64170	exon8			GACGAGCGTCTCC	AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1260G>A	9.37:g.139262098C>T			17	0	0		30	0.10	3	NM_052813	1	0.00	0	Q5SXM5|Q5SXM6|Q9H854	Silent	SNP	ENST00000371732.5	37	CCDS6997.1																																																																																			0		0.726	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055053.1		NM_052813	
MT-ND5	4540	hgsc.bcm.edu	37	M	13928	13928	+	Missense_Mutation	SNP	G	G	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrM:13928G>A	ENST00000361567.2	+	1	1592	c.1592G>A	c.(1591-1593)aGc>aAc	p.S531N	MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	531					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATTCTACCCTAGCATCACACA	0.433																																					p.S531N													.	.			0			c.G1592A																																									SO:0001583	missense	0	exon1			ACCCTAGCATCAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1592G>A	M.37:g.13928G>A	ENSP00000354813:p.Ser531Asn		10	0	0		8	0.88	7	ENST00000361567	0		0	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																						0.433	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024036	
MAOA	4128	mdanderson.org	37	X	43603153	43603153	+	Splice_Site	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrX:43603153G>T	ENST00000338702.3	+	13	1497		c.e13+1		MAOA_ENST00000542639.1_Splice_Site	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A						cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	AGCTAGGGAGGTAAGCAGGAA	0.542																																					.													.	.			0			c.975+1G>T												78.0	51.0	60.0					X																	43603153		2164	4216	6380	SO:0001630	splice_region_variant	4128	exon14			AGGGAGGTAAGCA		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1374+1G>T	X.37:g.43603153G>T			65	0	0		35	0.09	3	NM_001270458	1	0.00	0	B4DF46|Q16426	Splice_Site	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	G	9.748	1.166761	0.21621	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	.	.	.	5.84	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8984	0.58111	0.0811:0.0:0.9189:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAOA	43488097	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	8.906000	0.92626	1.217000	0.43442	-0.192000	0.12808	.			0.542	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056300.1		NM_000240	Intron
FAM104B	90736	mdanderson.org	37	X	55172718	55172718	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrX:55172718G>T	ENST00000358460.4	-	3	300	c.147C>A	c.(145-147)agC>agA	p.S49R	FAM104B_ENST00000477847.2_Missense_Mutation_p.S46R|FAM104B_ENST00000489298.1_Missense_Mutation_p.S48R|FAM104B_ENST00000332132.4_Missense_Mutation_p.S50R|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000478918.1_5'UTR|FAM104B_ENST00000425133.2_Missense_Mutation_p.S50R			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	49										endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						TGCGGCTGCTGCTCCTTTCAT	0.423																																					p.S50R													.	.			0			c.C150A												103.0	87.0	92.0					X																	55172718		2203	4300	6503	SO:0001583	missense	90736	exon3			GCTGCTGCTCCTT	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.147C>A	X.37:g.55172718G>T	ENSP00000364101:p.Ser49Arg		28	0	0		39	0.08	3	NM_001166700	95	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	g	11.31	1.602193	0.28534	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41	1.6	0.709	0.18150	.	0.107284	0.40908	U	0.000999	T	0.52581	0.1743	L	0.46157	1.445	0.09310	N	1	D;P;P	0.56035	0.974;0.782;0.782	B;P;P	0.58391	0.361;0.838;0.504	T	0.42616	-0.9441	10	0.72032	D	0.01	-2.7265	3.5968	0.08009	0.2606:0.0:0.7394:0.0	.	50;49;50	Q5XKR9-3;Q5XKR9;Q5XKR9-2	.;F104B_HUMAN;.	R	49;50;50;46;48	ENSP00000364101:S49R;ENSP00000333394:S50R;ENSP00000397188:S50R;ENSP00000421161:S46R;ENSP00000423164:S48R	ENSP00000333394:S50R	S	-	3	2	FAM104B	55189443	0.993000	0.37304	0.023000	0.16930	0.170000	0.22686	0.403000	0.20982	0.162000	0.19483	0.436000	0.28706	AGC			0.423	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
GRPEL2P2	100129994	bcgsc.ca	37	X	63918044	63918044	+	IGR	SNP	C	C	A			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrX:63918044C>A								MTMR8 (302711 upstream) : ZC4H2 (218205 downstream)																							TCTGATTCTTCAGAAATGCAC	0.468																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100129994	.			ATTCTTCAGAAAT																													X.37:g.63918044C>A			23	0	0		20	0.20	4	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.468										
MPP1	4354	mdanderson.org	37	X	154020464	154020464	+	Silent	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrX:154020464G>T	ENST00000369534.3	-	2	346	c.199C>A	c.(199-201)Cgg>Agg	p.R67R	MPP1_ENST00000413259.3_Silent_p.R37R|MPP1_ENST00000462825.1_Intron|MPP1_ENST00000393531.1_Silent_p.R67R	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	67					nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGCACTTTCCGCACCTCCTGT	0.557																																					p.R67R													.	.			0			c.C199A												116.0	96.0	102.0					X																	154020464		2203	4300	6503	SO:0001819	synonymous_variant	4354	exon2			CTTTCCGCACCTC		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.199C>A	X.37:g.154020464G>T			82	0	0		98	0.05	5	NM_002436	19	0.00	0	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Silent	SNP	ENST00000369534.3	37	CCDS14762.1																																																																																					0.557	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061191.3		NM_002436	
Unknown	0	bcgsc.ca	37	Y	23005328	23005328	+	IGR	SNP	C	C	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chrY:23005328C>T								RPS4Y2 (62410 upstream) : RP11-65G9.1 (194846 downstream)																							GGGAGGTGTCCGCCTGAGGCC	0.607																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGTCCGCCTGA																													Y.37:g.23005328C>T			46	0	0		23	0.52	12	.	0		0		RNA	SNP		37																																																																																					0	0.607										
DNM1	1759	mdanderson.org	37	9	130965862	130965862	+	Missense_Mutation	SNP	G	G	T			TCGA-SB-A76C-01A-11D-A435-10	TCGA-SB-A76C-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	93ef8c47-511c-41fd-af49-9f0490f4eabf	bfa61308-ebae-4b8c-acd3-b5cc89318427	g.chr9:130965862G>T	ENST00000372923.3	+	1	205	c.113G>T	c.(112-114)gGc>gTc	p.G38V	DNM1_ENST00000393594.3_Missense_Mutation_p.G38V|CIZ1_ENST00000372948.3_Intron|DNM1_ENST00000475805.1_Missense_Mutation_p.G38V|DNM1_ENST00000486160.1_Missense_Mutation_p.G38V|DNM1_ENST00000341179.7_Missense_Mutation_p.G38V|CIZ1_ENST00000393608.1_Intron	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	38	Dynamin-type G.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GCTGTGGTGGGCGGCCAGAGC	0.692																																					.	GBM(113;146 1575 2722 28670 29921)												.	.			0			.												14.0	15.0	14.0					9																	130965862		2174	4257	6431	SO:0001583	missense	1759	.			TGGTGGGCGGCCA	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.113G>T	9.37:g.130965862G>T	ENSP00000362014:p.Gly38Val		31	0	0		29	0.10	3	.	8	0.00	0	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	G	33	5.258016	0.95368	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160	D;D;D;D;D	0.99931	-8.19;-8.19;-8.19;-8.19;-8.19	4.08	4.08	0.47627	Dynamin, GTPase domain (2);	0.192669	0.45126	D	0.000385	D	0.99945	0.9976	H	0.97874	4.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.991;0.991	D	0.95741	0.8783	10	0.87932	D	0	-7.7578	16.0685	0.80907	0.0:0.0:1.0:0.0	.	38;38;38	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	V	38;38;38;33;38;38	ENSP00000419225:G38V;ENSP00000345680:G38V;ENSP00000362014:G38V;ENSP00000377219:G38V;ENSP00000420045:G38V	ENSP00000345680:G38V	G	+	2	0	DNM1	130005683	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.424000	0.73366	2.116000	0.64780	0.561000	0.74099	GGC			0.692	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054367.1		NM_004408	
