#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
LRRC47	57470	mdanderson.org	37	1	3712537	3712537	+	Silent	SNP	A	A	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:3712537A>G	ENST00000378251.1	-	1	531	c.504T>C	c.(502-504)ttT>ttC	p.F168F		NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	168							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GCTCGGCGGGAAAGGAGTCTA	0.697																																					p.F168F													.	.			0			c.T504C												12.0	12.0	12.0					1																	3712537		2171	4253	6424	SO:0001819	synonymous_variant	57470	exon1			GGCGGGAAAGGAG	AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.504T>C	1.37:g.3712537A>G			42	0.0476190476	2		29	0.14	4	NM_020710	76	0.00	0	Q9ULN5	Silent	SNP	ENST00000378251.1	37	CCDS51.1																																																																																					0.697	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009744.1		NM_020710	
EPB41	2035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	29359661	29359661	+	Silent	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:29359661C>T	ENST00000343067.4	+	9	1396	c.1269C>T	c.(1267-1269)taC>taT	p.Y423Y	EPB41_ENST00000349460.4_Silent_p.Y214Y|EPB41_ENST00000373798.1_Silent_p.Y423Y|EPB41_ENST00000373797.1_Silent_p.Y423Y|EPB41_ENST00000373800.3_Silent_p.Y214Y|EPB41_ENST00000398863.2_Silent_p.Y423Y|EPB41_ENST00000356093.2_Silent_p.Y423Y|EPB41_ENST00000347529.3_Silent_p.Y388Y	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	423	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		TTCTGGTTTACAAAGATAAGC	0.418																																					p.Y423Y													.	.			0			c.C1269T												115.0	113.0	114.0					1																	29359661		2203	4300	6503	SO:0001819	synonymous_variant	2035	exon9			GGTTTACAAAGAT	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.1269C>T	1.37:g.29359661C>T			137	0	0		97	0.37	36	NM_001166006	55	0.42	23	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Silent	SNP	ENST00000343067.4	37	CCDS53288.1																																																																																					0.418	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010312.1		NM_203342	
HIVEP3	59269	mdanderson.org	37	1	42049570	42049570	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:42049570G>T	ENST00000372583.1	-	4	1784	c.899C>A	c.(898-900)cCa>cAa	p.P300Q	HIVEP3_ENST00000429157.2_Missense_Mutation_p.P300Q|HIVEP3_ENST00000372584.1_Missense_Mutation_p.P300Q|HIVEP3_ENST00000247584.5_Missense_Mutation_p.P300Q	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	300	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTTGGGTCTTGGGGAGAGCTC	0.602																																					p.P300Q													.	.			0			c.C899A												79.0	82.0	81.0					1																	42049570		2203	4300	6503	SO:0001583	missense	59269	exon4			GGTCTTGGGGAGA	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.899C>A	1.37:g.42049570G>T	ENSP00000361664:p.Pro300Gln		65	0	0		48	0.06	3	NM_024503	0		0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757370	0.49468	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.08720	3.06;3.06;3.06;3.06	5.15	4.21	0.49690	.	0.119241	0.38663	N	0.001610	T	0.13841	0.0335	L	0.27053	0.805	0.36876	D	0.889171	D;D	0.59767	0.986;0.977	P;P	0.55923	0.787;0.617	T	0.11567	-1.0582	10	0.72032	D	0.01	1.1635	15.2105	0.73219	0.0:0.1414:0.8586:0.0	.	300;300	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Q	300	ENSP00000361665:P300Q;ENSP00000361664:P300Q;ENSP00000247584:P300Q;ENSP00000410828:P300Q	ENSP00000247584:P300Q	P	-	2	0	HIVEP3	41822157	0.995000	0.38212	0.929000	0.37066	0.606000	0.37113	5.478000	0.66806	1.350000	0.45770	0.655000	0.94253	CCA			0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000016978.1		NM_024503	
GFI1	2672	mdanderson.org	37	1	92946383	92946383	+	Silent	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:92946383T>C	ENST00000370332.1	-	4	879	c.561A>G	c.(559-561)gcA>gcG	p.A187A	GFI1_ENST00000483490.1_5'Flank|GFI1_ENST00000427103.1_Silent_p.A187A|GFI1_ENST00000294702.5_Silent_p.A187A	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	187	Ala/Gly-rich.|Required for interaction with RELA.				auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		CACCGGCCCCTGCGCTGCAGC	0.786																																					p.A187A													.	.			0			c.A561G												3.0	4.0	4.0					1																	92946383		1830	3668	5498	SO:0001819	synonymous_variant	2672	exon4			GGCCCCTGCGCTG	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.561A>G	1.37:g.92946383T>C			11	0	0		16	0.13	2	NM_001127215	0		0	Q8N564	Silent	SNP	ENST00000370332.1	37	CCDS30773.1																																																																																					0.786	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030054.1		NM_005263	
EDEM3	80267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	184706178	184706178	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:184706178T>C	ENST00000318130.8	-	4	592	c.326A>G	c.(325-327)gAt>gGt	p.D109G	EDEM3_ENST00000367512.3_Missense_Mutation_p.D66G	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	109					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GTCCAAAGAATCAATCAGTGT	0.294																																					p.D109G													.	.			0			c.A326G												94.0	95.0	95.0					1																	184706178		2203	4293	6496	SO:0001583	missense	80267	exon4			AAAGAATCAATCA	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.326A>G	1.37:g.184706178T>C	ENSP00000318147:p.Asp109Gly		355	0	0		305	0.31	95	NM_025191	21	0.33	7	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	ENST00000318130.8	37	CCDS1363.2	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369695	0.61624	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	D;D	0.84298	-1.83;-1.83	4.11	4.11	0.48088	.	0.051762	0.85682	D	0.000000	D	0.92854	0.7727	H	0.95151	3.63	0.80722	D	1	P;P	0.35944	0.529;0.529	P;B	0.50934	0.654;0.443	D	0.94008	0.7281	10	0.87932	D	0	.	11.9784	0.53105	0.0:0.0:0.0:1.0	.	109;66	Q9BZQ6;B7ZLZ2	EDEM3_HUMAN;.	G	109;66	ENSP00000318147:D109G;ENSP00000356482:D66G	ENSP00000318147:D109G	D	-	2	0	EDEM3	182972801	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.499000	0.81566	1.622000	0.50330	0.477000	0.44152	GAT			0.294	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085785.3		NM_025191	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186151356	186151356	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:186151356G>A	ENST00000271588.4	+	105	16580	c.16351G>A	c.(16351-16353)Gga>Aga	p.G5451R	HMCN1_ENST00000367492.2_Missense_Mutation_p.G5334R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5451	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAATACCTTTGGAAGTTATCA	0.398																																					p.G5451R													.	.			0			c.G16351A												141.0	133.0	136.0					1																	186151356		2203	4300	6503	SO:0001583	missense	83872	exon105			ACCTTTGGAAGTT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16351G>A	1.37:g.186151356G>A	ENSP00000271588:p.Gly5451Arg		229	0	0		233	0.27	63	NM_031935	44	0.16	7	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978549	0.92982	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.89939	-2.59;-2.59;-2.59	5.53	5.53	0.82687	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96987	0.9016	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98262	1.0499	10	0.87932	D	0	.	19.4713	0.94963	0.0:0.0:1.0:0.0	.	5451	Q96RW7	HMCN1_HUMAN	R	5451;5334;126	ENSP00000271588:G5451R;ENSP00000356462:G5334R;ENSP00000406205:G126R	ENSP00000271588:G5451R	G	+	1	0	HMCN1	184417979	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.562000	0.98145	2.587000	0.87381	0.563000	0.77884	GGA			0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131848.1		NM_031935	
KIF21B	23046	ucsc.edu	37	1	200974451	200974451	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:200974451G>T	ENST00000422435.2	-	5	1033	c.717C>A	c.(715-717)tgC>tgA	p.C239*	KIF21B_ENST00000360529.5_Nonsense_Mutation_p.C239*|KIF21B_ENST00000332129.2_Nonsense_Mutation_p.C239*|KIF21B_ENST00000461742.2_Nonsense_Mutation_p.C239*	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	239	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CGGGCTGGGTGCACATGCGCA	0.642																																					p.C239X													.	KIF21B	208		0			c.C717A												73.0	66.0	68.0					1																	200974451		2203	4300	6503	SO:0001587	stop_gained	23046	exon5			CTGGGTGCACATG	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.717C>A	1.37:g.200974451G>T	ENSP00000411831:p.Cys239*		27	0	0		28	0.14	4	NM_017596	6	0.00	0	B2RP62|B7ZMI0|Q5T4J3	Nonsense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	G	39	7.879844	0.98539	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	.	.	.	5.17	1.34	0.21922	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2924	0.26374	0.6271:0.0:0.3729:0.0	.	.	.	.	X	239	.	ENSP00000328494:C239X	C	-	3	2	KIF21B	199241074	0.006000	0.16342	0.980000	0.43619	0.901000	0.52897	0.111000	0.15458	0.391000	0.25143	-0.345000	0.07892	TGC			0.642	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000382635.1		XM_371332	
KISS1	3814	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	204159651	204159651	+	Silent	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:204159651C>T	ENST00000367194.4	-	3	526	c.378G>A	c.(376-378)gcG>gcA	p.A126A		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	126					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		TCCCTGGTGCCGCCTCCCGCT	0.692																																					p.A126A													.	.			0			c.G378A												9.0	9.0	9.0					1																	204159651		1786	3911	5697	SO:0001819	synonymous_variant	3814	exon3			TGGTGCCGCCTCC	U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.378G>A	1.37:g.204159651C>T			74	0	0		62	0.06	4	NM_002256	6	0.00	0	A8K6N0|Q9HBP1	Silent	SNP	ENST00000367194.4	37	CCDS41454.1																																																																																					0.692	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087892.1		NM_002256	
SLC30A1	7779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211751852	211751852	+	Silent	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr1:211751852G>A	ENST00000367001.4	-	1	232	c.103C>T	c.(103-105)Ctg>Ttg	p.L35L		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	35					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		AGCATCGCCAGCGACGAGGTC	0.692																																					p.L35L													.	.			0			c.C103T												41.0	40.0	40.0					1																	211751852		2193	4296	6489	SO:0001819	synonymous_variant	7779	exon1			TCGCCAGCGACGA	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.103C>T	1.37:g.211751852G>A			57	0	0		53	0.32	17	NM_021194	27	0.37	10	Q0VAK9|Q9BZF6	Silent	SNP	ENST00000367001.4	37	CCDS1499.1																																																																																					0.692	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000104738.2			
CHST3	9469	mdanderson.org	37	10	73768166	73768166	+	Silent	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:73768166C>T	ENST00000373115.4	+	3	1814	c.1377C>T	c.(1375-1377)gcC>gcT	p.A459A		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	459					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						CGCGGGACGCCGCCGCCCTCA	0.692																																					p.A459A													.	.			0			c.C1377T												12.0	12.0	12.0					10																	73768166		2167	4251	6418	SO:0001819	synonymous_variant	9469	exon3			GGACGCCGCCGCC	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1377C>T	10.37:g.73768166C>T			55	0	0		31	0.10	3	NM_004273	5	0.00	0	O75099|Q52M30	Silent	SNP	ENST00000373115.4	37	CCDS7312.1																																																																																					0.692	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048563.1		NM_004273	
SEC24C	9632	broad.mit.edu;mdanderson.org	37	10	75519799	75519799	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:75519799G>T	ENST00000339365.2	+	6	667	c.505G>T	c.(505-507)Gcc>Tcc	p.A169S	SEC24C_ENST00000345254.4_Missense_Mutation_p.A169S|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Missense_Mutation_p.A27S|SEC24C_ENST00000546025.1_Missense_Mutation_p.A27S	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	169					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GCTGGCTTCAGCCTCAGGAAG	0.537																																					p.A169S													.	SEC24C	86		0			c.G505T												99.0	92.0	94.0					10																	75519799		2200	4295	6495	SO:0001583	missense	9632	exon6			GCTTCAGCCTCAG	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.505G>T	10.37:g.75519799G>T	ENSP00000343405:p.Ala169Ser		94	0	0		47	0.06	3	NM_004922	119	0.00	0	B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	37	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	G	9.011	0.982471	0.18889	.	.	ENSG00000176986	ENST00000546025;ENST00000345254;ENST00000339365;ENST00000411652	T;T;D	0.81579	-1.02;-1.02;-1.51	5.39	4.47	0.54385	.	0.568667	0.21392	N	0.075298	T	0.70228	0.3200	L	0.40543	1.245	0.80722	D	1	B;B;B	0.18610	0.003;0.029;0.017	B;B;B	0.19946	0.002;0.027;0.007	T	0.62196	-0.6905	10	0.18710	T	0.47	-13.4655	9.9295	0.41514	0.1536:0.0:0.8464:0.0	.	27;169;169	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	S	27;169;169;27	ENSP00000321845:A169S;ENSP00000343405:A169S;ENSP00000402913:A27S	ENSP00000343405:A169S	A	+	1	0	SEC24C	75189805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.000000	0.40816	2.700000	0.92200	0.561000	0.74099	GCC			0.537	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048679.1			
FFAR4	338557	mdanderson.org	37	10	95326725	95326725	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:95326725G>T	ENST00000371483.4	+	1	304	c.248G>T	c.(247-249)tGc>tTc	p.C83F	FFAR4_ENST00000604414.1_Missense_Mutation_p.C83F|FFAR4_ENST00000371481.4_Missense_Mutation_p.C83F	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	83					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										AACCTCTTCTGCGCGGACCTG	0.672																																					p.C83F													O3FAR1,NS,carcinoma,+1,1	O3FAR1	1	1	0			c.G248T												50.0	48.0	49.0					10																	95326725		2203	4298	6501	SO:0001583	missense	338557	exon1			TCTTCTGCGCGGA		CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.248G>T	10.37:g.95326725G>T	ENSP00000360538:p.Cys83Phe		79	0	0		43	0.07	3	NM_001195755	1	0.00	0	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Missense_Mutation	SNP	ENST00000371483.4	37	CCDS31248.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081513	0.55753	.	.	ENSG00000186188	ENST00000371481;ENST00000371483	T;T	0.34072	1.38;1.38	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	L	0.36672	1.1	0.44030	D	0.996757	D;D	0.76494	0.999;0.999	D;D	0.77557	0.967;0.99	T	0.52472	-0.8571	10	0.62326	D	0.03	-34.7135	18.9768	0.92740	0.0:0.0:1.0:0.0	.	83;83	Q5NUL3-2;Q5NUL3	.;O3FA1_HUMAN	F	83	ENSP00000360536:C83F;ENSP00000360538:C83F	ENSP00000360536:C83F	C	+	2	0	O3FAR1	95316715	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	6.269000	0.72558	2.714000	0.92807	0.561000	0.74099	TGC			0.672	FFAR4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000083179.1		NM_181745	
ACSM6	142827	mdanderson.org	37	10	96988497	96988497	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:96988497G>T	ENST00000394005.3	+	10	1408	c.1399G>T	c.(1399-1401)Ggt>Tgt	p.G467C	RP11-310E22.4_ENST00000451737.1_RNA|C10orf129_ENST00000341686.3_Missense_Mutation_p.G467C|C10orf129_ENST00000430183.1_3'UTR			Q6P461	ACSM6_HUMAN		467					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CTGGTGGTCTGGTAGAGTTGA	0.493																																					p.G467C													.	.			0			c.G1399T												449.0	360.0	387.0					10																	96988497		692	1591	2283	SO:0001583	missense	142827	exon11			TGGTCTGGTAGAG																												ENST00000394005.3:c.1399G>T	10.37:g.96988497G>T	ENSP00000377573:p.Gly467Cys		82	0	0		46	0.07	3	NM_207321	2	0.00	0	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	ENST00000394005.3	37	CCDS7440.2	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803932	0.50315	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000394005	T;T	0.65178	-0.14;-0.14	0.962	0.962	0.19643	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.77896	0.4199	M	0.89030	3	0.21290	N	0.999738	D	0.89917	1.0	D	0.97110	1.0	T	0.62544	-0.6832	9	0.87932	D	0	.	5.2137	0.15331	0.0:0.0:1.0:0.0	.	467	Q6P461	ACSM6_HUMAN	C	493;467;467	ENSP00000340296:G467C;ENSP00000377573:G467C	ENSP00000340296:G467C	G	+	1	0	C10orf129	96978487	1.000000	0.71417	0.196000	0.23383	0.771000	0.43674	1.562000	0.36353	0.790000	0.33803	0.313000	0.20887	GGT			0.493	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049506.2			
PDCD11	22984	mdanderson.org	37	10	105160234	105160234	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:105160234G>T	ENST00000369797.3	+	3	277	c.183G>T	c.(181-183)aaG>aaT	p.K61N		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	61					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		AAATCGAAAAGAGAGAAAGCA	0.408																																					p.K61N													PDCD11,NS,carcinoma,0,1	PDCD11	0	1	0			c.G183T												115.0	126.0	123.0					10																	105160234		2203	4300	6503	SO:0001583	missense	22984	exon3			CGAAAAGAGAGAA	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.183G>T	10.37:g.105160234G>T	ENSP00000358812:p.Lys61Asn		86	0	0		39	0.08	3	NM_014976	46	0.00	0	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866946	0.51588	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.11821	2.74	5.72	-0.0584	0.13797	.	0.506424	0.24046	N	0.042058	T	0.07324	0.0185	L	0.28458	0.855	0.32896	D	0.512551	P	0.37914	0.611	B	0.31946	0.138	T	0.20140	-1.0284	10	0.59425	D	0.04	-4.1268	5.1788	0.15148	0.3133:0.2985:0.3882:0.0	.	61	Q14690	RRP5_HUMAN	N	61	ENSP00000358812:K61N	ENSP00000358812:K61N	K	+	3	2	PDCD11	105150224	0.995000	0.38212	0.964000	0.40570	0.989000	0.77384	0.698000	0.25571	0.077000	0.16863	0.561000	0.74099	AAG			0.408	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050151.1			
GPR123	84435	mdanderson.org	37	10	134912177	134912177	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr10:134912177G>T	ENST00000392607.3	+	4	601	c.165G>T	c.(163-165)acG>acT	p.T55T	GPR123_ENST00000607359.1_Silent_p.T775T	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	55					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCCGGCACACGCTCCTGAATT	0.647																																					p.T55T													.	.			0			c.G165T												74.0	66.0	69.0					10																	134912177		2203	4300	6503	SO:0001819	synonymous_variant	84435	exon4			GCACACGCTCCTG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.165G>T	10.37:g.134912177G>T			44	0	0		33	0.09	3	NM_001083909	3	0.00	0	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Silent	SNP	ENST00000392607.3	37	CCDS41580.1																																																																																					0.647	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000051113.2			
PHRF1	57661	mdanderson.org	37	11	607812	607812	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:607812G>T	ENST00000264555.5	+	14	2484	c.2356G>T	c.(2356-2358)Gca>Tca	p.A786S	PHRF1_ENST00000416188.2_Missense_Mutation_p.A785S|PHRF1_ENST00000533464.1_Missense_Mutation_p.A782S|PHRF1_ENST00000413872.2_Missense_Mutation_p.A784S	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	786					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						TGGAAACATGGCACATTCCAG	0.577																																					p.A785S													.	.			0			c.G2353T												51.0	57.0	55.0					11																	607812		2012	4165	6177	SO:0001583	missense	57661	exon14			AACATGGCACATT	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.2356G>T	11.37:g.607812G>T	ENSP00000264555:p.Ala786Ser		75	0	0		59	0.07	4	NM_020901	78	0.00	0	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	G	13.86	2.363526	0.41902	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	4.77	4.77	0.60923	.	0.169982	0.28125	N	0.016514	T	0.82047	0.4952	L	0.48642	1.525	0.32052	N	0.596834	D;D;D;D	0.56521	0.958;0.976;0.976;0.958	P;P;P;P	0.51615	0.475;0.675;0.675;0.475	T	0.83237	-0.0060	10	0.33940	T	0.23	-27.5858	18.1833	0.89785	0.0:0.0:1.0:0.0	.	782;784;785;786	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	S	786;784;785;782	ENSP00000264555:A786S;ENSP00000388589:A784S;ENSP00000410626:A785S;ENSP00000431870:A782S	ENSP00000264555:A786S	A	+	1	0	PHRF1	597812	1.000000	0.71417	0.024000	0.17045	0.060000	0.15804	5.200000	0.65158	2.356000	0.79943	0.555000	0.69702	GCA			0.577	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000382133.1		NM_020901	
ATG2A	23130	mdanderson.org	37	11	64679873	64679873	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:64679873C>T	ENST00000377264.3	-	7	960	c.848G>A	c.(847-849)gGc>gAc	p.G283D	ATG2A_ENST00000421419.2_Missense_Mutation_p.G283D	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	283					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GTGCAGGGAGCCCAGCTGTCC	0.677																																					p.G283D													.	.			0			c.G848A												18.0	18.0	18.0					11																	64679873		2138	4205	6343	SO:0001583	missense	23130	exon7			AGGGAGCCCAGCT		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.848G>A	11.37:g.64679873C>T	ENSP00000366475:p.Gly283Asp		62	0	0		20	0.15	3	NM_015104	27	0.00	0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121048	0.37436	.	.	ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459	T;T	0.09538	2.97;2.97	3.96	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.19287	0.0463	L	0.38175	1.15	0.50171	D	0.999852	D	0.69078	0.997	D	0.63597	0.916	T	0.02263	-1.1186	10	0.25751	T	0.34	.	13.91	0.63860	0.0:1.0:0.0:0.0	.	283	Q2TAZ0	ATG2A_HUMAN	D	283	ENSP00000410522:G283D;ENSP00000366475:G283D	ENSP00000227459:G283D	G	-	2	0	ATG2A	64436449	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	2.533000	0.45667	2.224000	0.72417	0.561000	0.74099	GGC			0.677	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000143224.1		NM_015104	
MAP3K11	4296	mdanderson.org	37	11	65367071	65367071	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:65367071G>T	ENST00000530153.1	-	9	1750	c.1229C>A	c.(1228-1230)cCa>cAa	p.P410Q	MAP3K11_ENST00000534432.1_5'UTR|MAP3K11_ENST00000309100.3_Missense_Mutation_p.P667Q|MAP3K11_ENST00000532507.1_Missense_Mutation_p.P83Q					mitogen-activated protein kinase kinase kinase 11											breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						CTCGCGTCCTGGGCCTCCCGG	0.761																																					p.P667Q													.	.			0			c.C2000A												5.0	8.0	7.0					11																	65367071		1822	3660	5482	SO:0001583	missense	4296	exon9			CGTCCTGGGCCTC		CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.1229C>A	11.37:g.65367071G>T	ENSP00000433886:p.Pro410Gln		28	0	0		20	0.10	2	NM_002419	17	0.00	0		Missense_Mutation	SNP	ENST00000530153.1	37		.	.	.	.	.	.	.	.	.	.	G	10.56	1.383675	0.25031	.	.	ENSG00000173327	ENST00000309100;ENST00000532507;ENST00000530153	T;T	0.73152	-0.61;-0.72	4.54	-6.26	0.02033	.	2.277220	0.02890	N	0.134056	T	0.44030	0.1274	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.23226	-1.0194	10	0.18276	T	0.48	.	0.5551	0.00669	0.3747:0.1456:0.2587:0.221	.	174;667	B3KQY4;Q16584	.;M3K11_HUMAN	Q	667;83;410	ENSP00000309597:P667Q;ENSP00000433886:P410Q	ENSP00000309597:P667Q	P	-	2	0	MAP3K11	65123647	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.171000	0.09883	-1.437000	0.01967	-2.048000	0.00412	CCA			0.761	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000390233.2			
RBM14	10432	mdanderson.org	37	11	66392959	66392959	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:66392959G>T	ENST00000310137.4	+	2	1751	c.1612G>T	c.(1612-1614)Gcc>Tcc	p.A538S	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	538	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CCAGGCTGCTGCCTCCTACCG	0.652																																					p.A538S													.	.			0			c.G1612T												42.0	36.0	38.0					11																	66392959		2200	4295	6495	SO:0001583	missense	10432	exon2			GCTGCTGCCTCCT	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1612G>T	11.37:g.66392959G>T	ENSP00000311747:p.Ala538Ser		69	0.0144927536	1		47	0.06	3	NM_006328	173	0.00	0	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519038	0.27211	.	.	ENSG00000239306	ENST00000310137	D	0.83914	-1.78	5.75	4.78	0.61160	.	0.106952	0.64402	D	0.000005	T	0.67335	0.2882	N	0.14661	0.345	0.80722	D	1	B	0.32781	0.384	B	0.23716	0.048	T	0.70513	-0.4851	10	0.62326	D	0.03	-0.1533	11.2464	0.49000	0.0:0.0:0.8178:0.1822	.	538	Q96PK6	RBM14_HUMAN	S	538	ENSP00000311747:A538S	ENSP00000311747:A538S	A	+	1	0	RBM14	66149535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.360000	0.59455	2.720000	0.93068	0.655000	0.94253	GCC			0.652	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000277128.1		NM_006328	
RBM4B	83759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66436560	66436560	+	Silent	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:66436560G>A	ENST00000525754.1	-	2	1283	c.615C>T	c.(613-615)taC>taT	p.Y205Y	RP11-658F2.8_ENST00000548810.1_RNA|RBM4B_ENST00000524637.1_3'UTR|RP11-658F2.8_ENST00000550837.1_RNA|RBM4B_ENST00000310046.4_Silent_p.Y205Y|RBM4B_ENST00000529195.2_5'Flank|RBM4B_ENST00000531969.1_Intron			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	205	Interaction with TNPO3. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						TGGATTCCCCGTAGCCCATGG	0.512																																					p.Y205Y													.	.			0			c.C615T												124.0	114.0	117.0					11																	66436560		2200	4295	6495	SO:0001819	synonymous_variant	83759	exon3			TTCCCCGTAGCCC	AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.615C>T	11.37:g.66436560G>A			164	0	0		78	0.44	34	NM_031492	43	0.60	26	B3KT83	Silent	SNP	ENST00000525754.1	37	CCDS8149.1																																																																																					0.512	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393851.1		NM_031492	
DLG2	1740	mdanderson.org	37	11	84996380	84996380	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:84996380G>T	ENST00000376104.2	-	4	381	c.70C>A	c.(70-72)Cta>Ata	p.L24I	DLG2_ENST00000543673.1_Missense_Mutation_p.L24I	NM_001142699.1	NP_001136171.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TGAGAATTTAGCAATGTCACC	0.358																																					p.L24I													.	.			0			c.C70A												155.0	140.0	145.0					11																	84996380		1568	3581	5149	SO:0001583	missense	1740	exon4			AATTTAGCAATGT	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000376104.2:c.70C>A	11.37:g.84996380G>T	ENSP00000365272:p.Leu24Ile		92	0	0		50	0.08	4	NM_001142699	2	0.00	0	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000376104.2	37	CCDS44690.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780131	0.49891	.	.	ENSG00000150672	ENST00000376104;ENST00000543673;ENST00000546021	T;T	0.22539	1.95;1.95	5.88	1.37	0.22104	.	0.000000	0.31268	N	0.007948	T	0.36580	0.0972	L	0.60067	1.865	0.80722	D	1	D	0.56035	0.974	D	0.67725	0.953	T	0.04029	-1.0983	9	.	.	.	.	11.3074	0.49342	0.2937:0.0:0.7063:0.0	.	24	Q15700-2	.	I	24	ENSP00000365272:L24I;ENSP00000441994:L24I	.	L	-	1	2	DLG2	84674028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.899000	0.39818	0.379000	0.24794	0.650000	0.86243	CTA			0.358	DLG2-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000259245.3		NM_001364	
DDX25	29118	mdanderson.org	37	11	125787112	125787112	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr11:125787112G>T	ENST00000263576.6	+	9	1159	c.1004G>T	c.(1003-1005)aGc>aTc	p.S335I	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	335	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		ATTTATGGCAGCATCACCATT	0.502																																					p.S335I													.	.			0			c.G1004T												40.0	39.0	39.0					11																	125787112		2129	4244	6373	SO:0001583	missense	29118	exon9			ATGGCAGCATCAC	AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1004G>T	11.37:g.125787112G>T	ENSP00000263576:p.Ser335Ile		61	0	0		41	0.07	3	NM_013264	7	0.00	0	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	ENST00000263576.6	37	CCDS44766.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112745	0.37242	.	.	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.04809	3.55	5.89	5.89	0.94794	Helicase, C-terminal (1);	0.219328	0.40302	N	0.001136	T	0.04003	0.0112	N	0.11927	0.2	0.33109	D	0.540252	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.21280	-1.0250	10	0.49607	T	0.09	-5.2769	14.6881	0.69065	0.0:0.0:0.8548:0.1452	.	335;335	B4DHI6;Q9UHL0	.;DDX25_HUMAN	I	221;335;201	ENSP00000263576:S335I	ENSP00000263576:S335I	S	+	2	0	DDX25	125292322	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.574000	0.46016	2.793000	0.96121	0.655000	0.94253	AGC			0.502	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386736.3		NM_013264	
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101763603	101763603	+	Silent	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr12:101763603G>A	ENST00000261637.4	+	49	6663	c.6489G>A	c.(6487-6489)ctG>ctA	p.L2163L		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2163					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.L2163L(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TCCTTCTGCTGAAGGACTATG	0.507																																					p.L2163L													UTP20,NS,carcinoma,0,1	UTP20	0	1	1	Substitution - coding silent(1)	lung(1)	c.G6489A												129.0	137.0	134.0					12																	101763603		2203	4300	6503	SO:0001819	synonymous_variant	27340	exon49			TCTGCTGAAGGAC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6489G>A	12.37:g.101763603G>A			91	0	0		95	0.06	6	NM_014503	51	0.10	5	Q9H3H4	Silent	SNP	ENST00000261637.4	37	CCDS9081.1																																																																																					0.507	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408242.1		NM_014503	
PSMB11	122706	mdanderson.org	37	14	23511880	23511880	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr14:23511880C>T	ENST00000408907.2	+	1	505	c.446C>T	c.(445-447)gCc>gTc	p.A149V		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	149					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GTGGCCACTGCCCTCTGCGGC	0.622																																					p.A149V													.	.			0			c.C446T												60.0	65.0	64.0					14																	23511880		2118	4229	6347	SO:0001583	missense	122706	exon1			CCACTGCCCTCTG		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.446C>T	14.37:g.23511880C>T	ENSP00000386212:p.Ala149Val		52	0	0		37	0.08	3	NM_001099780	0		0		Missense_Mutation	SNP	ENST00000408907.2	37	CCDS41923.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910281	0.52439	.	.	ENSG00000222028	ENST00000408907	T	0.27890	1.64	5.23	4.33	0.51752	.	0.122950	0.56097	D	0.000040	T	0.09686	0.0238	N	0.00500	-1.43	0.28454	N	0.916193	B	0.21071	0.051	B	0.23275	0.045	T	0.08722	-1.0708	10	0.66056	D	0.02	-1.1522	9.1796	0.37134	0.0:0.8414:0.0:0.1586	.	149	A5LHX3	PSB11_HUMAN	V	149	ENSP00000386212:A149V	ENSP00000386212:A149V	A	+	2	0	PSMB11	22581720	0.817000	0.29147	1.000000	0.80357	0.839000	0.47603	1.864000	0.39469	2.453000	0.82957	0.561000	0.74099	GCC			0.622	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408294.1		NM_001099780	
MAP2K5	5607	mdanderson.org	37	15	67835784	67835784	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr15:67835784G>T	ENST00000178640.5	+	1	738	c.111G>T	c.(109-111)ccG>ccT	p.P37P	MAP2K5_ENST00000395476.2_Silent_p.P37P|RP11-502I4.3_ENST00000604760.1_lincRNA|MAP2K5_ENST00000560591.1_3'UTR	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	37	OPR.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						ACTCCGGGCCGCAGTTACTCT	0.572																																					p.P37P													.	.			0			c.G111T												101.0	92.0	95.0					15																	67835784		2201	4298	6499	SO:0001819	synonymous_variant	5607	exon1			CGGGCCGCAGTTA	U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.111G>T	15.37:g.67835784G>T			91	0	0		55	0.05	3	NM_002757	44	0.00	0	B4DE43|Q92961|Q92962	Silent	SNP	ENST00000178640.5	37	CCDS10224.1																																																																																					0.572	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257041.1		NM_145162	
NEIL1	79661	ucsc.edu	37	15	75646087	75646087	+	Silent	SNP	A	A	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr15:75646087A>G	ENST00000564784.1	+	7	1355	c.726A>G	c.(724-726)aaA>aaG	p.K242K	MIR631_ENST00000384904.1_RNA|NEIL1_ENST00000355059.4_Silent_p.K242K|NEIL1_ENST00000569035.1_Silent_p.K242K|RP11-817O13.6_ENST00000563660.1_lincRNA			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	242			K -> R (in RNA edited version).		base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						CAGGGGGCAAAGGCTACGGGT	0.632								Base excision repair (BER), DNA glycosylases																													p.K328K													.	NEIL1	36		0			c.A984G												79.0	79.0	79.0					15																	75646087		2197	4294	6491	SO:0001819	synonymous_variant	79661	exon6			GGGCAAAGGCTAC	AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.726A>G	15.37:g.75646087A>G			85	0	0		85	0.01	1	NM_001256552	20	0.45	9	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Silent	SNP	ENST00000564784.1	37	CCDS10278.1																																																																																					0.632	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419885.1		NM_024608	
ADAMTS17	170691	mdanderson.org	37	15	100821452	100821452	+	Silent	SNP	G	G	T	rs143055688		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr15:100821452G>T	ENST00000268070.4	-	4	876	c.771C>A	c.(769-771)atC>atA	p.I257I		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	257	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TGACGGTCAGGATGAACCTCT	0.627																																					p.I257I													.	.			0			c.C771A												69.0	75.0	73.0					15																	100821452		2203	4300	6503	SO:0001819	synonymous_variant	170691	exon4			GGTCAGGATGAAC	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.771C>A	15.37:g.100821452G>T			21	0	0		24	0.13	3	NM_139057	9	0.00	0	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																					0.627	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313595.1		NM_139057	
MRPS34	65993	mdanderson.org	37	16	1822889	1822889	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr16:1822889G>T	ENST00000397375.2	-	1	267	c.232C>A	c.(232-234)Cgc>Agc	p.R78S	EME2_ENST00000307394.7_5'Flank|NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_Missense_Mutation_p.R78S|NME3_ENST00000219302.3_5'Flank|EME2_ENST00000568449.1_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	78						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						GTGACCAGGCGGCCCAGGCCG	0.746																																					p.R78S													.	.			0			c.C232A												2.0	3.0	2.0					16																	1822889		1366	2919	4285	SO:0001583	missense	65993	exon1			CCAGGCGGCCCAG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.232C>A	16.37:g.1822889G>T	ENSP00000380531:p.Arg78Ser		11	0	0		11	0.18	2	NM_023936	104	0.00	0	Q9BVI7	Missense_Mutation	SNP	ENST00000397375.2	37	CCDS10444.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138098	0.94560	.	.	ENSG00000074071	ENST00000397375;ENST00000177742	T;T	0.31769	1.48;1.48	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.49745	0.1575	M	0.69463	2.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.51076	-0.8751	10	0.62326	D	0.03	-16.3201	9.7711	0.40589	0.0:0.0:0.7937:0.2063	.	78;78	C9JJ19;P82930	.;RT34_HUMAN	S	78	ENSP00000380531:R78S;ENSP00000177742:R78S	ENSP00000177742:R78S	R	-	1	0	MRPS34	1762890	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.409000	0.66374	1.891000	0.54761	0.591000	0.81541	CGC			0.746	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250506.1		NM_023936	
PKD1	5310	mdanderson.org	37	16	2165409	2165409	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr16:2165409G>T	ENST00000262304.4	-	10	2275	c.2067C>A	c.(2065-2067)tcC>tcA	p.S689S	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.S689S	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	689					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGCGGGAACGGAGAAGAGGA	0.687																																					p.S689S													.	.			0			c.C2067A												9.0	11.0	10.0					16																	2165409		2104	4170	6274	SO:0001819	synonymous_variant	5310	exon10			GGGAACGGAGAAG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2067C>A	16.37:g.2165409G>T			53	0	0		36	0.08	3	NM_001009944	90	0.00	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																					0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
SRRM2	23524	broad.mit.edu	37	16	2817298	2817298	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr16:2817298G>T	ENST00000301740.8	+	11	7318	c.6769G>T	c.(6769-6771)Gct>Tct	p.A2257S	AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2257	Ala-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTGAACCTGGCTGACTCTCG	0.632																																					p.A2257S													.	SRRM2	263		0			c.G6769T												67.0	70.0	69.0					16																	2817298		2198	4300	6498	SO:0001583	missense	23524	exon11			AACCTGGCTGACT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6769G>T	16.37:g.2817298G>T	ENSP00000301740:p.Ala2257Ser		64	0.03125	2		70	0.09	6	NM_016333	858	0.06	50	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	9.588	1.125326	0.20959	.	.	ENSG00000167978	ENST00000301740;ENST00000544933	T	0.80033	-1.33	5.82	4.84	0.62591	.	0.089887	0.48767	D	0.000165	T	0.71151	0.3306	L	0.34521	1.04	0.30120	N	0.805738	P	0.40970	0.734	B	0.37731	0.257	T	0.71069	-0.4699	10	0.44086	T	0.13	-6.9946	12.7961	0.57560	0.0:0.1642:0.8358:0.0	.	2257	Q9UQ35	SRRM2_HUMAN	S	2257;1509	ENSP00000301740:A2257S	ENSP00000301740:A2257S	A	+	1	0	SRRM2	2757299	1.000000	0.71417	0.976000	0.42696	0.402000	0.30811	1.924000	0.40065	1.423000	0.47198	0.655000	0.94253	GCT			0.632	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436411.1			
ABCC6P1	653190	broad.mit.edu	37	16	18597596	18597596	+	RNA	DEL	A	A	-			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr16:18597596delA	ENST00000546162.2	+	0	999					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		actccgtatcaaaaaaaaaaa	0.468																																					.													.	.			0			.																																											0	.			CGTATCAAAAAAA	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192		16.37:g.18597596delA			8	0	0		8	0.25	2	.	0		0		RNA	DEL	ENST00000546162.2	37																																																																																						0.468	ABCC6P1-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000435772.2		NR_003569	
Unknown	0	bcgsc.ca	37	16	33408500	33408500	+	IGR	DEL	C	C	-			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr16:33408500delC								RP11-23E10.4 (41687 upstream) : BMS1P8 (88662 downstream)																							GCAGGGAAGTCCCACCTGTGC	0.572																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGAAGTCCCACCT																													16.37:g.33408500delC			84	0	0		82	0.20	16	.	1	0.00	0		RNA	DEL		37																																																																																					0	0.572										
OR1D5	8386	broad.mit.edu	37	17	2966569	2966569	+	Silent	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:2966569G>A	ENST00000575751.1	-	1	332	c.333C>T	c.(331-333)gaC>gaT	p.D111D		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	111					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						GGATGAGGTTGTCCAGGGTCA	0.572																																					p.D111D													.	OR1D5	33		0			c.C333T												36.0	42.0	40.0					17																	2966569		2189	4295	6484	SO:0001819	synonymous_variant	8386	exon1			GAGGTTGTCCAGG	AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.333C>T	17.37:g.2966569G>A			394	0	0		354	0.07	25	NM_014566	1	0.00	0	Q96RA6	Silent	SNP	ENST00000575751.1	37	CCDS58499.1																																																																																					0.572	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438410.2		NM_014566	
OR1D4	653166	broad.mit.edu;bcgsc.ca	37	17	3144302	3144302	+	RNA	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:3144302C>T	ENST00000531680.1	+	0	333					NR_033795.1		P47884	OR1D4_HUMAN	olfactory receptor, family 1, subfamily D, member 4 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TGACCCTGGACAACCTCATCC	0.567																																					.													.	.			0			.																																											653166	.			CCTGGACAACCTC	U04681		17p13.3	2014-03-20	2010-07-19		ENSG00000255095	ENSG00000255095		"""GPCR / Class A : Olfactory receptors"""	8185	protein-coding gene	gene with protein product			"""olfactory receptor, family 1, subfamily D, member 4"""			8004088, 10673334	Standard	NR_033795		Approved	OR17-30	uc002fvf.3	P47884	OTTHUMG00000166844		17.37:g.3144302C>T			343	0	0		290	0.25	72	.	0		0	Q96RA5|Q9UM75	RNA	SNP	ENST00000531680.1	37																																																																																						0.567	OR1D4-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000391569.1		NM_003552	
MYH10	4628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	8404192	8404193	+	Frame_Shift_Del	DEL	GT	GT	-	rs147095676		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	GT	GT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:8404192_8404193delGT	ENST00000269243.4	-	27	3740_3741	c.3602_3603delAC	c.(3601-3603)cacfs	p.H1201fs	MYH10_ENST00000379980.4_Frame_Shift_Del_p.H1217fs|MYH10_ENST00000396239.1_Frame_Shift_Del_p.H1222fs|MYH10_ENST00000360416.3_Frame_Shift_Del_p.H1232fs	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1201					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GGGCTGTTGCGTGTCTTTGTCT	0.53																																					p.1232_1233del													.	MYH10	148		0			c.3696_3697del																																									SO:0001589	frameshift_variant	4628	exon29			TGTTGCGTGTCTT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3602_3603delAC	17.37:g.8404194_8404195delGT	ENSP00000269243:p.His1201fs		68	0	0		80	0.34	27	NM_001256012	336	0.00	0	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Frame_Shift_Del	DEL	ENST00000269243.4	37	CCDS11144.1																																																																																					0.530	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000227001.2			
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		262	0.0687022901	18		176	0.06	10	NM_145301	84	0.52	44	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	27441062	27441063	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:27441062_27441063delCA	ENST00000527372.1	-	15	2744_2745	c.2564_2565delTG	c.(2563-2565)gtgfs	p.V855fs	MYO18A_ENST00000533112.1_Frame_Shift_Del_p.V855fs|MYO18A_ENST00000354329.4_Frame_Shift_Del_p.V855fs|MYO18A_ENST00000531253.1_Frame_Shift_Del_p.V855fs	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	855	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCACAGCAGCCACAGAGTCATC	0.614																																					p.855_856del	Esophageal Squamous(182;472 2015 7001 15270 22562)												.	MYO18A	217		0			c.2565_2566del																																									SO:0001589	frameshift_variant	399687	exon15			AGCAGCCACAGAG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2564_2565delTG	17.37:g.27441064_27441065delCA	ENSP00000437073:p.Val855fs		75	0	0		53	0.34	18	NM_078471	30	0.00	0	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Frame_Shift_Del	DEL	ENST00000527372.1	37	CCDS45642.1																																																																																					0.614	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389396.1		NM_078471	
ABHD15	116236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	27893554	27893554	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:27893554C>T	ENST00000307201.4	-	1	601	c.431G>A	c.(430-432)tGt>tAt	p.C144Y	RP11-68I3.2_ENST00000581474.1_RNA|TP53I13_ENST00000584522.1_3'UTR|TP53I13_ENST00000301057.7_5'Flank	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	144						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						GCCCCGAACACAAGGTCCTAC	0.687																																					p.C144Y													.	.			0			c.G431A												28.0	25.0	26.0					17																	27893554		2201	4294	6495	SO:0001583	missense	116236	exon1			CGAACACAAGGTC	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.431G>A	17.37:g.27893554C>T	ENSP00000302657:p.Cys144Tyr		52	0	0		72	0.29	21	NM_198147	18	0.17	3	Q96EC5	Missense_Mutation	SNP	ENST00000307201.4	37	CCDS32602.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334494	0.24253	.	.	ENSG00000168792	ENST00000307201	T	0.17854	2.25	4.34	4.34	0.51931	.	0.428639	0.23508	N	0.047427	T	0.12220	0.0297	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.04664	-1.0935	10	0.02654	T	1	-16.5978	15.5786	0.76414	0.0:1.0:0.0:0.0	.	144	Q6UXT9	ABH15_HUMAN	Y	144	ENSP00000302657:C144Y	ENSP00000302657:C144Y	C	-	2	0	ABHD15	24917680	0.607000	0.26958	0.943000	0.38184	0.568000	0.35870	1.678000	0.37586	2.244000	0.73946	0.563000	0.77884	TGT			0.687	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447796.2		NM_198147	
PTRF	284119	mdanderson.org	37	17	40556822	40556822	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:40556822G>T	ENST00000357037.5	-	2	1475	c.1056C>A	c.(1054-1056)ggC>ggA	p.G352G		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CGCGCTCCGCGCCGCCCTCGT	0.711																																					p.G352G													.	.			0			c.C1056A												21.0	20.0	20.0					17																	40556822		2195	4282	6477	SO:0001819	synonymous_variant	284119	exon2			CTCCGCGCCGCCC	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.1056C>A	17.37:g.40556822G>T			67	0	0		61	0.05	3	NM_012232	255	0.00	1		Silent	SNP	ENST00000357037.5	37	CCDS11425.1																																																																																					0.711	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449938.1		NM_012232	
RP11-156P1.3	0	broad.mit.edu	37	17	45131453	45131453	+	RNA	SNP	G	G	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:45131453G>C	ENST00000575173.1	-	0	418																											AGTACATTGTGAGATACGTGG	0.473																																					.													.	.			0			.																																											0	.			CATTGTGAGATAC																													17.37:g.45131453G>C			253	0	0		192	0.03	5	.	19	0.00	0		RNA	SNP	ENST00000575173.1	37																																																																																						0.473	RP11-156P1.3-009	KNOWN	basic	lincRNA	processed_transcript		OTTHUMT00000440924.1			
C17orf64	124773	mdanderson.org	37	17	58504167	58504167	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:58504167G>A	ENST00000269127.4	+	4	502	c.418G>A	c.(418-420)Gcc>Acc	p.A140T		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	140										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CAGCCAGCCGGCCAAGTTCCT	0.587																																					p.A140T													.	.			0			c.G418A												39.0	30.0	33.0					17																	58504167		2203	4300	6503	SO:0001583	missense	124773	exon4			CAGCCGGCCAAGT	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.418G>A	17.37:g.58504167G>A	ENSP00000269127:p.Ala140Thr		30	0	0		48	0.06	3	NM_181707	0		0	Q8IY87	Missense_Mutation	SNP	ENST00000269127.4	37	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	6.882	0.532086	0.13127	.	.	ENSG00000141371	ENST00000428000;ENST00000269127	.	.	.	5.01	0.82	0.18793	.	0.380726	0.22362	N	0.061080	T	0.29491	0.0735	L	0.45581	1.43	0.20703	N	0.999866	B	0.21071	0.051	B	0.14023	0.01	T	0.14980	-1.0453	9	0.36615	T	0.2	-2.6218	5.2615	0.15576	0.3207:0.1378:0.5415:0.0	.	140	Q86WR6	CQ064_HUMAN	T	134;140	.	ENSP00000269127:A140T	A	+	1	0	C17orf64	55858949	0.240000	0.23847	0.097000	0.21041	0.082000	0.17680	1.080000	0.30779	-0.052000	0.13311	-0.258000	0.10820	GCC			0.587	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000347743.1		NM_181707	
C17orf70	80233	broad.mit.edu;mdanderson.org	37	17	79517782	79517782	+	Silent	SNP	A	A	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr17:79517782A>G	ENST00000327787.8	-	3	784	c.738T>C	c.(736-738)ccT>ccC	p.P246P	C17orf70_ENST00000537152.1_Silent_p.P95P|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	246					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GCTGGCCATCAGGGAGACCAC	0.632																																					p.P246P													.	C17orf70	79		0			c.T738C												35.0	35.0	35.0					17																	79517782		2203	4300	6503	SO:0001819	synonymous_variant	80233	exon3			GCCATCAGGGAGA	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.738T>C	17.37:g.79517782A>G			71	0	0		51	0.06	3	NM_025161	122	0.00	0	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Silent	SNP	ENST00000327787.8	37	CCDS32765.2																																																																																					0.632	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396170.1		NM_025161	
EMILIN2	84034	mdanderson.org	37	18	2891184	2891184	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr18:2891184G>T	ENST00000254528.3	+	4	1218	c.1059G>T	c.(1057-1059)caG>caT	p.Q353H		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	353					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GCCTCCAGCAGCAGTGTGATG	0.522																																					p.Q353H													.	.			0			c.G1059T												79.0	82.0	81.0					18																	2891184		2203	4300	6503	SO:0001583	missense	84034	exon4			CCAGCAGCAGTGT	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1059G>T	18.37:g.2891184G>T	ENSP00000254528:p.Gln353His		62	0.0161290323	1		43	0.07	3	NM_032048	22	0.00	0	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.652238	0.29336	.	.	ENSG00000132205	ENST00000254528	T	0.42131	0.98	5.41	3.02	0.34903	.	0.164354	0.42548	D	0.000692	T	0.42245	0.1194	M	0.62723	1.935	0.38721	D	0.953444	P	0.37061	0.58	B	0.40659	0.336	T	0.48843	-0.8999	10	0.56958	D	0.05	-27.9265	9.7457	0.40446	0.3138:0.0:0.6862:0.0	.	353	Q9BXX0	EMIL2_HUMAN	H	353	ENSP00000254528:Q353H	ENSP00000254528:Q353H	Q	+	3	2	EMILIN2	2881184	0.999000	0.42202	1.000000	0.80357	0.718000	0.41266	0.760000	0.26475	1.107000	0.41642	0.557000	0.71058	CAG			0.522	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250337.2		NM_032048	
ZFR2	23217	broad.mit.edu	37	19	3827569	3827569	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:3827569G>T	ENST00000262961.4	-	6	945	c.935C>A	c.(934-936)cCg>cAg	p.P312Q		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	312							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CACCCCGCGCGGGCTCCCGTT	0.682																																					p.P312Q													.	ZFR2	63		0			c.C935A												16.0	18.0	17.0					19																	3827569		1929	4101	6030	SO:0001583	missense	23217	exon6			CCGCGCGGGCTCC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.935C>A	19.37:g.3827569G>T	ENSP00000262961:p.Pro312Gln		176	0	0		171	0.02	4	NM_015174	1	0.00	0		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	8.161	0.789476	0.16258	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15952	3.18;2.38	2.96	0.774	0.18521	.	.	.	.	.	T	0.27205	0.0667	M	0.75447	2.3	0.80722	D	1	D	0.76494	0.999	D	0.63597	0.916	T	0.42699	-0.9436	9	0.14656	T	0.56	-11.5328	2.3009	0.04162	0.2872:0.0:0.4665:0.2464	.	312	Q9UPR6	ZFR2_HUMAN	Q	312	ENSP00000262961:P312Q;ENSP00000388974:P312Q	ENSP00000262961:P312Q	P	-	2	0	ZFR2	3778569	0.595000	0.26857	0.072000	0.20136	0.260000	0.26232	1.646000	0.37249	0.574000	0.29417	0.185000	0.17295	CCG			0.682	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453648.2		NM_015174	
COL5A3	50509	broad.mit.edu	37	19	10097403	10097403	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:10097403T>C	ENST00000264828.3	-	28	2262	c.2177A>G	c.(2176-2178)gAg>gGg	p.E726G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	726	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCGCCTTTCTCCCCCTGGAG	0.552																																					p.E726G													.	COL5A3	243		0			c.A2177G												161.0	151.0	154.0					19																	10097403		2203	4300	6503	SO:0001583	missense	50509	exon28			CCTTTCTCCCCCT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2177A>G	19.37:g.10097403T>C	ENSP00000264828:p.Glu726Gly		173	0.0404624277	7		152	0.09	13	NM_015719	43	0.00	0	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996873	0.35226	.	.	ENSG00000080573	ENST00000264828	D	0.93712	-3.27	4.05	3.01	0.34805	.	0.328523	0.30311	N	0.009915	D	0.85957	0.5818	L	0.37466	1.105	0.28512	N	0.913475	B	0.06786	0.001	B	0.04013	0.001	T	0.72020	-0.4416	10	0.20519	T	0.43	.	4.902	0.13779	0.0:0.2326:0.0:0.7674	.	726	P25940	CO5A3_HUMAN	G	726	ENSP00000264828:E726G	ENSP00000264828:E726G	E	-	2	0	COL5A3	9958403	0.791000	0.28800	1.000000	0.80357	0.995000	0.86356	1.151000	0.31651	1.590000	0.49995	0.379000	0.24179	GAG			0.552	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315788.1		NM_015719	
ZNF653	115950	mdanderson.org	37	19	11616497	11616497	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:11616497G>T	ENST00000293771.5	-	1	241	c.105C>A	c.(103-105)ggC>ggA	p.G35G	ZNF653_ENST00000593191.1_5'Flank|CTC-398G3.6_ENST00000585656.1_Missense_Mutation_p.A6D|ECSIT_ENST00000591352.1_5'Flank	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GTCGCGGCCGGCCCCGCGCCT	0.786																																					p.G35G	Pancreas(83;980 1446 4542 6441 43352)												.	.			0			c.C105A												1.0	1.0	1.0					19																	11616497		781	1783	2564	SO:0001819	synonymous_variant	115950	exon1			CGGCCGGCCCCGC	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.105C>A	19.37:g.11616497G>T			11	0	0		10	0.30	3	NM_138783	6	0.00	0	Q96AS7	Silent	SNP	ENST00000293771.5	37	CCDS12261.1																																																																																					0.786	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458836.2		NM_138783	
DDX49	54555	mdanderson.org	37	19	19035692	19035692	+	Splice_Site	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:19035692G>T	ENST00000247003.4	+	9	998	c.931G>T	c.(931-933)Ggc>Tgc	p.G311C	AC002985.3_ENST00000596918.1_Intron|DDX49_ENST00000599156.1_3'UTR|DDX49_ENST00000438170.2_Silent_p.G213G	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	311	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			TGCCTCCAGGGGCCTGGACAT	0.637																																					p.G311C													.	.			0			c.G931T												61.0	55.0	57.0					19																	19035692		2203	4300	6503	SO:0001630	splice_region_variant	54555	exon9			TCCAGGGGCCTGG		CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.930-1G>T	19.37:g.19035692G>T			41	0	0		27	0.11	3	NM_019070	157	0.00	0	E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	ENST00000247003.4	37	CCDS12390.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804262	0.70682	.	.	ENSG00000105671	ENST00000247003	T	0.63417	-0.04	4.94	4.94	0.65067	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88032	0.6328	H	0.98721	4.31	0.80722	D	1	P	0.40794	0.729	P	0.62813	0.907	D	0.92008	0.5616	10	0.72032	D	0.01	-32.5481	17.1638	0.86810	0.0:0.0:1.0:0.0	.	311	Q9Y6V7	DDX49_HUMAN	C	311	ENSP00000247003:G311C	ENSP00000247003:G311C	G	+	1	0	DDX49	18896692	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	9.441000	0.97557	2.294000	0.77228	0.511000	0.50034	GGC			0.637	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464593.1		NM_019070	Missense_Mutation
SPTBN4	57731	mdanderson.org	37	19	41009747	41009747	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:41009747G>T	ENST00000352632.3	+	12	1459	c.1373G>T	c.(1372-1374)gGg>gTg	p.G458V	SPTBN4_ENST00000595535.1_Missense_Mutation_p.G458V|SPTBN4_ENST00000344104.3_Missense_Mutation_p.G458V|SPTBN4_ENST00000338932.3_Missense_Mutation_p.G458V|SPTBN4_ENST00000598249.1_Missense_Mutation_p.G458V			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	458					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GACAACTTTGGGTATGAGCTG	0.617																																					p.G458V													.	.			0			c.G1373T												32.0	28.0	29.0					19																	41009747		2203	4300	6503	SO:0001583	missense	57731	exon12			ACTTTGGGTATGA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.1373G>T	19.37:g.41009747G>T	ENSP00000263373:p.Gly458Val		56	0	0		42	0.07	3	NM_020971	3	0.00	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	g	16.41	3.115376	0.56505	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.54675	0.56;0.56;0.56	3.88	2.84	0.33178	.	0.000000	0.64402	U	0.000007	T	0.70937	0.3281	M	0.82433	2.59	0.80722	D	1	D;D	0.76494	0.999;0.969	D;P	0.77557	0.99;0.742	T	0.73691	-0.3903	10	0.87932	D	0	.	10.2846	0.43560	0.1008:0.0:0.8992:0.0	.	458;458	Q9H254;Q71S06	SPTN4_HUMAN;.	V	458	ENSP00000263373:G458V;ENSP00000340345:G458V;ENSP00000340741:G458V	ENSP00000340345:G458V	G	+	2	0	SPTBN4	45701587	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.582000	0.98214	0.846000	0.35142	0.486000	0.48141	GGG			0.617	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462559.2			
KLC3	147700	mdanderson.org	37	19	45849859	45849859	+	Missense_Mutation	SNP	C	C	T	rs372402110	byFrequency	TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:45849859C>T	ENST00000391946.2	+	3	418	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C	KLC3_ENST00000585434.1_Missense_Mutation_p.R106C|KLC3_ENST00000470402.1_Missense_Mutation_p.R120C	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	106					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GCAGCGGCTGCGCTCGCAGGC	0.711													C|||	4	0.000798722	0.0023	0.0014	5008	,	,		12083	0.0		0.0	False		,,,				2504	0.0				p.R106C													.	.			0			c.C316T							C	CYS/ARG	3,3731		0,3,1864	5.0	8.0	7.0		316	3.8	1.0	19		7	0,7730		0,0,3865	no	missense	KLC3	NM_177417.2	180	0,3,5729	TT,TC,CC		0.0,0.0803,0.0262	probably-damaging	106/505	45849859	3,11461	1867	3865	5732	SO:0001583	missense	147700	exon3			CGGCTGCGCTCGC	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.316C>T	19.37:g.45849859C>T	ENSP00000375810:p.Arg106Cys		30	0	0		20	0.15	3	NM_177417	5	0.00	0	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	ENST00000391946.2	37	CCDS12660.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084818	0.76642	8.03E-4	0.0	ENSG00000104892	ENST00000391946;ENST00000470402	T;T	0.47528	0.84;0.84	3.77	3.77	0.43336	Rabaptin, GTPase-Rab5 binding (1);	0.000000	0.64402	D	0.000004	T	0.59702	0.2213	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.996	T	0.61997	-0.6947	10	0.87932	D	0	-3.7865	8.8226	0.35036	0.2246:0.7754:0.0:0.0	.	106;120;106	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	C	106;120	ENSP00000375810:R106C;ENSP00000436019:R120C	ENSP00000375810:R106C	R	+	1	0	KLC3	50541699	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	4.428000	0.59894	2.113000	0.64589	0.455000	0.32223	CGC			0.711	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000289776.1		NM_145275	
NOSIP	51070	ucsc.edu	37	19	50060501	50060501	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:50060501G>T	ENST00000596358.1	-	5	322	c.264C>A	c.(262-264)taC>taA	p.Y88*	NOSIP_ENST00000391853.3_Nonsense_Mutation_p.Y88*|NOSIP_ENST00000339093.3_Nonsense_Mutation_p.Y88*	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	88					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		GCTGCTTCTCGTAGGCCTGCG	0.647																																					p.Y88X													NOSIP,NS,carcinoma,0,1	NOSIP	28	1	0			c.C264A												14.0	15.0	15.0					19																	50060501		2200	4292	6492	SO:0001587	stop_gained	51070	exon6			CTTCTCGTAGGCC	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.264C>A	19.37:g.50060501G>T	ENSP00000470034:p.Tyr88*		46	0	0		35	0.11	4	NM_015953	263	0.00	0	Q96FD2	Nonsense_Mutation	SNP	ENST00000596358.1	37	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114722	0.77210	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	.	.	.	5.15	-7.5	0.01351	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.3621	10.2575	0.43405	0.649:0.1059:0.2451:0.0	.	.	.	.	X	88	.	ENSP00000343497:Y88X	Y	-	3	2	NOSIP	54752313	0.009000	0.17119	0.695000	0.30226	0.764000	0.43329	-1.471000	0.02344	-1.409000	0.02038	-0.448000	0.05591	TAC			0.647	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000465423.1			
POLD1	5424	mdanderson.org	37	19	50910291	50910291	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:50910291G>T	ENST00000440232.2	+	13	1599	c.1546G>T	c.(1546-1548)Gcc>Tcc	p.A516S	POLD1_ENST00000595904.1_Missense_Mutation_p.A516S|POLD1_ENST00000599857.1_Missense_Mutation_p.A516S	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	516					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CCTGAAGGATGCCTACCTGCC	0.672								DNA polymerases (catalytic subunits)																													p.A516S													.	.			0			c.G1546T												65.0	69.0	68.0					19																	50910291		2203	4300	6503	SO:0001583	missense	5424	exon13			AAGGATGCCTACC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1546G>T	19.37:g.50910291G>T	ENSP00000406046:p.Ala516Ser		46	0	0		46	0.07	3	NM_002691	73	0.00	0	Q8NER3|Q96H98	Missense_Mutation	SNP	ENST00000440232.2	37	CCDS12795.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493818	0.64186	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.19938	2.11	3.96	3.96	0.45880	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.28466	0.0704	M	0.65677	2.01	0.80722	D	1	P;P	0.42961	0.795;0.795	B;B	0.42422	0.316;0.387	T	0.21793	-1.0235	10	0.59425	D	0.04	-35.3512	15.6703	0.77267	0.0:0.0:1.0:0.0	.	516;516	E7EVW0;P28340	.;DPOD1_HUMAN	S	516;517	ENSP00000406046:A516S	ENSP00000366129:A517S	A	+	1	0	POLD1	55602103	1.000000	0.71417	0.983000	0.44433	0.153000	0.21895	7.074000	0.76791	2.157000	0.67596	0.313000	0.20887	GCC			0.672	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464732.1			
U2AF2	11338	mdanderson.org	37	19	56180496	56180496	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr19:56180496G>T	ENST00000308924.4	+	10	1033	c.993G>T	c.(991-993)ctG>ctT	p.L331L	CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000450554.2_Silent_p.L331L|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_Silent_p.L167L|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	331	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		AGAAGCTGCTGGTCCAGAGGG	0.662																																					p.L331L													.	.			0			c.G993T												43.0	43.0	43.0					19																	56180496		2203	4300	6503	SO:0001819	synonymous_variant	11338	exon10			GCTGCTGGTCCAG	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.993G>T	19.37:g.56180496G>T			91	0	0		49	0.06	3	NM_001012478	610	0.00	0	Q96HC5	Silent	SNP	ENST00000308924.4	37	CCDS12933.1																																																																																					0.662	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000453599.1		NM_007279	
NBAS	51594	broad.mit.edu	37	2	15359012	15359012	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:15359012C>T	ENST00000281513.5	-	48	6342	c.6317G>A	c.(6316-6318)cGc>cAc	p.R2106H	NBAS_ENST00000441750.1_Missense_Mutation_p.R1986H	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2106					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CACGTGAATGCGGGGCCGCAC	0.567																																					p.R2106H													NBAS,NS,carcinoma,-1,1	NBAS	246	1	0			c.G6317A												57.0	61.0	60.0					2																	15359012		2203	4300	6503	SO:0001583	missense	51594	exon48			TGAATGCGGGGCC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6317G>A	2.37:g.15359012C>T	ENSP00000281513:p.Arg2106His		259	0	0		202	0.02	4	NM_015909	103	0.00	0	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.413540|5.413540	0.96072|0.96072	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513	.|T;T	.|0.55052	.|0.54;0.54	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72285|0.72285	0.3441|0.3441	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.81914	.|0.995;0.912	T|T	0.74266|0.74266	-0.3721|-0.3721	5|10	.|0.87932	.|D	.|0	.|.	18.6777|18.6777	0.91534|0.91534	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1986;2106	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	T|H	1154|1986;2106	.|ENSP00000413201:R1986H;ENSP00000281513:R2106H	.|ENSP00000281513:R2106H	A|R	-|-	1|2	0|0	NBAS|NBAS	15276463|15276463	1.000000|1.000000	0.71417|0.71417	0.861000|0.861000	0.33841|0.33841	0.987000|0.987000	0.75469|0.75469	6.932000|6.932000	0.75869|0.75869	2.644000|2.644000	0.89710|0.89710	0.591000|0.591000	0.81541|0.81541	GCA|CGC			0.567	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241638.1		NM_015909	
APOB	338	broad.mit.edu	37	2	21224911	21224911	+	Silent	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:21224911T>C	ENST00000233242.1	-	29	13510	c.13383A>G	c.(13381-13383)aaA>aaG	p.K4461K	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4461					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCTTTCCCTTTTCCATCTG	0.413																																					p.K4461K													.	APOB	761		0			c.A13383G												72.0	75.0	74.0					2																	21224911		2203	4300	6503	SO:0001819	synonymous_variant	338	exon29			TTTCCCTTTTCCA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13383A>G	2.37:g.21224911T>C			165	0.0060606061	1		148	0.02	3	NM_000384	16	0.00	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																					0.413	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207571.1			
AGBL5	60509	mdanderson.org	37	2	27276346	27276346	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:27276346C>T	ENST00000360131.4	+	3	451	c.292C>T	c.(292-294)Cag>Tag	p.Q98*	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.Q98*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	98					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGAACAAGCAGAGCAAGCT	0.552																																					p.Q98X													.	.			0			c.C292T												108.0	103.0	104.0					2																	27276346		2203	4300	6503	SO:0001587	stop_gained	60509	exon3			AACAAGCAGAGCA	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.292C>T	2.37:g.27276346C>T	ENSP00000353249:p.Gln98*		84	0	0		84	0.06	5	NM_001035507	138	0.00	0	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	.	.	.	.	.	.	.	.	.	.	C	36	5.835535	0.97003	.	.	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	.	.	.	5.67	5.67	0.87782	.	0.050931	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-1.3152	18.5343	0.91004	0.0:1.0:0.0:0.0	.	.	.	.	X	98	.	ENSP00000323681:Q98X	Q	+	1	0	AGBL5	27129850	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.197000	0.77814	2.666000	0.90696	0.561000	0.74099	CAG			0.552	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000309033.1		NM_021831	
SH2D6	284948	hgsc.bcm.edu;bcgsc.ca	37	2	85662140	85662149	+	Frame_Shift_Del	DEL	CCCCACCCCA	CCCCACCCCA	-			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	CCCCACCCCA	CCCCACCCCA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:85662140_85662149delCCCCACCCCA	ENST00000340326.2	+	1	223_232	c.62_71delCCCCACCCCA	c.(61-72)cccccaccccacfs	p.PPPH21fs	Y_RNA_ENST00000384478.1_RNA|SH2D6_ENST00000389938.2_Intron|SH2D6_ENST00000481426.2_Intron	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6	21	Pro-rich.									central_nervous_system(1)|lung(2)	3						CTTTGcccacccccaccccaccccacccca	0.633																																					p.21_24del													.	SH2D6	15		0			c.61_70del																																									SO:0001589	frameshift_variant	284948	exon1			GCCCACCCCCACC	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176	ENST00000340326.2:c.62_71delCCCCACCCCA	2.37:g.85662150_85662159delCCCCACCCCA	ENSP00000341867:p.Pro21fs		354	0	0		277	0.14	40	NM_198482	0		0	A6ND14|Q6R306	Frame_Shift_Del	DEL	ENST00000340326.2	37	CCDS1976.1																																																																																					0.633	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252493.2		NM_198482	
COX5B	1329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98264520	98264520	+	Silent	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:98264520C>T	ENST00000258424.2	+	4	386	c.339C>T	c.(337-339)tgC>tgT	p.C113C	COX5B_ENST00000464949.1_3'UTR	NM_001862.2	NP_001853.2	P10606	COX5B_HUMAN	cytochrome c oxidase subunit Vb	113					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3						CCCAGCGATGCCCCCGCTGTG	0.507																																					p.C113C													.	.			0			c.C339T												49.0	48.0	49.0					2																	98264520		2203	4300	6503	SO:0001819	synonymous_variant	1329	exon4			GCGATGCCCCCGC	BC006229	CCDS2032.1	2q11.2	2011-07-04			ENSG00000135940	ENSG00000135940	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2269	protein-coding gene	gene with protein product		123866					Standard	NM_001862		Approved		uc002sya.3	P10606	OTTHUMG00000130548	ENST00000258424.2:c.339C>T	2.37:g.98264520C>T			330	0	0		277	0.26	72	NM_001862	624	0.35	221	Q53YB7|Q96J18|Q99610	Silent	SNP	ENST00000258424.2	37	CCDS2032.1																																																																																					0.507	COX5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252972.2		NM_001862	
VWA3B	200403	mdanderson.org	37	2	98914394	98914394	+	Missense_Mutation	SNP	G	G	T	rs146321928		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:98914394G>T	ENST00000477737.1	+	24	3386	c.3182G>T	c.(3181-3183)cGc>cTc	p.R1061L	AC092675.1_ENST00000401293.1_RNA|VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1061										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGTGTGAGCCGCACCCAAGCA	0.532																																					p.R1061L													.	.			0			c.G3182T												86.0	90.0	88.0					2																	98914394		2014	4166	6180	SO:0001583	missense	200403	exon24			TGAGCCGCACCCA	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3182G>T	2.37:g.98914394G>T	ENSP00000417955:p.Arg1061Leu		55	0	0		53	0.06	3	NM_144992	0		0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	7.853	0.724362	0.15439	.	.	ENSG00000168658	ENST00000477737;ENST00000358269	T	0.22945	1.93	4.93	-0.398	0.12418	.	750.824000	0.00166	N	0.000000	T	0.15652	0.0377	N	0.08118	0	0.09310	N	1	B;B	0.14805	0.011;0.006	B;B	0.19148	0.024;0.005	T	0.27806	-1.0063	10	0.40728	T	0.16	.	8.6816	0.34212	0.2741:0.4468:0.279:0.0	.	453;1061	Q502W6-5;Q502W6	.;VWA3B_HUMAN	L	1061;183	ENSP00000417955:R1061L	ENSP00000351009:R183L	R	+	2	0	VWA3B	98280826	0.000000	0.05858	0.093000	0.20910	0.314000	0.28054	0.066000	0.14489	0.036000	0.15547	-0.151000	0.13558	CGC			0.532	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353469.2		NM_144992	
AC018804.7	0	bcgsc.ca	37	2	130987132	130987132	+	RNA	SNP	C	C	T	rs77736556	byFrequency	TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:130987132C>T	ENST00000450578.1	+	0	0																											GCGTAAAGGCCGTGCCTCTGA	0.627																																					.													.	.			0			.																																											0	.			AAAGGCCGTGCCT																													2.37:g.130987132C>T			39	0	0		62	0.15	9	.	1	0.00	0		RNA	SNP	ENST00000450578.1	37																																																																																						0.627	AC018804.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000332326.2			
MCM6	4175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	136633830	136633830	+	Splice_Site	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:136633830C>T	ENST00000264156.2	-	1	166	c.106G>A	c.(106-108)Gag>Aag	p.E36K		NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	36					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CCGACTTACTCCTCCAAGAAG	0.741																																					p.E36K	Ovarian(196;141 2104 8848 24991 25939)												.	.			0			c.G106A												12.0	17.0	16.0					2																	136633830		2159	4251	6410	SO:0001630	splice_region_variant	4175	exon1			CTTACTCCTCCAA		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.107+1G>A	2.37:g.136633830C>T			47	0	0		35	0.34	12	NM_005915	111	0.32	35	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	37	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838595	0.91117	.	.	ENSG00000076003	ENST00000264156	T	0.12039	2.72	4.96	4.96	0.65561	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.22627	0.0546	M	0.76433	2.335	0.80722	D	1	B	0.27932	0.194	B	0.31869	0.137	T	0.03193	-1.1062	10	0.32370	T	0.25	-16.2858	18.4056	0.90535	0.0:1.0:0.0:0.0	.	36	Q14566	MCM6_HUMAN	K	36	ENSP00000264156:E36K	ENSP00000264156:E36K	E	-	1	0	MCM6	136350300	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.195000	0.77798	2.571000	0.86741	0.467000	0.42956	GAG			0.741	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254658.1		NM_005915	Missense_Mutation
PLEKHA3	65977	mdanderson.org	37	2	179367197	179367197	+	Intron	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:179367197G>T	ENST00000234453.5	+	8	1177					NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			tgtgaaaaaagttatctgagg	0.418																																					.													.	.			0			.																																									SO:0001627	intron_variant	100302152	.			AAAAAAGTTATCT	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.776-1290G>T	2.37:g.179367197G>T			64	0	0		49	0.06	3	.	0		0	Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	ENST00000234453.5	37	CCDS33336.1	.	.	.	.	.	.	.	.	.	.	G	1.397	-0.579215	0.03854	.	.	ENSG00000116095	ENST00000421187	.	.	.	2.46	-4.91	0.03085	.	.	.	.	.	T	0.36468	0.0968	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45056	-0.9287	5	0.87932	D	0	.	6.4252	0.21766	0.66:0.0:0.1945:0.1456	.	.	.	.	F	113	.	ENSP00000396136:V113F	V	+	1	0	PLEKHA3	179075443	0.000000	0.05858	0.000000	0.03702	0.103000	0.19146	-1.335000	0.02662	-1.999000	0.00967	-1.114000	0.02060	GTT			0.418	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335241.2		NM_019091	
TMEM169	92691	broad.mit.edu	37	2	216965047	216965047	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:216965047G>T	ENST00000295658.4	+	3	883	c.676G>T	c.(676-678)Ggc>Tgc	p.G226C	TMEM169_ENST00000454545.1_Missense_Mutation_p.G226C|TMEM169_ENST00000406027.2_Missense_Mutation_p.G226C|TMEM169_ENST00000437356.2_Missense_Mutation_p.G226C	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	226						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTTCCCTCGGCCTCTACGC	0.562																																					p.G226C													.	TMEM169	46		0			c.G676T												260.0	204.0	223.0					2																	216965047		2203	4300	6503	SO:0001583	missense	92691	exon4			TCCCTCGGCCTCT	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.676G>T	2.37:g.216965047G>T	ENSP00000295658:p.Gly226Cys		167	0	0		136	0.03	4	NM_001142310	6	0.00	0	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694799	0.68386	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.93	4.05	0.47172	.	0.156048	0.56097	D	0.000028	T	0.74749	0.3757	M	0.69823	2.125	0.51012	D	0.999902	D	0.76494	0.999	D	0.67382	0.951	T	0.75448	-0.3314	8	.	.	.	-19.2499	12.1989	0.54313	0.0818:0.0:0.9182:0.0	.	226	Q96HH4	TM169_HUMAN	C	226	.	.	G	+	1	0	TMEM169	216673292	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	9.636000	0.98440	1.297000	0.44761	0.655000	0.94253	GGC			0.562	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256666.2		NM_138390	
ESPNL	339768	mdanderson.org	37	2	239009324	239009324	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr2:239009324G>T	ENST00000343063.3	+	1	527	c.264G>T	c.(262-264)tgG>tgT	p.W88C	ESPNL_ENST00000409169.1_Missense_Mutation_p.W88C	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	88										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		AGCTGTGCTGGCTGGTCCGCG	0.741																																					p.W88C													.	.			0			c.G264T												3.0	3.0	3.0					2																	239009324		1592	3458	5050	SO:0001583	missense	339768	exon1			GTGCTGGCTGGTC	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.264G>T	2.37:g.239009324G>T	ENSP00000339115:p.Trp88Cys		14	0	0		16	0.13	2	NM_194312	0		0	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124436	0.77436	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.64991	-0.01;-0.13	4.1	4.1	0.47936	Ankyrin repeat-containing domain (4);	0.000000	0.64402	U	0.000013	T	0.64271	0.2583	N	0.16201	0.385	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.70695	-0.4801	10	0.59425	D	0.04	-15.0611	15.1014	0.72279	0.0:0.0:1.0:0.0	.	88	Q6ZVH7	ESPNL_HUMAN	C	88	ENSP00000339115:W88C;ENSP00000386577:W88C	ENSP00000339115:W88C	W	+	3	0	ESPNL	238674063	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.542000	0.90647	1.838000	0.53458	0.462000	0.41574	TGG			0.741	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257164.2		NM_194312	
BCL2L1	598	broad.mit.edu	37	20	30309595	30309595	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr20:30309595A>G	ENST00000307677.4	-	2	837	c.427T>C	c.(427-429)Ttt>Ctt	p.F143L	BCL2L1_ENST00000376055.4_Intron|BCL2L1_ENST00000376062.2_Missense_Mutation_p.F143L|BCL2L1_ENST00000420653.1_Missense_Mutation_p.F143L	NM_138578.1	NP_612815.1	Q07817	B2CL1_HUMAN	BCL2-like 1	143					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process in bone marrow (GO:0071839)|cell proliferation (GO:0008283)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to alkaloid (GO:0071312)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cytokinesis (GO:0000910)|endocytosis (GO:0006897)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fertilization (GO:0009566)|germ cell development (GO:0007281)|growth (GO:0040007)|hepatocyte apoptotic process (GO:0097284)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|release of cytochrome c from mitochondria (GO:0001836)|response to cycloheximide (GO:0046898)|response to cytokine (GO:0034097)|spermatogenesis (GO:0007283)|suppression by virus of host apoptotic process (GO:0019050)	Bcl-2 family protein complex (GO:0097136)|cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synapse (GO:0045202)	BH3 domain binding (GO:0051434)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			AAGGAGAAAAAGGCCACAATG	0.537																																					p.F143L	Colon(51;693 1004 1401 20431 21026)												.	BCL2L1	23		0			c.T427C												201.0	200.0	200.0					20																	30309595		2203	4300	6503	SO:0001583	missense	598	exon2			AGAAAAAGGCCAC	Z23115	CCDS13188.1, CCDS13189.1	20q11.21	2014-03-07			ENSG00000171552	ENSG00000171552		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	992	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 52"""	600039				8358789	Standard	NM_001191		Approved	BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, PPP1R52	uc002wwl.3	Q07817	OTTHUMG00000032192	ENST00000307677.4:c.427T>C	20.37:g.30309595A>G	ENSP00000302564:p.Phe143Leu		240	0.0041666667	1		220	0.01	3	NM_138578	412	0.00	1	E1P5L6|Q5CZ89|Q5TE65|Q92976	Missense_Mutation	SNP	ENST00000307677.4	37	CCDS13189.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.534051	0.45073	.	.	ENSG00000171552	ENST00000376062;ENST00000307677;ENST00000420653;ENST00000450273;ENST00000420488;ENST00000456404;ENST00000422920;ENST00000439267	T;T;T;T;T;T;T;T	0.05855	3.38;3.38;3.38;3.38;3.38;3.38;3.38;3.38	5.4	5.4	0.78164	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);Apoptosis regulator, Bcl-2, BH1 motif, conserved site (1);	0.051853	0.85682	D	0.000000	T	0.03095	0.0091	N	0.00879	-1.12	0.58432	D	0.999995	B	0.26081	0.141	B	0.34180	0.177	T	0.58567	-0.7614	10	0.29301	T	0.29	-7.7013	14.7657	0.69637	1.0:0.0:0.0:0.0	.	143	Q07817	B2CL1_HUMAN	L	143	ENSP00000365230:F143L;ENSP00000302564:F143L;ENSP00000405563:F143L;ENSP00000406203:F143L;ENSP00000390760:F143L;ENSP00000395545:F143L;ENSP00000411252:F143L;ENSP00000389688:F143L	ENSP00000302564:F143L	F	-	1	0	BCL2L1	29773256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.886000	0.69743	2.277000	0.76020	0.528000	0.53228	TTT			0.537	BCL2L1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078575.1		NM_138578	
HELZ2	85441	mdanderson.org	37	20	62198924	62198924	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr20:62198924G>T	ENST00000467148.1	-	6	1856	c.1787C>A	c.(1786-1788)cCc>cAc	p.P596H	HELZ2_ENST00000479540.1_5'Flank|HELZ2_ENST00000427522.2_Missense_Mutation_p.P27H	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	596	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGTGGCCTCGGGGTGGCCGCC	0.667																																					p.P596H													.	.			0			c.C1787A												14.0	12.0	13.0					20																	62198924		2150	4253	6403	SO:0001583	missense	85441	exon7			GCCTCGGGGTGGC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.1787C>A	20.37:g.62198924G>T	ENSP00000417401:p.Pro596His		43	0	0		46	0.07	3	NM_001037335	18	0.00	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304498	0.40795	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;D	0.82344	-1.42;-1.6	4.52	3.56	0.40772	ATPase, AAA+ type, core (1);	0.903362	0.09460	N	0.799149	D	0.90611	0.7056	M	0.87547	2.89	0.29277	N	0.870303	D;D	0.61697	0.98;0.99	P;P	0.57152	0.814;0.789	T	0.83058	-0.0149	10	0.51188	T	0.08	-10.8385	13.9546	0.64140	0.0:0.0:0.8474:0.1526	.	596;27	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	H	27;596	ENSP00000393257:P27H;ENSP00000417401:P596H	ENSP00000393257:P27H	P	-	2	0	RP4-697K14.7	61669368	0.092000	0.21681	0.479000	0.27329	0.005000	0.04900	2.052000	0.41316	0.890000	0.36211	0.491000	0.48974	CCC			0.667	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354127.1		NM_001037335	
MICAL3	57553	broad.mit.edu	37	22	18314645	18314645	+	Missense_Mutation	SNP	G	G	T	rs551069272		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr22:18314645G>T	ENST00000441493.2	-	21	3382	c.3030C>A	c.(3028-3030)gaC>gaA	p.D1010E		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1010	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		cctcctcctcgtcatagtcct	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		19181	0.001		0.0	False		,,,				2504	0.0				p.D1010E													.	MICAL3	53		0			c.C3030A												122.0	104.0	109.0					22																	18314645		1533	3523	5056	SO:0001583	missense	57553	exon21			CTCCTCGTCATAG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3030C>A	22.37:g.18314645G>T	ENSP00000416015:p.Asp1010Glu		144	0	0		86	0.03	3	NM_015241	4	0.00	0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	G	2.170	-0.390133	0.04932	.	.	ENSG00000093100	ENST00000441493	T	0.60672	0.17	5.27	-10.5	0.00291	.	.	.	.	.	T	0.20820	0.0501	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57854	-0.7739	9	0.02654	T	1	.	3.4957	0.07654	0.2037:0.084:0.4238:0.2885	.	1010	Q7RTP6	MICA3_HUMAN	E	1010	ENSP00000416015:D1010E	ENSP00000416015:D1010E	D	-	3	2	XXbac-B461K10.4	16694645	0.000000	0.05858	0.001000	0.08648	0.286000	0.27126	-1.791000	0.01758	-5.410000	0.00015	-1.333000	0.01266	GAC			0.527	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447351.1			
ZBTB11	27107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101371663	101371663	+	Missense_Mutation	SNP	T	T	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr3:101371663T>G	ENST00000312938.4	-	9	3009	c.2429A>C	c.(2428-2430)tAt>tCt	p.Y810S		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	810					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CACATGGGAATACCAATCTTT	0.403																																					p.Y810S													.	.			0			c.A2429C												140.0	132.0	135.0					3																	101371663		2203	4300	6503	SO:0001583	missense	27107	exon9			TGGGAATACCAAT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2429A>C	3.37:g.101371663T>G	ENSP00000326200:p.Tyr810Ser		91	0	0		69	0.30	21	NM_014415	47	0.30	14	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	37	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.154376	0.78114	.	.	ENSG00000066422	ENST00000312938	T	0.27402	1.67	4.92	4.92	0.64577	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	N	0.03999	-0.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39702	-0.9601	10	0.31617	T	0.26	-18.9494	14.8582	0.70359	0.0:0.0:0.0:1.0	.	810	O95625	ZBT11_HUMAN	S	810	ENSP00000326200:Y810S	ENSP00000326200:Y810S	Y	-	2	0	ZBTB11	102854353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	1.960000	0.56953	0.533000	0.62120	TAT			0.403	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353441.2		NM_014415	
GATA2	2624	mdanderson.org	37	3	128200738	128200738	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr3:128200738G>T	ENST00000341105.2	-	5	1398	c.1067C>A	c.(1066-1068)aCc>aAc	p.T356N	GATA2_ENST00000487848.1_Missense_Mutation_p.T356N|GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000430265.2_Missense_Mutation_p.T342N	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	356					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TAAGGTGGTGGTTGTCGTCTG	0.647			Mis		AML(CML blast transformation)																																p.T356N				Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	.	.			0			c.C1067A												106.0	85.0	92.0					3																	128200738		2203	4300	6503	SO:0001583	missense	2624	exon5			GTGGTGGTTGTCG	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1067C>A	3.37:g.128200738G>T	ENSP00000345681:p.Thr356Asn		113	0	0		101	0.05	5	NM_032638	323	0.00	0	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Missense_Mutation	SNP	ENST00000341105.2	37	CCDS3049.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563704	0.86335	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848	D;D;D	0.99470	-5.96;-5.96;-5.96	4.95	4.95	0.65309	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	0.000000	0.85682	D	0.000000	D	0.98823	0.9603	N	0.21508	0.67	0.80722	D	1	D;P	0.67145	0.996;0.566	P;B	0.61070	0.883;0.403	D	0.99919	1.1241	10	0.59425	D	0.04	-22.8129	18.1809	0.89777	0.0:0.0:1.0:0.0	.	342;356	P23769-2;P23769	.;GATA2_HUMAN	N	356;342;356	ENSP00000345681:T356N;ENSP00000400259:T342N;ENSP00000417074:T356N	ENSP00000345681:T356N	T	-	2	0	GATA2	129683428	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.922000	0.87538	2.271000	0.75665	0.591000	0.81541	ACC			0.647	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356925.1		NM_032638	
PLXND1	23129	mdanderson.org	37	3	129275264	129275264	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr3:129275264G>T	ENST00000324093.4	-	36	5847	c.5669C>A	c.(5668-5670)gCc>gAc	p.A1890D	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_Intron	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1890					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CTCCAGCGCGGCCATGATCTG	0.612																																					p.A1890D	Ovarian(97;366 1484 3738 22084 39045)												PLXND1,caecum,carcinoma,-1,1	PLXND1	-1	1	0			c.C5669A												103.0	102.0	102.0					3																	129275264		2203	4300	6503	SO:0001583	missense	23129	exon36			AGCGCGGCCATGA	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5669C>A	3.37:g.129275264G>T	ENSP00000317128:p.Ala1890Asp		103	0	0		104	0.05	5	NM_015103	579	0.00	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292110	0.40594	.	.	ENSG00000004399	ENST00000324093	T	0.33654	1.4	4.58	3.69	0.42338	.	0.550816	0.19248	N	0.119012	T	0.27489	0.0675	L	0.28115	0.83	0.80722	D	1	B;B	0.24258	0.041;0.1	B;B	0.21151	0.017;0.033	T	0.05131	-1.0904	10	0.51188	T	0.08	.	13.8349	0.63404	0.0:0.3074:0.6926:0.0	.	486;1890	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	D	1890	ENSP00000317128:A1890D	ENSP00000317128:A1890D	A	-	2	0	PLXND1	130757954	0.008000	0.16893	0.458000	0.27068	0.841000	0.47740	0.516000	0.22817	0.886000	0.36113	0.462000	0.41574	GCC			0.612	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356132.4		NM_015103	
SI	6476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164777693	164777693	+	Silent	SNP	T	T	C	rs531010619		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr3:164777693T>C	ENST00000264382.3	-	10	1205	c.1143A>G	c.(1141-1143)ccA>ccG	p.P381P		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	381	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TACTTACAAATGGTATGCCAG	0.363										HNSCC(35;0.089)			T|||	1	0.000199681	0.0008	0.0	5008	,	,		13343	0.0		0.0	False		,,,				2504	0.0				p.P381P													.	.			0			c.A1143G												207.0	230.0	222.0					3																	164777693		2203	4300	6503	SO:0001819	synonymous_variant	6476	exon10			TACAAATGGTATG	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1143A>G	3.37:g.164777693T>C			82	0	0		93	0.33	31	NM_001041	14	0.29	4	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	CCDS3196.1																																																																																					0.363	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350116.1		NM_001041	
LINC00969	440993	broad.mit.edu	37	3	195398365	195398365	+	lincRNA	SNP	T	T	G	rs202222949		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr3:195398365T>G	ENST00000445430.1	+	0	1088									long intergenic non-protein coding RNA 969																		TTAGCCAGTTTCTTTCTCAAA	0.483																																					.													.	.			0			.																																											0	.			CCAGTTTCTTTCT	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195398365T>G			8	0	0		6	0.50	3	.	0		0		RNA	SNP	ENST00000445430.1	37																																																																																						0.483	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
ZNF732	654254	hgsc.bcm.edu	37	4	265103	265103	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr4:265103T>C	ENST00000419098.1	-	4	1553	c.1543A>G	c.(1543-1545)Aca>Gca	p.T515A		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CTCAGGTATGTGGACCATCCA	0.388																																					p.T514A													ZNF732_ENST00000419098,NS,carcinoma,0,1	ZNF732_ENST00000419098	0	1	0			c.A1540G												74.0	66.0	68.0					4																	265103		692	1591	2283	SO:0001583	missense	654254	exon3			GGTATGTGGACCA	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1543A>G	4.37:g.265103T>C	ENSP00000415774:p.Thr515Ala		115	0.0086956522	1		100	0.04	4	NM_001137608	3	0.00	0		Missense_Mutation	SNP	ENST00000419098.1	37	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	T	4.709	0.131914	0.08981	.	.	ENSG00000186777	ENST00000419098	T	0.07114	3.22	0.977	-1.95	0.07548	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04497	0.0123	N	0.16478	0.41	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.38200	-0.9672	9	0.56958	D	0.05	.	4.0207	0.09664	0.4203:0.0:0.0:0.5797	.	515	B4DXR9	ZN732_HUMAN	A	515	ENSP00000415774:T515A	ENSP00000415774:T515A	T	-	1	0	ZNF732	255103	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.147000	0.03188	-0.820000	0.04318	-0.903000	0.02851	ACA			0.388	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000357937.2		NM_001137608	
PHOX2B	8929	mdanderson.org	37	4	41747890	41747890	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr4:41747890G>T	ENST00000226382.2	-	3	1238	c.879C>A	c.(877-879)agC>agA	p.S293R	RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	293					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						AAGATAGGACGCTGGCGAAGG	0.677			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.S293R			yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	.			0			c.C879A												25.0	33.0	30.0					4																	41747890		2203	4300	6503	SO:0001583	missense	8929	exon3	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TAGGACGCTGGCG	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.879C>A	4.37:g.41747890G>T	ENSP00000226382:p.Ser293Arg		69	0	0		47	0.06	3	NM_003924	0		0	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648910	0.29336	.	.	ENSG00000109132	ENST00000226382	D	0.91631	-2.88	3.93	3.09	0.35607	.	0.044651	0.85682	N	0.000000	D	0.90652	0.7068	N	0.19112	0.55	0.49483	D	0.999799	D	0.71674	0.998	D	0.74348	0.983	D	0.88938	0.3378	10	0.54805	T	0.06	.	7.5525	0.27806	0.2072:0.0:0.7928:0.0	.	293	Q99453	PHX2B_HUMAN	R	293	ENSP00000226382:S293R	ENSP00000226382:S293R	S	-	3	2	PHOX2B	41442647	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	2.924000	0.48876	0.855000	0.35359	-0.657000	0.03884	AGC			0.677	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216832.2			
CENPE	1062	mdanderson.org	37	4	104070563	104070563	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr4:104070563G>T	ENST00000265148.3	-	27	3488	c.3399C>A	c.(3397-3399)agC>agA	p.S1133R	CENPE_ENST00000380026.3_Missense_Mutation_p.S1108R	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1133					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GGAGTTGCTGGCTCTTAAAAT	0.289																																					p.S1133R													.	.			0			c.C3399A												36.0	35.0	36.0					4																	104070563		2201	4288	6489	SO:0001583	missense	1062	exon27			TTGCTGGCTCTTA	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.3399C>A	4.37:g.104070563G>T	ENSP00000265148:p.Ser1133Arg		62	0.0161290323	1		33	0.09	3	NM_001813	12	0.00	0	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385347	0.25031	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.72167	-0.63;-0.63	4.0	3.15	0.36227	.	.	.	.	.	T	0.53530	0.1802	L	0.44542	1.39	0.29564	N	0.850398	P;P	0.43701	0.815;0.514	B;B	0.33890	0.172;0.047	T	0.47058	-0.9146	9	0.18276	T	0.48	.	7.5109	0.27573	0.1193:0.0:0.8807:0.0	.	1108;1133	Q02224-3;Q02224	.;CENPE_HUMAN	R	1133;1133;1108	ENSP00000265148:S1133R;ENSP00000369365:S1108R	ENSP00000265148:S1133R	S	-	3	2	CENPE	104290012	0.008000	0.16893	0.981000	0.43875	0.980000	0.70556	0.203000	0.17315	1.012000	0.39366	0.591000	0.81541	AGC			0.289	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
TRPC3	7222	broad.mit.edu;bcgsc.ca	37	4	122853966	122853966	+	Missense_Mutation	SNP	G	G	T	rs199887234		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr4:122853966G>T	ENST00000379645.3	-	2	520	c.447C>A	c.(445-447)aaC>aaA	p.N149K	TRPC3_ENST00000513531.1_Missense_Mutation_p.N76K|TRPC3_ENST00000264811.5_Missense_Mutation_p.N76K	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	64					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GCTGCAGCGCGTTCTGGCCCA	0.637																																					p.N149K													.	TRPC3	201		0			c.C447A												60.0	54.0	56.0					4																	122853966		2203	4300	6503	SO:0001583	missense	7222	exon2			CAGCGCGTTCTGG	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.447C>A	4.37:g.122853966G>T	ENSP00000368966:p.Asn149Lys		160	0	0		104	0.06	6	NM_001130698	2	0.00	0	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571365	0.65765	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531;ENST00000502968	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.06	5.95	3.33	0.38152	.	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	L	0.58810	1.83	0.43448	D	0.995639	D;D	0.89917	0.999;1.0	D;D	0.91635	0.99;0.999	T	0.76997	-0.2751	10	0.62326	D	0.03	-38.2855	9.2419	0.37502	0.3323:0.0:0.6677:0.0	.	76;149	E9PCJ9;Q5G1L5	.;.	K	76;149;76;76	ENSP00000264811:N76K;ENSP00000368966:N149K;ENSP00000426899:N76K;ENSP00000422214:N76K	ENSP00000264811:N76K	N	-	3	2	TRPC3	123073416	0.983000	0.35010	1.000000	0.80357	0.995000	0.86356	0.258000	0.18387	0.425000	0.26087	-0.119000	0.15052	AAC			0.637	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000364252.1		NM_003305	
ARHGAP10	79658	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	148802993	148802993	+	Missense_Mutation	SNP	A	A	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr4:148802993A>G	ENST00000336498.3	+	10	1183	c.944A>G	c.(943-945)gAc>gGc	p.D315G	ARHGAP10_ENST00000414545.2_5'Flank	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TTGCAGGGGGACGGAGAGGTG	0.408																																					p.D315G													.	ARHGAP10	92		0			c.A944G												148.0	144.0	145.0					4																	148802993		2203	4300	6503	SO:0001583	missense	79658	exon10			AGGGGGACGGAGA	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.944A>G	4.37:g.148802993A>G	ENSP00000336923:p.Asp315Gly		82	0	0		56	0.07	4	NM_024605	36	0.00	0	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	37	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	A	10.50	1.368824	0.24771	.	.	ENSG00000071205	ENST00000336498	T	0.40756	1.02	4.94	4.94	0.65067	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.053409	0.85682	D	0.000000	T	0.38692	0.1050	L	0.56769	1.78	0.80722	D	1	B	0.31026	0.304	B	0.29077	0.098	T	0.19257	-1.0311	10	0.19590	T	0.45	.	14.2898	0.66270	1.0:0.0:0.0:0.0	.	315	A1A4S6	RHG10_HUMAN	G	315	ENSP00000336923:D315G	ENSP00000336923:D315G	D	+	2	0	ARHGAP10	149022443	1.000000	0.71417	0.826000	0.32828	0.073000	0.16967	8.306000	0.89962	1.853000	0.53794	0.482000	0.46254	GAC			0.408	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365005.1		NM_024605	
MOCS2	4338	mdanderson.org	37	5	52404454	52404454	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr5:52404454G>A	ENST00000361377.4	-	2	79	c.38C>T	c.(37-39)gCa>gTa	p.A13V	MOCS2_ENST00000582677.1_Missense_Mutation_p.A13V|MOCS2_ENST00000450852.3_Missense_Mutation_p.A13V|MOCS2_ENST00000396954.3_5'UTR|MOCS2_ENST00000527216.1_Missense_Mutation_p.A8V|MOCS2_ENST00000510818.2_Missense_Mutation_p.A13V|CTD-2366F13.1_ENST00000499459.2_RNA|CTD-2366F13.1_ENST00000512301.1_RNA|CTD-2366F13.1_ENST00000502171.2_RNA|MOCS2_ENST00000508922.1_Missense_Mutation_p.A13V|MOCS2_ENST00000584946.1_Missense_Mutation_p.A13V					molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				AGCACTTTTTGCAAAATACAA	0.368																																					p.A13V													.	.			0			c.C38T												84.0	75.0	78.0					5																	52404454		1829	4089	5918	SO:0001583	missense	4338	exon2			CTTTTTGCAAAAT	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000361377.4:c.38C>T	5.37:g.52404454G>A	ENSP00000355160:p.Ala13Val		79	0	0		45	0.07	3	NM_176806	94	0.00	0		Missense_Mutation	SNP	ENST00000361377.4	37	CCDS47205.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160780	0.94727	.	.	ENSG00000164172	ENST00000361377;ENST00000510818;ENST00000450852;ENST00000508922	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.96	5.96	0.96718	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	.	.	.	.	D	0.90772	0.7103	.	.	.	0.39116	D	0.961578	D	0.89917	1.0	D	0.87578	0.998	D	0.91566	0.5268	8	0.87932	D	0	.	20.0324	0.97544	0.0:0.0:1.0:0.0	.	13	O96033	MOC2A_HUMAN	V	13	ENSP00000355160:A13V;ENSP00000424267:A13V;ENSP00000411022:A13V;ENSP00000426274:A13V	ENSP00000355160:A13V	A	-	2	0	MOCS2	52440211	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.674000	0.83992	2.832000	0.97577	0.655000	0.94253	GCA			0.368	MOCS2-004	KNOWN	alternative_3_UTR|NMD_exception|basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000367796.3		NM_183418	
TTC37	9652	mdanderson.org	37	5	94803686	94803686	+	Silent	SNP	G	G	T	rs372395062		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr5:94803686G>T	ENST00000358746.2	-	42	4802	c.4504C>A	c.(4504-4506)Cgg>Agg	p.R1502R		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1502						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						AAAAGACGCCGTGTCTCTCTG	0.368																																					p.R1502R													.	.			0			c.C4504A												80.0	76.0	77.0					5																	94803686		2203	4300	6503	SO:0001819	synonymous_variant	9652	exon42			GACGCCGTGTCTC	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.4504C>A	5.37:g.94803686G>T			79	0	0		41	0.07	3	NM_014639	152	0.00	0	O15077|Q6PJI3	Silent	SNP	ENST00000358746.2	37	CCDS4072.1																																																																																					0.368	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241651.1		NM_014639	
CAMK4	814	mdanderson.org	37	5	110730442	110730442	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr5:110730442G>T	ENST00000282356.4	+	5	819	c.421G>T	c.(421-423)Gct>Tct	p.A141S	CAMK4_ENST00000512453.1_Missense_Mutation_p.A141S	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	141	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TGAGCGAGATGCTGCAGATGC	0.393																																					p.A141S													.	.			0			c.G421T												143.0	143.0	143.0					5																	110730442		2202	4300	6502	SO:0001583	missense	814	exon5			CGAGATGCTGCAG	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.421G>T	5.37:g.110730442G>T	ENSP00000282356:p.Ala141Ser		87	0.0114942529	1		43	0.07	3	NM_001744	17	0.00	0	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024727	0.93518	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.68025	-0.3;-0.3;-0.3	5.65	5.65	0.86999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	M	0.65498	2.005	0.58432	D	0.999995	D	0.69078	0.997	D	0.77004	0.989	T	0.82442	-0.0455	10	0.87932	D	0	.	18.5035	0.90890	0.0:0.0:1.0:0.0	.	141	Q16566	KCC4_HUMAN	S	141	ENSP00000426940:A141S;ENSP00000422634:A141S;ENSP00000282356:A141S	ENSP00000282356:A141S	A	+	1	0	CAMK4	110758341	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.627000	0.83176	2.680000	0.91292	0.467000	0.42956	GCT			0.393	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250719.2		NM_001744	
ADAM19	8728	hgsc.bcm.edu	37	5	156915307	156915307	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr5:156915307G>T	ENST00000517905.1	-	21	2560	c.2516C>A	c.(2515-2517)cCa>cAa	p.P839Q	ADAM19_ENST00000430702.2_Missense_Mutation_p.P572Q|ADAM19_ENST00000257527.4_Missense_Mutation_p.P839Q|ADAM19_ENST00000394020.1_Missense_Mutation_p.P841Q			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	839					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGGGGAATTGGCCGGCTTGG	0.567																																					p.P839Q													.	.			0			c.C2516A												93.0	99.0	97.0					5																	156915307		2203	4300	6503	SO:0001583	missense	8728	exon21			GGAATTGGCCGGC	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2516C>A	5.37:g.156915307G>T	ENSP00000428654:p.Pro839Gln		137	0	0		88	0.05	4	NM_033274	32	0.00	0	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.24|18.24	3.579162|3.579162	0.65878|0.65878	.|.	.|.	ENSG00000135074|ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905|ENST00000517374	T;T;T;T|.	0.02140|.	4.43;4.57;4.59;4.54|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.66237|0.66237	0.2769|0.2769	L|L	0.41492|0.41492	1.28|1.28	0.54753|0.54753	D|D	0.999982|0.999982	D;D;D|.	0.89917|.	0.996;1.0;0.999|.	D;D;D|.	0.85130|.	0.936;0.997;0.974|.	T|T	0.61098|0.61098	-0.7131|-0.7131	10|5	0.72032|.	D|.	0.01|.	.|.	17.9944|17.9944	0.89178|0.89178	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	839;839;572|.	Q9H013-2;Q9H013;E9PD32|.	.;ADA19_HUMAN;.|.	Q|K	572;839;841;839|410	ENSP00000414088:P572Q;ENSP00000257527:P839Q;ENSP00000377588:P841Q;ENSP00000428654:P839Q|.	ENSP00000257527:P839Q|.	P|Q	-|-	2|1	0|0	ADAM19|ADAM19	156847885|156847885	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.329000|0.329000	0.28539|0.28539	5.816000|5.816000	0.69222|0.69222	2.688000|2.688000	0.91661|0.91661	0.491000|0.491000	0.48974|0.48974	CCA|CAA			0.567	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000373918.1		NM_033274	
ABCF1	23	mdanderson.org	37	6	30552321	30552321	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr6:30552321C>T	ENST00000326195.8	+	14	1481	c.1369C>T	c.(1369-1371)Cgc>Tgc	p.R457C	ABCF1_ENST00000376545.3_Missense_Mutation_p.R419C|MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	457	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						AGGGGGCTGGCGCATGCGTGT	0.622																																					p.R457C													.	.			0			c.C1369T												84.0	76.0	79.0					6																	30552321		1508	2708	4216	SO:0001583	missense	23	exon14			GGCTGGCGCATGC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1369C>T	6.37:g.30552321C>T	ENSP00000313603:p.Arg457Cys		45	0	0		48	0.06	3	NM_001025091	139	0.00	0	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696377	0.68386	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000455943	D;D	0.94793	-3.52;-3.52	4.98	3.15	0.36227	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.155494	0.53938	D	0.000049	D	0.96667	0.8912	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.96228	0.9166	10	0.87932	D	0	-6.0206	8.9403	0.35725	0.2985:0.5569:0.1446:0.0	.	419;457;457	Q2L6I2;Q8NE71;A2BF75	.;ABCF1_HUMAN;.	C	457;419;436	ENSP00000313603:R457C;ENSP00000365728:R419C	ENSP00000313603:R457C	R	+	1	0	ABCF1	30660300	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.142000	0.42177	0.645000	0.30675	0.462000	0.41574	CGC			0.622	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076137.3			
NELFE	7936	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31922436	31922437	+	Frame_Shift_Del	DEL	TC	TC	-	rs556062290	byFrequency	TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	TC	TC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr6:31922436_31922437delTC	ENST00000375429.3	-	7	863_864	c.637_638delGA	c.(637-639)gacfs	p.D213fs	MIR1236_ENST00000408340.1_RNA|NELFE_ENST00000444811.2_Frame_Shift_Del_p.D183fs|NELFE_ENST00000375425.5_Frame_Shift_Del_p.D220fs	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	213	30 X 2 AA approximate tandem repeats of R-[DSNE].				gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ccgctctctgtctctgtctcga	0.663																																					p.213_213del													.	.			0			c.638_639del																																									SO:0001589	frameshift_variant	7936	exon7			TCTCTGTCTCTGT	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.637_638delGA	6.37:g.31922438_31922439delTC	ENSP00000364578:p.Asp213fs		130	0	0		133	0.17	23	NM_002904	399	0.00	0	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Frame_Shift_Del	DEL	ENST00000375429.3	37	CCDS4730.1																																																																																					0.663	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000076047.4			
COL12A1	1303	mdanderson.org	37	6	75798829	75798829	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr6:75798829G>T	ENST00000322507.8	-	64	9312	c.9003C>A	c.(9001-9003)ggC>ggA	p.G3001G	COL12A1_ENST00000416123.2_Silent_p.G2925G|COL12A1_ENST00000345356.6_Silent_p.G1837G|COL12A1_ENST00000483888.2_Silent_p.G2997G|COL12A1_ENST00000511023.1_5'Flank	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	3001	Triple-helical region (COL1) with 2 imperfections.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TACCTGGGGGGCCAGGCAGCC	0.478																																					p.G3001G													.	.			0			c.C9003A												34.0	38.0	37.0					6																	75798829		1816	4071	5887	SO:0001819	synonymous_variant	1303	exon64			TGGGGGGCCAGGC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.9003C>A	6.37:g.75798829G>T			49	0	0		38	0.08	3	NM_004370	242	0.00	1	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1																																																																																					0.478	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041249.3		NM_004370	
FERD3L	222894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	19184670	19184670	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:19184670C>T	ENST00000275461.3	-	1	374	c.316G>A	c.(316-318)Gcc>Acc	p.A106T	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	106	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						CGGATGTTGGCGGCCTGGCGC	0.602																																					p.A106T													FERD3L,NS,carcinoma,0,1	FERD3L	0	1	0			c.G316A												87.0	73.0	78.0					7																	19184670		2203	4300	6503	SO:0001583	missense	222894	exon1			TGTTGGCGGCCTG	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.316G>A	7.37:g.19184670C>T	ENSP00000275461:p.Ala106Thr		108	0	0		104	0.36	37	NM_152898	0		0	Q495K0	Missense_Mutation	SNP	ENST00000275461.3	37	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	C	35	5.495559	0.96355	.	.	ENSG00000146618	ENST00000275461	D	0.98120	-4.73	5.66	5.66	0.87406	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.98682	0.9558	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.99731	1.1012	10	0.87932	D	0	-7.2535	19.751	0.96268	0.0:1.0:0.0:0.0	.	106	Q96RJ6	FER3L_HUMAN	T	106	ENSP00000275461:A106T	ENSP00000275461:A106T	A	-	1	0	FERD3L	19151195	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.693000	0.91896	0.650000	0.86243	GCC			0.602	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207627.1			
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			110	0.0090909091	1		113	0.03	3	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
ERVW-1	30816	ucsc.edu;bcgsc.ca	37	7	92098776	92098776	+	Missense_Mutation	SNP	C	C	T	rs10266695	byFrequency	TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:92098776C>T	ENST00000493463.2	-	1	1843	c.920G>A	c.(919-921)aGt>aAt	p.S307N	ERVW-1_ENST00000604270.1_Intron|AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000603053.1_Missense_Mutation_p.S307N	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	307			S -> N (in dbSNP:rs10266695). {ECO:0000269|PubMed:10693809, ECO:0000269|PubMed:11990458, ECO:0000269|PubMed:14757826}.		anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						tatgacataactgtataaatc	0.443													T|||	1198	0.239217	0.3011	0.2032	5008	,	,		19781	0.3313		0.1958	False		,,,				2504	0.1309				.													.	.			0			.							T	ASN/SER,ASN/SER	1211,3195	706.1+/-407.3	154,903,1146	107.0	116.0	113.0		920,920	0.1	0.1	7	dbSNP_119	113	1598,7002	743.2+/-407.2	156,1286,2858	no	missense,missense	ERVW-1	NM_001130925.1,NM_014590.3	46,46	310,2189,4004	TT,TC,CC		18.5814,27.4852,21.5977	,	307/539,307/539	92098776	2809,10197	2203	4300	6503	SO:0001583	missense	30816	.			ACATAACTGTATA	AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.920G>A	7.37:g.92098776C>T	ENSP00000419945:p.Ser307Asn		72	0.0138888889	1		13	0.31	4	.	0		0	B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	ENST00000493463.2	37	CCDS5626.1	553	0.2532051282051282	135	0.27439024390243905	83	0.2292817679558011	187	0.3269230769230769	148	0.19525065963060687	T	0.029	-1.345723	0.01266	0.274852	0.185814	ENSG00000242950	ENST00000493463	T	0.18502	2.21	0.0465	0.0465	0.14256	.	0.261548	0.12722	U	0.444651	T	0.00012	0.0000	N	0.12887	0.27	0.80722	P	0.0	.	.	.	.	.	.	T	0.46331	-0.9199	6	0.15066	T	0.55	.	.	.	.	rs10266695;rs13445539;rs56651367;rs10266695	.	.	.	N	307	ENSP00000419945:S307N	ENSP00000419945:S307N	S	-	2	0	ERVW-1	91936712	0.256000	0.24012	0.102000	0.21198	0.102000	0.19082	-1.255000	0.02872	-1.579000	0.01646	-1.611000	0.00801	AGT			0.443	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254009.2		NM_014590	
MEPCE	56257	mdanderson.org	37	7	100028001	100028001	+	Silent	SNP	C	C	G			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:100028001C>G	ENST00000310512.2	+	1	748	c.360C>G	c.(358-360)ggC>ggG	p.G120G	ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank|MEPCE_ENST00000414441.1_Intron|ZCWPW1_ENST00000398027.2_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	120	Gly-rich.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGGAGGGGGCGGGACAGAGC	0.756																																					p.G120G													.	.			0			c.C360G												3.0	4.0	4.0					7																	100028001		1105	2437	3542	SO:0001819	synonymous_variant	56257	exon1			AGGGGGCGGGACA	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.360C>G	7.37:g.100028001C>G			10	0	0		15	0.20	3	NM_019606	8	0.00	0	B3KP86|D6W5V7|Q9NPD4	Silent	SNP	ENST00000310512.2	37	CCDS5693.1																																																																																					0.756	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339135.1			
PCOLCE	5118	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	100203305	100203305	+	Missense_Mutation	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:100203305G>A	ENST00000223061.5	+	5	875	c.595G>A	c.(595-597)Gcg>Acg	p.A199T	PCOLCE-AS1_ENST00000446022.1_RNA|PCOLCE-AS1_ENST00000442166.2_RNA|PCOLCE-AS1_ENST00000544873.1_RNA	NM_002593.3	NP_002584.2	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	199	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				multicellular organismal development (GO:0007275)|positive regulation of peptidase activity (GO:0010952)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCAGGTCATCGCGCTGACCTT	0.682																																					p.A199T													.	.			0			c.G595A												17.0	17.0	17.0					7																	100203305		2183	4288	6471	SO:0001583	missense	5118	exon5			GTCATCGCGCTGA	L33799	CCDS5700.1	7q22	2008-07-18			ENSG00000106333	ENSG00000106333			8738	protein-coding gene	gene with protein product	"""procollagen, type 1, COOH-terminal proteinase enhancer"", ""procollagen C-proteinase enhancer 1"""	600270				8824813, 9799793	Standard	NM_002593		Approved	PCPE, PCPE1	uc003uvo.3	Q15113	OTTHUMG00000156675	ENST00000223061.5:c.595G>A	7.37:g.100203305G>A	ENSP00000223061:p.Ala199Thr		237	0	0		204	0.28	58	NM_002593	1555	0.30	459	B2R9E1|O14550	Missense_Mutation	SNP	ENST00000223061.5	37	CCDS5700.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945255	0.53079	.	.	ENSG00000106333	ENST00000223061	T	0.17370	2.28	5.04	-1.29	0.09288	CUB (5);	0.737792	0.12876	N	0.431897	T	0.06280	0.0162	N	0.03209	-0.39	0.20764	N	0.999859	B	0.17268	0.021	B	0.20384	0.029	T	0.33394	-0.9870	10	0.38643	T	0.18	0.7893	5.23	0.15416	0.2771:0.0:0.3424:0.3806	.	199	Q15113	PCOC1_HUMAN	T	199	ENSP00000223061:A199T	ENSP00000223061:A199T	A	+	1	0	PCOLCE	100041241	0.931000	0.31567	0.728000	0.30774	0.664000	0.39144	0.752000	0.26362	-0.502000	0.06596	0.467000	0.42956	GCG			0.682	PCOLCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345285.1		NM_002593	
FOXP2	93986	mdanderson.org	37	7	114270000	114270000	+	Silent	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:114270000G>A	ENST00000393494.2	+	5	816	c.537G>A	c.(535-537)caG>caA	p.Q179Q	FOXP2_ENST00000390668.3_Silent_p.Q203Q|FOXP2_ENST00000408937.3_Silent_p.Q204Q|FOXP2_ENST00000350908.4_Silent_p.Q179Q|FOXP2_ENST00000403559.4_Silent_p.Q196Q|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000378237.3_Silent_p.Q179Q|FOXP2_ENST00000393500.3_Silent_p.Q104Q|FOXP2_ENST00000393491.3_Silent_p.Q87Q|FOXP2_ENST00000360232.4_Silent_p.Q179Q|FOXP2_ENST00000393498.2_Silent_p.Q159Q|FOXP2_ENST00000393489.3_Silent_p.Q87Q			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcaacaacagcagcagcagc	0.498																																					p.Q204Q													FOXP2,NS,carcinoma,0,6	FOXP2	0	6	1	Substitution - coding silent(1)	lung(1)	c.G612A												41.0	38.0	39.0					7																	114270000		2199	4282	6481	SO:0001819	synonymous_variant	93986	exon6			ACAACAGCAGCAG	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.537G>A	7.37:g.114270000G>A			28	0	0		18	0.11	2	NM_148898	42	0.02	1	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	CCDS5760.1																																																																																					0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317366.1		NM_014491	
REPIN1	29803	mdanderson.org	37	7	150068974	150068974	+	Missense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr7:150068974G>T	ENST00000425389.2	+	1	722	c.644G>T	c.(643-645)cGg>cTg	p.R215L	REPIN1_ENST00000489432.2_Missense_Mutation_p.R272L|REPIN1_ENST00000397281.2_Missense_Mutation_p.R215L|REPIN1_ENST00000479668.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000444957.1_Missense_Mutation_p.R215L|REPIN1_ENST00000540729.1_Missense_Mutation_p.R215L	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	215					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CTggggccccggcccaggggc	0.721																																					p.R272L													.	.			0			c.G815T												7.0	10.0	9.0					7																	150068974		1730	3856	5586	SO:0001583	missense	29803	exon3			GGCCCCGGCCCAG	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.644G>T	7.37:g.150068974G>T	ENSP00000388287:p.Arg215Leu		37	0	0		36	0.08	3	NM_001099695	91	0.00	0	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	ENST00000425389.2	37	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065843	0.76187	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	T;T;T;T;T;T;T	0.07444	3.22;3.22;3.22;3.19;3.44;3.26;3.22	5.08	5.08	0.68730	.	.	.	.	.	T	0.13586	0.0329	N	0.08118	0	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.74023	0.982;0.982	T	0.34179	-0.9839	9	0.72032	D	0.01	-13.6971	15.9814	0.80114	0.0:0.0:1.0:0.0	.	272;215	C9J3L7;Q9BWE0	.;REPI1_HUMAN	L	215;215;215;272;274;275;215	ENSP00000445016:R215L;ENSP00000380451:R215L;ENSP00000407714:R215L;ENSP00000417291:R272L;ENSP00000419789:R274L;ENSP00000419872:R275L;ENSP00000388287:R215L	ENSP00000380451:R215L	R	+	2	0	REPIN1	149699907	0.003000	0.15002	0.957000	0.39632	0.991000	0.79684	0.179000	0.16840	2.353000	0.79882	0.462000	0.41574	CGG			0.721	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000376940.1		NM_014374	
ZHX2	22882	broad.mit.edu	37	8	123966158	123966158	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr8:123966158C>T	ENST00000314393.4	+	3	3243	c.2408C>T	c.(2407-2409)gCg>gTg	p.A803V		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	803					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GAGGAGGATGCGATCTCAGAT	0.622																																					p.A803V	Esophageal Squamous(94;1056 1388 11767 13799 49639)												.	ZHX2	106		0			c.C2408T												109.0	85.0	93.0					8																	123966158		2203	4300	6503	SO:0001583	missense	22882	exon3			AGGATGCGATCTC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2408C>T	8.37:g.123966158C>T	ENSP00000314709:p.Ala803Val		148	0	0		165	0.03	5	NM_014943	62	0.00	0		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901268	0.52227	.	.	ENSG00000178764	ENST00000314393	T	0.18960	2.18	6.04	4.16	0.48862	.	0.312006	0.29876	N	0.010969	T	0.14485	0.0350	L	0.27053	0.805	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.14839	-1.0458	10	0.52906	T	0.07	-13.4376	9.3439	0.38096	0.1059:0.7139:0.1143:0.0659	.	803	Q9Y6X8	ZHX2_HUMAN	V	803	ENSP00000314709:A803V	ENSP00000314709:A803V	A	+	2	0	ZHX2	124035339	0.002000	0.14202	0.269000	0.24586	0.446000	0.32137	0.624000	0.24462	1.576000	0.49790	0.561000	0.74099	GCG			0.622	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381709.1		NM_014943	
PRSS3	5646	ucsc.edu	37	9	33798037	33798037	+	Silent	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr9:33798037T>C	ENST00000361005.5	+	3	582	c.582T>C	c.(580-582)acT>acC	p.T194T	PRSS3_ENST00000342836.4_Silent_p.T151T|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Silent_p.T137T|PRSS3_ENST00000429677.3_Silent_p.T130T	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	194	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTGCTGGCACTGAGTGCCTCA	0.562																																					p.T194T													PRSS3_ENST00000361005,NS,carcinoma,0,3	PRSS3	79	3	0			c.T582C												161.0	127.0	138.0					9																	33798037		2203	4300	6503	SO:0001819	synonymous_variant	5646	exon3			TGGCACTGAGTGC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.582T>C	9.37:g.33798037T>C			125	0	0		100	0.03	3	NM_007343	45	0.67	30	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																					0.562	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1	rescued with RNA-seq	NM_002771	
Unknown	0	bcgsc.ca	37	9	45376198	45376198	+	IGR	SNP	G	G	A	rs146422224		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr9:45376198G>A								RP11-449H15.2 (163697 upstream) : RP11-187C18.5 (17646 downstream)																							CATCCGGCTCGCGGACCAAAC	0.532																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441420	.			CGGCTCGCGGACC																													9.37:g.45376198G>A			38	0	0		43	0.16	7	.	0		0		RNA	SNP		37																																																																																					0	0.532										
Unknown	0	bcgsc.ca	37	9	68728891	68728891	+	IGR	SNP	C	C	T	rs144596557		TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr9:68728891C>T								CR786580.1 (215704 upstream) : AL353763.2 (268517 downstream)																							atgaagaaACCCAGCTTGATA	0.279																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGAAACCCAGCTT																													9.37:g.68728891C>T			103	0.0291262136	3		70	0.11	8	.	226	0.01	3		RNA	SNP		37																																																																																					0	0.279										
SPTAN1	6709	mdanderson.org	37	9	131337577	131337577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chr9:131337577G>T	ENST00000372731.4	+	5	714	c.604G>T	c.(604-606)Gaa>Taa	p.E202*	SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.E202*|SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.E202*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	202					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GGCTGCTCATGAAGAAAGAGT	0.378																																					p.E202X	NSCLC(120;833 1744 2558 35612 37579)												.	.			0			c.G604T												81.0	85.0	84.0					9																	131337577		2203	4300	6503	SO:0001587	stop_gained	6709	exon5			GCTCATGAAGAAA	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.604G>T	9.37:g.131337577G>T	ENSP00000361816:p.Glu202*		64	0	0		45	0.09	4	NM_003127	67	0.00	0	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Nonsense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	38	6.791923	0.97841	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	19.0874	0.93209	0.0:0.0:1.0:0.0	.	.	.	.	X	202	.	ENSP00000350882:E202X	E	+	1	0	SPTAN1	130377398	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.350000	0.97070	2.762000	0.94881	0.467000	0.42956	GAA			0.378	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054472.1		NM_003127	
MT-ND2	4536	broad.mit.edu	37	M	1868	1868	+	5'Flank	SNP	G	G	A			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chrM:1868G>A	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ATGAATTAACTAGAAATAACT	0.403																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			TAACTAGAAATAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1868G>A	Exception_encountered		14	0	0		4	1.00	4	.	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																						0.403	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
FAM9A	171482	mdanderson.org	37	X	8763195	8763195	+	Missense_Mutation	SNP	C	C	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chrX:8763195C>T	ENST00000543214.1	-	7	890	c.755G>A	c.(754-756)gGa>gAa	p.G252E	FAM9A_ENST00000381003.3_Missense_Mutation_p.G252E	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	252	Glu-rich.|Poly-Gly.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				tcctcctcctccttcttctcc	0.463																																					p.G252E													.	.			0			c.G755A												42.0	36.0	38.0					X																	8763195		2193	4278	6471	SO:0001583	missense	171482	exon7			CCTCCTCCTTCTT		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.755G>A	X.37:g.8763195C>T	ENSP00000440163:p.Gly252Glu		18	0	0		36	0.08	3	NM_174951	0		0	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	t	0	-2.786172	0.00078	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.507	-1.01	0.10169	.	.	.	.	.	T	0.15046	0.0363	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19160	-1.0314	7	0.87932	D	0	.	.	.	.	.	252	Q8IZU1	FAM9A_HUMAN	E	252	.	ENSP00000370391:G252E	G	-	2	0	FAM9A	8723195	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-1.395000	0.02516	-1.592000	0.01619	-1.314000	0.01303	GGA			0.463	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055697.1		NM_174951	
SPIN2A	54466	broad.mit.edu	37	X	57162583	57162583	+	Missense_Mutation	SNP	T	T	C			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chrX:57162583T>C	ENST00000374908.1	-	1	847	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	SPIN2A_ENST00000374906.3_Missense_Mutation_p.M150V			Q99865	SPI2A_HUMAN	spindlin family, member 2A	150					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				breast(1)|kidney(1)|ovary(1)	3						GCTAAGACCATCCCCCTCCAT	0.413																																					p.M150V													.	SPIN2A	7		0			c.A448G												88.0	79.0	82.0					X																	57162583		2201	4294	6495	SO:0001583	missense	54466	exon2			AGACCATCCCCCT	Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.448A>G	X.37:g.57162583T>C	ENSP00000364043:p.Met150Val		389	0.0025706941	1		667	0.01	7	NM_019003	0		0	O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	ENST00000374908.1	37	CCDS35312.1	.	.	.	.	.	.	.	.	.	.	.	10.86	1.471027	0.26423	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.45276	0.9;0.9	2.74	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	L	0.33753	1.03	0.39768	D	0.972128	P	0.42827	0.791	P	0.62740	0.906	T	0.32428	-0.9907	10	0.23302	T	0.38	-23.7792	8.4178	0.32681	0.0:0.0:0.0:1.0	.	150	Q99865	SPI2A_HUMAN	V	150	ENSP00000364043:M150V;ENSP00000364041:M150V	ENSP00000364041:M150V	M	-	1	0	SPIN2A	57179308	1.000000	0.71417	0.997000	0.53966	0.897000	0.52465	6.373000	0.73128	1.327000	0.45338	0.345000	0.21793	ATG			0.413	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058915.1		NM_019003	
ARHGAP4	393	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	153174596	153174596	+	Silent	SNP	G	G	T			TCGA-SN-A84W-01A-11D-A435-10	TCGA-SN-A84W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7cc41d24-e0f3-46ee-a8a3-52a28666742b	b4c25462-07cf-4f0c-a865-a6dcc36a802b	g.chrX:153174596G>T	ENST00000350060.5	-	21	2576	c.2535C>A	c.(2533-2535)gcC>gcA	p.A845A	ARHGAP4_ENST00000537206.1_Silent_p.A822A|ARHGAP4_ENST00000370016.1_Silent_p.A824A|ARHGAP4_ENST00000370028.3_Silent_p.A885A|ARHGAP4_ENST00000393721.1_Silent_p.A667A|ARHGAP4_ENST00000467421.1_5'Flank	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	845					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGGTCCCATGGCCTCAGGTG	0.647																																					p.A885A													.	.			0			c.C2655A												99.0	72.0	81.0					X																	153174596		2203	4300	6503	SO:0001819	synonymous_variant	393	exon22			TCCCATGGCCTCA	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2535C>A	X.37:g.153174596G>T			40	0	0		61	0.08	5	NM_001164741	70	0.00	0	Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	37	CCDS14736.1																																																																																					0.647	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000061119.1		NM_001666	
