#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ZBTB48	3104	mdanderson.org	37	1	6646792	6646792	+	Missense_Mutation	SNP	G	G	T	rs368975120		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:6646792G>T	ENST00000377674.4	+	5	1240	c.1082G>T	c.(1081-1083)cGa>cTa	p.R361L		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	361					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		ACATTCCGCCGAAGGATGGAG	0.647																																					p.R361L	Esophageal Squamous(125;1449 1657 4031 29866 49542)												.	ZBTB48	33		0			c.G1082T												89.0	65.0	73.0					1																	6646792		2203	4300	6503	SO:0001583	missense	3104	exon5			TCCGCCGAAGGAT	BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1082G>T	1.37:g.6646792G>T	ENSP00000366902:p.Arg361Leu		62	0	0		56	0.05	3	NM_005341	82	0.00	0	Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053065	0.75960	.	.	ENSG00000204859	ENST00000377674	T	0.60548	0.18	5.45	4.51	0.55191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.257049	0.44285	N	0.000470	T	0.45538	0.1347	L	0.28344	0.845	0.47214	D	0.999353	B	0.12013	0.005	B	0.12156	0.007	T	0.32375	-0.9909	10	0.36615	T	0.2	-30.8533	14.8503	0.70292	0.0:0.0:0.8553:0.1447	.	361	P10074	ZBT48_HUMAN	L	361	ENSP00000366902:R361L	ENSP00000366902:R361L	R	+	2	0	ZBTB48	6569379	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.447000	0.60020	1.406000	0.46857	0.561000	0.74099	CGA			0.647	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004193.1		NM_005341	
PADI2	11240	mdanderson.org	37	1	17431436	17431436	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:17431436G>T	ENST00000375486.4	-	2	276	c.213C>A	c.(211-213)ctC>ctA	p.L71L	PADI2_ENST00000375481.1_Silent_p.L71L|PADI2_ENST00000444885.2_Silent_p.L71L	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	71					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TGCTGGGCGAGAGAAGCCAGC	0.662																																					p.L71L													.	PADI2	72		0			c.C213A												52.0	46.0	48.0					1																	17431436		2203	4300	6503	SO:0001819	synonymous_variant	11240	exon2			GGGCGAGAGAAGC	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.213C>A	1.37:g.17431436G>T			38	0	0		39	0.08	3	NM_007365	40	0.00	0	Q96DA7|Q9UPN2	Silent	SNP	ENST00000375486.4	37	CCDS177.1																																																																																					0.662	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006624.1			
PADI2	11240	mdanderson.org	37	1	17431515	17431515	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:17431515G>T	ENST00000375486.4	-	2	197	c.134C>A	c.(133-135)tCg>tAg	p.S45*	PADI2_ENST00000375481.1_Nonsense_Mutation_p.S45*|PADI2_ENST00000444885.2_Nonsense_Mutation_p.S45*	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	45					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	CACGTGTTCCGAGTGCTTCAG	0.667																																					p.S45X													.	PADI2	72		0			c.C134A												43.0	41.0	42.0					1																	17431515		2203	4300	6503	SO:0001587	stop_gained	11240	exon2			TGTTCCGAGTGCT	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.134C>A	1.37:g.17431515G>T	ENSP00000364635:p.Ser45*		47	0	0		50	0.06	3	NM_007365	40	0.00	0	Q96DA7|Q9UPN2	Nonsense_Mutation	SNP	ENST00000375486.4	37	CCDS177.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337135	0.60963	.	.	ENSG00000117115	ENST00000375486;ENST00000444885;ENST00000375481	.	.	.	4.93	4.93	0.64822	.	0.134489	0.48767	D	0.000170	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9917	13.6651	0.62389	0.0:0.0:1.0:0.0	.	.	.	.	X	45	.	ENSP00000364630:S45X	S	-	2	0	PADI2	17304102	1.000000	0.71417	0.935000	0.37517	0.064000	0.16182	5.237000	0.65360	2.267000	0.75376	0.655000	0.94253	TCG			0.667	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006624.1			
KIF17	57576	mdanderson.org	37	1	21031250	21031250	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:21031250G>T	ENST00000247986.2	-	5	1123	c.813C>A	c.(811-813)ggC>ggA	p.G271G	KIF17_ENST00000400463.3_Silent_p.G271G|KIF17_ENST00000375044.1_Silent_p.G171G			Q9P2E2	KIF17_HUMAN	kinesin family member 17	271	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		AGATGACATTGCCCAGTGCCG	0.672																																					p.G271G													.	KIF17	130		0			c.C813A												76.0	77.0	77.0					1																	21031250		2203	4300	6503	SO:0001819	synonymous_variant	57576	exon5			GACATTGCCCAGT	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.813C>A	1.37:g.21031250G>T			52	0	0		50	0.06	3	NM_020816	5	0.00	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																					0.672	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276995.1		NM_020816	
RPS6KA1	6195	mdanderson.org	37	1	26898408	26898408	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:26898408G>T	ENST00000374168.2	+	19	1975	c.1821G>T	c.(1819-1821)atG>atT	p.M607I	RPS6KA1_ENST00000530003.1_Missense_Mutation_p.M591I|RPS6KA1_ENST00000531382.1_Missense_Mutation_p.M616I|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.M596I|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.M515I|RPS6KA1_ENST00000526792.1_Missense_Mutation_p.M515I	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	607	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		TGTACACCATGCTGGCAGGGT	0.627																																					p.M616I													.	RPS6KA1	65		0			c.G1848T												51.0	47.0	48.0					1																	26898408		2203	4300	6503	SO:0001583	missense	6195	exon18			CACCATGCTGGCA	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1821G>T	1.37:g.26898408G>T	ENSP00000363283:p.Met607Ile		16	0	0		34	0.09	3	NM_001006665	215	0.00	0	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	CCDS284.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075731	0.76415	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000531382	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.16	5.16	0.70880	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.036467	0.85682	D	0.000000	T	0.50292	0.1607	N	0.13140	0.3	0.80722	D	1	D;D;B	0.76494	0.999;0.961;0.31	D;P;B	0.85130	0.997;0.798;0.282	T	0.58758	-0.7580	10	0.87932	D	0	.	18.8434	0.92194	0.0:0.0:1.0:0.0	.	591;616;607	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	I	607;596;515;515;591;616	ENSP00000363283:M607I;ENSP00000363281:M596I;ENSP00000431651:M515I;ENSP00000363277:M515I;ENSP00000432281:M591I;ENSP00000435412:M616I	ENSP00000363277:M515I	M	+	3	0	RPS6KA1	26770995	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.602000	0.98312	2.678000	0.91216	0.563000	0.77884	ATG			0.627	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011431.1		NM_002953	
MECR	51102	bcgsc.ca	37	1	29542572	29542572	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:29542572G>T	ENST00000263702.6	-	3	376	c.351C>A	c.(349-351)agC>agA	p.S117R	MECR_ENST00000489248.1_5'UTR|MECR_ENST00000373791.3_Missense_Mutation_p.S41R			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	117					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		CGGTCACATTGCTGCCCACCG	0.537																																					p.S117R													.	MECR	31		0			c.C351A												143.0	128.0	133.0					1																	29542572		2203	4300	6503	SO:0001583	missense	51102	exon3			CACATTGCTGCCC		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.351C>A	1.37:g.29542572G>T	ENSP00000263702:p.Ser117Arg		124	0	0		134	0.05	7	NM_016011	75	0.00	0	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503409	0.26949	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792	T;T	0.49139	0.79;0.79	5.53	4.61	0.57282	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.548925	0.23964	N	0.042837	T	0.39091	0.1065	L	0.41961	1.31	0.39093	D	0.961132	B	0.12013	0.005	B	0.25291	0.059	T	0.39099	-0.9630	10	0.52906	T	0.07	-20.5192	7.6867	0.28544	0.0851:0.0:0.7543:0.1606	.	117	Q9BV79	MECR_HUMAN	R	41;117;29	ENSP00000362896:S41R;ENSP00000263702:S117R	ENSP00000263702:S117R	S	-	3	2	MECR	29415159	0.165000	0.22948	0.955000	0.39395	0.355000	0.29361	1.721000	0.38032	2.617000	0.88574	0.549000	0.68633	AGC			0.537	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130740.1		NM_016011	
TCHH	7062	hgsc.bcm.edu	37	1	152082320	152082320	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:152082320T>C	ENST00000368804.1	-	2	3372	c.3373A>G	c.(3373-3375)Aga>Gga	p.R1125G		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1125	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cgttcctctctcagcagctgc	0.612																																					p.R1125G													TCHH,NS,carcinoma,0,5	TCHH	0	5	0			c.A3373G												93.0	94.0	94.0					1																	152082320		1979	4139	6118	SO:0001583	missense	7062	exon3			CCTCTCTCAGCAG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3373A>G	1.37:g.152082320T>C	ENSP00000357794:p.Arg1125Gly		85	0.0117647059	1		120	0.06	7	NM_007113	0		0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	T	5.521	0.281051	0.10458	.	.	ENSG00000159450	ENST00000368804	T	0.06849	3.25	2.38	1.02	0.19986	.	.	.	.	.	T	0.04407	0.0121	L	0.29908	0.895	0.09310	N	1	D	0.58268	0.982	P	0.59171	0.853	T	0.40590	-0.9555	9	0.28530	T	0.3	.	5.1512	0.15011	0.0:0.0:0.3026:0.6974	.	1125	Q07283	TRHY_HUMAN	G	1125	ENSP00000357794:R1125G	ENSP00000357794:R1125G	R	-	1	2	TCHH	150348944	0.001000	0.12720	0.006000	0.13384	0.018000	0.09664	1.171000	0.31896	0.940000	0.37473	0.379000	0.24179	AGA			0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036671.2		NM_007113	
GON4L	54856	ucsc.edu	37	1	155726782	155726782	+	Silent	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:155726782C>T	ENST00000368331.1	-	27	5532	c.5484G>A	c.(5482-5484)agG>agA	p.R1828R	GON4L_ENST00000271883.5_Silent_p.R1828R|GON4L_ENST00000437809.1_Silent_p.R1828R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1828					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTCTTTTTTCCTCTTGTTCT	0.438																																					p.R1828R													.	GON4L	392		0			c.G5484A												120.0	114.0	116.0					1																	155726782		1859	4096	5955	SO:0001819	synonymous_variant	54856	exon27			TTTTTTCCTCTTG	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5484G>A	1.37:g.155726782C>T			132	0	0		194	0.01	1	NM_001037533	76	0.16	12	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																						0.438	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_032292	
SNAP47	116841	mdanderson.org	37	1	227947187	227947187	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr1:227947187G>T	ENST00000366759.4	+	3	1537		c.e3+1		SNAP47_ENST00000315781.5_Splice_Site|SNAP47_ENST00000366760.1_Splice_Site	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa						long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TGGCATGCAGGTTAGTGACCG	0.527																																					.													.	SNAP47	42		0			c.1123+1G>T												100.0	104.0	102.0					1																	227947187		2203	4300	6503	SO:0001630	splice_region_variant	116841	exon3			ATGCAGGTTAGTG	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.1123+1G>T	1.37:g.227947187G>T			77	0	0		80	0.05	4	NM_053052	0		0	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Splice_Site	SNP	ENST00000366759.4	37	CCDS1562.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193734	0.38707	.	.	ENSG00000143740	ENST00000366760;ENST00000366759;ENST00000315781;ENST00000418653;ENST00000426344	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7667	0.62999	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNAP47	226013810	1.000000	0.71417	0.999000	0.59377	0.209000	0.24338	6.380000	0.73158	2.623000	0.88846	0.561000	0.74099	.			0.527	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091961.1		NM_053052	Intron
JMJD1C	221037	broad.mit.edu	37	10	64958278	64958278	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr10:64958278T>C	ENST00000399262.2	-	12	5704	c.5486A>G	c.(5485-5487)aAg>aGg	p.K1829R	JMJD1C_ENST00000402544.1_Missense_Mutation_p.K1610R|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000542921.1_Missense_Mutation_p.K1647R	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1829					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTTACCATCCTTTTTCACCCA	0.294																																					p.K1829R													.	JMJD1C	347		0			c.A5486G												115.0	117.0	117.0					10																	64958278		1828	4062	5890	SO:0001583	missense	221037	exon12			CCATCCTTTTTCA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5486A>G	10.37:g.64958278T>C	ENSP00000382204:p.Lys1829Arg		129	0	0		118	0.03	3	NM_032776	31	0.00	0	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.348496	0.82132	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	T;T;T	0.55930	0.85;0.49;0.85	5.17	5.17	0.71159	.	0.046729	0.85682	D	0.000000	T	0.64057	0.2564	L	0.39566	1.225	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.85130	0.997;0.874	T	0.63060	-0.6721	10	0.39692	T	0.17	-13.4039	15.2997	0.73936	0.0:0.0:0.0:1.0	.	1829;1647	Q15652;A0T124	JHD2C_HUMAN;.	R	1829;1610;1647	ENSP00000382204:K1829R;ENSP00000384990:K1610R;ENSP00000444682:K1647R	ENSP00000382204:K1829R	K	-	2	0	JMJD1C	64628284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.908000	0.87438	2.073000	0.62155	0.397000	0.26171	AAG			0.294	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048249.2		NM_004241	
CNNM1	26507	broad.mit.edu	37	10	101124187	101124187	+	Missense_Mutation	SNP	T	T	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr10:101124187T>G	ENST00000356713.4	+	5	2331	c.2042T>G	c.(2041-2043)gTg>gGg	p.V681G	CNNM1_ENST00000370528.3_Missense_Mutation_p.V610G|CNNM1_ENST00000370534.4_Missense_Mutation_p.V316G|CNNM1_ENST00000446890.1_Missense_Mutation_p.V610G	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	681					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.V316G(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		AAAGTGGAGGTGGAGGTTGGT	0.433																																					p.V681G													CNNM1,extremity,malignant_melanoma,0,1	CNNM1	101	1	1	Substitution - Missense(1)	skin(1)	c.T2042G												88.0	69.0	75.0					10																	101124187		2203	4300	6503	SO:0001583	missense	26507	exon5			TGGAGGTGGAGGT	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.2042T>G	10.37:g.101124187T>G	ENSP00000349147:p.Val681Gly		49	0.2040816327	10		45	0.24	11	NM_020348	0		0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242197	0.79912	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	D;D;D;D	0.90676	-2.65;-2.71;-2.63;-1.6	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.96112	0.8733	M	0.90542	3.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.999;0.996	D;D;D;D	0.81914	0.995;0.979;0.971;0.969	D	0.96895	0.9656	10	0.87932	D	0	-22.9685	15.9362	0.79712	0.0:0.0:0.0:1.0	.	316;681;316;681	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	G	681;610;610;316;134	ENSP00000349147:V681G;ENSP00000406492:V610G;ENSP00000359559:V610G;ENSP00000359565:V316G	ENSP00000349147:V681G	V	+	2	0	CNNM1	101114177	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.841000	0.86834	2.170000	0.68504	0.379000	0.24179	GTG			0.433	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049792.2		NM_020348	
MUC2	4583	mdanderson.org	37	11	1093304	1093304	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:1093304C>T	ENST00000441003.2	+	30	5150	c.5123C>T	c.(5122-5124)aCc>aTc	p.T1708I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1675I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	actacggtgaccccaacccca	0.637																																					p.T1708I													.	MUC2	614		0			c.C5123T																																									SO:0001583	missense	4583	exon30			CGGTGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5123C>T	11.37:g.1093304C>T	ENSP00000415183:p.Thr1708Ile		27	0	0		33	0.09	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.180	-0.168188	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11063	2.81;2.83	1.6	1.6	0.23607	.	1.229070	0.07278	U	0.870357	T	0.07458	0.0188	.	.	.	0.09310	N	1	P	0.50617	0.937	B	0.37780	0.258	T	0.33904	-0.9850	9	0.37606	T	0.19	.	6.598	0.22685	0.0:1.0:0.0:0.0	.	1708	E7EUV1	.	I	1708;1675	ENSP00000415183:T1708I;ENSP00000351956:T1675I	ENSP00000351956:T1675I	T	+	2	0	MUC2	1083304	0.000000	0.05858	0.007000	0.13788	0.026000	0.11368	0.014000	0.13333	0.903000	0.36546	0.184000	0.17185	ACC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MOB2	81532	broad.mit.edu	37	11	1501963	1501963	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:1501963G>C	ENST00000329957.6	-	2	452	c.263C>G	c.(262-264)gCc>gGc	p.A88G	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	57					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)	4						ACTGTTGCTGGCCAGCCACTC	0.682																																					p.A88G													.	MOB2	23		0			c.C263G												25.0	28.0	28.0					11																	1501963		1955	4134	6089	SO:0001583	missense	81532	exon2			TTGCTGGCCAGCC		CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.263C>G	11.37:g.1501963G>C	ENSP00000328694:p.Ala88Gly		84	0.0476190476	4		65	0.12	8	NM_001172223	65	0.02	1	B4DKP3|Q96M67	Missense_Mutation	SNP	ENST00000329957.6	37	CCDS53591.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881211	0.91740	.	.	ENSG00000182208	ENST00000329957	.	.	.	5.36	4.45	0.53987	.	0.000000	0.85682	D	0.000000	D	0.86527	0.5954	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90294	0.4325	9	0.87932	D	0	-30.4157	14.0951	0.65016	0.0725:0.0:0.9275:0.0	.	88;57	E9PDA5;Q70IA6	.;MOB2_HUMAN	G	88	.	ENSP00000328694:A88G	A	-	2	0	AC091196.1	1458539	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.492000	0.97957	1.266000	0.44231	0.462000	0.41574	GCC			0.682	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000384770.1		NM_053005	
EIF3F	8665	mdanderson.org	37	11	8013657	8013657	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:8013657G>T	ENST00000533626.1	+	5	1088	c.462G>T	c.(460-462)aaG>aaT	p.K154N	EIF3F_ENST00000309828.4_Missense_Mutation_p.K154N|EIF3F_ENST00000449102.2_Missense_Mutation_p.K5N|EIF3F_ENST00000537635.1_Missense_Mutation_p.K169N					eukaryotic translation initiation factor 3, subunit F											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)	13				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AATTTGCTAAGAATATGTATG	0.453																																					p.K154N													.	EIF3F	23		0			c.G462T												58.0	54.0	55.0					11																	8013657		2201	4296	6497	SO:0001583	missense	8665	exon3			TGCTAAGAATATG	U94855, AK093511	CCDS7785.1	11p15.4	2010-03-10	2007-07-27	2007-07-27	ENSG00000175390	ENSG00000175390			3275	protein-coding gene	gene with protein product		603914	"""eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa"""	EIF3S5		9341143	Standard	NM_003754		Approved	eIF3-epsilon, eIF3-p47, eIF3f	uc001mfw.3	O00303		ENST00000533626.1:c.462G>T	11.37:g.8013657G>T	ENSP00000431800:p.Lys154Asn		41	0	0		39	0.08	3	NM_003754	229	0.00	0		Missense_Mutation	SNP	ENST00000533626.1	37	CCDS7785.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614969	0.46631	.	.	ENSG00000175390	ENST00000533626;ENST00000537635;ENST00000309828;ENST00000538607;ENST00000449102	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.53562	0.1804	L	0.58925	1.835	0.58432	D	0.999998	B	0.25486	0.127	B	0.31869	0.137	T	0.58423	-0.7639	10	0.66056	D	0.02	-22.3421	15.588	0.76502	0.0:0.0:1.0:0.0	.	154	O00303	EIF3F_HUMAN	N	154;169;154;104;5	ENSP00000431800:K154N;ENSP00000442283:K169N;ENSP00000310040:K154N;ENSP00000396929:K5N	ENSP00000310040:K154N	K	+	3	2	EIF3F	7970233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.966000	0.49208	2.452000	0.82932	0.644000	0.83932	AAG			0.453	EIF3F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000385713.2		NM_003754	
SBF2	81846	mdanderson.org	37	11	9801975	9801975	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:9801975G>T	ENST00000256190.8	-	40	5677	c.5540C>A	c.(5539-5541)tCt>tAt	p.S1847Y	SBF2-AS1_ENST00000498905.2_RNA|SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000525636.1_RNA|SBF2-AS1_ENST00000527406.1_RNA|SBF2-AS1_ENST00000499953.2_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1847	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TCAGGCATCAGAGATACAACT	0.478																																					p.S1847Y													.	SBF2	146		0			c.C5540A												131.0	110.0	117.0					11																	9801975		2201	4294	6495	SO:0001583	missense	81846	exon40			GCATCAGAGATAC	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.5540C>A	11.37:g.9801975G>T	ENSP00000256190:p.Ser1847Tyr		60	0	0		53	0.06	3	NM_030962	40	0.00	0	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736827	0.89482	.	.	ENSG00000133812	ENST00000256190	T	0.78003	-1.14	5.93	5.01	0.66863	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.049759	0.85682	D	0.000000	D	0.88288	0.6396	M	0.83603	2.65	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.89235	0.3580	10	0.72032	D	0.01	.	14.5412	0.67997	0.0697:0.0:0.9303:0.0	.	1847	Q86WG5	MTMRD_HUMAN	Y	1847	ENSP00000256190:S1847Y	ENSP00000256190:S1847Y	S	-	2	0	SBF2	9758551	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.907000	0.87430	2.814000	0.96858	0.655000	0.94253	TCT			0.478	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386911.2		NM_030962	
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			196	0	0		167	0.07	12	NM_004476	3	0.00	0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
OR5F1	338674	mdanderson.org	37	11	55761334	55761334	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:55761334G>T	ENST00000278409.1	-	1	767	c.768C>A	c.(766-768)atC>atA	p.I256I		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	256					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GGTAAGTATAGATGCAGGTGG	0.483																																					p.I256I													.	OR5F1	116		0			c.C768A												93.0	91.0	92.0					11																	55761334		2201	4296	6497	SO:0001819	synonymous_variant	338674	exon1			AGTATAGATGCAG	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.768C>A	11.37:g.55761334G>T			92	0	0		92	0.04	4	NM_003697	0		0	Q495D1|Q6IFB9	Silent	SNP	ENST00000278409.1	37	CCDS31515.1																																																																																					0.483	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391532.1		NM_003697	
TMX2	51075	mdanderson.org	37	11	57479594	57479594	+	5'Flank	SNP	C	C	T	rs202123309		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:57479594C>T	ENST00000278422.4	+	0	0				TMX2_ENST00000378312.4_5'Flank|TMX2-CTNND1_ENST00000528395.1_5'Flank|MED19_ENST00000431606.2_Missense_Mutation_p.A20T|MED19_ENST00000337672.2_Missense_Mutation_p.A20T	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2						cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						AAGCCGAGTGCGGTTGGGGGC	0.721																																					p.A20T													.	MED19	15		0			c.G58A												11.0	12.0	11.0					11																	57479594		1951	3822	5773	SO:0001631	upstream_gene_variant	219541	exon1			CGAGTGCGGTTGG	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200		11.37:g.57479594C>T	Exception_encountered		71	0	0		62	0.05	3	NM_153450	17	0.00	0	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Missense_Mutation	SNP	ENST00000278422.4	37	CCDS7967.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.529081	0.85706	.	.	ENSG00000156603	ENST00000337672;ENST00000431606	.	.	.	5.56	2.54	0.30619	.	0.396250	0.28031	N	0.016879	T	0.25975	0.0633	L	0.27053	0.805	0.09310	N	0.999998	B;B	0.19073	0.001;0.033	B;B	0.15052	0.001;0.012	T	0.19484	-1.0304	9	0.66056	D	0.02	-5.4252	4.9475	0.13997	0.1531:0.6183:0.1478:0.0808	.	20;20	A0JLT2-2;A0JLT2	.;MED19_HUMAN	T	20	.	ENSP00000337340:A20T	A	-	1	0	MED19	57236170	0.806000	0.28996	0.023000	0.16930	0.925000	0.55904	0.991000	0.29654	0.250000	0.21479	0.491000	0.48974	GCA			0.721	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393708.1		NM_015959	
DDB1	1642	broad.mit.edu	37	11	61071379	61071379	+	Silent	SNP	C	C	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:61071379C>A	ENST00000301764.7	-	22	3187	c.2790G>T	c.(2788-2790)gtG>gtT	p.V930V	DDB1_ENST00000451943.2_5'Flank|DDB1_ENST00000538470.1_5'Flank|DDB1_ENST00000450997.2_Silent_p.V241V	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	930	Interaction with CDT1 and CUL4A.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						CAAGCAGCAGCACTGAGCGCA	0.567								Nucleotide excision repair (NER)																													p.V930V													.	DDB1	100		0			c.G2790T												166.0	156.0	159.0					11																	61071379		2203	4299	6502	SO:0001819	synonymous_variant	1642	exon22			CAGCAGCACTGAG	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2790G>T	11.37:g.61071379C>A			109	0.0183486239	2		111	0.06	7	NM_001923	838	0.01	11	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Silent	SNP	ENST00000301764.7	37	CCDS31576.1																																																																																					0.567	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398816.1		NM_001923	
PITPNM1	9600	mdanderson.org	37	11	67265611	67265611	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:67265611C>A	ENST00000534749.1	-	10	1855	c.1667G>T	c.(1666-1668)tGt>tTt	p.C556F	PITPNM1_ENST00000436757.2_Missense_Mutation_p.C556F|PITPNM1_ENST00000356404.3_Missense_Mutation_p.C556F			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	556					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GACCTGCCCACAGAAGCCGGC	0.657																																					p.C556F	GBM(28;144 709 4607 5525)												.	PITPNM1	84		0			c.G1667T												42.0	41.0	42.0					11																	67265611		2200	4294	6494	SO:0001583	missense	9600	exon11			TGCCCACAGAAGC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1667G>T	11.37:g.67265611C>A	ENSP00000437286:p.Cys556Phe		30	0	0		24	0.08	2	NM_001130848	57	0.00	0	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	c	13.99	2.401989	0.42613	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.18657	2.2;2.2;2.2	4.94	3.98	0.46160	.	0.000000	0.56097	D	0.000031	T	0.19005	0.0456	N	0.14661	0.345	0.25513	N	0.987445	P;P	0.49696	0.927;0.88	P;B	0.49999	0.628;0.438	T	0.05801	-1.0863	10	0.72032	D	0.01	-22.2056	12.7992	0.57576	0.0:0.6916:0.3084:0.0	.	556;556	O00562-2;O00562	.;PITM1_HUMAN	F	556	ENSP00000437286:C556F;ENSP00000398787:C556F;ENSP00000348772:C556F	ENSP00000348772:C556F	C	-	2	0	PITPNM1	67022187	0.025000	0.19082	0.997000	0.53966	0.684000	0.39900	0.698000	0.25571	2.293000	0.77203	0.556000	0.70494	TGT			0.657	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395520.1		NM_004910	
FAM181B	220382	mdanderson.org	37	11	82443763	82443763	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr11:82443763G>T	ENST00000329203.3	-	1	1143	c.1009C>A	c.(1009-1011)Ctg>Atg	p.L337M		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	337	Pro-rich.									large_intestine(1)|lung(2)|prostate(1)	4						GGGGCAGTCAGGGGGCTCTTT	0.711																																					p.L337M													.	FAM181B	14		0			c.C1009A												1.0	1.0	1.0					11																	82443763		890	2221	3111	SO:0001583	missense	220382	exon1			CAGTCAGGGGGCT	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.1009C>A	11.37:g.82443763G>T	ENSP00000365295:p.Leu337Met		49	0	0		49	0.06	3	NM_175885	0		0	B2RWP1	Missense_Mutation	SNP	ENST00000329203.3	37	CCDS31648.1	.	.	.	.	.	.	.	.	.	.	G	3.344	-0.134067	0.06711	.	.	ENSG00000182103	ENST00000329203	T	0.42513	0.97	5.03	1.97	0.26223	.	1.007950	0.07991	U	0.987060	T	0.40619	0.1124	L	0.27053	0.805	0.09310	N	1	P	0.51791	0.948	P	0.53102	0.718	T	0.26395	-1.0104	9	.	.	.	.	7.4692	0.27338	0.0903:0.3153:0.5944:0.0	.	337	A6NEQ2	F181B_HUMAN	M	337	ENSP00000365295:L337M	.	L	-	1	2	FAM181B	82121411	.	.	0.001000	0.08648	0.078000	0.17371	.	.	0.114000	0.18032	0.491000	0.48974	CTG			0.711	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391626.1		NM_175885	
FGF23	8074	mdanderson.org	37	12	4488714	4488714	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:4488714G>T	ENST00000237837.1	-	1	180	c.35C>A	c.(34-36)gCc>gAc	p.A12D		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	12					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			GCTGCACAAGGCACAGACCCA	0.632																																					p.A12D													.	FGF23	57		0			c.C35A												41.0	36.0	38.0					12																	4488714		2203	4300	6503	SO:0001583	missense	8074	exon1			CACAAGGCACAGA	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.35C>A	12.37:g.4488714G>T	ENSP00000237837:p.Ala12Asp		27	0	0		34	0.12	4	NM_020638	0		0	Q4V758	Missense_Mutation	SNP	ENST00000237837.1	37	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686145	0.29962	.	.	ENSG00000118972	ENST00000237837	T	0.80909	-1.43	3.74	-2.81	0.05805	.	1.544930	0.03309	N	0.190216	T	0.62245	0.2412	N	0.08118	0	0.09310	N	1	B	0.29716	0.255	B	0.27170	0.077	T	0.55321	-0.8159	10	0.59425	D	0.04	-5.9389	6.8058	0.23777	0.6288:0.0:0.2447:0.1265	.	12	Q9GZV9	FGF23_HUMAN	D	12	ENSP00000237837:A12D	ENSP00000237837:A12D	A	-	2	0	FGF23	4358975	0.016000	0.18221	0.040000	0.18447	0.979000	0.70002	0.024000	0.13555	-0.565000	0.06061	0.655000	0.94253	GCC			0.632	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398936.1			
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K													TUBA1C,colon,carcinoma,0,1	TUBA1C	32	1	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A												56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A			227	0.0837004405	19		312	0.09	27	NM_032704	1918	0.53	1010		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																					0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404424.1		NM_032704	
NAV3	89795	bcgsc.ca;mdanderson.org	37	12	78513322	78513322	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:78513322G>T	ENST00000397909.2	+	15	3519	c.3346G>T	c.(3346-3348)Ggt>Tgt	p.G1116C	NAV3_ENST00000536525.2_Missense_Mutation_p.G1116C|NAV3_ENST00000228327.6_Missense_Mutation_p.G1116C|NAV3_ENST00000266692.7_Missense_Mutation_p.G1116C			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1116	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGTTTGGACGGTTCACAGAA	0.483										HNSCC(70;0.22)																											p.G1116C													.	NAV3	506		0			c.G3346T												85.0	86.0	85.0					12																	78513322		1999	4173	6172	SO:0001583	missense	89795	exon15			TTGGACGGTTCAC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3346G>T	12.37:g.78513322G>T	ENSP00000381007:p.Gly1116Cys		110	0	0		126	0.04	5	NM_014903	0		0	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.480833|4.480833	0.84747|0.84747	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692|ENST00000552895	T;T;T;T|.	0.29397|.	1.57;1.57;1.57;1.57|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.40908|.	U|.	0.000981|.	T|T	0.75766|0.75766	0.3894|0.3894	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	T|T	0.72984|0.72984	-0.4125|-0.4125	10|5	0.49607|.	T|.	0.09|.	-18.0188|-18.0188	19.949|19.949	0.97192|0.97192	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1116;1116;1116;1116|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	C|L	1116|187	ENSP00000446132:G1116C;ENSP00000381007:G1116C;ENSP00000228327:G1116C;ENSP00000266692:G1116C|.	ENSP00000228327:G1116C|.	G|R	+|+	1|2	0|0	NAV3|NAV3	77037453|77037453	1.000000|1.000000	0.71417|0.71417	0.876000|0.876000	0.34364|0.34364	0.983000|0.983000	0.72400|0.72400	9.582000|9.582000	0.98214|0.98214	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	GGT|CGG			0.483	NAV3-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000406812.1		NM_001024383	
SART3	9733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	108938917	108938917	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:108938917G>A	ENST00000228284.3	-	4	961	c.727C>T	c.(727-729)Cgg>Tgg	p.R243W	SART3_ENST00000552221.1_5'Flank|SART3_ENST00000431469.2_Missense_Mutation_p.R243W	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	243					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						GTACTCACCCGAGCAGCTTCC	0.483									Porokeratosis																												p.R243W													.	.			0			c.C727T												177.0	178.0	178.0					12																	108938917		2203	4300	6503	SO:0001583	missense	9733	exon4	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	TCACCCGAGCAGC	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.727C>T	12.37:g.108938917G>A	ENSP00000228284:p.Arg243Trp		198	0	0		193	0.25	49	NM_014706	63	0.29	18	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.	.	.	.	.	.	.	.	.	.	G	34	5.313642	0.95655	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000412617;ENST00000546815;ENST00000550322;ENST00000550619	T;T;T;T;T	0.50813	1.19;1.19;1.31;1.19;0.73	5.97	5.97	0.96955	.	0.109583	0.64402	D	0.000004	T	0.64091	0.2567	L	0.49778	1.585	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.998;0.998	P;P;P;P	0.62298	0.9;0.784;0.623;0.714	T	0.63717	-0.6574	10	0.87932	D	0	-30.3605	20.428	0.99075	0.0:0.0:1.0:0.0	.	191;243;243;243	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	W	243;243;191;243;111;111	ENSP00000228284:R243W;ENSP00000414453:R243W;ENSP00000449386:R243W;ENSP00000447324:R111W;ENSP00000449602:R111W	ENSP00000228284:R243W	R	-	1	2	SART3	107463047	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.623000	0.90957	2.837000	0.97791	0.655000	0.94253	CGG			0.483	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404094.1			
OAS1	4938	broad.mit.edu	37	12	113354329	113354329	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:113354329G>T	ENST00000202917.5	+	4	933	c.670G>T	c.(670-672)Ggg>Tgg	p.G224W	OAS1_ENST00000551241.1_Missense_Mutation_p.G224W|OAS1_ENST00000445409.2_Missense_Mutation_p.G224W|OAS1_ENST00000452357.2_Missense_Mutation_p.G224W|RP1-71H24.1_ENST00000552784.1_RNA	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	224					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						GAAGAAGCTTGGGAAGCTGCC	0.473																																					p.G224W													.	OAS1	128		0			c.G670T												59.0	57.0	58.0					12																	113354329		2203	4300	6503	SO:0001583	missense	4938	exon4			AAGCTTGGGAAGC	X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.670G>T	12.37:g.113354329G>T	ENSP00000202917:p.Gly224Trp		115	0	0		132	0.03	4	NM_001032409	188	0.00	0	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	ENST00000202917.5	37	CCDS41838.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494446	0.44352	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000550883;ENST00000551241;ENST00000377508;ENST00000550689	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	4.53	3.6	0.41247	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	1.069840	0.07277	N	0.870097	T	0.66992	0.2846	M	0.84773	2.715	0.22412	N	0.99913	D;D;D;P;D	0.89917	1.0;0.999;1.0;0.922;0.999	D;D;D;B;D	0.83275	0.996;0.933;0.996;0.395;0.989	T	0.43507	-0.9387	10	0.87932	D	0	-21.871	7.0888	0.25272	0.1328:0.0:0.8672:0.0	.	224;224;224;224;224	E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;OAS1_HUMAN;.;.	W	224;224;224;66;224;224;220	ENSP00000202917:G224W;ENSP00000388001:G224W;ENSP00000415721:G224W;ENSP00000450286:G66W;ENSP00000448790:G224W;ENSP00000448348:G220W	ENSP00000202917:G224W	G	+	1	0	OAS1	111838712	0.000000	0.05858	0.690000	0.30148	0.792000	0.44763	0.160000	0.16462	1.056000	0.40484	0.563000	0.77884	GGG			0.473	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000405896.2			
RASAL1	8437	mdanderson.org	37	12	113565942	113565942	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:113565942T>C	ENST00000261729.5	-	4	479	c.164A>G	c.(163-165)gAg>gGg	p.E55G	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Missense_Mutation_p.E55G|RASAL1_ENST00000548055.1_Missense_Mutation_p.E55G|RASAL1_ENST00000546530.1_Missense_Mutation_p.E55G			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	55	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CGTGTACTCCTCCCCCCAGAA	0.617																																					p.E55G													.	RASAL1	89		0			c.A164G												183.0	183.0	183.0					12																	113565942		2203	4300	6503	SO:0001583	missense	8437	exon4			TACTCCTCCCCCC	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.164A>G	12.37:g.113565942T>C	ENSP00000261729:p.Glu55Gly		44	0	0		47	0.06	3	NM_001193520	5	0.00	0	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.793246	0.90453	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.12	5.12	0.69794	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92014	0.7470	H	0.97415	4	0.46396	D	0.999023	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;0.999	D	0.94502	0.7710	10	0.87932	D	0	.	13.8909	0.63738	0.0:0.0:0.0:1.0	.	55;55;55;67;55;55;55	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	G	55	ENSP00000450244:E55G;ENSP00000261729:E55G;ENSP00000395920:E55G;ENSP00000448510:E55G	ENSP00000261729:E55G	E	-	2	0	RASAL1	112050325	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	7.259000	0.78381	1.939000	0.56221	0.402000	0.26972	GAG			0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000405522.2		NM_004658	
TPCN1	53373	mdanderson.org	37	12	113714756	113714756	+	Silent	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:113714756C>T	ENST00000335509.6	+	11	1289	c.975C>T	c.(973-975)gaC>gaT	p.D325D	TPCN1_ENST00000541517.1_Silent_p.D397D|TPCN1_ENST00000550785.1_Silent_p.D397D|TPCN1_ENST00000392569.4_Silent_p.D257D	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	325					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CCTTCAATGACATTGAGAAAC	0.557																																					p.D397D													.	TPCN1	109		0			c.C1191T												184.0	179.0	181.0					12																	113714756		2203	4300	6503	SO:0001819	synonymous_variant	53373	exon12			CAATGACATTGAG	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.975C>T	12.37:g.113714756C>T			48	0	0		48	0.06	3	NM_001143819	60	0.07	4	A7E258|Q86XS9|Q8NC20	Silent	SNP	ENST00000335509.6	37	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	C	9.757	1.169083	0.21621	.	.	ENSG00000186815	ENST00000546781	.	.	.	5.56	4.68	0.58851	.	.	.	.	.	T	0.62146	0.2404	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60347	-0.7281	4	.	.	.	-49.0722	10.4428	0.44474	0.0:0.8503:0.0:0.1497	.	.	.	.	Y	12	.	.	H	+	1	0	TPCN1	112199139	0.975000	0.34042	1.000000	0.80357	0.925000	0.55904	0.109000	0.15417	1.352000	0.45808	0.609000	0.83330	CAT			0.557	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405156.3		NM_017901	
EP400	57634	hgsc.bcm.edu	37	12	132547105	132547105	+	Silent	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr12:132547105G>A	ENST00000333577.4	+	48	8410	c.8301G>A	c.(8299-8301)caG>caA	p.Q2767Q	EP400_ENST00000330386.6_Silent_p.Q2650Q|EP400_ENST00000389562.2_Silent_p.Q2730Q|EP400_ENST00000389561.2_Silent_p.Q2731Q|EP400_ENST00000332482.4_Silent_p.Q2694Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2767	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcagcagcagc	0.587																																					p.Q2731Q													.	.			0			c.G8193A												22.0	27.0	25.0					12																	132547105		2072	4019	6091	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8301G>A	12.37:g.132547105G>A			96	0	0		101	0.09	9	NM_015409	33	0.00	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																						0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015409	
HSPH1	10808	mdanderson.org	37	13	31727066	31727066	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr13:31727066G>T	ENST00000320027.5	-	5	796	c.452C>A	c.(451-453)gCt>gAt	p.A151D	HSPH1_ENST00000380405.4_Missense_Mutation_p.A151D|HSPH1_ENST00000445273.2_Missense_Mutation_p.A153D|HSPH1_ENST00000429785.2_Intron|HSPH1_ENST00000380406.5_Missense_Mutation_p.A110D	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	151					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TCGCCTCTCAGCATCTGTAAA	0.363																																					p.A151D													.	HSPH1	65		0			c.C452A												161.0	157.0	159.0					13																	31727066		2203	4299	6502	SO:0001583	missense	10808	exon5			CTCTCAGCATCTG	AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.452C>A	13.37:g.31727066G>T	ENSP00000318687:p.Ala151Asp		67	0	0		50	0.06	3	NM_006644	72	0.00	0	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	ENST00000320027.5	37	CCDS9340.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516977	0.85495	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000438061	T;T;T;T	0.01113	5.32;5.32;5.32;5.32	5.15	5.15	0.70609	.	0.211412	0.40469	N	0.001081	T	0.09247	0.0228	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D	0.67145	0.996;0.989;0.996;0.981;0.996	D;D;D;D;D	0.74348	0.969;0.953;0.983;0.949;0.98	T	0.00814	-1.1555	10	0.72032	D	0.01	-20.208	18.9909	0.92791	0.0:0.0:1.0:0.0	.	202;110;153;151;151	B4DZB4;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	D	151;151;110;153;202	ENSP00000318687:A151D;ENSP00000369768:A151D;ENSP00000369769:A110D;ENSP00000396090:A153D	ENSP00000318687:A151D	A	-	2	0	HSPH1	30625066	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.558000	0.82253	2.553000	0.86117	0.591000	0.81541	GCT			0.363	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044384.1			
DIO3	1735	mdanderson.org	37	14	102026686	102026686	+	5'Flank	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr14:102026686G>T	ENST00000510508.4	+	0	0				DIO3_ENST00000359323.3_5'Flank|DIO3OS_ENST00000408206.1_lincRNA			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III						cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				CGTTCCCGGGGTAGAGAGCAA	0.746																																					.													.	.			0			.												15.0	18.0	17.0					14																	102026686		1558	3576	5134	SO:0001631	upstream_gene_variant	100302145	.			CCCGGGGTAGAGA	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681		14.37:g.102026686G>T	Exception_encountered		29	0	0		31	0.10	3	.	0		0	G3XAM0|Q8WVN5	RNA	SNP	ENST00000510508.4	37	CCDS41992.2																																																																																					0.746	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000361712.4		NM_001362	
SPPL2A	84888	mdanderson.org	37	15	51028300	51028300	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr15:51028300G>T	ENST00000261854.5	-	8	1204	c.930C>A	c.(928-930)gaC>gaA	p.D310E		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	310					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		ATTCATACCTGTCTTCATTTC	0.358																																					p.D310E	Melanoma(50;790 1209 4069 22965 33125)												.	SPPL2A	26		0			c.C930A												124.0	107.0	113.0					15																	51028300		2196	4294	6490	SO:0001583	missense	84888	exon8			ATACCTGTCTTCA		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.930C>A	15.37:g.51028300G>T	ENSP00000261854:p.Asp310Glu		39	0	0		25	0.08	2	NM_032802	186	0.00	0	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	ENST00000261854.5	37	CCDS10138.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.267058	0.59540	.	.	ENSG00000138600	ENST00000261854	T	0.12147	2.71	5.07	-0.727	0.11166	.	0.153629	0.56097	N	0.000030	T	0.22704	0.0548	M	0.78801	2.425	0.39878	D	0.973596	D	0.58620	0.983	P	0.55222	0.771	T	0.06463	-1.0825	10	0.33940	T	0.23	-14.0898	6.1574	0.20346	0.594:0.128:0.2781:0.0	.	310	Q8TCT8	PSL2_HUMAN	E	310	ENSP00000261854:D310E	ENSP00000261854:D310E	D	-	3	2	AC012100.1	48815592	0.992000	0.36948	0.999000	0.59377	0.804000	0.45430	0.307000	0.19296	0.007000	0.14760	-0.471000	0.05019	GAC			0.358	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254543.3		NM_032802	
ACAN	176	bcgsc.ca	37	15	89395085	89395085	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr15:89395085G>T	ENST00000561243.1	+	10	2087	c.2087G>T	c.(2086-2088)gGt>gTt	p.G696V	ACAN_ENST00000559004.1_Missense_Mutation_p.G696V|ACAN_ENST00000439576.2_Missense_Mutation_p.G696V|ACAN_ENST00000352105.7_Missense_Mutation_p.G696V			P16112	PGCA_HUMAN	aggrecan	695	KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCACCCTCTGGTGTGGAGGAG	0.562																																					p.G696V													.	ACAN	220		0			c.G2087T												53.0	67.0	62.0					15																	89395085		2070	4188	6258	SO:0001583	missense	176	exon11			CCTCTGGTGTGGA	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2087G>T	15.37:g.89395085G>T	ENSP00000453342:p.Gly696Val		203	0.0049261084	1		154	0.04	6	NM_001135	1	0.00	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	8.591	0.884666	0.17467	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.10005	2.92;2.92	5.07	-9.74	0.00509	.	0.975523	0.08301	N	0.966862	T	0.03651	0.0104	N	0.08118	0	0.09310	N	0.999997	B;B	0.12013	0.005;0.005	B;B	0.08055	0.003;0.003	T	0.39522	-0.9610	10	0.25106	T	0.35	0.1785	6.7234	0.23342	0.2873:0.0:0.4766:0.2361	.	696;696	E7ENV9;E7EX88	.;.	V	696	ENSP00000387356:G696V;ENSP00000341615:G696V	ENSP00000268134:G696V	G	+	2	0	ACAN	87196089	0.001000	0.12720	0.000000	0.03702	0.083000	0.17756	0.010000	0.13242	-2.370000	0.00602	-0.424000	0.05967	GGT			0.562	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416267.2		NM_001135	
HAPLN3	145864	mdanderson.org	37	15	89422428	89422428	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr15:89422428G>A	ENST00000359595.3	-	4	780	c.566C>T	c.(565-567)gCa>gTa	p.A189V	HAPLN3_ENST00000562889.1_Missense_Mutation_p.A251V	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	189	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	AGCCTGCTCTGCACAGACCTG	0.642											OREG0023445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A189V													.	HAPLN3	43		0			c.C566T												46.0	51.0	50.0					15																	89422428		2200	4299	6499	SO:0001583	missense	145864	exon4			TGCTCTGCACAGA	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.566C>T	15.37:g.89422428G>A	ENSP00000352606:p.Ala189Val		67	0	0	1267	47	0.06	3	NM_178232	83	0.01	1	A8K7P0	Missense_Mutation	SNP	ENST00000359595.3	37	CCDS10346.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753246	0.31046	.	.	ENSG00000140511	ENST00000359595	T	0.10288	2.89	4.36	3.22	0.36961	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.166719	0.51477	D	0.000086	T	0.07638	0.0192	N	0.26092	0.79	0.23820	N	0.996754	B;B	0.12013	0.005;0.005	B;B	0.18561	0.022;0.022	T	0.35400	-0.9790	10	0.23302	T	0.38	-13.6421	10.0321	0.42107	0.0:0.0:0.2043:0.7957	.	189;189	A8K7T8;Q96S86	.;HPLN3_HUMAN	V	189	ENSP00000352606:A189V	ENSP00000352606:A189V	A	-	2	0	HAPLN3	87223432	0.930000	0.31532	0.918000	0.36340	0.010000	0.07245	0.806000	0.27126	0.620000	0.30215	-0.274000	0.10170	GCA			0.642	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309070.1		NM_178232	
WFIKKN1	117166	mdanderson.org	37	16	683468	683468	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:683468G>T	ENST00000319070.2	+	2	1380	c.1058G>T	c.(1057-1059)cGc>cTc	p.R353L		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	353					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				GCCTGTGCCCGCGGCCCCGGC	0.761																																					p.R353L													.	WFIKKN1	30		0			c.G1058T												3.0	4.0	4.0					16																	683468		1693	3368	5061	SO:0001583	missense	117166	exon2			GTGCCCGCGGCCC	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1058G>T	16.37:g.683468G>T	ENSP00000324763:p.Arg353Leu		8	0	0		9	0.22	2	NM_053284	2	0.00	0	Q7LDW0|Q8NBQ1|Q96S20	Missense_Mutation	SNP	ENST00000319070.2	37	CCDS10414.1	.	.	.	.	.	.	.	.	.	.	g	5.223	0.226625	0.09916	.	.	ENSG00000127578	ENST00000319070	T	0.68903	-0.36	4.74	0.143	0.14820	Proteinase inhibitor I2, Kunitz metazoa (2);	0.454289	0.23700	N	0.045439	T	0.44138	0.1279	L	0.46741	1.465	0.09310	N	1	P	0.36010	0.532	B	0.23716	0.048	T	0.20371	-1.0277	10	0.24483	T	0.36	.	2.3428	0.04264	0.1713:0.3095:0.3866:0.1327	.	353	Q96NZ8	WFKN1_HUMAN	L	353	ENSP00000324763:R353L	ENSP00000324763:R353L	R	+	2	0	WFIKKN1	623469	0.002000	0.14202	0.000000	0.03702	0.049000	0.14656	1.320000	0.33666	0.096000	0.17463	-0.265000	0.10407	CGC			0.761	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206731.2		NM_053284	
PKD1	5310	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	2156409	2156409	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:2156409G>C	ENST00000262304.4	-	18	7687	c.7479C>G	c.(7477-7479)ttC>ttG	p.F2493L	PKD1_ENST00000561991.1_5'UTR|PKD1_ENST00000423118.1_Missense_Mutation_p.F2493L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2493	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGTGCATTCGAAGTGCACCT	0.711																																					p.F2493L													.	.			0			c.C7479G												4.0	4.0	4.0					16																	2156409		1909	3921	5830	SO:0001583	missense	5310	exon18			GCATTCGAAGTGC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7479C>G	16.37:g.2156409G>C	ENSP00000262304:p.Phe2493Leu		27	0	0		32	0.19	6	NM_000296	10	0.40	4	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	16.06	3.014600	0.54468	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.69435	-0.4;-0.4	4.81	0.28	0.15682	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.000000	0.85682	D	0.000000	T	0.73583	0.3605	L	0.54323	1.7	0.42341	D	0.99233	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.71090	-0.4693	10	0.48119	T	0.1	.	10.3097	0.43702	0.4571:0.0:0.5429:0.0	.	2493;2493	P98161-3;P98161	.;PKD1_HUMAN	L	2493;2493;1844;772	ENSP00000262304:F2493L;ENSP00000399501:F2493L	ENSP00000262304:F2493L	F	-	3	2	PKD1	2096410	0.099000	0.21834	0.382000	0.26119	0.675000	0.39556	-0.482000	0.06544	0.138000	0.18790	-0.399000	0.06403	TTC			0.711	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
KNOP1	400506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19722702	19722702	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:19722702T>C	ENST00000219837.7	-	3	1057	c.979A>G	c.(979-981)Ata>Gta	p.I327V	AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_Missense_Mutation_p.I6V	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	327	Interaction with ZNF106. {ECO:0000250}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										ACCTGGTCTATGTGCGCCTCA	0.572																																					p.I327V													C16orf88,NS,carcinoma,0,1	C16orf88	0	1	0			c.A979G												223.0	245.0	237.0					16																	19722702		2191	4294	6485	SO:0001583	missense	400506	exon3			GGTCTATGTGCGC	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.979A>G	16.37:g.19722702T>C	ENSP00000219837:p.Ile327Val		123	0	0		100	0.14	14	NM_001012991	83	0.22	18	O43328|Q5FWF3	Missense_Mutation	SNP	ENST00000219837.7	37	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	T	10.98	1.505260	0.26949	.	.	ENSG00000103550	ENST00000219837	T	0.27256	1.68	4.43	4.43	0.53597	.	0.937037	0.08987	N	0.864931	T	0.30916	0.0780	M	0.64997	1.995	0.48040	D	0.999577	P	0.38335	0.627	B	0.39258	0.295	T	0.05550	-1.0878	9	.	.	.	-18.5312	11.4487	0.50138	0.0:0.0:0.0:1.0	.	327	Q1ED39	CP088_HUMAN	V	327	ENSP00000219837:I327V	.	I	-	1	0	C16orf88	19630203	1.000000	0.71417	0.997000	0.53966	0.567000	0.35839	4.603000	0.61105	1.975000	0.57531	0.379000	0.24179	ATA			0.572	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435993.2		NM_001012991	
ACSM2A	123876	broad.mit.edu	37	16	20492208	20492208	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:20492208G>A	ENST00000573854.1	+	12	1588	c.1474G>A	c.(1474-1476)Gct>Act	p.A492T	ACSM2A_ENST00000219054.6_Missense_Mutation_p.A492T|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000575690.1_Missense_Mutation_p.A492T|ACSM2A_ENST00000536134.1_Missense_Mutation_p.A264T|ACSM2A_ENST00000396104.2_Missense_Mutation_p.A492T|ACSM2A_ENST00000417235.2_Missense_Mutation_p.A413T	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	492					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGTTGAGACGGCTGTGATCAG	0.557																																					p.A492T													.	ACSM2A	120		0			c.G1474A												106.0	95.0	99.0					16																	20492208		2202	4299	6501	SO:0001583	missense	123876	exon13			GAGACGGCTGTGA	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1474G>A	16.37:g.20492208G>A	ENSP00000459451:p.Ala492Thr		188	0	0		186	0.04	7	NM_001010845	0		0	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295226	0.60086	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	3.26	3.26	0.37387	AMP-dependent synthetase/ligase (1);	0.466770	0.17729	N	0.163960	T	0.82075	0.4958	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.954	D	0.86329	0.1697	10	0.87932	D	0	-2.1101	14.6156	0.68547	0.0:0.0:1.0:0.0	.	413;492	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	T	413;492;264;492	ENSP00000392169:A413T;ENSP00000219054:A492T;ENSP00000445082:A264T;ENSP00000379411:A492T	ENSP00000219054:A492T	A	+	1	0	ACSM2A	20399709	1.000000	0.71417	0.156000	0.22583	0.329000	0.28539	5.949000	0.70257	1.560000	0.49568	0.289000	0.19496	GCT			0.557	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436764.1		NM_001010845	
PHKB	5257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	47630436	47630436	+	Missense_Mutation	SNP	C	C	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:47630436C>G	ENST00000323584.5	+	13	1381	c.1357C>G	c.(1357-1359)Ctc>Gtc	p.L453V	PHKB_ENST00000455779.1_Missense_Mutation_p.L446V|PHKB_ENST00000566044.1_Missense_Mutation_p.L446V|PHKB_ENST00000299167.8_Missense_Mutation_p.L453V	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	453					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CATCGCAAAACTCCTGGGTAA	0.373																																					p.L453V													.	.			0			c.C1357G												167.0	171.0	169.0					16																	47630436		2201	4299	6500	SO:0001583	missense	5257	exon13			GCAAAACTCCTGG		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1357C>G	16.37:g.47630436C>G	ENSP00000313504:p.Leu453Val		119	0	0		134	0.12	16	NM_000293	21	0.05	1	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656387	0.88056	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91843	-2.92;-2.92	5.73	5.73	0.89815	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.96944	0.9002	M	0.92122	3.275	0.80722	D	1	D;P	0.54964	0.969;0.8	P;B	0.61940	0.896;0.423	D	0.97352	0.9964	10	0.87932	D	0	-12.7996	19.9002	0.96983	0.0:1.0:0.0:0.0	.	453;446	Q93100;Q93100-4	KPBB_HUMAN;.	V	446;446;453	ENSP00000414345:L446V;ENSP00000313504:L453V	ENSP00000299167:L446V	L	+	1	0	PHKB	46187937	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.873000	0.69644	2.709000	0.92574	0.655000	0.94253	CTC			0.373	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000430413.1			
SLC12A3	6559	mdanderson.org	37	16	56919268	56919268	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:56919268G>T	ENST00000563236.1	+	15	1942	c.1917G>T	c.(1915-1917)aaG>aaT	p.K639N	SLC12A3_ENST00000566786.1_Missense_Mutation_p.K638N|SLC12A3_ENST00000438926.2_Missense_Mutation_p.K639N|SLC12A3_ENST00000262502.5_Missense_Mutation_p.K638N			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	639					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	ACCACATCAAGAACTACCGGT	0.607																																					p.K639N													.	SLC12A3	99		0			c.G1917T												57.0	50.0	52.0					16																	56919268		2167	4247	6414	SO:0001583	missense	6559	exon15			CATCAAGAACTAC		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1917G>T	16.37:g.56919268G>T	ENSP00000456149:p.Lys639Asn		54	0	0		35	0.09	3	NM_001126108	0		0	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006964	0.74932	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.4	5.4	0.78164	Amino acid permease domain (1);	0.099926	0.64402	D	0.000002	D	0.86280	0.5895	H	0.97023	3.925	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.995	D	0.89066	0.3466	9	0.87932	D	0	.	9.5561	0.39339	0.1575:0.0:0.8425:0.0	.	638;639;639	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	N	638;639	.	ENSP00000262502:K639N	K	+	3	2	SLC12A3	55476769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.376000	0.52417	2.531000	0.85337	0.655000	0.94253	AAG			0.607	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000432337.1			
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	89345676	89345677	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	TC	TC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr16:89345676_89345677TC>AA	ENST00000301030.4	-	9	7733_7734	c.7273_7274GA>TT	c.(7273-7275)GAt>TTt	p.D2425F	ANKRD11_ENST00000378330.2_Missense_Mutation_p.D2425F	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2425					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTCGATGGCATCCAGCTTGATG	0.604																																					p.D2425F													.	.			0			c.G7273T																																									SO:0001583	missense	29123	exon9			ATGGCATCCAGCT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7273_7274delinsAA	16.37:g.89345676_89345677delinsAA	ENSP00000301030:p.Asp2425Phe		107	0	0		131	0.11	15	NM_001256183	133	0.05	7	Q6NTG1|Q6QMF8	Missense_Mutation	DNP	ENST00000301030.4	37	CCDS32513.1																																																																																					0.604	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
CLUH	23277	broad.mit.edu	37	17	2598369	2598369	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:2598369G>T	ENST00000570628.2	-	16	2622	c.2517C>A	c.(2515-2517)gcC>gcA	p.A839A	CLUH_ENST00000538975.1_Silent_p.A839A|CLUH_ENST00000435359.1_Silent_p.A839A			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	839					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)		p.A840A(2)									GGCTGATGGCGGCTGAGAGGC	0.642																																					p.A839A													KIAA0664_ENST00000322335,NS,carcinoma,0,2	.		2	2	Substitution - coding silent(2)	endometrium(2)	c.C2517A												30.0	39.0	36.0					17																	2598369		1984	4175	6159	SO:0001819	synonymous_variant	23277	exon16			GATGGCGGCTGAG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2517C>A	17.37:g.2598369G>T			59	0.0169491525	1		52	0.06	3	NM_015229	115	0.00	0	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Silent	SNP	ENST00000570628.2	37	CCDS45572.1																																																																																					0.642	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437807.2		NM_015229	
SPNS3	201305	broad.mit.edu;mdanderson.org	37	17	4351498	4351498	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:4351498G>T	ENST00000355530.2	+	6	950	c.670G>T	c.(670-672)Gtt>Ttt	p.V224F	SPNS3_ENST00000333476.2_Missense_Mutation_p.V97F|SPNS3_ENST00000576069.1_3'UTR	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	224					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						TATCCTGCTGGTTCCAGACCC	0.637																																					p.V224F													.	SPNS3	52		0			c.G670T												35.0	32.0	33.0					17																	4351498		2203	4300	6503	SO:0001583	missense	201305	exon6			CTGCTGGTTCCAG		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.670G>T	17.37:g.4351498G>T	ENSP00000347721:p.Val224Phe		64	0	0		52	0.08	4	NM_182538	0		0	Q8IZ31	Missense_Mutation	SNP	ENST00000355530.2	37	CCDS11045.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049840	0.75846	.	.	ENSG00000182557	ENST00000355530;ENST00000333476	T;T	0.55234	0.53;0.53	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.189945	0.45867	D	0.000323	T	0.74718	0.3753	M	0.83953	2.67	0.45867	D	0.998724	D;D	0.71674	0.998;0.992	D;D	0.72982	0.974;0.979	T	0.78635	-0.2127	10	0.87932	D	0	-24.3472	16.7529	0.85490	0.0:0.0:1.0:0.0	.	97;224	Q6ZMD2-2;Q6ZMD2	.;SPNS3_HUMAN	F	224;97	ENSP00000347721:V224F;ENSP00000333207:V97F	ENSP00000333207:V97F	V	+	1	0	SPNS3	4298247	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.543000	0.60684	2.636000	0.89361	0.563000	0.77884	GTT			0.637	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438793.1		NM_182538	
ACAP1	9744	mdanderson.org	37	17	7252473	7252473	+	Missense_Mutation	SNP	A	A	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:7252473A>T	ENST00000158762.3	+	18	2044	c.1838A>T	c.(1837-1839)cAg>cTg	p.Q613L	ACAP1_ENST00000571471.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank|KCTD11_ENST00000333751.3_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	613	Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						CCGCTGATCCAGGCCACAGCT	0.602																																					p.Q613L													.	ACAP1	66		0			c.A1838T												92.0	78.0	83.0					17																	7252473		2203	4300	6503	SO:0001583	missense	9744	exon18			TGATCCAGGCCAC	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1838A>T	17.37:g.7252473A>T	ENSP00000158762:p.Gln613Leu		54	0	0		56	0.05	3	NM_014716	126	0.00	0	Q53XN9	Missense_Mutation	SNP	ENST00000158762.3	37	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.880979	0.51801	.	.	ENSG00000072818	ENST00000158762	T	0.61158	0.13	5.41	4.1	0.47936	Ankyrin repeat-containing domain (4);	0.056229	0.64402	D	0.000001	T	0.31358	0.0794	N	0.16016	0.355	0.80722	D	1	B	0.25048	0.117	B	0.24701	0.055	T	0.14727	-1.0462	10	0.05525	T	0.97	.	6.0008	0.19519	0.7484:0.0:0.2516:0.0	.	613	Q15027	ACAP1_HUMAN	L	613	ENSP00000158762:Q613L	ENSP00000158762:Q613L	Q	+	2	0	ACAP1	7193197	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.122000	0.64697	0.868000	0.35678	0.459000	0.35465	CAG			0.602	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000220049.4		NM_014716	
FGF11	2256	mdanderson.org	37	17	7345131	7345131	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:7345131T>C	ENST00000293829.4	+	3	935	c.341T>C	c.(340-342)gTc>gCc	p.V114A	RP11-104H15.10_ENST00000575331.1_RNA|FGF11_ENST00000575082.1_5'UTR|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000575235.1_5'UTR|FGF11_ENST00000572907.1_5'UTR|RP11-104H15.8_ENST00000576615.1_RNA|FGF11_ENST00000575398.1_5'UTR	NM_004112.2	NP_004103.1	Q92914	FGF11_HUMAN	fibroblast growth factor 11	114					cell-cell signaling (GO:0007267)|nervous system development (GO:0007399)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	growth factor activity (GO:0008083)			central_nervous_system(1)|large_intestine(3)|ovary(1)|prostate(1)	6		Prostate(122;0.157)				CTCCGTGTGGTCACCATCCAG	0.587																																					p.V114A													.	FGF11	14		0			c.T341C												101.0	82.0	88.0					17																	7345131		2203	4300	6503	SO:0001583	missense	2256	exon3			GTGTGGTCACCAT		CCDS11105.1	17p13.1	2008-07-18			ENSG00000161958	ENSG00000161958			3667	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 3"""	601514				8790420	Standard	NM_004112		Approved	FHF3, FLJ16061, MGC45269, MGC102953	uc002ggz.3	Q92914	OTTHUMG00000108136	ENST00000293829.4:c.341T>C	17.37:g.7345131T>C	ENSP00000293829:p.Val114Ala		66	0	0		61	0.05	3	NM_004112	13	0.00	0	Q2YDX8	Missense_Mutation	SNP	ENST00000293829.4	37	CCDS11105.1	.	.	.	.	.	.	.	.	.	.	T	31	5.079215	0.94050	.	.	ENSG00000161958	ENST00000293829	T	0.74632	-0.86	5.13	5.13	0.70059	.	0.119854	0.56097	D	0.000033	D	0.88220	0.6378	M	0.91768	3.24	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.83275	0.992;0.996	D	0.90347	0.4363	10	0.66056	D	0.02	.	12.9278	0.58270	0.0:0.0:0.0:1.0	.	55;114	B7Z1C3;Q92914	.;FGF11_HUMAN	A	114	ENSP00000293829:V114A	ENSP00000293829:V114A	V	+	2	0	FGF11	7285855	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.190000	0.77755	2.161000	0.67846	0.454000	0.30748	GTC			0.587	FGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226939.3		NM_004112	
MYOCD	93649	mdanderson.org	37	17	12649289	12649289	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:12649289G>T	ENST00000343344.4	+	9	1025	c.1025G>T	c.(1024-1026)aGc>aTc	p.S342I	MYOCD_ENST00000425538.1_Missense_Mutation_p.S342I|MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.S246I			Q8IZQ8	MYCD_HUMAN	myocardin	342					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		ACGCCACTGAGCAATACCCCC	0.423																																					p.S342I													MYOCD_ENST00000425538,NS,carcinoma,0,2	MYOCD	291	2	0			c.G1025T												166.0	159.0	161.0					17																	12649289		2203	4300	6503	SO:0001583	missense	93649	exon9			CACTGAGCAATAC	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1025G>T	17.37:g.12649289G>T	ENSP00000341835:p.Ser342Ile		140	0	0		128	0.04	5	NM_153604	1	0.00	0	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174802	0.57692	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.51574	0.7;0.7	5.71	3.68	0.42216	.	0.188168	0.64402	D	0.000011	T	0.39708	0.1088	N	0.24115	0.695	0.53005	D	0.999962	P;D;P;P	0.54964	0.893;0.969;0.946;0.846	B;P;P;P	0.52343	0.219;0.668;0.696;0.499	T	0.22103	-1.0226	10	0.45353	T	0.12	-11.2386	5.9529	0.19257	0.228:0.1391:0.6329:0.0	.	61;246;342;342	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	I	61;342;342;246;47	ENSP00000341835:S342I;ENSP00000400148:S47I	ENSP00000341835:S342I	S	+	2	0	MYOCD	12590014	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	1.065000	0.30592	1.391000	0.46566	0.561000	0.74099	AGC			0.423	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000129950.1		NM_153604	
FLJ36000	284124	broad.mit.edu	37	17	21909166	21909167	+	lincRNA	DEL	TG	TG	-	rs143137221		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:21909166_21909167delTG	ENST00000581223.2	+	0	148					NR_027084.1																						TCTTTTCCTCtgtgtgtgtgtg	0.53																																					.													.	.			0			.																																											0	.			TTCCTCTGTGTGT																													17.37:g.21909176_21909177delTG			5	0	0		7	0.43	3	.	1	0.00	0		RNA	DEL	ENST00000581223.2	37																																																																																						0.530	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
TMEM97	27346	ucsc.edu	37	17	26653806	26653806	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:26653806G>A	ENST00000226230.6	+	3	663	c.518G>A	c.(517-519)aGa>aAa	p.R173K	TMEM97_ENST00000336687.6_Missense_Mutation_p.R66K|TMEM97_ENST00000583381.1_Missense_Mutation_p.R66K	NM_014573.2	NP_055388.2	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	173					cholesterol homeostasis (GO:0042632)|regulation of cell growth (GO:0001558)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)				endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	6	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GAAGAGAAAAGAAAAAAAAAA	0.443																																					p.R173K													.	TMEM97	27		0			c.G518A												60.0	57.0	58.0					17																	26653806		2203	4300	6503	SO:0001583	missense	27346	exon3			AGAAAAGAAAAAA	BC091504	CCDS11226.2	17q11.2	2014-01-28			ENSG00000109084	ENSG00000109084			28106	protein-coding gene	gene with protein product		612912				7694637, 15375745	Standard	NM_014573		Approved	MAC30	uc002hat.3	Q5BJF2	OTTHUMG00000132497	ENST00000226230.6:c.518G>A	17.37:g.26653806G>A	ENSP00000226230:p.Arg173Lys		61	0.0163934426	1		57	0.05	3	NM_014573	65	0.17	11	B4DS02|Q07823	Missense_Mutation	SNP	ENST00000226230.6	37	CCDS11226.2	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392014	0.42410	.	.	ENSG00000109084	ENST00000226230;ENST00000336687	.	.	.	5.71	2.6	0.31112	.	0.139798	0.64402	D	0.000005	T	0.45256	0.1333	L	0.47716	1.5	0.37601	D	0.92055	B	0.10296	0.003	B	0.10450	0.005	T	0.39165	-0.9627	9	0.31617	T	0.26	-6.3279	7.1459	0.25583	0.152:0.0:0.7099:0.1381	.	173	Q5BJF2	TMM97_HUMAN	K	173;66	.	ENSP00000226230:R173K	R	+	2	0	TMEM97	23677933	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	2.478000	0.45189	0.769000	0.33313	0.655000	0.94253	AGA			0.443	TMEM97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255675.2		NM_014573	
RP11-271K11.5	0	broad.mit.edu	37	17	29369597	29369598	+	RNA	INS	-	-	CA	rs371745947|rs10700828|rs140197488	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:29369597_29369598insCA	ENST00000583112.1	-	0	628																		p.?(1)									acacttgcaagcacacacacac	0.515														846	0.16893	0.5726	0.0648	5008	,	,		19545	0.0		0.0179	False		,,,				2504	0.0266				.													.	.			1	Unknown(1)	central_nervous_system(1)	.																																											0	.			TTGCAAGCACACA																													17.37:g.29369606_29369607dupCA			5	0	0		7	0.29	2	.	0		0		RNA	INS	ENST00000583112.1	37																																																																																						0.515	RP11-271K11.5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000444574.1			
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274360	39274360	+	Missense_Mutation	SNP	A	A	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:39274360A>T	ENST00000391413.2	-	1	246	c.208T>A	c.(208-210)Tgc>Agc	p.C70S		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	70	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CTGGAGATGCAGCATCTGGGG	0.667																																					p.C70S													KRTAP4-11,NS,carcinoma,0,1	KRTAP4-11	0	1	0			c.T208A												7.0	12.0	11.0					17																	39274360		677	1580	2257	SO:0001583	missense	653240	exon1			AGATGCAGCATCT	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.208T>A	17.37:g.39274360A>T	ENSP00000375232:p.Cys70Ser		34	0.0588235294	2		34	0.12	4	NM_033059	0		0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	13.38	2.219303	0.39201	.	.	ENSG00000212721	ENST00000391413	T	0.02280	4.36	3.77	1.34	0.21922	.	0.000000	0.36972	U	0.002304	T	0.04770	0.0129	M	0.90252	3.1	0.23636	N	0.997233	B	0.17268	0.021	B	0.17722	0.019	T	0.23048	-1.0199	10	0.54805	T	0.06	.	4.9719	0.14119	0.7038:0.1861:0.1101:0.0	.	70	Q9BYQ6	KR411_HUMAN	S	70	ENSP00000375232:C70S	ENSP00000375232:C70S	C	-	1	0	KRTAP4-11	36527886	0.844000	0.29557	0.494000	0.27515	0.120000	0.20174	1.052000	0.30429	0.644000	0.30656	0.496000	0.49642	TGC			0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257690.1			
KRTAP4-12	83755	mdanderson.org	37	17	39280273	39280273	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:39280273G>T	ENST00000394014.1	-	1	146	c.102C>A	c.(100-102)acC>acA	p.T34T		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	34	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GGCGGCAGCAGGTGGTCCTGC	0.662																																					p.T34T													.	KRTAP4-12	32		0			c.C102A												36.0	50.0	45.0					17																	39280273		2179	4267	6446	SO:0001819	synonymous_variant	83755	exon1			GCAGCAGGTGGTC	AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.102C>A	17.37:g.39280273G>T			45	0.0222222222	1		56	0.11	6	NM_031854	0		0	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	37	CCDS32649.1																																																																																					0.662	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257777.1			
CLTC	1213	bcgsc.ca	37	17	57746271	57746271	+	Silent	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr17:57746271C>T	ENST00000269122.3	+	14	2536	c.2262C>T	c.(2260-2262)taC>taT	p.Y754Y	CLTC_ENST00000393043.1_Silent_p.Y754Y|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	754	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GCAACTGCTACGATCCTGAGC	0.408			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.Y754Y				Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124		0			c.C2262T												110.0	112.0	111.0					17																	57746271		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon14			CTGCTACGATCCT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2262C>T	17.37:g.57746271C>T			31	0	0		46	0.09	4	NM_004859	135	0.00	0	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	37	CCDS32696.1																																																																																					0.408	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258859.1		NM_004859	
GREB1L	80000	mdanderson.org	37	18	19079853	19079853	+	Missense_Mutation	SNP	A	A	T	rs4800747	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr18:19079853A>T	ENST00000580732.2	+	22	3936	c.3555A>T	c.(3553-3555)gaA>gaT	p.E1185D	GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000269218.6_Missense_Mutation_p.E1076D|GREB1L_ENST00000424526.1_Missense_Mutation_p.E1185D			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1185	Ser-rich.					integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TGAAGCAGGAATGTGACTCCC	0.652																																					p.E1185D													.	GREB1L	69		0			c.A3555T												19.0	24.0	23.0					18																	19079853		692	1591	2283	SO:0001583	missense	80000	exon22			GCAGGAATGTGAC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3555A>T	18.37:g.19079853A>T	ENSP00000464162:p.Glu1185Asp		58	0	0		58	0.03	2	NM_001142966	1	0.00	0	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304614	0.40795	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.07444	3.19;3.19	4.43	3.56	0.40772	.	0.251415	0.33144	N	0.005230	T	0.21881	0.0527	M	0.68952	2.095	0.80722	D	1	D;B;B	0.71674	0.998;0.0;0.003	D;B;B	0.77557	0.99;0.003;0.004	T	0.01111	-1.1448	10	0.27082	T	0.32	-6.9905	9.2552	0.37579	0.3021:0.0:0.6979:0.0	.	1076;1185;559	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	D	1185;1076	ENSP00000412060:E1185D;ENSP00000269218:E1076D	ENSP00000269218:E1076D	E	+	3	2	GREB1L	17333851	1.000000	0.71417	0.988000	0.46212	0.691000	0.40173	3.822000	0.55708	0.509000	0.28195	-0.215000	0.12644	GAA			0.652	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443782.2		NM_024935	
DSG1	1828	broad.mit.edu	37	18	28934743	28934743	+	Missense_Mutation	SNP	G	G	T	rs201083341		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr18:28934743G>T	ENST00000257192.4	+	15	2796	c.2584G>T	c.(2584-2586)Gtg>Ttg	p.V862L	RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA|DSG1_ENST00000462981.2_Missense_Mutation_p.V221L	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	862					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AGCATCAAACGTGGTAGTGAC	0.512													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22174	0.0		0.0	False		,,,				2504	0.0				p.V862L													.	DSG1	176		0			c.G2584T												180.0	157.0	165.0					18																	28934743		2203	4300	6503	SO:0001583	missense	1828	exon15			TCAAACGTGGTAG	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.2584G>T	18.37:g.28934743G>T	ENSP00000257192:p.Val862Leu		143	0	0		121	0.03	4	NM_001942	0		0	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.24	2.178295	0.38511	.	.	ENSG00000134760	ENST00000257192	T	0.81415	-1.49	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000012	D	0.86012	0.5831	M	0.65498	2.005	0.46298	D	0.998973	D	0.56521	0.976	P	0.52856	0.711	D	0.85588	0.1244	10	0.48119	T	0.1	.	19.9765	0.97312	0.0:0.0:1.0:0.0	.	862	Q02413	DSG1_HUMAN	L	862	ENSP00000257192:V862L	ENSP00000257192:V862L	V	+	1	0	DSG1	27188741	1.000000	0.71417	0.999000	0.59377	0.669000	0.39330	6.778000	0.75043	2.733000	0.93635	0.467000	0.42956	GTG			0.512	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254947.1		NM_001942	
GALR1	2587	mdanderson.org	37	18	74962795	74962795	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr18:74962795G>T	ENST00000299727.3	+	1	291	c.291G>T	c.(289-291)gcG>gcT	p.A97A		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	97					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCGTGTACGCGCTGCCCACCT	0.617																																					p.A97A													.	GALR1	53		0			c.G291T												128.0	114.0	119.0					18																	74962795		2203	4300	6503	SO:0001819	synonymous_variant	2587	exon1			GTACGCGCTGCCC	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.291G>T	18.37:g.74962795G>T			46	0	0		40	0.08	3	NM_001480	0		0	Q4VBL7	Silent	SNP	ENST00000299727.3	37	CCDS12012.1																																																																																					0.617	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256362.1			
CHAF1A	10036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	4409387	4409387	+	Silent	SNP	C	C	T	rs188842259		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:4409387C>T	ENST00000301280.5	+	3	692	c.591C>T	c.(589-591)ggC>ggT	p.G197G		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	197	Binds to CBX1 chromo shadow domain.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGGAGAGGCGACTCCCAGG	0.582								Chromatin Structure					c|||	1	0.000199681	0.0	0.0	5008	,	,		18160	0.001		0.0	False		,,,				2504	0.0				p.G197G													.	.			0			c.C591T												74.0	75.0	74.0					19																	4409387		2203	4300	6503	SO:0001819	synonymous_variant	10036	exon3			GAGAGGCGACTCC	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.591C>T	19.37:g.4409387C>T			82	0	0		120	0.08	9	NM_005483	60	0.18	11	Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	ENST00000301280.5	37	CCDS32875.1																																																																																			0		0.582	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458310.2		NM_005483	
MUC16	94025	mdanderson.org	37	19	9059459	9059459	+	Missense_Mutation	SNP	G	G	T	rs201658687		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:9059459G>T	ENST00000397910.4	-	3	28190	c.27987C>A	c.(27985-27987)agC>agA	p.S9329R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9331	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGATGTTCTGCTAGAAGAGA	0.493																																					p.S9329R													.	MUC16	4315		0			c.C27987A												159.0	156.0	157.0					19																	9059459		1997	4169	6166	SO:0001583	missense	94025	exon3			TGTTCTGCTAGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27987C>A	19.37:g.9059459G>T	ENSP00000381008:p.Ser9329Arg		79	0	0		99	0.05	5	NM_024690	0		0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.626	0.116289	0.08881	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	2.43	1.3	0.21679	.	.	.	.	.	T	0.03783	0.0107	N	0.14661	0.345	.	.	.	D	0.64830	0.994	P	0.56960	0.81	T	0.42275	-0.9461	8	0.87932	D	0	.	5.5897	0.17293	0.1649:0.0:0.8351:0.0	.	9329	B5ME49	.	R	9329	ENSP00000381008:S9329R	ENSP00000381008:S9329R	S	-	3	2	MUC16	8920459	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.128000	0.10531	0.547000	0.28938	0.461000	0.40582	AGC			0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402806.1		NM_024690	
ZNF700	90592	hgsc.bcm.edu	37	19	12060269	12060269	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:12060269A>G	ENST00000254321.5	+	4	1573	c.1430A>G	c.(1429-1431)aAg>aGg	p.K477R	ZNF763_ENST00000591944.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.K459R|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TATGAATGTAAGGAATGTGGG	0.413																																					p.K480R													.	.			0			c.A1439G												74.0	75.0	75.0					19																	12060269		2203	4300	6503	SO:0001583	missense	90592	exon4			AATGTAAGGAATG	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1430A>G	19.37:g.12060269A>G	ENSP00000254321:p.Lys477Arg		66	0	0		83	0.05	4	NM_001271848	25	0.00	0	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	a	12.34	1.909621	0.33721	.	.	ENSG00000196757	ENST00000254321	T	0.03831	3.79	0.606	0.606	0.17559	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08802	0.0218	N	0.26042	0.785	0.09310	N	1	D	0.76494	0.999	D	0.87578	0.998	T	0.33214	-0.9877	9	0.46703	T	0.11	.	4.5084	0.11899	0.6646:0.3354:0.0:0.0	.	477	Q9H0M5	ZN700_HUMAN	R	477	ENSP00000254321:K477R	ENSP00000254321:K477R	K	+	2	0	ZNF700	11921269	0.000000	0.05858	0.188000	0.23233	0.341000	0.28922	-2.027000	0.01433	0.485000	0.27652	0.164000	0.16699	AAG			0.413	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344126.2		NM_144566	
ATP13A1	57130	mdanderson.org	37	19	19770791	19770791	+	Silent	SNP	G	G	A	rs111834843	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:19770791G>A	ENST00000357324.6	-	2	428	c.402C>T	c.(400-402)taC>taT	p.Y134Y	ATP13A1_ENST00000291503.5_Silent_p.Y16Y	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	134						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.Y134Y(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGCTGGGGTCGTACTCCTGAC	0.572													G|||	6	0.00119808	0.0038	0.0014	5008	,	,		18918	0.0		0.0	False		,,,				2504	0.0				p.Y134Y	Esophageal Squamous(142;920 1789 9047 14684 24777)												ATP13A1,colon,carcinoma,0,1	ATP13A1	82	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T							G		23,4377		0,23,2177	39.0	32.0	34.0		402	-5.6	0.8	19	dbSNP_132	34	0,8592		0,0,4296	no	coding-synonymous	ATP13A1	NM_020410.2		0,23,6473	AA,AG,GG		0.0,0.5227,0.177		134/1205	19770791	23,12969	2200	4296	6496	SO:0001819	synonymous_variant	57130	exon2			GGGGTCGTACTCC	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.402C>T	19.37:g.19770791G>A			40	0	0		55	0.05	3	NM_020410	80	0.00	0	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	9.030	0.987064	0.18889	0.005227	0.0	ENSG00000105726	ENST00000455627	.	.	.	4.22	-5.59	0.02505	.	.	.	.	.	T	0.41143	0.1146	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.47394	-0.9121	4	.	.	.	-6.3171	7.6732	0.28470	0.5249:0.1125:0.3626:0.0	.	.	.	.	M	53	.	.	T	-	2	0	ATP13A1	19631791	0.035000	0.19736	0.840000	0.33206	0.994000	0.84299	-0.573000	0.05874	-1.322000	0.02278	-0.238000	0.12139	ACG	0.002		0.572	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329005.1		NM_020410	
CTC-260E6.6	0	broad.mit.edu	37	19	20242380	20242381	+	RNA	DEL	TT	TT	-	rs112605508|rs76101235		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:20242380_20242381delTT	ENST00000590606.1	-	0	315				CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA																							CAttttcttctttttttttttt	0.396																																					.													.	.			0			.																																											0	.			TTCTTCTTTTTTT																													19.37:g.20242390_20242391delTT			6	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000590606.1	37																																																																																						0.396	CTC-260E6.6-005	KNOWN	basic	antisense	antisense		OTTHUMT00000452859.1			
MEGF8	1954	mdanderson.org	37	19	42861670	42861670	+	Missense_Mutation	SNP	C	C	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:42861670C>A	ENST00000251268.6	+	28	4945	c.4945C>A	c.(4945-4947)Ctg>Atg	p.L1649M	MEGF8_ENST00000334370.4_Missense_Mutation_p.L1582M	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1649					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CAACCAGCAGCTGCTGGAGTA	0.677																																					p.L1649M													.	MEGF8	358		0			c.C4945A												34.0	34.0	34.0					19																	42861670		2203	4299	6502	SO:0001583	missense	1954	exon28			CAGCAGCTGCTGG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4945C>A	19.37:g.42861670C>A	ENSP00000251268:p.Leu1649Met		56	0	0		47	0.06	3	NM_001271938	7	0.00	0	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	C	15.83	2.950361	0.53186	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.69435	-0.4;-0.4	5.26	3.12	0.35913	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.000000	0.53938	D	0.000052	T	0.71787	0.3381	L	0.52126	1.63	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.927;0.994	T	0.69888	-0.5023	10	0.72032	D	0.01	-10.5048	4.4735	0.11724	0.0:0.5885:0.184:0.2276	.	1649;1582	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	M	1582;1649	ENSP00000334219:L1582M;ENSP00000251268:L1649M	ENSP00000251268:L1649M	L	+	1	2	MEGF8	47553510	1.000000	0.71417	0.985000	0.45067	0.583000	0.36354	1.117000	0.31234	0.520000	0.28426	0.655000	0.94253	CTG			0.677	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
ATF5	22809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50434258	50434258	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:50434258C>T	ENST00000423777.2	+	2	528	c.151C>T	c.(151-153)Ctt>Ttt	p.L51F	IL4I1_ENST00000595948.1_5'Flank|ATF5_ENST00000595125.1_Missense_Mutation_p.L51F|NUP62_ENST00000422090.2_5'Flank|MIR4751_ENST00000578027.1_RNA|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597723.1_5'Flank|NUP62_ENST00000597029.1_5'Flank|ATF5_ENST00000600336.1_Missense_Mutation_p.L51F|CTC-326K19.6_ENST00000451973.1_Intron|NUP62_ENST00000596217.1_5'Flank|NUP62_ENST00000413454.1_5'Flank|NUP62_ENST00000352066.3_5'Flank|IL4I1_ENST00000341114.3_5'Flank	NM_001193646.1	NP_001180575.1	Q9Y2D1	ATF5_HUMAN	activating transcription factor 5	51					multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|olfactory bulb interneuron development (GO:0021891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription corepressor activity (GO:0003714)			NS(1)|endometrium(2)|large_intestine(1)|skin(3)	7		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00221)|OV - Ovarian serous cystadenocarcinoma(262;0.017)	Pseudoephedrine(DB00852)	GGAGGGCGGGCTTCCAGTGGG	0.662																																					p.L51F	GBM(48;768 989 9196 9511 26329)												.	.			0			c.C151T												5.0	6.0	6.0					19																	50434258		2124	4196	6320	SO:0001583	missense	22809	exon3			GGCGGGCTTCCAG	AF101388	CCDS12789.1	19q13.33	2013-09-20			ENSG00000169136	ENSG00000169136		"""basic leucine zipper proteins"""	790	protein-coding gene	gene with protein product		606398				10373550	Standard	NM_012068		Approved		uc002prd.3	Q9Y2D1	OTTHUMG00000183065	ENST00000423777.2:c.151C>T	19.37:g.50434258C>T	ENSP00000396954:p.Leu51Phe		86	0	0		66	0.21	14	NM_012068	220	0.04	9	B3KND3|Q9BSA1|Q9UNQ3	Missense_Mutation	SNP	ENST00000423777.2	37	CCDS12789.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588552	0.46110	.	.	ENSG00000169136	ENST00000423777	T	0.50277	0.75	4.13	4.13	0.48395	.	0.455403	0.17378	N	0.176410	T	0.48714	0.1515	L	0.36672	1.1	0.36764	D	0.883437	D	0.69078	0.997	P	0.56127	0.792	T	0.52457	-0.8573	10	0.40728	T	0.16	-8.3229	9.4863	0.38931	0.2112:0.7888:0.0:0.0	.	51	Q9Y2D1	ATF5_HUMAN	F	51	ENSP00000396954:L51F	ENSP00000396954:L51F	L	+	1	0	ATF5	55126070	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	1.344000	0.33941	2.308000	0.77769	0.462000	0.41574	CTT			0.662	ATF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464915.2			
TRIM28	10155	mdanderson.org	37	19	59059871	59059871	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr19:59059871G>A	ENST00000253024.5	+	9	1524	c.1235G>A	c.(1234-1236)cGt>cAt	p.R412H	TRIM28_ENST00000341753.6_Missense_Mutation_p.R330H	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	412					convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GTGGCAGAGCGTCCTGGCACT	0.582																																					p.R412H													TRIM28,NS,carcinoma,+1,1	TRIM28	46	1	0			c.G1235A												92.0	94.0	93.0					19																	59059871		2203	4300	6503	SO:0001583	missense	10155	exon9			CAGAGCGTCCTGG		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.1235G>A	19.37:g.59059871G>A	ENSP00000253024:p.Arg412His		60	0	0		57	0.05	3	NM_005762	1373	0.00	0	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349391	0.61183	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.68181	-0.1;-0.31	5.12	5.12	0.69794	.	0.098434	0.47852	D	0.000204	T	0.65354	0.2683	N	0.08118	0	0.38218	D	0.940668	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.80764	0.994;0.98;0.987	T	0.71052	-0.4704	10	0.46703	T	0.11	-26.0996	14.2646	0.66107	0.0:0.0:1.0:0.0	.	330;412;412	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	H	412;330	ENSP00000253024:R412H;ENSP00000342232:R330H	ENSP00000253024:R412H	R	+	2	0	TRIM28	63751683	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.803000	0.47924	2.837000	0.97791	0.655000	0.94253	CGT			0.582	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467074.1		NM_005762	
ANKRD36BP2	645784	broad.mit.edu	37	2	89082294	89082295	+	RNA	INS	-	-	TT	rs368332037		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:89082294_89082295insTT	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		TTAAAGTCTCATATGTTGAACT	0.332																																					.													.	.			0			.																																											0	.			AGTCTCATATGTT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082294_89082295insTT			7	0	0		7	0.43	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89082296	89082297	+	RNA	INS	-	-	TC	rs370959214		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:89082296_89082297insTC	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		AAAGTCTCATATGTTGAACTAT	0.332																																					.													.	.			0			.																																											0	.			TCTCATATGTTGA			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082296_89082297insTC			7	0	0		7	0.43	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89082340	89082343	+	RNA	DEL	ATTG	ATTG	-	rs150412285		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	ATTG	ATTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:89082340_89082343delATTG	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		TACTTCATGTATTGATTATTTTGT	0.368																																					.													.	.			0			.																																											0	.			TCATGTATTGATT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082340_89082343delATTG			13	0	0		5	0.40	2	.	0		0		RNA	DEL	ENST00000393525.3	37																																																																																						0.368	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89082352	89082353	+	RNA	INS	-	-	T	rs369392603		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:89082352_89082353insT	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		TGATTATTTTGTTTCAAATCCC	0.361																																					.													.	.			0			.																																											0	.			TATTTTGTTTCAA			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082355_89082355dupT			16	0	0		5	0.40	2	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.361	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
RAB3GAP1	22930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135920150	135920150	+	Missense_Mutation	SNP	A	A	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:135920150A>T	ENST00000264158.8	+	20	2358	c.2315A>T	c.(2314-2316)aAa>aTa	p.K772I	RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.K772I|RAB3GAP1_ENST00000487003.1_3'UTR|ZRANB3_ENST00000412849.1_5'UTR|RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.K728I	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	772					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		GCAATCCAGAAACCTGCAGAC	0.463																																					p.K772I													.	.			0			c.A2315T												53.0	51.0	51.0					2																	135920150		2203	4300	6503	SO:0001583	missense	22930	exon20			TCCAGAAACCTGC	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2315A>T	2.37:g.135920150A>T	ENSP00000264158:p.Lys772Ile		116	0	0		113	0.10	11	NM_001172435	118	0.03	3	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	37	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.914983	0.92178	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.49139	0.79;0.79;0.79	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.66307	0.2776	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.98	T	0.65261	-0.6211	10	0.44086	T	0.13	-26.8913	16.6093	0.84858	1.0:0.0:0.0:0.0	.	772;772	C9J837;Q15042	.;RB3GP_HUMAN	I	772;728;772	ENSP00000264158:K772I;ENSP00000444306:K728I;ENSP00000411418:K772I	ENSP00000264158:K772I	K	+	2	0	RAB3GAP1	135636620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.574000	0.90763	2.324000	0.78689	0.533000	0.62120	AAA			0.463	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337514.2		NM_012233	
SLC38A11	151258	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	165793940	165793940	+	Splice_Site	SNP	C	C	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:165793940C>G	ENST00000409149.3	-	6	661		c.e6-1		SLC38A11_ENST00000493887.1_Splice_Site|SLC38A11_ENST00000409058.1_Splice_Site|SLC38A11_ENST00000303735.4_Splice_Site|SLC38A11_ENST00000409662.1_Splice_Site	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						TGAGGGAGACCTGTAAAAGAA	0.323																																					.													SLC38A11,colon,carcinoma,0,1	SLC38A11	41	1	0			c.304-1G>C												111.0	112.0	112.0					2																	165793940		2203	4300	6503	SO:0001630	splice_region_variant	151258	exon6			GGAGACCTGTAAA		CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.370-1G>C	2.37:g.165793940C>G			46	0	0		55	0.11	6	NM_173512	0		0	B4DF99|Q8N887	Splice_Site	SNP	ENST00000409149.3	37	CCDS56142.1	.	.	.	.	.	.	.	.	.	.	C	8.207	0.799515	0.16397	.	.	ENSG00000169507	ENST00000303735;ENST00000409149;ENST00000409058;ENST00000409662	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.008	0.86398	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC38A11	165502186	1.000000	0.71417	0.997000	0.53966	0.043000	0.13939	5.692000	0.68256	2.391000	0.81399	0.555000	0.69702	.			0.323	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333390.1		NM_173512	Intron
SP140L	93349	mdanderson.org	37	2	231193483	231193483	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr2:231193483G>T	ENST00000415673.2	+	2	130	c.44G>T	c.(43-45)gGa>gTa	p.G15V	SP140L_ENST00000396563.4_Missense_Mutation_p.G15V|SP140L_ENST00000444636.1_Missense_Mutation_p.G15V|SP140_ENST00000486687.2_Intron|SP140L_ENST00000243810.6_Missense_Mutation_p.G15V	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	15						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						gggctgaacggaggtgtttca	0.373																																					p.G15V													.	SP140L	68		0			c.G44T												93.0	100.0	98.0					2																	231193483		2198	4300	6498	SO:0001583	missense	93349	exon2			TGAACGGAGGTGT	BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.44G>T	2.37:g.231193483G>T	ENSP00000397911:p.Gly15Val		106	0	0		87	0.05	4	NM_138402	20	0.00	0	Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	ENST00000415673.2	37	CCDS46538.1	.	.	.	.	.	.	.	.	.	.	G	1.406	-0.576914	0.03854	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	D;T;D;D	0.83755	-1.59;-1.23;-1.59;-1.76	2.07	-4.14	0.03892	.	.	.	.	.	T	0.63474	0.2514	N	0.08118	0	0.09310	N	1	P	0.42357	0.777	B	0.42087	0.375	T	0.59193	-0.7500	9	0.59425	D	0.04	.	4.1833	0.10387	0.4489:0.0:0.3876:0.1635	.	15	Q9H930-4	.	V	15	ENSP00000395195:G15V;ENSP00000397911:G15V;ENSP00000243810:G15V;ENSP00000379811:G15V	ENSP00000243810:G15V	G	+	2	0	SP140L	230901727	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.093000	0.11111	-1.835000	0.01191	-1.407000	0.01130	GGA			0.373	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374538.1		NM_138402	
DIDO1	11083	mdanderson.org	37	20	61525294	61525294	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr20:61525294G>T	ENST00000266070.4	-	12	3150	c.2825C>A	c.(2824-2826)cCg>cAg	p.P942Q	DIDO1_ENST00000395340.1_Missense_Mutation_p.P942Q|DIDO1_ENST00000395343.1_Missense_Mutation_p.P942Q|DIDO1_ENST00000395335.2_Missense_Mutation_p.P942Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	942					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GTCTTCCAGCGGGGAGGGCTC	0.632																																					p.P942Q	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												.	DIDO1	321		0			c.C2825A												54.0	52.0	53.0					20																	61525294		2203	4300	6503	SO:0001583	missense	11083	exon12			TCCAGCGGGGAGG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2825C>A	20.37:g.61525294G>T	ENSP00000266070:p.Pro942Gln		45	0	0		65	0.05	3	NM_033081	12	0.00	0	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786909	0.31593	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.10860	3.2;3.2;2.83;2.83	6.17	-1.72	0.08107	.	1.934510	0.02924	N	0.138347	T	0.08492	0.0211	N	0.22421	0.69	0.09310	N	0.999999	P;P	0.50710	0.933;0.938	B;B	0.43990	0.438;0.253	T	0.31779	-0.9931	10	0.22706	T	0.39	-0.6589	6.4516	0.21906	0.5322:0.1319:0.336:0.0	.	942;942	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	Q	942	ENSP00000266070:P942Q;ENSP00000378752:P942Q;ENSP00000378749:P942Q;ENSP00000378744:P942Q	ENSP00000266070:P942Q	P	-	2	0	DIDO1	60995739	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.481000	0.22260	-0.052000	0.13311	-0.302000	0.09304	CCG			0.632	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080091.2		NM_080796	
MICAL3	57553	broad.mit.edu	37	22	18273827	18273832	+	In_Frame_Del	DEL	GCTCCC	GCTCCC	-			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	GCTCCC	GCTCCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:18273827_18273832delGCTCCC	ENST00000441493.2	-	31	6108_6113	c.5756_5761delGGGAGC	c.(5755-5763)cgggagctg>ctg	p.RE1919del	MICAL3_ENST00000580469.1_5'UTR|XXbac-B461K10.4_ENST00000476405.1_RNA	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1919					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.R297Q(1)		large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TCCAGCTCCAGCTCCCGGGCACTGAG	0.65																																					p.1919_1921del													.	MICAL3	53		1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.5756_5761del																																									SO:0001651	inframe_deletion	57553	exon31			GCTCCAGCTCCCG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5756_5761delGGGAGC	22.37:g.18273827_18273832delGCTCCC	ENSP00000416015:p.Arg1919_Glu1920del		46	0	0		59	0.15	9	NM_015241	21	0.00	0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	In_Frame_Del	DEL	ENST00000441493.2	37	CCDS46659.1																																																																																					0.650	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447351.1			
ZNF74	7625	mdanderson.org	37	22	20760070	20760070	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:20760070G>T	ENST00000400451.2	+	5	1261	c.747G>T	c.(745-747)gtG>gtT	p.V249V	ZNF74_ENST00000356671.5_Silent_p.V249V|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000405993.1_Silent_p.V217V|ZNF74_ENST00000403682.3_3'UTR	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	249					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCGAGTTCGTGTGCGGCGAGT	0.687																																					p.V249V													.	ZNF74	54		0			c.G747T												14.0	18.0	17.0					22																	20760070		2188	4289	6477	SO:0001819	synonymous_variant	7625	exon6			GTTCGTGTGCGGC	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.747G>T	22.37:g.20760070G>T			37	0	0		45	0.07	3	NM_001256524	20	0.00	0	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Silent	SNP	ENST00000400451.2	37	CCDS42982.1																																																																																					0.687	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319648.2		NM_003426	
ZNF74	7625	mdanderson.org	37	22	20760418	20760418	+	Silent	SNP	C	C	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:20760418C>T	ENST00000400451.2	+	5	1609	c.1095C>T	c.(1093-1095)tgC>tgT	p.C365C	ZNF74_ENST00000356671.5_Silent_p.C365C|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000405993.1_Silent_p.C333C|ZNF74_ENST00000403682.3_3'UTR	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	365					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCGGCGAGTGCGGCAAGGCCT	0.662																																					p.C365C													.	ZNF74	54		0			c.C1095T												42.0	51.0	48.0					22																	20760418		2203	4300	6503	SO:0001819	synonymous_variant	7625	exon6			CGAGTGCGGCAAG	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1095C>T	22.37:g.20760418C>T			59	0	0		66	0.08	5	NM_001256524	25	0.00	0	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Silent	SNP	ENST00000400451.2	37	CCDS42982.1																																																																																					0.662	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319648.2		NM_003426	
AIFM3	150209	mdanderson.org	37	22	21334370	21334370	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:21334370G>T	ENST00000399167.2	+	19	1954	c.1714G>T	c.(1714-1716)Gag>Tag	p.E572*	AIFM3_ENST00000405089.1_Nonsense_Mutation_p.E578*|AIFM3_ENST00000399163.2_Nonsense_Mutation_p.E572*|XXbac-B135H6.18_ENST00000610278.1_lincRNA|LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_5'Flank|AIFM3_ENST00000333607.6_Nonsense_Mutation_p.E572*|AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000440238.2_Nonsense_Mutation_p.E572*|AIFM3_ENST00000335375.5_Nonsense_Mutation_p.E560*|LZTR1_ENST00000215739.8_5'Flank	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	572					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CAAGGTCGCTGAGGTGCTGGC	0.627																																					p.E578X													.	AIFM3	49		0			c.G1732T												73.0	58.0	63.0					22																	21334370		2203	4300	6503	SO:0001587	stop_gained	150209	exon19			GTCGCTGAGGTGC	AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.1714G>T	22.37:g.21334370G>T	ENSP00000382120:p.Glu572*		31	0	0		41	0.07	3	NM_001146288	9	0.00	0	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Nonsense_Mutation	SNP	ENST00000399167.2	37	CCDS13786.1	.	.	.	.	.	.	.	.	.	.	G	41	9.048298	0.99048	.	.	ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000183773;ENSG00000099949	ENST00000399167;ENST00000399163;ENST00000405089;ENST00000335375;ENST00000440238;ENST00000333607;ENST00000539817	.	.	.	4.87	3.86	0.44501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-22.1296	11.0041	0.47624	0.0903:0.0:0.9097:0.0	.	.	.	.	X	572;572;578;560;572;572;12	.	ENSP00000327671:E572X	E	+	1	0	AIFM3;LZTR1	19664370	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	6.761000	0.74945	1.286000	0.44565	0.655000	0.94253	GAG			0.627	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000320150.1		NM_144704	
FAM83F	113828	hgsc.bcm.edu	37	22	40391306	40391307	+	In_Frame_Ins	INS	-	-	CAAGGC			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:40391306_40391307insCAAGGC	ENST00000333407.6	+	1	354_355	c.260_261insCAAGGC	c.(259-264)agcaag>agCAAGGCcaag	p.92_93insAK		NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	92										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						CGGGGCAAGAGCAAGGCCAAGG	0.757																																					p.S87delinsSKA													.	FAM83F	29		0			c.260_261insCAAGGC																																									SO:0001652	inframe_insertion	113828	exon1			GCAAGAGCAAGGC		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.273_278dupCAAGGC	22.37:g.40391307_40391312dupCAAGGC	ENSP00000330432:p.Ala91_Lys92dup		9	0	0		20	0.50	10	NM_138435	2	0.00	0	Q96FD6	In_Frame_Ins	INS	ENST00000333407.6	37	CCDS14000.2																																																																																					0.757	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319624.3		NM_138435	
PPP6R2	9701	mdanderson.org	37	22	50845165	50845165	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr22:50845165T>C	ENST00000216061.5	+	5	645	c.275T>C	c.(274-276)aTc>aCc	p.I92T	PPP6R2_ENST00000359139.3_Missense_Mutation_p.I92T|PPP6R2_ENST00000395741.3_Missense_Mutation_p.I92T|PPP6R2_ENST00000395744.3_Missense_Mutation_p.I92T			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	92						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GTGCCGCAGATCAGCGACCGC	0.537																																					p.I92T													.	PPP6R2	71		0			c.T275C												175.0	167.0	170.0					22																	50845165		2203	4300	6503	SO:0001583	missense	9701	exon4			CGCAGATCAGCGA	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.275T>C	22.37:g.50845165T>C	ENSP00000216061:p.Ile92Thr		44	0	0		56	0.05	3	NM_001242899	58	0.00	0	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	t	21.2	4.119366	0.77323	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	H	0.94886	3.595	0.58432	D	0.999998	D;P;P;P;P	0.63880	0.993;0.5;0.521;0.633;0.521	D;B;P;B;P	0.63703	0.917;0.238;0.508;0.417;0.508	T	0.75744	-0.3210	10	0.87932	D	0	-19.593	14.1898	0.65630	0.0:0.0:0.0:1.0	.	92;92;92;92;92	O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;PP6R2_HUMAN;.;.;.	T	92	ENSP00000352051:I92T;ENSP00000379090:I92T;ENSP00000379093:I92T;ENSP00000216061:I92T	ENSP00000216061:I92T	I	+	2	0	PPP6R2	49192031	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.047000	0.71038	2.004000	0.58718	0.449000	0.29647	ATC			0.537	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000316809.1		NM_014678	
GRIP2	80852	broad.mit.edu	37	3	14575374	14575374	+	RNA	DEL	T	T	-			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr3:14575374delT	ENST00000273083.3	-	0	106				RNU6-905P_ENST00000384434.1_RNA			Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						GAGCCATCTCTTTTCCCAGCT	0.567																																					.													.	GRIP2	68		0			.																																											80852	.			CATCTCTTTTCCC	AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14575374delT			7	0	0		6	0.33	2	.	0		0	Q8TEH9|Q9H7H3	RNA	DEL	ENST00000273083.3	37																																																																																						0.567	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000340582.2		NM_001080423	
NBEAL2	23218	mdanderson.org	37	3	47036675	47036675	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr3:47036675G>T	ENST00000450053.3	+	13	1629	c.1450G>T	c.(1450-1452)Gcc>Tcc	p.A484S	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.A484S	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	484					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CAGCTGCCCTGCCAGCCGTGC	0.677																																					p.A484S													.	NBEAL2	267		0			c.G1450T												7.0	8.0	8.0					3																	47036675		1952	4070	6022	SO:0001583	missense	23218	exon13			TGCCCTGCCAGCC	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.1450G>T	3.37:g.47036675G>T	ENSP00000415034:p.Ala484Ser		50	0.08	4		70	0.16	11	NM_015175	16	0.00	0	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	4.150	0.026253	0.08054	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.49720	0.77;0.77	4.59	1.62	0.23740	Armadillo-like helical (1);Armadillo-type fold (1);	0.449291	0.22539	N	0.058757	T	0.25457	0.0619	L	0.28274	0.84	0.80722	D	1	B;B	0.25667	0.131;0.006	B;B	0.21151	0.033;0.005	T	0.04320	-1.0960	10	0.09843	T	0.71	.	5.4741	0.16686	0.1981:0.2893:0.5126:0.0	.	450;484	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	S	484;484;450	ENSP00000292309:A484S;ENSP00000415034:A484S	ENSP00000292309:A484S	A	+	1	0	NBEAL2	47011679	0.893000	0.30496	0.997000	0.53966	0.951000	0.60555	1.393000	0.34497	0.674000	0.31244	-0.224000	0.12420	GCC			0.677	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344363.3		XM_291064	
SPINK8	646424	bcgsc.ca;mdanderson.org	37	3	48362556	48362556	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr3:48362556G>T	ENST00000434006.1	-	2	75	c.76C>A	c.(76-78)Ctt>Att	p.L26I		NM_001080525.1	NP_001073994.1	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8 (putative)	26						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GCCATAGGAAGGGGGAAGTCT	0.473																																					p.L26I													.	SPINK8	5		0			c.C76A												51.0	46.0	47.0					3																	48362556		1865	4109	5974	SO:0001583	missense	646424	exon2			TAGGAAGGGGGAA		CCDS46822.1	3p21.31	2011-08-31			ENSG00000229453	ENSG00000229453		"""Serine peptidase inhibitors, Kazal type"""	33160	protein-coding gene	gene with protein product						16930550	Standard	NM_001080525		Approved		uc003csq.1	P0C7L1	OTTHUMG00000156832	ENST00000434006.1:c.76C>A	3.37:g.48362556G>T	ENSP00000407497:p.Leu26Ile		75	0	0		78	0.06	5	NM_001080525	0		0		Missense_Mutation	SNP	ENST00000434006.1	37	CCDS46822.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348820	0.24426	.	.	ENSG00000229453	ENST00000434006	T	0.26067	1.76	3.31	2.42	0.29668	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.09310	N	1	P	0.48834	0.916	B	0.39935	0.314	T	0.10894	-1.0610	8	0.87932	D	0	.	8.5444	0.33413	0.0:0.2377:0.7623:0.0	.	26	P0C7L1	ISK8_HUMAN	I	26	ENSP00000407497:L26I	ENSP00000407497:L26I	L	-	1	0	SPINK8	48337560	0.731000	0.28111	0.117000	0.21633	0.127000	0.20565	0.772000	0.26647	0.953000	0.37825	0.650000	0.86243	CTT			0.473	SPINK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346123.1		NM_001080525	
CAMKV	79012	broad.mit.edu	37	3	49897047	49897047	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr3:49897047G>T	ENST00000477224.1	-	11	1688	c.1210C>A	c.(1210-1212)Cca>Aca	p.P404T	CAMKV_ENST00000488336.1_Missense_Mutation_p.P373T|CAMKV_ENST00000296471.7_Missense_Mutation_p.P376T|CAMKV_ENST00000467248.1_Missense_Mutation_p.P329T|CAMKV_ENST00000463537.1_Silent_p.P335P|CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000466940.1_Missense_Mutation_p.P330T			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	404	Ala-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCGGTGGCTGGGGTGACACTG	0.617																																					p.P404T													.	CAMKV	84		0			c.C1210A												115.0	118.0	117.0					3																	49897047		2203	4299	6502	SO:0001583	missense	79012	exon11			TGGCTGGGGTGAC	BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.1210C>A	3.37:g.49897047G>T	ENSP00000419195:p.Pro404Thr		153	0	0		133	0.04	5	NM_024046	4	0.00	0	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Missense_Mutation	SNP	ENST00000477224.1	37	CCDS33762.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342343	0.41498	.	.	ENSG00000164076	ENST00000296471;ENST00000488336;ENST00000477224;ENST00000467248;ENST00000466940	T;T;T;T;T	0.69926	0.3;-0.21;-0.21;-0.44;1.59	5.44	5.44	0.79542	.	0.000000	0.42172	D	0.000741	T	0.68915	0.3053	L	0.29908	0.895	0.44635	D	0.997617	P;B;D;D;P;P;P	0.62365	0.9;0.1;0.991;0.991;0.939;0.782;0.9	B;B;P;P;P;B;B	0.58013	0.339;0.023;0.831;0.831;0.639;0.188;0.339	T	0.71052	-0.4704	10	0.66056	D	0.02	.	14.6416	0.68729	0.0:0.0:1.0:0.0	.	330;336;404;329;376;373;404	E7ETR1;B4DMF2;B2RDF9;B4DM24;Q8NCB2-2;Q8NCB2-3;Q8NCB2	.;.;.;.;.;.;CAMKV_HUMAN	T	376;373;404;329;330	ENSP00000296471:P376T;ENSP00000418809:P373T;ENSP00000419195:P404T;ENSP00000420053:P329T;ENSP00000420724:P330T	ENSP00000296471:P376T	P	-	1	0	CAMKV	49872051	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.035000	0.41155	2.837000	0.97791	0.655000	0.94253	CCA			0.617	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350584.4		NM_024046	
ERICH6	131831	mdanderson.org	37	3	150421549	150421549	+	Missense_Mutation	SNP	T	T	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr3:150421549T>A	ENST00000295910.6	-	1	189	c.137A>T	c.(136-138)gAa>gTa	p.E46V	RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron|RP11-103G8.2_ENST00000471093.1_RNA	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctccacctcttcctcctcctc	0.612																																					p.E46V													FAM194A,NS,carcinoma,+1,1	FAM194A	91	1	0			c.A137T												127.0	106.0	113.0					3																	150421549		2203	4300	6503	SO:0001583	missense	131831	exon1			ACCTCTTCCTCCT																												ENST00000295910.6:c.137A>T	3.37:g.150421549T>A	ENSP00000295910:p.Glu46Val		44	0.0681818182	3		54	0.15	8	NM_152394	0		0		Missense_Mutation	SNP	ENST00000295910.6	37	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	T	4.389	0.071826	0.08436	.	.	ENSG00000163645	ENST00000295910;ENST00000474463	T;T	0.54279	2.03;0.58	0.443	0.443	0.16587	.	0.580363	0.13317	N	0.397030	T	0.45175	0.1329	N	0.08118	0	0.09310	N	0.999991	D	0.54772	0.968	P	0.61874	0.895	T	0.33369	-0.9871	9	0.66056	D	0.02	-1.7724	.	.	.	.	46	Q7L0X2	F194A_HUMAN	V	46	ENSP00000295910:E46V;ENSP00000419304:E46V	ENSP00000295910:E46V	E	-	2	0	FAM194A	151904239	0.000000	0.05858	0.011000	0.14972	0.012000	0.07955	-1.137000	0.03219	0.449000	0.26747	0.438000	0.28831	GAA			0.612	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257666.1			
SPINK2	6691	mdanderson.org	37	4	57687798	57687798	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr4:57687798G>T	ENST00000248701.4	-	1	110	c.31C>A	c.(31-33)Ctg>Atg	p.L11M	SPINK2_ENST00000506738.1_Missense_Mutation_p.L11M|SPINK2_ENST00000504762.1_Missense_Mutation_p.L11M	NM_021114.2	NP_066937.1	P20155	ISK2_HUMAN	serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)	11					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(2)	4	Glioma(25;0.08)|all_neural(26;0.181)					GCCAGGAGCAGCAGCGCCAAG	0.701																																					p.L11M													.	SPINK2	12		0			c.C31A												10.0	10.0	10.0					4																	57687798		2122	4090	6212	SO:0001583	missense	6691	exon1			GGAGCAGCAGCGC	BC022514	CCDS3508.1, CCDS63971.1, CCDS63972.1, CCDS75128.1	4q12	2011-08-31	2005-08-17		ENSG00000128040	ENSG00000128040		"""Serine peptidase inhibitors, Kazal type"""	11245	protein-coding gene	gene with protein product		605753	"""serine protease inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)"""			8428671	Standard	NM_001271718		Approved	HUSI-II	uc031sep.1	P20155	OTTHUMG00000128769	ENST00000248701.4:c.31C>A	4.37:g.57687798G>T	ENSP00000248701:p.Leu11Met		33	0	0		48	0.06	3	NM_001271722	7	0.00	0	Q6FGH2	Missense_Mutation	SNP	ENST00000248701.4	37	CCDS3508.1	.	.	.	.	.	.	.	.	.	.	G	6.634	0.485397	0.12641	.	.	ENSG00000128040	ENST00000248701;ENST00000506738;ENST00000504762	T;D;D	0.84800	-1.36;-1.9;-1.9	2.81	-5.62	0.02481	.	4.048720	0.02147	N	0.057690	T	0.70928	0.3280	.	.	.	0.09310	N	1	P	0.37955	0.612	B	0.32533	0.147	T	0.63382	-0.6650	9	0.42905	T	0.14	.	2.1178	0.03718	0.2126:0.1526:0.4828:0.152	.	11	P20155	ISK2_HUMAN	M	11	ENSP00000248701:L11M;ENSP00000425961:L11M;ENSP00000423858:L11M	ENSP00000248701:L11M	L	-	1	2	SPINK2	57382555	0.005000	0.15991	0.005000	0.12908	0.021000	0.10359	-1.085000	0.03390	-1.344000	0.02216	0.313000	0.20887	CTG			0.701	SPINK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000250690.2		NM_021114	
TRIO	7204	mdanderson.org	37	5	14369582	14369582	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr5:14369582G>T	ENST00000344204.4	+	18	3190	c.3166G>T	c.(3166-3168)Gtg>Ttg	p.V1056L	TRIO_ENST00000509967.2_Missense_Mutation_p.V1007L|TRIO_ENST00000537187.1_Missense_Mutation_p.V1056L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1056					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GACGGACCACGTGACGCCCAT	0.612																																					p.V1056L													.	TRIO	305		0			c.G3166T												105.0	99.0	101.0					5																	14369582		2203	4300	6503	SO:0001583	missense	7204	exon18			GACCACGTGACGC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3166G>T	5.37:g.14369582G>T	ENSP00000339299:p.Val1056Leu		49	0	0		49	0.06	3	NM_007118	7	0.00	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999785	0.54147	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T;T	0.59906	0.98;0.98;0.98;0.23	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	L	0.31294	0.92	0.80722	D	1	B;B;D	0.69078	0.035;0.334;0.997	B;B;D	0.74674	0.064;0.218;0.984	T	0.57551	-0.7792	10	0.17369	T	0.5	.	20.1374	0.98035	0.0:0.0:1.0:0.0	.	1007;1056;1056	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	L	1056;1056;1007;743	ENSP00000339299:V1056L;ENSP00000446348:V1056L;ENSP00000445592:V1007L;ENSP00000426342:V743L	ENSP00000339299:V1056L	V	+	1	0	TRIO	14422582	1.000000	0.71417	0.999000	0.59377	0.130000	0.20726	9.869000	0.99810	2.763000	0.94921	0.563000	0.77884	GTG			0.612	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253711.2		NM_007118	
NPR3	4883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	32712263	32712263	+	Silent	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr5:32712263G>A	ENST00000265074.8	+	1	724	c.381G>A	c.(379-381)aaG>aaA	p.K127K	NPR3_ENST00000434067.2_Intron|NPR3_ENST00000415167.2_Silent_p.K127K|NPR3_ENST00000415685.2_Intron	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	127					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.K127N(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GGGGCGCCAAGCCAGACCTTA	0.687																																					p.K127K													.	.			1	Substitution - Missense(1)	lung(1)	c.G381A												50.0	59.0	56.0					5																	32712263		1925	4121	6046	SO:0001819	synonymous_variant	4883	exon1			CGCCAAGCCAGAC		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.381G>A	5.37:g.32712263G>A			139	0	0		109	0.20	22	NM_000908	0		0	A2RRD1|B4DT84|E7EPG9	Silent	SNP	ENST00000265074.8	37	CCDS56357.1																																																																																					0.687	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317550.3		NM_000908	
MAP1B	4131	mdanderson.org	37	5	71482492	71482492	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr5:71482492G>T	ENST00000296755.7	+	4	719	c.421G>T	c.(421-423)Ggg>Tgg	p.G141W		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	141					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CGTGCTGACCGGGCAGTGCTT	0.522																																					p.G141W	Melanoma(17;367 822 11631 31730 47712)												.	MAP1B	243		0			c.G421T												117.0	114.0	115.0					5																	71482492		2203	4300	6503	SO:0001583	missense	4131	exon4			CTGACCGGGCAGT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.421G>T	5.37:g.71482492G>T	ENSP00000296755:p.Gly141Trp		90	0	0		64	0.05	3	NM_005909	1	0.00	0	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	30	5.053840	0.93793	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.04706	3.57;3.57;3.57	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000003	T	0.26122	0.0637	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00422	-1.1749	10	0.87932	D	0	-25.4623	19.8968	0.96969	0.0:0.0:1.0:0.0	.	15;141	A2BDK6;P46821	.;MAP1B_HUMAN	W	141;141;15	ENSP00000296755:G141W;ENSP00000423444:G141W;ENSP00000423416:G15W	ENSP00000296755:G141W	G	+	1	0	MAP1B	71518248	1.000000	0.71417	0.889000	0.34880	0.993000	0.82548	9.722000	0.98770	2.691000	0.91804	0.655000	0.94253	GGG			0.522	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218561.6		NM_005909	
EIF4E1B	253314	broad.mit.edu	37	5	176070126	176070128	+	In_Frame_Del	DEL	AGA	AGA	-	rs73806058	byFrequency	TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr5:176070126_176070128delAGA	ENST00000318682.6	+	4	643_645	c.59_61delAGA	c.(58-63)gagaag>gag	p.K21del	EIF4E1B_ENST00000504597.1_In_Frame_Del_p.K21del	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	21					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)			breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaggaggaggagaaggaggagga	0.601																																					p.20_21del													.	EIF4E1B	24		0			c.59_61del									268,3714		18,232,1741						-3.3	0.0			38	20,7998		7,6,3996	no	coding	EIF4E1B	NM_001099408.1		25,238,5737	A1A1,A1R,RR		0.2494,6.7303,2.4				288,11712				SO:0001651	inframe_deletion	253314	exon4			AGGAGGAGAAGGA		CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	ENST00000318682.6:c.59_61delAGA	5.37:g.176070126_176070128delAGA	ENSP00000323714:p.Lys21del		143	0	0		153	0.05	8	NM_001099408	0		0		In_Frame_Del	DEL	ENST00000318682.6	37	CCDS47345.1																																																																																					0.601	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372187.1		NM_001099408	
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83847668	83847668	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr6:83847668G>T	ENST00000349129.2	+	21	4167	c.3907G>T	c.(3907-3909)Gcc>Tcc	p.A1303S	DOPEY1_ENST00000237163.5_Missense_Mutation_p.A1284S|DOPEY1_ENST00000369739.3_Missense_Mutation_p.A1294S|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1303					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGTAAAACTTGCCAGAAAAAA	0.338																																					p.A1303S													.	.			0			c.G3907T												56.0	56.0	56.0					6																	83847668		2202	4298	6500	SO:0001583	missense	23033	exon21			AAACTTGCCAGAA	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3907G>T	6.37:g.83847668G>T	ENSP00000195654:p.Ala1303Ser		69	0	0		53	0.13	7	NM_015018	8	0.00	0	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	2.583	-0.297079	0.05532	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.24723	1.84;1.86	6.16	6.16	0.99307	.	0.099611	0.64402	D	0.000002	T	0.06872	0.0175	N	0.19112	0.55	0.80722	D	1	B;B;B	0.25719	0.132;0.051;0.051	B;B;B	0.20767	0.031;0.01;0.01	T	0.07673	-1.0760	10	0.06757	T	0.87	.	15.5636	0.76269	0.0:0.0:0.8622:0.1378	.	1194;1294;1303	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	S	1303;1284;1284	ENSP00000195654:A1303S;ENSP00000237163:A1284S	ENSP00000237163:A1284S	A	+	1	0	DOPEY1	83904387	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.126000	0.50477	2.937000	0.99478	0.650000	0.86243	GCC			0.338	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043785.2		NM_015018	
SOGA3	387104	mdanderson.org	37	6	127796588	127796588	+	Missense_Mutation	SNP	G	G	T	rs374876819		TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr6:127796588G>T	ENST00000525778.1	-	6	3328	c.2583C>A	c.(2581-2583)gaC>gaA	p.D861E	SOGA3_ENST00000481848.2_Missense_Mutation_p.D861E|SOGA3_ENST00000474293.2_5'UTR|SOGA3_ENST00000465909.2_Missense_Mutation_p.D861E|SOGA3_ENST00000368268.2_Missense_Mutation_p.D861E|SOGA3_ENST00000556132.1_Missense_Mutation_p.D861E			Q5TF21	SOGA3_HUMAN	SOGA family member 3	861					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.D861D(1)									TGCGGCTGCCGTCGTCCTCCT	0.642																																					p.D861E													C6orf174,bladder,carcinoma,0,2	.		2	1	Substitution - coding silent(1)	large_intestine(1)	c.C2583A												55.0	67.0	63.0					6																	127796588		2169	4269	6438	SO:0001583	missense	387104	exon6			GCTGCCGTCGTCC	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2583C>A	6.37:g.127796588G>T	ENSP00000434570:p.Asp861Glu		56	0	0		53	0.06	3	NM_001012279	1	0.00	0		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400365	0.25291	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	5.69	2.51	0.30379	.	0.229598	0.49305	D	0.000158	T	0.03520	0.0101	N	0.03608	-0.345	0.46901	D	0.999246	B	0.14805	0.011	B	0.19666	0.026	T	0.25467	-1.0131	10	0.23302	T	0.38	-26.6669	7.2835	0.26324	0.4354:0.0:0.5646:0.0	.	861	Q5TF21	CF174_HUMAN	E	861	ENSP00000451768:D861E;ENSP00000357251:D861E;ENSP00000434570:D861E;ENSP00000435559:D861E	ENSP00000435559:D861E	D	-	3	2	C6orf174	127838281	0.968000	0.33430	1.000000	0.80357	0.998000	0.95712	0.924000	0.28777	0.778000	0.33520	0.556000	0.70494	GAC			0.642	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388246.1		NM_001012279	
SCAF8	22828	hgsc.bcm.edu	37	6	155153803	155153803	+	Silent	SNP	T	T	C			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr6:155153803T>C	ENST00000367178.3	+	20	3666	c.3090T>C	c.(3088-3090)ccT>ccC	p.P1030P	TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000367186.4_Silent_p.P1096P|SCAF8_ENST00000417268.1_Silent_p.P1030P	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1030	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TTAGTAGACCTCCCCCTGTGG	0.473																																					p.P1030P													.	.			0			c.T3090C												61.0	62.0	62.0					6																	155153803		2203	4299	6502	SO:0001819	synonymous_variant	22828	exon20			TAGACCTCCCCCT	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3090T>C	6.37:g.155153803T>C			79	0	0		104	0.05	5	NM_014892	127	0.02	2	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	CCDS5247.1																																																																																					0.473	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042798.1		NM_014892	
RBAK	57786	mdanderson.org	37	7	5104859	5104859	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr7:5104859G>T	ENST00000353796.3	+	6	2096	c.1772G>T	c.(1771-1773)gGc>gTc	p.G591V	RBAK_ENST00000396912.1_Missense_Mutation_p.G591V|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	591	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GTACACACAGGCGAGAAACCC	0.378																																					p.G591V													.	RBAK	82		0			c.G1772T												44.0	48.0	46.0					7																	5104859		2203	4299	6502	SO:0001583	missense	57786	exon5			ACACAGGCGAGAA	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1772G>T	7.37:g.5104859G>T	ENSP00000275423:p.Gly591Val		38	0	0		44	0.09	4	NM_021163	8	0.00	0	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769594	0.49680	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.23552	1.9;1.9	3.76	3.76	0.43208	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000123	T	0.54175	0.1842	M	0.86864	2.845	0.43462	D	0.995663	D	0.89917	1.0	D	0.78314	0.991	T	0.68577	-0.5372	8	.	.	.	.	13.8561	0.63527	0.0:0.0:1.0:0.0	.	591	Q9NYW8	RBAK_HUMAN	V	591	ENSP00000275423:G591V;ENSP00000380120:G591V	.	G	+	2	0	RBAK	5071385	0.998000	0.40836	0.780000	0.31762	0.954000	0.61252	2.547000	0.45786	2.386000	0.81285	0.555000	0.69702	GGC			0.378	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241640.2		NM_021163	
STK17A	9263	mdanderson.org	37	7	43622932	43622932	+	Silent	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr7:43622932G>A	ENST00000319357.5	+	1	269	c.90G>A	c.(88-90)ccG>ccA	p.P30P	STK17A_ENST00000462448.1_Intron	NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	30					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						TGAgcgggccgtgccggccgc	0.751																																					p.P30P													.	STK17A	31		0			c.G90A												2.0	3.0	3.0					7																	43622932		1578	3193	4771	SO:0001819	synonymous_variant	9263	exon1			CGGGCCGTGCCGG	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.90G>A	7.37:g.43622932G>A			31	0	0		26	0.08	2	NM_004760	2	0.00	0	A4D1V6|Q8IVC8	Silent	SNP	ENST00000319357.5	37	CCDS5470.1																																																																																					0.751	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250902.1		NM_004760	
MAGI2	9863	mdanderson.org	37	7	77762375	77762375	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr7:77762375G>T	ENST00000354212.4	-	18	3287	c.3034C>A	c.(3034-3036)Ctc>Atc	p.L1012I	MAGI2_ENST00000419488.1_Missense_Mutation_p.L998I|MAGI2_ENST00000522391.1_Missense_Mutation_p.L1012I	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1012					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGGCTGTTGAGCTCTGCGATG	0.592																																					p.L1012I													.	MAGI2	246		0			c.C3034A												96.0	102.0	100.0					7																	77762375		2203	4300	6503	SO:0001583	missense	9863	exon18			TGTTGAGCTCTGC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3034C>A	7.37:g.77762375G>T	ENSP00000346151:p.Leu1012Ile		35	0	0		38	0.08	3	NM_012301	0		0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.661120	0.29515	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.10763	2.94;2.94;2.84	5.76	5.76	0.90799	PDZ/DHR/GLGF (1);	0.000000	0.32459	U	0.006061	T	0.07863	0.0197	N	0.19112	0.55	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.18263	0.002;0.021;0.008	T	0.35847	-0.9772	10	0.19590	T	0.45	.	12.8594	0.57906	0.075:0.0:0.925:0.0	.	1012;998;1012	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	I	998;1012;1012;1012	ENSP00000405766:L998I;ENSP00000346151:L1012I;ENSP00000428389:L1012I	ENSP00000346151:L1012I	L	-	1	0	MAGI2	77600311	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.294000	0.51787	2.726000	0.93360	0.655000	0.94253	CTC			0.592	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253197.3		NM_012301	
Unknown	0	hgsc.bcm.edu	37	7	97599706	97599706	+	IGR	SNP	T	T	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr7:97599706T>G								MIR5692C2 (5913 upstream) : OCM2 (14289 downstream)																							ttttttttttttggagacgga	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTTTTTTTGGAGA																													7.37:g.97599706T>G			176	0	0		174	0.09	16	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.473										
NKX2-6	137814	mdanderson.org	37	8	23560024	23560024	+	Silent	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr8:23560024G>T	ENST00000325017.3	-	2	845	c.846C>A	c.(844-846)ggC>ggA	p.G282G	NKX2-6_ENST00000418222.1_Silent_p.G200G	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	282					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGGCATTCTGGCCACCGTGTC	0.706																																					p.G282G													.	NKX2-6	6		0			c.C846A												12.0	19.0	17.0					8																	23560024		691	1591	2282	SO:0001819	synonymous_variant	137814	exon2			ATTCTGGCCACCG	CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.846C>A	8.37:g.23560024G>T			21	0	0		17	0.12	2	NM_001136271	0		0		Silent	SNP	ENST00000325017.3	37																																																																																						0.706	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000376057.4		NM_001136271	
FAM49B	51571	mdanderson.org	37	8	130863111	130863111	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr8:130863111G>T	ENST00000519824.2	-	9	956	c.683C>A	c.(682-684)gCt>gAt	p.A228D	FAM49B_ENST00000517654.1_Missense_Mutation_p.A228D|FAM49B_ENST00000519540.1_Missense_Mutation_p.A228D|FAM49B_ENST00000522941.1_Missense_Mutation_p.A82D|FAM49B_ENST00000519110.1_Missense_Mutation_p.A228D|FAM49B_ENST00000522746.1_Missense_Mutation_p.A228D|FAM49B_ENST00000522250.1_Missense_Mutation_p.A82D|FAM49B_ENST00000401979.2_Missense_Mutation_p.A228D|FAM49B_ENST00000523509.1_Missense_Mutation_p.A228D	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	228						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			GCATACACTAGCCATTGTGCT	0.323																																					p.A228D													.	FAM49B	36		0			c.C683A												106.0	100.0	102.0					8																	130863111		2203	4300	6503	SO:0001583	missense	51571	exon10			ACACTAGCCATTG	AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.683C>A	8.37:g.130863111G>T	ENSP00000429150:p.Ala228Asp		48	0	0		46	0.07	3	NM_001256763	323	0.00	0	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	ENST00000519824.2	37	CCDS6361.1	.	.	.	.	.	.	.	.	.	.	G	35	5.473669	0.96291	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000522250;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000522941;ENST00000311292	T;T;T;T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47;0.47	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.77837	0.4190	M	0.87180	2.865	0.80722	D	1	D	0.63046	0.992	D	0.70227	0.968	T	0.79701	-0.1693	10	0.87932	D	0	-10.9395	19.8676	0.96824	0.0:0.0:1.0:0.0	.	228	Q9NUQ9	FA49B_HUMAN	D	228;228;228;228;82;228;228;228;82;182	ENSP00000428117:A228D;ENSP00000429802:A228D;ENSP00000384880:A228D;ENSP00000429078:A228D;ENSP00000429978:A82D;ENSP00000429150:A228D;ENSP00000430674:A228D;ENSP00000429499:A228D;ENSP00000430433:A82D	ENSP00000311651:A182D	A	-	2	0	FAM49B	130932293	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	GCT			0.323	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380390.2		NM_016623	
FAM166B	730112	mdanderson.org	37	9	35562684	35562684	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chr9:35562684G>T	ENST00000399742.2	-	4	576	c.506C>A	c.(505-507)tCc>tAc	p.S169Y	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	169										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						GTCATCCATGGAGTAGGGAGA	0.587																																					p.S169Y													.	FAM166B	19		0			c.C506A												55.0	63.0	60.0					9																	35562684		2017	4169	6186	SO:0001583	missense	730112	exon4			TCCATGGAGTAGG	BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.506C>A	9.37:g.35562684G>T	ENSP00000382646:p.Ser169Tyr		66	0	0		51	0.06	3	NM_001164310	0		0	A1L3B2|B7ZBJ0	Missense_Mutation	SNP	ENST00000399742.2	37	CCDS56572.1	.	.	.	.	.	.	.	.	.	.	G	4.786	0.146219	0.09134	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	.	.	.	5.12	5.12	0.69794	.	0.517201	0.14493	U	0.316222	T	0.62539	0.2436	M	0.70595	2.14	0.32772	N	0.503592	D;P;P	0.61697	0.99;0.911;0.956	P;P;P	0.57911	0.829;0.507;0.564	T	0.61681	-0.7013	9	0.02654	T	1	-20.9308	14.4039	0.67068	0.0:0.0:1.0:0.0	.	169;169;169	B7ZW33;A8MTA8;A8MTA8-2	.;F166B_HUMAN;.	Y	169	.	ENSP00000382646:S169Y	S	-	2	0	FAM166B	35552684	0.998000	0.40836	1.000000	0.80357	0.442000	0.32017	2.098000	0.41757	2.518000	0.84900	0.563000	0.77884	TCC			0.587	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336563.1		NM_001099951	
MT-ND6	4541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	14179	14179	+	Silent	SNP	A	A	G			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chrM:14179A>G	ENST00000361681.2	-	1	494	c.495T>C	c.(493-495)taT>taC	p.Y165Y	MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	165			Y -> C. {ECO:0000269|PubMed:1757091}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TCAATTACAATATATACACCA	0.413																																					p.Y165Y													.	.			0			c.T495C																																									SO:0001819	synonymous_variant	0	exon1			TACAATATATACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.495T>C	M.37:g.14179A>G			21	0	0		13	0.46	6	ENST00000361681	0		0	Q34774|Q8HG30	Silent	SNP	ENST00000361681.2	37																																																																																						0.413	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024037	
MT-CYB	4519	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	14804	14804	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chrM:14804G>A	ENST00000361789.2	+	1	58	c.58G>A	c.(58-60)Gac>Aac	p.D20N	MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	20					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACTCATTCATCGACCTCCCCA	0.443																																					p.D20N													.	.			0			c.G58A																																									SO:0001583	missense	0	exon1			TTCATCGACCTCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.58G>A	M.37:g.14804G>A	ENSP00000354554:p.Asp20Asn		84	0	0		77	0.22	17	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.443	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
HAUS7	55559	mdanderson.org	37	X	152734605	152734605	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AB-01A-31D-A435-10	TCGA-VF-A8AB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	01d47985-e09b-4438-8c1b-820be9a3e0e3	16586582-b7cd-44b0-8494-76745a479e35	g.chrX:152734605G>T	ENST00000370211.4	-	2	296	c.253C>A	c.(253-255)Cgg>Agg	p.R85R	HAUS7_ENST00000421080.2_5'UTR|TREX2_ENST00000370232.1_5'UTR|TREX2_ENST00000338525.2_5'UTR|HAUS7_ENST00000370210.1_Splice_Site_p.R75R|HAUS7_ENST00000370212.3_Splice_Site_p.R85R|TREX2_ENST00000330912.2_5'UTR|TREX2_ENST00000334497.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	85					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						ATGCATTACCGGGTACACATC	0.552																																					p.R85R													.	HAUS7	44		0			c.C253A												204.0	172.0	183.0					X																	152734605		2203	4300	6503	SO:0001630	splice_region_variant	55559	exon2			ATTACCGGGTACA	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.254+1C>A	X.37:g.152734605G>T			48	0	0		57	0.05	3	NM_017518	106	0.00	0	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Silent	SNP	ENST00000370211.4	37	CCDS35438.1																																																																																					0.552	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060963.2		NM_017518	Silent
