#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PHC2	1912	mdanderson.org	37	1	33820462	33820462	+	Missense_Mutation	SNP	G	G	T	rs139804561		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr1:33820462G>T	ENST00000257118.5	-	7	1422	c.1369C>A	c.(1369-1371)Caa>Aaa	p.Q457K	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Missense_Mutation_p.Q428K|RP11-415J8.5_ENST00000432703.1_RNA|PHC2_ENST00000419414.2_Missense_Mutation_p.Q457K|PHC2_ENST00000373422.3_Missense_Mutation_p.Q62K	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	457					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GGCTGCAGTTGTAAGATGACA	0.622																																					p.Q457K													.	.			0			c.C1369A												68.0	59.0	62.0					1																	33820462		2203	4300	6503	SO:0001583	missense	1912	exon7			GCAGTTGTAAGAT	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1369C>A	1.37:g.33820462G>T	ENSP00000257118:p.Gln457Lys		51	0	0		40	0.08	3	NM_198040	1	0.00	0	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407478	0.42715	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000419414	T;T;T;T	0.52057	1.84;1.42;0.68;1.87	5.59	5.59	0.84812	.	0.536654	0.18860	N	0.129174	T	0.65186	0.2667	M	0.66939	2.045	0.80722	D	1	D;D;D	0.54964	0.969;0.969;0.969	D;D;D	0.64877	0.93;0.93;0.93	T	0.62096	-0.6926	10	0.40728	T	0.16	-0.9959	15.0973	0.72244	0.0:0.0:1.0:0.0	.	457;428;457	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	K	428;457;62;457	ENSP00000389436:Q428K;ENSP00000257118:Q457K;ENSP00000362521:Q62K;ENSP00000391440:Q457K	ENSP00000257118:Q457K	Q	-	1	0	PHC2	33593049	1.000000	0.71417	0.697000	0.30258	0.046000	0.14306	4.888000	0.63164	2.629000	0.89072	0.591000	0.81541	CAA			0.622	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000011895.1		NM_198040	
STK40	83931	mdanderson.org	37	1	36820843	36820843	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr1:36820843G>T	ENST00000373129.3	-	6	940	c.534C>A	c.(532-534)ttC>ttA	p.F178L	STK40_ENST00000373132.3_Missense_Mutation_p.F178L|STK40_ENST00000373130.3_Missense_Mutation_p.F183L|STK40_ENST00000482458.1_5'Flank|STK40_ENST00000359297.2_Missense_Mutation_p.F178L	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CCACGTCGTAGAAGATTACCA	0.582																																					p.F178L													.	.			0			c.C534A												160.0	134.0	143.0					1																	36820843		2203	4300	6503	SO:0001583	missense	83931	exon6			GTCGTAGAAGATT	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.534C>A	1.37:g.36820843G>T	ENSP00000362221:p.Phe178Leu		48	0	0		44	0.07	3	NM_032017	32	0.00	0	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	37	CCDS407.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887004	0.72410	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	T;T;T;T	0.72615	-0.67;-0.12;-0.12;-0.67	5.62	3.74	0.42951	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78679	0.4321	L	0.61218	1.895	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.77146	-0.2695	10	0.66056	D	0.02	-22.0969	6.6252	0.22826	0.1604:0.0:0.6929:0.1467	.	178;183;178	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	L	178;178;183;178	ENSP00000362221:F178L;ENSP00000352245:F178L;ENSP00000362222:F183L;ENSP00000362224:F178L	ENSP00000352245:F178L	F	-	3	2	STK40	36593430	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	4.432000	0.59922	0.716000	0.32124	-0.321000	0.08615	TTC			0.582	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000022592.1		NM_032017	
PFKFB2	5208	ucsc.edu	37	1	207252307	207252307	+	IGR	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr1:207252307G>T	ENST00000367080.3	+	0	7094				PFKFB2_ENST00000541914.1_Missense_Mutation_p.E246D|PFKFB2_ENST00000411990.2_Missense_Mutation_p.E355D|PFKFB2_ENST00000367079.2_Missense_Mutation_p.E453D|PFKFB2_ENST00000473310.1_3'UTR	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					AGGCAGCAGAGACCACACTGG	0.542																																					p.E453D													.	PFKFB2	70		0			c.G1359T												140.0	127.0	131.0					1																	207252307		2203	4300	6503	SO:0001628	intergenic_variant	5208	exon15			AGCAGAGACCACA		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033		1.37:g.207252307G>T			38	0	0		37	0.11	4	NM_001018053	2	0.00	0	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	37	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	G	3.675	-0.066814	0.07273	.	.	ENSG00000123836	ENST00000411990;ENST00000367079;ENST00000541914	.	.	.	5.0	-5.53	0.02552	.	.	.	.	.	T	0.07908	0.0198	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.20887	0.0;0.0;0.049	B;B;B	0.23275	0.0;0.0;0.045	T	0.31223	-0.9951	8	0.11485	T	0.65	.	1.41	0.02289	0.162:0.2215:0.1787:0.4378	.	246;355;453	B4DI16;B4DY91;Q5VVQ3	.;.;.	D	355;453;246	.	ENSP00000356046:E453D	E	+	3	2	PFKFB2	205318930	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.413000	0.07123	-0.948000	0.03668	-0.868000	0.02995	GAG			0.542	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087838.1			
GTPBP4	23560	broad.mit.edu	37	10	1058562	1058562	+	Missense_Mutation	SNP	A	A	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr10:1058562A>G	ENST00000360803.4	+	14	1584	c.1502A>G	c.(1501-1503)aAg>aGg	p.K501R	GTPBP4_ENST00000545048.1_Missense_Mutation_p.K454R|GTPBP4_ENST00000538293.1_Missense_Mutation_p.K385R	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	501					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		TCCAAAGAAAAGAATACACAG	0.428																																					p.K501R													.	GTPBP4	57		0			c.A1502G												60.0	66.0	64.0					10																	1058562		2203	4299	6502	SO:0001583	missense	23560	exon14			AAGAAAAGAATAC	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1502A>G	10.37:g.1058562A>G	ENSP00000354040:p.Lys501Arg		199	0	0		192	0.02	4	NM_012341	166	0.00	0	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Missense_Mutation	SNP	ENST00000360803.4	37	CCDS31132.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.323743	0.41096	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	T;T;T	0.33654	1.41;1.4;1.42	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	L	0.31578	0.945	0.80722	D	1	B	0.14012	0.009	B	0.12837	0.008	T	0.05419	-1.0886	10	0.22109	T	0.4	-26.6383	15.4287	0.75075	1.0:0.0:0.0:0.0	.	501	Q9BZE4	NOG1_HUMAN	R	501;385;454	ENSP00000354040:K501R;ENSP00000444277:K385R;ENSP00000445473:K454R	ENSP00000354040:K501R	K	+	2	0	GTPBP4	1048562	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	8.677000	0.91203	2.120000	0.65058	0.459000	0.35465	AAG			0.428	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046412.1		NM_012341	
ANKRD30A	91074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	37508722	37508722	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr10:37508722T>C	ENST00000602533.1	+	34	4013	c.3914T>C	c.(3913-3915)aTg>aCg	p.M1305T	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.M1305T|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.M1424T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1361					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAGAGGAAAATGCAACATCAT	0.294																																					p.M1305T													.	.			0			c.T3914C												32.0	31.0	31.0					10																	37508722		1828	4076	5904	SO:0001583	missense	91074	exon34			GGAAAATGCAACA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3914T>C	10.37:g.37508722T>C	ENSP00000473551:p.Met1305Thr		90	0	0		74	0.19	14	NM_052997	0		0	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	t	0.010	-1.751919	0.00663	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.12984	2.63;2.63	2.95	-3.19	0.05171	.	.	.	.	.	T	0.09024	0.0223	L	0.43152	1.355	0.09310	N	1	B	0.26708	0.157	B	0.22152	0.038	T	0.33599	-0.9862	9	0.37606	T	0.19	.	3.1212	0.06392	0.4187:0.0:0.373:0.2083	.	1361	Q9BXX3	AN30A_HUMAN	T	1305;1424	ENSP00000354432:M1305T;ENSP00000363792:M1424T	ENSP00000354432:M1305T	M	+	2	0	ANKRD30A	37548728	0.985000	0.35326	0.001000	0.08648	0.000000	0.00434	1.611000	0.36879	-0.547000	0.06207	-2.309000	0.00256	ATG			0.294	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000047588.2		NM_052997	
PIDD1	55367	mdanderson.org	37	11	802057	802057	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr11:802057G>T	ENST00000347755.5	-	7	1351	c.1210C>A	c.(1210-1212)Cag>Aag	p.Q404K	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.Q404K	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CGCCGGGCCTGCGGTGGGGTG	0.672																																					p.Q404K													.	.			0			c.C1210A												17.0	16.0	16.0					11																	802057		2180	4269	6449	SO:0001583	missense	55367	exon7			GGGCCTGCGGTGG																												ENST00000347755.5:c.1210C>A	11.37:g.802057G>T	ENSP00000337797:p.Gln404Lys		67	0	0		40	0.08	3	NM_145887	37	0.00	0		Missense_Mutation	SNP	ENST00000347755.5	37	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	G	7.111	0.576038	0.13623	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.40756	1.02;1.02	4.25	1.08	0.20341	ZU5 (2);	0.387617	0.18115	N	0.151250	T	0.14614	0.0353	N	0.08118	0	0.09310	N	1	B;B;B	0.17852	0.024;0.015;0.015	B;B;B	0.15484	0.013;0.005;0.006	T	0.27468	-1.0073	10	0.02654	T	1	.	2.9745	0.05933	0.0922:0.1456:0.4337:0.3284	.	404;258;404	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	K	404	ENSP00000416801:Q404K;ENSP00000337797:Q404K	ENSP00000337797:Q404K	Q	-	1	0	PIDD	792057	0.046000	0.20272	0.067000	0.19924	0.158000	0.22134	1.176000	0.31957	0.043000	0.15746	0.491000	0.48974	CAG			0.672	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257103.1			
TRIM3	10612	mdanderson.org	37	11	6478097	6478097	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr11:6478097G>T	ENST00000525074.1	-	6	1253	c.859C>A	c.(859-861)Ccg>Acg	p.P287T	TRIM3_ENST00000359518.3_Missense_Mutation_p.P287T|TRIM3_ENST00000537602.1_Intron|TRIM3_ENST00000345851.3_Missense_Mutation_p.P287T|TRIM3_ENST00000536344.1_Missense_Mutation_p.P168T|TRIM3_ENST00000529058.1_5'UTR	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	287					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCGCTCCGGGAAGGCCTGT	0.662																																					p.P287T	Melanoma(6;5 510 1540 25169 29084)												.	.			0			c.C859A												54.0	50.0	52.0					11																	6478097		2197	4287	6484	SO:0001583	missense	10612	exon7			GCTCCGGGAAGGC	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.859C>A	11.37:g.6478097G>T	ENSP00000433102:p.Pro287Thr		53	0	0		38	0.08	3	NM_006458	19	0.00	0	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532530	0.45073	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000359518;ENST00000536344	T;T;T;D	0.83673	-0.6;-0.6;-0.6;-1.75	5.27	5.27	0.74061	.	0.049292	0.85682	D	0.000000	D	0.87763	0.6259	M	0.70275	2.135	0.58432	D	0.99999	P;D;B	0.56035	0.602;0.974;0.235	B;P;B	0.57911	0.343;0.829;0.08	D	0.84491	0.0611	10	0.12430	T	0.62	-18.9291	17.4649	0.87629	0.0:0.0:1.0:0.0	.	168;168;287	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	T	287;287;287;287;276;287;168	ENSP00000433102:P287T;ENSP00000340797:P287T;ENSP00000352508:P287T;ENSP00000445460:P168T	ENSP00000337094:P276T	P	-	1	0	TRIM3	6434673	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.539000	0.82063	2.472000	0.83506	0.563000	0.77884	CCG			0.662	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384224.2		NM_006458	
SLC5A12	159963	mdanderson.org	37	11	26718754	26718754	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr11:26718754G>T	ENST00000396005.3	-	8	1306	c.997C>A	c.(997-999)Ctg>Atg	p.L333M	SLC5A12_ENST00000280467.6_Missense_Mutation_p.L333M	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	333					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AGTCCTGGCAGTCCTGGCATT	0.393																																					p.L333M													.	.			0			c.C997A												157.0	147.0	150.0					11																	26718754		2203	4299	6502	SO:0001583	missense	159963	exon8			CTGGCAGTCCTGG	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.997C>A	11.37:g.26718754G>T	ENSP00000379326:p.Leu333Met		61	0	0		53	0.06	3	NM_178498	0		0	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867032	0.32977	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.90676	-2.71;-2.71;-2.71	5.97	2.01	0.26516	.	0.154363	0.43260	D	0.000592	D	0.89015	0.6595	L	0.39898	1.24	0.42933	D	0.994329	B;P	0.44429	0.322;0.835	B;P	0.53518	0.23;0.728	D	0.84507	0.0620	10	0.40728	T	0.16	.	7.6439	0.28309	0.1907:0.2315:0.5778:0.0	.	333;333	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	M	333;333;145	ENSP00000379326:L333M;ENSP00000280467:L333M;ENSP00000435053:L145M	ENSP00000280467:L333M	L	-	1	2	SLC5A12	26675330	0.980000	0.34600	0.806000	0.32338	0.932000	0.56968	1.569000	0.36428	0.124000	0.18369	-0.781000	0.03364	CTG			0.393	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319681.1		NM_178498	
DSCAML1	57453	mdanderson.org	37	11	117351904	117351904	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr11:117351904G>T	ENST00000321322.6	-	13	2822	c.2821C>A	c.(2821-2823)Caa>Aaa	p.Q941K	DSCAML1_ENST00000527706.1_Missense_Mutation_p.Q671K	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	881	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ACAGTGAGTTGGATCAAGCCC	0.637																																					p.Q941K													.	.			0			c.C2821A												103.0	90.0	94.0					11																	117351904		2201	4296	6497	SO:0001583	missense	57453	exon13			TGAGTTGGATCAA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2821C>A	11.37:g.117351904G>T	ENSP00000315465:p.Gln941Lys		137	0	0		115	0.04	5	NM_020693	0		0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395305	0.62066	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.65916	-0.18;-0.18	4.52	4.52	0.55395	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70116	0.3187	L	0.56396	1.775	0.80722	D	1	P	0.49862	0.929	P	0.53760	0.734	T	0.73560	-0.3944	9	0.56958	D	0.05	.	16.2307	0.82341	0.0:0.0:1.0:0.0	.	881	Q8TD84	DSCL1_HUMAN	K	671;941;648	ENSP00000434335:Q671K;ENSP00000315465:Q941K	ENSP00000315465:Q941K	Q	-	1	0	DSCAML1	116857114	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.309000	0.78937	2.329000	0.79093	0.485000	0.47835	CAA			0.637	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392907.2		NM_020693	
SRPR	6734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	126135872	126135872	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr11:126135872C>G	ENST00000332118.6	-	8	1191	c.1037G>C	c.(1036-1038)cGt>cCt	p.R346P	SRPR_ENST00000530680.1_5'Flank|SRPR_ENST00000532259.1_Missense_Mutation_p.R318P	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	346					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		GAGATGATCACGCATCTTGTC	0.507																																					p.R346P													SRPR,NS,carcinoma,+1,1	SRPR	1	1	0			c.G1037C												211.0	196.0	201.0					11																	126135872		2201	4299	6500	SO:0001583	missense	6734	exon8			TGATCACGCATCT	BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1037G>C	11.37:g.126135872C>G	ENSP00000328023:p.Arg346Pro		91	0	0		63	0.16	10	NM_003139	232	0.59	138	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	ENST00000332118.6	37	CCDS31717.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301343	0.60195	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	5.25	5.25	0.73442	Signal recognition particle, SRP54 subunit, helical bundle (4);	0.049013	0.85682	D	0.000000	T	0.70081	0.3183	M	0.79011	2.435	0.58432	D	0.999996	D;D	0.62365	0.991;0.982	D;D	0.64237	0.923;0.923	T	0.72827	-0.4175	9	0.62326	D	0.03	-8.6593	6.2973	0.21093	0.0:0.7884:0.0:0.2116	.	318;346	E9PJS4;P08240	.;SRPR_HUMAN	P	346;318	.	ENSP00000328023:R346P	R	-	2	0	SRPR	125641082	1.000000	0.71417	0.991000	0.47740	0.646000	0.38490	3.951000	0.56684	2.738000	0.93877	0.655000	0.94253	CGT			0.507	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386425.2		NM_003139	
AQP6	363	broad.mit.edu	37	12	50369380	50369380	+	Missense_Mutation	SNP	G	G	A	rs566077374		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr12:50369380G>A	ENST00000315520.5	+	4	1112	c.775G>A	c.(775-777)Gca>Aca	p.A259T	AQP6_ENST00000551733.1_Missense_Mutation_p.A85T	NM_001652.3	NP_001643.2	Q13520	AQP6_HUMAN	aquaporin 6, kidney specific	259					anion transport (GO:0006820)|excretion (GO:0007588)|odontogenesis (GO:0042476)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	integral component of plasma membrane (GO:0005887)|transport vesicle membrane (GO:0030658)	anion channel activity (GO:0005253)|water channel activity (GO:0015250)			endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(2)	13						GGGGACAGGGGCAGGGGCAGG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		13900	0.001		0.0	False		,,,				2504	0.0				p.A259T													.	AQP6	25		0			c.G775A												31.0	38.0	35.0					12																	50369380		2203	4300	6503	SO:0001583	missense	363	exon4			ACAGGGGCAGGGG	AL137716	CCDS31798.1	12q13	2005-09-20			ENSG00000086159	ENSG00000086159		"""Ion channels / Aquaporins"""	639	protein-coding gene	gene with protein product		601383		AQP2L		8812490	Standard	XM_006719375		Approved		uc001rvr.1	Q13520	OTTHUMG00000133548	ENST00000315520.5:c.775G>A	12.37:g.50369380G>A	ENSP00000320247:p.Ala259Thr		107	0	0		217	0.02	5	NM_001652	2	0.00	0		Missense_Mutation	SNP	ENST00000315520.5	37	CCDS31798.1	.	.	.	.	.	.	.	.	.	.	G	0.377	-0.930601	0.02359	.	.	ENSG00000086159	ENST00000551733;ENST00000315520	D;D	0.94828	-3.53;-2.2	0.225	-0.451	0.12214	.	2.066580	0.03066	N	0.156570	D	0.84620	0.5512	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.75631	-0.3251	9	0.10636	T	0.68	.	.	.	.	.	259	Q13520	AQP6_HUMAN	T	85;259	ENSP00000449830:A85T;ENSP00000320247:A259T	ENSP00000320247:A259T	A	+	1	0	AQP6	48655647	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.065000	0.11617	-0.779000	0.04560	-0.786000	0.03341	GCA			0.652	AQP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257528.2		NM_001652, NM_053286	
TBC1D15	64786	mdanderson.org	37	12	72266784	72266784	+	Splice_Site	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr12:72266784G>T	ENST00000550746.1	+	3	268		c.e3+1		TBC1D15_ENST00000393309.3_Splice_Site|TBC1D15_ENST00000485960.2_Splice_Site|TBC1D15_ENST00000319106.8_Splice_Site	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGCTAGAAAGGTATTTAAGAA	0.308																																					.													.	.			0			c.204+1G>T												98.0	106.0	104.0					12																	72266784		2203	4299	6502	SO:0001630	splice_region_variant	64786	exon3			AGAAAGGTATTTA	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.204+1G>T	12.37:g.72266784G>T			48	0	0		50	0.06	3	NM_001146213	2	0.00	0	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Splice_Site	SNP	ENST00000550746.1	37	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264091	0.80358	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3389	0.94334	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D15	70553051	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.993000	0.70616	2.575000	0.86900	0.655000	0.94253	.			0.308	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000351266.2		NM_022771	Intron
PUS1	80324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	132426156	132426156	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr12:132426156C>G	ENST00000376649.3	+	5	1364	c.864C>G	c.(862-864)agC>agG	p.S288R	PUS1_ENST00000542167.2_Missense_Mutation_p.S235R|PUS1_ENST00000440818.2_Missense_Mutation_p.S260R|PUS1_ENST00000443358.2_Missense_Mutation_p.S260R|PUS1_ENST00000535067.1_Intron	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	288					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		AGGGCCAGAGCTTCATGATGC	0.602																																					p.S288R	Esophageal Squamous(102;671 2009 17384 45666)												.	.			0			c.C864G												149.0	143.0	145.0					12																	132426156		2203	4300	6503	SO:0001583	missense	80324	exon5			CCAGAGCTTCATG	AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.864C>G	12.37:g.132426156C>G	ENSP00000365837:p.Ser288Arg		108	0	0		122	0.10	12	NM_025215	163	0.16	26	A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	ENST00000376649.3	37	CCDS9275.2	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539373	0.65085	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167	T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32	5.17	4.07	0.47477	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.000000	0.85682	D	0.000000	T	0.81861	0.4912	H	0.96430	3.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86547	0.1832	10	0.87932	D	0	-10.5566	11.9683	0.53049	0.0:0.837:0.0:0.163	.	235;288	F5H1S9;Q9Y606	.;TRUA_HUMAN	R	260;288;260;260;235	ENSP00000392451:S260R;ENSP00000365837:S288R;ENSP00000324726:S260R;ENSP00000400032:S260R;ENSP00000438948:S235R	ENSP00000324726:S260R	S	+	3	2	PUS1	130992109	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.518000	0.45537	2.405000	0.81733	0.491000	0.48974	AGC			0.602	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250313.2		NM_025215	
ERICH6B	220081	ucsc.edu	37	13	46170726	46170726	+	Missense_Mutation	SNP	A	A	G	rs28548352|rs142875900|rs375947127	byFrequency	TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr13:46170726A>G	ENST00000298738.2	-	3	579	c.415T>C	c.(415-417)Tat>Cat	p.Y139H		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		139	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTCCCCAGATActcttcctcc	0.488																																					p.Y139H													.	FAM194B	42		0			c.T415C												134.0	79.0	95.0					13																	46170726		692	1566	2258	SO:0001583	missense	220081	exon3			CCAGATACTCTTC																												ENST00000298738.2:c.415T>C	13.37:g.46170726A>G	ENSP00000298738:p.Tyr139His		213	0.0046948357	1		156	0.11	17	NM_182542	0		0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089484	0.07053	.	.	ENSG00000165837	ENST00000298738	T	0.06294	3.32	2.4	-0.599	0.11645	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.27594	0.182;0.071	B;B	0.26310	0.068;0.009	T	0.43925	-0.9361	9	0.87932	D	0	0.4727	0.1132	0.00058	0.3431:0.2385:0.1823:0.236	rs28548352	139;139	A2VDI6;Q5W0A0	.;F194B_HUMAN	H	139	ENSP00000298738:Y139H	ENSP00000298738:Y139H	Y	-	1	0	FAM194B	45068727	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-6.553000	0.00061	0.160000	0.19432	0.358000	0.22013	TAT			0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044781.3			
MED4	29079	hgsc.bcm.edu	37	13	48651479	48651479	+	Intron	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr13:48651479G>A	ENST00000258648.2	-	7	666				MED4_ENST00000378586.1_Intron|MED4-AS1_ENST00000422483.1_RNA|MED4_ENST00000495013.1_Intron	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		GATAAGAACAGCTCTATCTGT	0.323																																					.	Pancreas(38;399 1016 9170 13426 20145)												.	.			0			.												36.0	35.0	35.0					13																	48651479		2203	4300	6503	SO:0001627	intron_variant	100873965	.			AGAACAGCTCTAT	AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.641-32C>T	13.37:g.48651479G>A			57	0	0		43	0.26	11	.	1	0.00	0	B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	RNA	SNP	ENST00000258648.2	37	CCDS9408.1																																																																																					0.323	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000044863.1		NM_014166	
GPC5	2262	mdanderson.org	37	13	92051332	92051332	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr13:92051332G>A	ENST00000377067.3	+	1	404	c.32G>A	c.(31-33)cGc>cAc	p.R11H		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	11					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GTGGGCTTTCGCTGCCTCCTC	0.677																																					p.R11H													.	.			0			c.G32A												30.0	28.0	29.0					13																	92051332		2188	4281	6469	SO:0001583	missense	2262	exon1			GCTTTCGCTGCCT	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.32G>A	13.37:g.92051332G>A	ENSP00000366267:p.Arg11His		49	0	0		31	0.10	3	NM_004466	0		0	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.182869	0.38511	.	.	ENSG00000179399	ENST00000377067	T	0.51325	0.71	4.0	2.04	0.26737	.	0.648332	0.14560	N	0.312114	T	0.28101	0.0693	N	0.22421	0.69	0.09310	N	0.999994	P	0.38167	0.621	B	0.37047	0.24	T	0.07462	-1.0771	10	0.27082	T	0.32	.	4.9109	0.13821	0.1214:0.2187:0.6599:0.0	.	11	P78333	GPC5_HUMAN	H	11	ENSP00000366267:R11H	ENSP00000366267:R11H	R	+	2	0	GPC5	90849333	0.041000	0.20044	0.430000	0.26722	0.543000	0.35085	0.121000	0.15667	0.959000	0.37980	0.471000	0.43371	CGC			0.677	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045454.1		NM_004466	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	28474449	28474449	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:28474449G>A	ENST00000261609.7	-	34	5272	c.5164C>T	c.(5164-5166)Cct>Tct	p.P1722S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CGATTAAAAGGCGGGATCAAA	0.408																																					p.P1722S													.	.			0			c.C5164T												76.0	84.0	81.0					15																	28474449		2202	4280	6482	SO:0001583	missense	8924	exon34			TAAAAGGCGGGAT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5164C>T	15.37:g.28474449G>A	ENSP00000261609:p.Pro1722Ser		214	0	0		233	0.11	25	NM_004667	11	0.09	1		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.462354	0.63513	.	.	ENSG00000128731	ENST00000261609	T	0.51325	0.71	4.27	4.27	0.50696	.	0.061460	0.64402	D	0.000004	T	0.47040	0.1424	L	0.54323	1.7	0.80722	D	1	P	0.47409	0.895	B	0.42030	0.373	T	0.57039	-0.7879	10	0.62326	D	0.03	.	16.8954	0.86099	0.0:0.0:1.0:0.0	.	1722	O95714	HERC2_HUMAN	S	1722	ENSP00000261609:P1722S	ENSP00000261609:P1722S	P	-	1	0	HERC2	26148044	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.229000	0.95273	2.194000	0.70268	0.555000	0.69702	CCT			0.408	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251358.2		NM_004667	
RP11-1000B6.3	0	broad.mit.edu	37	15	32828941	32828973	+	lincRNA	DEL	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	-			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:32828941_32828973delGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	ENST00000564670.1	+	0	103				RP11-632K20.7_ENST00000561563.2_RNA																							TTGGGCTCCAGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCTGCTGCGCGGT	0.73																																					.													.	.			0			.																																											0	.			GCTCCAGCCCCAG																													15.37:g.32828941_32828973delGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT			8	0	0		14	0.21	3	.	0		0		RNA	DEL	ENST00000564670.1	37																																																																																						0.730	RP11-1000B6.3-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000429854.1			
RYR3	6263	broad.mit.edu;mdanderson.org	37	15	34048566	34048566	+	Missense_Mutation	SNP	T	T	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:34048566T>G	ENST00000389232.4	+	59	8645	c.8575T>G	c.(8575-8577)Ttt>Gtt	p.F2859V	RYR3_ENST00000415757.3_Missense_Mutation_p.F2859V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2859					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GATCAAATTCTTTGCCAAAGT	0.413																																					p.F2859V													.	RYR3	760		0			c.T8575G												73.0	71.0	72.0					15																	34048566		1860	4103	5963	SO:0001583	missense	6263	exon59			AAATTCTTTGCCA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8575T>G	15.37:g.34048566T>G	ENSP00000373884:p.Phe2859Val		76	0	0		84	0.06	5	NM_001243996	0		0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.867214	0.91511	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98835	-5.17;-5.15	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.98713	0.9568	M	0.71036	2.16	0.80722	D	1	D;P	0.62365	0.991;0.942	P;P	0.59595	0.86;0.684	D	0.99659	1.0993	10	0.87932	D	0	.	15.4481	0.75248	0.0:0.0:0.0:1.0	.	2859;2859	Q15413-2;Q15413	.;RYR3_HUMAN	V	2859	ENSP00000373884:F2859V;ENSP00000399610:F2859V	ENSP00000354735:F2859V	F	+	1	0	RYR3	31835858	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.383000	0.79741	2.371000	0.80710	0.533000	0.62120	TTT			0.413	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000417514.1			
MYO5A	4644	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	15	52645822	52645822	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:52645822G>C	ENST00000399231.3	-	27	3844	c.3601C>G	c.(3601-3603)Ctg>Gtg	p.L1201V	MYO5A_ENST00000399233.2_Missense_Mutation_p.L1201V|MYO5A_ENST00000553916.1_Missense_Mutation_p.L1201V|MYO5A_ENST00000358212.6_Missense_Mutation_p.L1201V|MYO5A_ENST00000356338.6_Missense_Mutation_p.L1201V	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1201					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TCATATTCCAGTTCTGCACCT	0.353																																					p.L1201V													.	.			0			c.C3601G												114.0	110.0	111.0					15																	52645822		1812	4079	5891	SO:0001583	missense	4644	exon27			ATTCCAGTTCTGC		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3601C>G	15.37:g.52645822G>C	ENSP00000382177:p.Leu1201Val		110	0	0		105	0.09	9	NM_000259	49	0.22	11	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.438205	0.62955	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.20598	3.5;3.5;2.06;3.5;2.06	5.92	3.94	0.45596	.	0.073354	0.56097	D	0.000024	T	0.32882	0.0844	L	0.43152	1.355	0.53688	D	0.999974	B;D	0.76494	0.255;0.999	B;D	0.66602	0.046;0.945	T	0.01596	-1.1316	10	0.42905	T	0.14	.	9.7924	0.40715	0.2549:0.0:0.7451:0.0	.	1201;1201	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	V	1201;735;1201;1201;1201;831;1201	ENSP00000382177:L1201V;ENSP00000382179:L1201V;ENSP00000348693:L1201V;ENSP00000350945:L1201V;ENSP00000451109:L1201V	ENSP00000348693:L1201V	L	-	1	2	MYO5A	50433114	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.086000	0.50159	0.739000	0.32628	-0.136000	0.14681	CTG			0.353	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000268102.1		NM_000259	
CYP1A1	1543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75015099	75015099	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:75015099G>T	ENST00000379727.3	-	2	538	c.340C>A	c.(340-342)Ctc>Atc	p.L114I	CYP1A1_ENST00000395049.4_Missense_Mutation_p.L114I|CYP1A1_ENST00000395048.2_Missense_Mutation_p.L114I|CYP1A1_ENST00000564596.1_Intron|CYP1A1_ENST00000567032.1_Missense_Mutation_p.L114I			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	114					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	TTACTGATGAGGGTGAAGGTG	0.632									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.L114I													.	.			0			c.C340A												49.0	49.0	49.0					15																	75015099		2197	4295	6492	SO:0001583	missense	1543	exon2	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	TGATGAGGGTGAA	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.340C>A	15.37:g.75015099G>T	ENSP00000369050:p.Leu114Ile		49	0	0		70	0.14	10	NM_000499	0		0	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486319	0.26686	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.68624	-0.34;-0.34;-0.34	5.23	-3.3	0.05003	.	0.559079	0.19708	N	0.107863	T	0.69663	0.3136	M	0.62154	1.92	0.09310	N	1	P;P	0.45902	0.868;0.458	P;P	0.53760	0.734;0.591	T	0.68029	-0.5517	10	0.52906	T	0.07	.	13.1229	0.59338	0.7456:0.0:0.2544:0.0	.	114;114	E7EMT5;P04798	.;CP1A1_HUMAN	I	114	ENSP00000369050:L114I;ENSP00000378488:L114I;ENSP00000378489:L114I	ENSP00000268062:L114I	L	-	1	0	CYP1A1	72802152	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.153000	0.10144	-0.522000	0.06417	-0.362000	0.07510	CTC			0.632	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286396.1		NM_000499	
AP3B2	8120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83357926	83357926	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:83357926G>A	ENST00000261722.3	-	3	455	c.248C>T	c.(247-249)gCc>gTc	p.A83V	AP3B2_ENST00000561455.1_5'UTR|AP3B2_ENST00000542200.1_Missense_Mutation_p.A83V|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Missense_Mutation_p.A83V|AP3B2_ENST00000535359.1_Missense_Mutation_p.A83V	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	83					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GTTCTTACAGGCCACGTTCTT	0.547																																					p.A83V													.	.			0			c.C248T												67.0	67.0	67.0					15																	83357926		2015	4172	6187	SO:0001583	missense	8120	exon3			TTACAGGCCACGT	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.248C>T	15.37:g.83357926G>A	ENSP00000261722:p.Ala83Val		105	0	0		125	0.12	15	NM_004644	26	0.35	9	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.093959	0.56075	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359;ENST00000541693;ENST00000542200;ENST00000535513	T;T;T;T;T	0.28895	1.59;2.54;1.59;1.59;1.59	5.96	5.96	0.96718	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	N	0.17379	0.485	0.80722	D	1	B;P;P;P	0.37500	0.046;0.477;0.565;0.597	B;B;B;P	0.44647	0.027;0.371;0.23;0.456	T	0.01666	-1.1300	10	0.07030	T	0.85	-25.976	20.3928	0.98949	0.0:0.0:1.0:0.0	.	83;83;83;83	F5H0E6;B7ZKR7;B7ZKS0;Q13367	.;.;.;AP3B2_HUMAN	V	83;83;83;39;83;83	ENSP00000261722:A83V;ENSP00000438721:A83V;ENSP00000440984:A83V;ENSP00000441961:A39V;ENSP00000440719:A83V	ENSP00000261722:A83V	A	-	2	0	AP3B2	81154980	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.733000	0.98818	2.813000	0.96785	0.655000	0.94253	GCC			0.547	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397463.1			
AKAP13	11214	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	86076953	86076953	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr15:86076953C>G	ENST00000394518.2	+	4	415	c.320C>G	c.(319-321)gCt>gGt	p.A107G	AKAP13_ENST00000361243.2_Missense_Mutation_p.A107G|AKAP13_ENST00000560302.1_Missense_Mutation_p.A107G	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	107					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCAACCAGTGCTGGAAATCAG	0.493																																					p.A107G	Melanoma(94;603 1453 3280 32295 32951)												.	AKAP13	394		0			c.C320G												124.0	119.0	121.0					15																	86076953		2202	4299	6501	SO:0001583	missense	11214	exon4			CCAGTGCTGGAAA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.320C>G	15.37:g.86076953C>G	ENSP00000378026:p.Ala107Gly		169	0	0		189	0.12	23	NM_007200	11	0.18	2	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724656	0.89298	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.61274	0.12;0.12	5.67	5.67	0.87782	.	.	.	.	.	T	0.72277	0.3440	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.994;0.997;0.998	T	0.73084	-0.4094	9	0.87932	D	0	.	19.115	0.93334	0.0:1.0:0.0:0.0	.	107;107;107	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	G	107;107;106;106	ENSP00000354718:A107G;ENSP00000378026:A107G	ENSP00000354718:A107G	A	+	2	0	AKAP13	83877957	0.998000	0.40836	0.998000	0.56505	0.998000	0.95712	3.726000	0.54977	2.828000	0.97474	0.655000	0.94253	GCT			0.493	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000417318.1		NM_007200	
WDR24	84219	mdanderson.org	37	16	737638	737638	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr16:737638G>A	ENST00000248142.6	-	6	972	c.973C>T	c.(973-975)Cgt>Tgt	p.R325C	WDR24_ENST00000293883.4_Missense_Mutation_p.R195C|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	325										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CGGTCGGGACGCCGGATGTCC	0.637																																					p.R195C													.	.			0			c.C583T												103.0	86.0	92.0					16																	737638		2199	4300	6499	SO:0001583	missense	84219	exon2			CGGGACGCCGGAT	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.973C>T	16.37:g.737638G>A	ENSP00000248142:p.Arg325Cys		65	0	0		47	0.06	3	NM_032259	63	0.00	0	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	G	16.63	3.177182	0.57692	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.29655	1.56;1.56	5.05	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	L	0.49126	1.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.50591	-0.8810	10	0.87932	D	0	-13.0716	12.7391	0.57241	0.0:0.0:0.6114:0.3886	.	195	Q96S15-2	.	C	325;195	ENSP00000248142:R325C;ENSP00000293883:R195C	ENSP00000248142:R325C	R	-	1	0	WDR24	677639	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	1.907000	0.39897	1.307000	0.44944	0.650000	0.86243	CGT			0.637	WDR24-201	KNOWN	basic	protein_coding	protein_coding				NM_032259	
ARHGAP17	55114	mdanderson.org	37	16	24950698	24950698	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr16:24950698G>T	ENST00000289968.6	-	17	1780	c.1711C>A	c.(1711-1713)Cca>Aca	p.P571T	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Intron	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	571	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCGTCGCCTGGGCTCGGCCCC	0.677																																					p.P571T													.	.			0			c.C1711A												15.0	19.0	17.0					16																	24950698		2186	4272	6458	SO:0001583	missense	55114	exon17			CGCCTGGGCTCGG	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1711C>A	16.37:g.24950698G>T	ENSP00000289968:p.Pro571Thr		32	0	0		32	0.09	3	NM_001006634	42	0.00	0	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064870	0.36470	.	.	ENSG00000140750	ENST00000289968;ENST00000455311	T	0.20738	2.05	5.32	5.32	0.75619	.	0.165614	0.28946	N	0.013630	T	0.20901	0.0503	L	0.47716	1.5	0.80722	D	1	P;P	0.36535	0.501;0.557	B;B	0.39258	0.058;0.295	T	0.02059	-1.1221	10	0.13470	T	0.59	.	14.3713	0.66840	0.0:0.0:1.0:0.0	.	571;104	Q68EM7;Q68EM7-7	RHG17_HUMAN;.	T	571	ENSP00000289968:P571T	ENSP00000289968:P571T	P	-	1	0	ARHGAP17	24858199	1.000000	0.71417	0.995000	0.50966	0.914000	0.54420	3.221000	0.51215	2.767000	0.95098	0.655000	0.94253	CCA			0.677	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436548.3		NM_018054	
ADCY7	113	mdanderson.org	37	16	50334626	50334626	+	Splice_Site	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr16:50334626G>T	ENST00000394697.2	+	9	1417	c.1077G>T	c.(1075-1077)aaG>aaT	p.K359N	ADCY7_ENST00000537579.1_Splice_Site_p.K359N|ADCY7_ENST00000566433.2_Splice_Site_p.K359N|ADCY7_ENST00000254235.3_Splice_Site_p.K359N|ADCY7_ENST00000538642.1_Splice_Site_p.K359N			P51828	ADCY7_HUMAN	adenylate cyclase 7	359	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		TCTGCCCCAGGCAGGTGCGGG	0.657																																					p.K359N													.	.			0			c.G1077T												52.0	45.0	48.0					16																	50334626		2033	3944	5977	SO:0001630	splice_region_variant	113	exon8			CCCCAGGCAGGTG	D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.1077-1G>T	16.37:g.50334626G>T			55	0	0		44	0.07	3	NM_001114	16	0.00	0	A0AVA6	Missense_Mutation	SNP	ENST00000394697.2	37	CCDS10741.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749411	0.69533	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000537579;ENST00000254235	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	4.83	4.83	0.62350	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.46442	U	0.000288	D	0.83385	0.5243	L	0.35793	1.09	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.992;0.991	T	0.82074	-0.0637	9	.	.	.	.	12.3848	0.55327	0.082:0.0:0.918:0.0	.	359;359	P51828;F5H4D1	ADCY7_HUMAN;.	N	359	ENSP00000445046:K359N;ENSP00000378187:K359N;ENSP00000437788:K359N;ENSP00000254235:K359N	.	K	+	3	2	ADCY7	48892127	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.964000	0.56780	2.209000	0.71365	0.313000	0.20887	AAG			0.657	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256877.3			Missense_Mutation
RTN4RL1	146760	mdanderson.org	37	17	1840549	1840549	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:1840549G>T	ENST00000331238.6	-	2	1046	c.567C>A	c.(565-567)ggC>ggA	p.G189G		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						AGGTGCCCGGGCCCAGACTCC	0.617																																					p.G189G	GBM(68;949 1139 14865 32798 38342)												.	.			0			c.C567A												35.0	40.0	38.0					17																	1840549		1985	4152	6137	SO:0001819	synonymous_variant	146760	exon2			GCCCGGGCCCAGA	AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.567C>A	17.37:g.1840549G>T			28	0	0		27	0.11	3	NM_178568	12	0.00	0		Silent	SNP	ENST00000331238.6	37	CCDS45569.1																																																																																					0.617	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450155.2		NM_178568	
NLGN2	57555	mdanderson.org	37	17	7311730	7311730	+	Silent	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:7311730C>T	ENST00000302926.2	+	1	229	c.156C>T	c.(154-156)cgC>cgT	p.R52R	NLGN2_ENST00000575301.1_Silent_p.R52R|NLGN2_ENST00000572893.1_Intron	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	52					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GGCGAGTGCGCGGTGTGCGGC	0.776																																					p.R52R													.	.			0			c.C156T												7.0	7.0	7.0					17																	7311730		2034	4017	6051	SO:0001819	synonymous_variant	57555	exon1			AGTGCGCGGTGTG	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.156C>T	17.37:g.7311730C>T			34	0	0		22	0.14	3	NM_020795	4	0.00	0	Q9P2I1	Silent	SNP	ENST00000302926.2	37	CCDS11103.1																																																																																					0.776	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226941.2		NM_020795	
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7637852	7637852	+	Silent	SNP	A	A	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:7637852A>T	ENST00000572933.1	+	7	2264	c.804A>T	c.(802-804)acA>acT	p.T268T	DNAH2_ENST00000082259.3_Silent_p.T268T|DNAH2_ENST00000570791.1_Silent_p.T268T|DNAH2_ENST00000389173.2_Silent_p.T268T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	268	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGTGGAGACAGGAGAAAATT	0.527																																					p.T268T													.	.			0			c.A804T												89.0	84.0	86.0					17																	7637852		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon6			GGAGACAGGAGAA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.804A>T	17.37:g.7637852A>T			66	0	0		53	0.15	8	NM_020877	0		0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																					0.527	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
DNAH2	146754	mdanderson.org	37	17	7726883	7726883	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:7726883C>T	ENST00000572933.1	+	74	12726	c.11266C>T	c.(11266-11268)Cag>Tag	p.Q3756*	DNAH2_ENST00000389173.2_Nonsense_Mutation_p.Q3756*			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3756					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTCCTTTGAGCAGTACCCTCG	0.532																																					p.Q3756X													.	.			0			c.C11266T												173.0	132.0	146.0					17																	7726883		2203	4300	6503	SO:0001587	stop_gained	146754	exon73			TTTGAGCAGTACC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11266C>T	17.37:g.7726883C>T	ENSP00000458355:p.Gln3756*		79	0	0		75	0.05	4	NM_020877	1	0.00	0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Nonsense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	52	19.673128	0.99922	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	.	.	.	4.89	3.91	0.45181	.	0.202696	0.42294	D	0.000736	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	13.5596	0.61782	0.1573:0.8427:0.0:0.0	.	.	.	.	X	3717;3756	.	ENSP00000353818:Q3717X	Q	+	1	0	DNAH2	7667608	1.000000	0.71417	0.983000	0.44433	0.982000	0.71751	2.953000	0.49105	1.280000	0.44463	0.609000	0.83330	CAG			0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
DNAH9	1770	bcgsc.ca;mdanderson.org	37	17	11583113	11583113	+	Silent	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:11583113C>T	ENST00000262442.4	+	18	3461	c.3393C>T	c.(3391-3393)agC>agT	p.S1131S	DNAH9_ENST00000454412.2_Silent_p.S1131S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1131	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.S1131S(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAGTGAGAGCGGCTTACTCA	0.433																																					p.S1131S													DNAH9,colon,carcinoma,0,1	DNAH9	695	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C3393T												139.0	138.0	138.0					17																	11583113		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon18			TGAGAGCGGCTTA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3393C>T	17.37:g.11583113C>T			70	0	0		44	0.11	5	NM_001372	0		0	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																					0.433	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252756.2		NM_001372	
RAI1	10743	ucsc.edu	37	17	17697105	17697105	+	Silent	SNP	G	G	A	rs398124422|rs587780431		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:17697105G>A	ENST00000353383.1	+	3	1312	c.843G>A	c.(841-843)caG>caA	p.Q281Q	RAI1_ENST00000261641.6_Silent_p.Q281Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	281	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		agcagcagcagcagcagcagc	0.632																																					p.Q281Q													.	RAI1	121		0			c.G843A												20.0	25.0	24.0					17																	17697105		2020	4001	6021	SO:0001819	synonymous_variant	10743	exon3			GCAGCAGCAGCAG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.843G>A	17.37:g.17697105G>A			58	0.0172413793	1		36	0.11	4	NM_030665	10	0.00	0	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	CCDS11188.1																																																																																					0.632	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131775.1		NM_030665	
CCDC144CP	348254	mdanderson.org	37	17	18513400	18513400	+	IGR	SNP	G	G	A	rs377459168		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:18513400G>A								CCDC144B (3696 upstream) : TBC1D28 (24918 downstream)																							ATTGGCACAGGTCATGGAGAG	0.438																																					.													.	.			0			.												103.0	105.0	105.0					17																	18513400		1843	4082	5925	SO:0001628	intergenic_variant	284047	.			GCACAGGTCATGG																													17.37:g.18513400G>A			452	0	0		406	0.09	35	.	0		0		RNA	SNP		37																																																																																					0	0.438										
PIGS	94005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	26897967	26897967	+	Silent	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:26897967C>A	ENST00000308360.7	-	3	564	c.189G>T	c.(187-189)gtG>gtT	p.V63V	PIGS_ENST00000543734.1_Silent_p.V2V|RP11-192H23.5_ENST00000585189.1_RNA|PIGS_ENST00000395346.2_Silent_p.V55V	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	63					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					CAGTGACAGGCACCATGAGGC	0.612																																					p.V63V													.	.			0			c.G189T												102.0	101.0	101.0					17																	26897967		2203	4300	6503	SO:0001819	synonymous_variant	94005	exon3			GACAGGCACCATG		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.189G>T	17.37:g.26897967C>A			134	0	0		154	0.06	10	NM_033198	40	0.18	7	Q6UVX6	Silent	SNP	ENST00000308360.7	37	CCDS11235.1																																																																																					0.612	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255833.3		NM_033198	
PSMD11	5717	broad.mit.edu	37	17	30771555	30771555	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:30771555C>T	ENST00000261712.3	+	1	277	c.14C>T	c.(13-15)gCg>gTg	p.A5V	PSMD11_ENST00000457654.2_Missense_Mutation_p.A5V	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			gcggcggcggcggtggtggAG	0.701																																					p.A5V	Ovarian(130;1038 1716 9294 11987 19279)												.	PSMD11	41		0			c.C14T												18.0	18.0	18.0					17																	30771555		2186	4270	6456	SO:0001583	missense	5717	exon1			CGGCGGCGGTGGT	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.14C>T	17.37:g.30771555C>T	ENSP00000261712:p.Ala5Val		184	0.0108695652	2		224	0.03	7	NM_002815	98	0.00	0	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	ENST00000261712.3	37	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999150	0.74818	.	.	ENSG00000108671	ENST00000261712	.	.	.	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.24928	0.0605	N	0.08118	0	0.53688	D	0.999975	P;B	0.37038	0.579;0.212	B;B	0.33392	0.163;0.049	T	0.08086	-1.0739	9	0.27785	T	0.31	-19.5166	11.4424	0.50105	0.0:0.9133:0.0:0.0867	.	5;5	B4DTS5;O00231	.;PSD11_HUMAN	V	5	.	ENSP00000261712:A5V	A	+	2	0	PSMD11	27795668	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.945000	0.75947	1.455000	0.47813	0.558000	0.71614	GCG			0.701	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256252.2		NM_002815	
JUP	3728	mdanderson.org	37	17	39925795	39925795	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:39925795G>T	ENST00000393931.3	-	3	461	c.343C>A	c.(343-345)Cga>Aga	p.R115R	JUP_ENST00000310706.5_Silent_p.R115R|JUP_ENST00000393930.1_Silent_p.R115R|JUP_ENST00000540235.1_Silent_p.R115R	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	115					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TCGGCCAGTCGCTGCAGGTTG	0.672																																					p.R115R	Colon(16;42 520 6044 17852 28530)												.	.			0			c.C343A												25.0	25.0	25.0					17																	39925795		2200	4290	6490	SO:0001819	synonymous_variant	3728	exon3			CCAGTCGCTGCAG	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.343C>A	17.37:g.39925795G>T			43	0	0		42	0.07	3	NM_002230	660	0.00	0	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Silent	SNP	ENST00000393931.3	37	CCDS11407.1																																																																																					0.672	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257406.1			
GFAP	2670	mdanderson.org	37	17	42989051	42989051	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:42989051G>T	ENST00000253408.5	-	5	960	c.895C>A	c.(895-897)Ctg>Atg	p.L299M	GFAP_ENST00000591327.1_5'Flank|GFAP_ENST00000588735.1_Intron|GFAP_ENST00000435360.2_Missense_Mutation_p.L299M|GFAP_ENST00000586793.1_Missense_Mutation_p.L299M	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	299	Coil 2B.|Rod.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				GTGCCGCGCAGAGACTCCAGG	0.711																																					p.L299M													.	.			0			c.C895A												43.0	40.0	41.0					17																	42989051		2202	4298	6500	SO:0001583	missense	2670	exon5			CGCGCAGAGACTC	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.895C>A	17.37:g.42989051G>T	ENSP00000253408:p.Leu299Met		41	0	0		35	0.09	3	NM_002055	0		0	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	37	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014253	0.35511	.	.	ENSG00000131095	ENST00000253408;ENST00000421021;ENST00000435360	D;D	0.96200	-3.94;-3.94	4.38	-5.83	0.02325	Filament (1);	0.000000	0.64402	D	0.000003	D	0.95570	0.8560	L	0.60012	1.86	0.41871	D	0.990276	D;D	0.89917	1.0;0.99	D;D	0.77557	0.99;0.964	D	0.93589	0.6919	10	0.56958	D	0.05	.	11.9787	0.53107	0.2804:0.0:0.6193:0.1003	.	299;299	E9PAX3;P14136	.;GFAP_HUMAN	M	299;274;299	ENSP00000253408:L299M;ENSP00000403962:L299M	ENSP00000253408:L299M	L	-	1	2	GFAP	40344577	1.000000	0.71417	0.580000	0.28601	0.008000	0.06430	0.989000	0.29629	-1.268000	0.02439	-0.355000	0.07637	CTG			0.711	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448701.1		NM_002055	
MPO	4353	ucsc.edu;bcgsc.ca	37	17	56355398	56355398	+	Missense_Mutation	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:56355398C>A	ENST00000225275.3	-	7	1170	c.994G>T	c.(994-996)Gcg>Tcg	p.A332S	MPO_ENST00000578493.1_5'UTR|MPO_ENST00000340482.3_Missense_Mutation_p.A364S	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	332					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GAAGTGAGCGCGTTGATCTGG	0.637																																					p.A332S													MPO,NS,carcinoma,0,1	MPO	114	1	0			c.G994T												113.0	97.0	102.0					17																	56355398		2203	4300	6503	SO:0001583	missense	4353	exon7			TGAGCGCGTTGAT		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.994G>T	17.37:g.56355398C>A	ENSP00000225275:p.Ala332Ser		41	0	0		36	0.11	4	NM_000250	3	0.00	0	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972830	0.53614	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.68903	-0.36;-0.36	5.32	3.19	0.36642	.	0.054931	0.64402	D	0.000001	T	0.64271	0.2583	L	0.54908	1.71	0.35998	D	0.837191	B	0.26708	0.157	B	0.36808	0.233	T	0.69420	-0.5150	10	0.44086	T	0.13	-24.8911	11.2691	0.49127	0.1425:0.7202:0.1372:0.0	.	332	P05164	PERM_HUMAN	S	364;332	ENSP00000344419:A364S;ENSP00000225275:A332S	ENSP00000225275:A332S	A	-	1	0	MPO	53710397	0.579000	0.26725	0.890000	0.34922	0.942000	0.58702	1.197000	0.32211	1.206000	0.43276	0.561000	0.74099	GCG			0.637	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443971.1			
RP11-178C3.1	0	broad.mit.edu	37	17	58053027	58053027	+	IGR	DEL	A	A	-			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:58053027delA	ENST00000591035.1	+	0	481				RP11-178C3.2_ENST00000586209.1_lincRNA																							actccatctcaaaaaaaaaaa	0.453																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CATCTCAAAAAAA																													17.37:g.58053027delA			5	0	0		8	0.38	3	.	0		0		RNA	DEL	ENST00000591035.1	37																																																																																						0.453	RP11-178C3.1-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000449157.1			
USP32	84669	mdanderson.org	37	17	58343352	58343352	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:58343352G>T	ENST00000300896.4	-	8	1106	c.912C>A	c.(910-912)cgC>cgA	p.R304R	USP32_ENST00000393003.3_Silent_p.R304R	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	304					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TATCATCAGTGCGGTTGTCCT	0.388																																					p.R304R													.	.			0			c.C912A												111.0	100.0	104.0					17																	58343352		2203	4300	6503	SO:0001819	synonymous_variant	84669	exon8			ATCAGTGCGGTTG	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.912C>A	17.37:g.58343352G>T			63	0	0		46	0.07	3	NM_032582	48	0.00	0	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	ENST00000300896.4	37	CCDS32697.1																																																																																					0.388	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449235.2		NM_032582	
BRIP1	83990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59934456	59934456	+	Silent	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:59934456T>C	ENST00000259008.2	-	4	609	c.342A>G	c.(340-342)ccA>ccG	p.P114P	BRIP1_ENST00000577598.1_Silent_p.P114P	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	114	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TTTCAGAAGGTGGTGTGCTTG	0.348			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.P114P			yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	.			0			c.A342G												297.0	268.0	278.0					17																	59934456		2203	4300	6503	SO:0001819	synonymous_variant	83990	exon4			AGAAGGTGGTGTG	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.342A>G	17.37:g.59934456T>C			137	0	0		152	0.17	26	NM_032043	10	0.30	3	Q3MJE2|Q8NCI5	Silent	SNP	ENST00000259008.2	37	CCDS11631.1																																																																																					0.348	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445362.1		NM_032043	
ACE	1636	mdanderson.org	37	17	61574511	61574511	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:61574511G>T	ENST00000290866.4	+	25	3729	c.3705G>T	c.(3703-3705)ggG>ggT	p.G1235G	ACE_ENST00000577647.1_Intron|ACE_ENST00000490216.2_Intron|ACE_ENST00000413513.3_Silent_p.G620G|ACE_ENST00000290863.6_Silent_p.G661G|ACE_ENST00000421982.2_Silent_p.G440G|ACE_ENST00000428043.1_Intron	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1235					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GCTCAGAAGGGCCCCTCCCAG	0.721																																					p.G1235G													.	.			0			c.G3705T												12.0	15.0	14.0					17																	61574511		2190	4275	6465	SO:0001819	synonymous_variant	1636	exon25			AGAAGGGCCCCTC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3705G>T	17.37:g.61574511G>T			31	0	0		23	0.13	3	NM_000789	207	0.00	0	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Silent	SNP	ENST00000290866.4	37	CCDS11637.1																																																																																					0.721	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337675.2			
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	76471541	76471541	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:76471541T>C	ENST00000585328.1	-	54	8439	c.8315A>G	c.(8314-8316)gAg>gGg	p.E2772G	DNAH17_ENST00000389840.5_Missense_Mutation_p.E2763G|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2763	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CACGGCGTCCTCAAACAGCAC	0.592																																					p.E2777G													.	.			0			c.A8330G												47.0	49.0	48.0					17																	76471541		2107	4235	6342	SO:0001583	missense	8632	exon54			GCGTCCTCAAACA	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8315A>G	17.37:g.76471541T>C	ENSP00000465516:p.Glu2772Gly		42	0	0		78	0.09	7	NM_173628	0		0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	T	10.48	1.363265	0.24684	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.47177	0.85	4.72	4.72	0.59763	.	.	.	.	.	T	0.63674	0.2531	M	0.78801	2.425	0.38794	D	0.95504	.	.	.	.	.	.	T	0.71045	-0.4706	7	0.72032	D	0.01	.	12.7775	0.57457	0.0:0.0:0.0:1.0	.	.	.	.	G	2772;2763	ENSP00000374490:E2763G	ENSP00000300671:E2772G	E	-	2	0	DNAH17	73983136	1.000000	0.71417	0.637000	0.29366	0.222000	0.24845	4.861000	0.62969	1.771000	0.52183	0.397000	0.26171	GAG			0.592	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000318962.2		NM_173628	
LRRC45	201255	mdanderson.org	37	17	79981644	79981644	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr17:79981644T>C	ENST00000306688.3	+	1	467	c.125T>C	c.(124-126)cTg>cCg	p.L42P	STRA13_ENST00000580435.1_5'Flank|STRA13_ENST00000392359.3_5'Flank|LRRC45_ENST00000583383.1_3'UTR|STRA13_ENST00000306704.6_5'Flank|STRA13_ENST00000583767.1_5'Flank|STRA13_ENST00000584347.1_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	42						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			ACGCAAAGCCTGACGGTGGAG	0.692																																					p.L42P													.	.			0			c.T125C												17.0	13.0	14.0					17																	79981644		2147	4246	6393	SO:0001583	missense	201255	exon1			AAAGCCTGACGGT	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.125T>C	17.37:g.79981644T>C	ENSP00000306760:p.Leu42Pro		24	0	0		16	0.13	2	NM_144999	52	0.00	0		Missense_Mutation	SNP	ENST00000306688.3	37	CCDS11797.1	.	.	.	.	.	.	.	.	.	.	T	31	5.097852	0.94197	.	.	ENSG00000169683	ENST00000306688	T	0.61392	0.11	5.07	5.07	0.68467	.	0.152271	0.43747	D	0.000534	T	0.80460	0.4627	M	0.92691	3.335	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	D	0.85713	0.1320	9	.	.	.	-17.1415	15.0853	0.72148	0.0:0.0:0.0:1.0	.	42	Q96CN5	LRC45_HUMAN	P	42	ENSP00000306760:L42P	.	L	+	2	0	LRRC45	77574933	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.272000	0.78516	2.026000	0.59711	0.379000	0.24179	CTG			0.692	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442058.1		NM_144999	
BSG	682	mdanderson.org	37	19	571563	571563	+	5'Flank	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:571563G>T	ENST00000333511.3	+	0	0				AC009005.2_ENST00000588290.1_RNA|BSG_ENST00000346916.4_Missense_Mutation_p.A6S|AC009005.2_ENST00000590292.1_RNA|AC009005.2_ENST00000588908.1_RNA|BSG_ENST00000545507.2_5'UTR|BSG_ENST00000353555.4_5'Flank|AC009005.2_ENST00000589457.1_RNA	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)						blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gcagtcggacgcgtctcccca	0.607																																					p.A6S													.	.			0			c.G16T												34.0	35.0	35.0					19																	571563		2197	4290	6487	SO:0001631	upstream_gene_variant	682	exon1			TCGGACGCGTCTC	L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613			19.37:g.571563G>T	Exception_encountered		34	0	0		35	0.09	3	NM_198591	10	0.00	0	A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Missense_Mutation	SNP	ENST00000333511.3	37	CCDS12033.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.488755	0.01018	.	.	ENSG00000172270	ENST00000346916	T	0.15256	2.44	0.158	-0.317	0.12736	.	.	.	.	.	T	0.05640	0.0148	.	.	.	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.39683	-0.9602	7	0.06891	T	0.86	.	.	.	.	.	6	A6NJW1	.	S	6	ENSP00000344707:A6S	ENSP00000344707:A6S	A	+	1	0	BSG	522563	0.008000	0.16893	0.007000	0.13788	0.007000	0.05969	-0.884000	0.04166	-1.055000	0.03209	-1.054000	0.02325	GCG			0.607	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438630.2		NM_001728	
BSG	682	mdanderson.org	37	19	577807	577807	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:577807G>T	ENST00000333511.3	+	2	171	c.101G>T	c.(100-102)aGg>aTg	p.R34M	BSG_ENST00000346916.4_Intron|BSG_ENST00000545507.2_Intron|BSG_ENST00000353555.4_Intron|BSG_ENST00000574970.1_3'UTR	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	34					blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCAGCAGAGGTGGGTGGGG	0.687																																					p.R34M													.	.			0			c.G101T												9.0	9.0	9.0					19																	577807		2140	4188	6328	SO:0001583	missense	682	exon2			AGCAGAGGTGGGT	L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.101G>T	19.37:g.577807G>T	ENSP00000333769:p.Arg34Met		22	0	0		42	0.07	3	NM_001728	3	0.00	0	A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Missense_Mutation	SNP	ENST00000333511.3	37	CCDS12033.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110808	0.56398	.	.	ENSG00000172270	ENST00000333511	T	0.66460	-0.21	3.34	-0.619	0.11572	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.441905	0.21868	U	0.067931	T	0.66645	0.2810	M	0.61703	1.905	0.22156	N	0.999329	D	0.59767	0.986	P	0.54372	0.75	T	0.57452	-0.7809	10	0.54805	T	0.06	-3.8827	5.8295	0.18572	0.2154:0.1619:0.6227:0.0	.	34	P35613	BASI_HUMAN	M	34	ENSP00000333769:R34M	ENSP00000333769:R34M	R	+	2	0	BSG	528807	0.986000	0.35501	0.002000	0.10522	0.183000	0.23260	1.100000	0.31025	0.458000	0.26988	0.455000	0.32223	AGG			0.687	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438630.2		NM_001728	
ABCA7	10347	hgsc.bcm.edu	37	19	1047523	1047523	+	Silent	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:1047523C>T	ENST00000263094.6	+	16	2370	c.2139C>T	c.(2137-2139)ggC>ggT	p.G713G	ABCA7_ENST00000433129.1_Silent_p.G713G|ABCA7_ENST00000435683.2_Silent_p.G575G|ABCA7_ENST00000533574.1_3'UTR	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	713					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGCGAGGGCGCGCAGTGGC	0.706																																					p.G713G													ABCA7,rectum,carcinoma,0,1	ABCA7	0	1	0			c.C2139T												15.0	19.0	18.0					19																	1047523		2190	4287	6477	SO:0001819	synonymous_variant	10347	exon16			CGAGGGCGCGCAG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2139C>T	19.37:g.1047523C>T			11	0.1818181818	2		17	0.24	4	NM_019112	4	0.75	3	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																					0.706	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000394993.1		NM_019112	
ZNF844	284391	mdanderson.org	37	19	12187930	12187930	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:12187930G>T	ENST00000439326.3	+	4	2170	c.1995G>T	c.(1993-1995)ctG>ctT	p.L665L	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	665					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						GGCTCACACTGGAGTGAAACC	0.428																																					p.L665L													.	.			0			c.G1995T												41.0	44.0	43.0					19																	12187930		692	1591	2283	SO:0001819	synonymous_variant	284391	exon4			CACACTGGAGTGA	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1995G>T	19.37:g.12187930G>T			59	0	0		37	0.08	3	NM_001136501	17	0.00	0	Q5JPI8	Silent	SNP	ENST00000439326.3	37	CCDS45985.1																																																																																					0.428	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344086.2			
NACC1	112939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13249085	13249085	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:13249085G>C	ENST00000292431.4	+	6	1575	c.1449G>C	c.(1447-1449)aaG>aaC	p.K483N	CTC-250I14.3_ENST00000591825.1_RNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	483					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						AGGTGCTCAAGGCTGAGGATG	0.607																																					p.K483N													.	.			0			c.G1449C												199.0	159.0	172.0					19																	13249085		2203	4300	6503	SO:0001583	missense	112939	exon6			GCTCAAGGCTGAG	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.1449G>C	19.37:g.13249085G>C	ENSP00000292431:p.Lys483Asn		74	0	0		74	0.22	16	NM_052876	150	0.30	45		Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709084	0.48517	.	.	ENSG00000160877	ENST00000292431	T	0.52754	0.65	4.41	4.41	0.53225	.	0.407124	0.26875	N	0.022047	T	0.29914	0.0748	N	0.08118	0	0.28203	N	0.927279	B	0.13145	0.007	B	0.06405	0.002	T	0.33599	-0.9862	10	0.87932	D	0	.	14.5401	0.67987	0.0:0.0:1.0:0.0	.	483	Q96RE7	NACC1_HUMAN	N	483	ENSP00000292431:K483N	ENSP00000292431:K483N	K	+	3	2	NACC1	13110085	1.000000	0.71417	0.038000	0.18304	0.868000	0.49771	4.232000	0.58645	2.011000	0.59026	0.555000	0.69702	AAG			0.607	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452879.1		NM_052876	
CD97	976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14517723	14517723	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:14517723C>G	ENST00000242786.5	+	17	2238	c.2158C>G	c.(2158-2160)Cag>Gag	p.Q720E	DDX39A_ENST00000592927.1_5'Flank|CD97_ENST00000357355.3_Missense_Mutation_p.Q671E|CD97_ENST00000358600.3_Missense_Mutation_p.Q627E|CTC-548K16.5_ENST00000590626.1_RNA	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	720					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GAAGCTCACTCAGAAGTTTTC	0.557											OREG0025312	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q720E													.	.			0			c.C2158G												174.0	188.0	183.0					19																	14517723		2203	4300	6503	SO:0001583	missense	976	exon17			CTCACTCAGAAGT		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.2158C>G	19.37:g.14517723C>G	ENSP00000242786:p.Gln720Glu		81	0	0	695	99	0.18	18	NM_078481	61	0.08	5	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616887	0.46736	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.44881	0.91;0.91;0.91	5.09	2.86	0.33363	GPCR, family 2-like (1);	1.722310	0.03792	N	0.263065	T	0.46288	0.1385	L	0.55213	1.73	0.21220	N	0.999756	P;P;B	0.50819	0.749;0.939;0.07	B;P;B	0.46659	0.441;0.523;0.073	T	0.22977	-1.0201	10	0.38643	T	0.18	.	7.7288	0.28775	0.3424:0.5022:0.1554:0.0	.	627;671;720	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	E	720;671;627;670	ENSP00000242786:Q720E;ENSP00000349918:Q671E;ENSP00000351413:Q627E	ENSP00000242786:Q720E	Q	+	1	0	CD97	14378723	0.022000	0.18835	0.372000	0.25991	0.982000	0.71751	0.170000	0.16663	0.466000	0.27193	0.655000	0.94253	CAG			0.557	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459821.2		NM_078481	
NOTCH3	4854	broad.mit.edu;mdanderson.org	37	19	15276316	15276316	+	Missense_Mutation	SNP	C	C	T	rs372834264		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:15276316C>T	ENST00000263388.2	-	31	5753	c.5678G>A	c.(5677-5679)cGa>cAa	p.R1893Q		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1893					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGAGCGGTTTCGGATGAGAAT	0.592																																					p.R1893Q													.	NOTCH3	340		0			c.G5678A							C	GLN/ARG	0,4406		0,0,2203	53.0	52.0	52.0		5678	4.9	1.0	19		52	1,8599	1.2+/-3.3	0,1,4299	no	missense	NOTCH3	NM_000435.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1893/2322	15276316	1,13005	2203	4300	6503	SO:0001583	missense	4854	exon31			CGGTTTCGGATGA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5678G>A	19.37:g.15276316C>T	ENSP00000263388:p.Arg1893Gln		20	0	0		23	0.13	3	NM_000435	47	0.09	4	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470380	0.84533	0.0	1.16E-4	ENSG00000074181	ENST00000263388	T	0.63744	-0.06	4.9	4.9	0.64082	Ankyrin repeat-containing domain (4);	0.000000	0.30201	N	0.010173	T	0.67040	0.2851	N	0.17594	0.5	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.71777	-0.4490	10	0.59425	D	0.04	.	17.02	0.86431	0.0:1.0:0.0:0.0	.	1893	Q9UM47	NOTC3_HUMAN	Q	1893	ENSP00000263388:R1893Q	ENSP00000263388:R1893Q	R	-	2	0	NOTCH3	15137316	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	7.176000	0.77643	2.560000	0.86352	0.561000	0.74099	CGA			0.592	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465714.1		NM_000435	
WDR88	126248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33647335	33647335	+	Missense_Mutation	SNP	A	A	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:33647335A>G	ENST00000355868.3	+	7	960	c.884A>G	c.(883-885)aAa>aGa	p.K295R	WDR88_ENST00000361680.2_Missense_Mutation_p.K295R	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	295										breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					TCCTGGGATAAAAACTTAAAA	0.478																																					p.K295R													.	.			0			c.A884G												112.0	108.0	109.0					19																	33647335		2203	4300	6503	SO:0001583	missense	126248	exon7			GGGATAAAAACTT	BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.884A>G	19.37:g.33647335A>G	ENSP00000348129:p.Lys295Arg		74	0	0		77	0.17	13	NM_173479	0		0	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.643561	0.47258	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.39592	1.07;1.07	5.59	4.56	0.56223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.551163	0.18117	N	0.151178	T	0.33147	0.0853	L	0.35542	1.07	0.29219	N	0.874029	P	0.34757	0.467	B	0.36719	0.231	T	0.17745	-1.0359	10	0.31617	T	0.26	.	10.7729	0.46334	0.9241:0.0:0.0759:0.0	.	295	Q6ZMY6	WDR88_HUMAN	R	295	ENSP00000348129:K295R;ENSP00000355148:K295R	ENSP00000348129:K295R	K	+	2	0	WDR88	38339175	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.697000	0.37784	0.916000	0.36871	0.454000	0.30748	AAA			0.478	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450840.1		NM_173479	
ZFP30	22835	broad.mit.edu;mdanderson.org	37	19	38125922	38125922	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:38125922G>T	ENST00000351218.2	-	6	2077	c.1520C>A	c.(1519-1521)tCa>tAa	p.S507*	ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000392144.1_Nonsense_Mutation_p.S507*|ZFP30_ENST00000514101.2_Nonsense_Mutation_p.S507*	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTAAGATGTGAATGTTGTCT	0.328																																					p.S507X													.	ZFP30	68		0			c.C1520A												72.0	68.0	69.0					19																	38125922		2203	4300	6503	SO:0001587	stop_gained	22835	exon6			AGATGTGAATGTT	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1520C>A	19.37:g.38125922G>T	ENSP00000343581:p.Ser507*		78	0	0		108	0.05	5	NM_014898	38	0.00	0	Q58EY8	Nonsense_Mutation	SNP	ENST00000351218.2	37	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	G	39	7.380156	0.98248	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	.	.	.	4.05	4.05	0.47172	.	0.000000	0.29745	N	0.011309	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0653	0.64824	0.0:0.0:1.0:0.0	.	.	.	.	X	507;507;507;422	.	ENSP00000343581:S507X	S	-	2	0	ZFP30	42817762	0.193000	0.23313	1.000000	0.80357	0.988000	0.76386	2.109000	0.41863	2.249000	0.74217	0.585000	0.79938	TCA			0.328	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109601.2		NM_014898	
MEGF8	1954	mdanderson.org	37	19	42853771	42853771	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:42853771G>T	ENST00000251268.6	+	14	2419	c.2419G>T	c.(2419-2421)Ggc>Tgc	p.G807C	MEGF8_ENST00000334370.4_Missense_Mutation_p.G740C	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	807					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				AGAGATCCAGGGCCAGCTCAA	0.652																																					p.G807C													MEGF8_ENST00000334370,NS,carcinoma,-1,9	MEGF8_ENST00000334370	-1	9	0			c.G2419T												61.0	63.0	62.0					19																	42853771		2203	4300	6503	SO:0001583	missense	1954	exon14			ATCCAGGGCCAGC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2419G>T	19.37:g.42853771G>T	ENSP00000251268:p.Gly807Cys		32	0	0		32	0.09	3	NM_001271938	4	0.00	0	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	19.87	3.906620	0.72868	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22539	1.95;2.0	4.54	3.5	0.40072	.	0.077051	0.49916	D	0.000122	T	0.27594	0.0678	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69479	0.956;0.964	T	0.01349	-1.1378	10	0.38643	T	0.18	.	9.5764	0.39461	0.1048:0.0:0.8952:0.0	.	807;740	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	C	740;807	ENSP00000334219:G740C;ENSP00000251268:G807C	ENSP00000251268:G807C	G	+	1	0	MEGF8	47545611	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.179000	0.71974	2.084000	0.62774	0.491000	0.48974	GGC			0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
HRC	3270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49658348	49658348	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr19:49658348G>T	ENST00000252825.4	-	1	333	c.147C>A	c.(145-147)ctC>ctA	p.L49L	TRPM4_ENST00000355712.5_5'Flank|TRPM4_ENST00000427978.2_5'Flank|HRC_ENST00000595625.1_Silent_p.L49L|TRPM4_ENST00000252826.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	49					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CCTCCTCGGAGAGCCCGGCGA	0.602																																					p.L49L	Melanoma(37;75 1097 24567 25669 30645)												.	.			0			c.C147A												146.0	131.0	136.0					19																	49658348		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCGGAGAGCCCG		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.147C>A	19.37:g.49658348G>T			64	0	0		67	0.15	10	NM_002152	1	0.00	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																					0.602	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465649.1		NM_002152	
BIRC6	57448	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32690146	32690146	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:32690146C>G	ENST00000421745.2	+	26	5404	c.5270C>G	c.(5269-5271)tCt>tGt	p.S1757C		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1757					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CCACTTGGTTCTGGTCTAGCC	0.328																																					p.S1757C	Pancreas(94;175 1509 16028 18060 45422)												.	BIRC6	838		0			c.C5270G												59.0	58.0	59.0					2																	32690146		2203	4299	6502	SO:0001583	missense	57448	exon26			TTGGTTCTGGTCT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5270C>G	2.37:g.32690146C>G	ENSP00000393596:p.Ser1757Cys		510	0.0019607843	1		657	0.23	149	NM_016252	44	0.30	13	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281415	0.59758	.	.	ENSG00000115760	ENST00000421745	T	0.75589	-0.95	5.92	5.92	0.95590	.	0.215721	0.41823	D	0.000813	T	0.71617	0.3361	L	0.47716	1.5	0.51767	D	0.999936	P	0.40000	0.698	B	0.37091	0.241	T	0.74542	-0.3631	10	0.72032	D	0.01	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	1757	Q9NR09	BIRC6_HUMAN	C	1757	ENSP00000393596:S1757C	ENSP00000393596:S1757C	S	+	2	0	BIRC6	32543650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.498000	0.73679	2.810000	0.96702	0.650000	0.86243	TCT			0.328	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318769.3		NM_016252	
XPO1	7514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61708414	61708414	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:61708414G>C	ENST00000401558.2	-	24	3702	c.2975C>G	c.(2974-2976)gCt>gGt	p.A992G	RP11-355B11.2_ENST00000603652.1_RNA|RP11-355B11.2_ENST00000605437.1_RNA|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.A992G|XPO1_ENST00000404992.2_Missense_Mutation_p.A992G|RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	992					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			CTTTACTTGAGCACTGCAAAT	0.378			Mis		CLL																																p.A992G			-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	.			0			c.C2975G												51.0	51.0	51.0					2																	61708414		2203	4300	6503	SO:0001583	missense	7514	exon24			ACTTGAGCACTGC	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2975C>G	2.37:g.61708414G>C	ENSP00000384863:p.Ala992Gly		295	0	0		289	0.11	32	NM_003400	618	0.18	114	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180369	0.57800	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66995	-0.24;-0.24;-0.24	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	L	0.56199	1.76	0.80722	D	1	B;B	0.19200	0.0;0.034	B;B	0.18263	0.001;0.021	T	0.58691	-0.7592	10	0.31617	T	0.26	-14.5188	19.8764	0.96873	0.0:0.0:1.0:0.0	.	639;992	B3KWD0;O14980	.;XPO1_HUMAN	G	992	ENSP00000384863:A992G;ENSP00000385942:A992G;ENSP00000385559:A992G	ENSP00000384863:A992G	A	-	2	0	XPO1	61561918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.726000	0.98782	2.768000	0.95171	0.655000	0.94253	GCT			0.378	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325872.3		NM_003400	
C2orf81	388963	mdanderson.org	37	2	74642062	74642062	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:74642062G>T	ENST00000517883.1	-	1	1648	c.957C>A	c.(955-957)acC>acA	p.T319T	C2orf81_ENST00000290390.5_Silent_p.T387T			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	380										endometrium(3)|kidney(1)	4						CCCGGGCCTTGGTCTTCTCGC	0.687																																					p.T387T													.	.			0			c.C1161A												8.0	11.0	10.0					2																	74642062		689	1590	2279	SO:0001819	synonymous_variant	388963	exon4			GGCCTTGGTCTTC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.957C>A	2.37:g.74642062G>T			34	0	0		29	0.10	3	NM_001145054	11	0.00	0		Silent	SNP	ENST00000517883.1	37																																																																																						0.687	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000377683.1		NM_001145054	
CWC22	57703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	180810353	180810353	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:180810353G>C	ENST00000410053.3	-	20	2529	c.2230C>G	c.(2230-2232)Caa>Gaa	p.Q744E	CWC22_ENST00000295749.6_Missense_Mutation_p.Q744E	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	744					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						CTTTCTTTTTGTTTCCTATCA	0.388																																					p.Q744E													.	.			0			c.C2230G												119.0	110.0	113.0					2																	180810353		1855	4095	5950	SO:0001583	missense	57703	exon20			CTTTTTGTTTCCT		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2230C>G	2.37:g.180810353G>C	ENSP00000387006:p.Gln744Glu		92	0	0		90	0.12	11	NM_020943	239	0.27	65	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	ENST00000410053.3	37	CCDS46465.1	.	.	.	.	.	.	.	.	.	.	G	4.950	0.176402	0.09443	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.21543	2.27;2.27;2.0	5.02	4.12	0.48240	.	1.156650	0.06053	N	0.656875	T	0.16257	0.0391	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27606	-1.0069	10	0.26408	T	0.33	-1.1062	6.0864	0.19970	0.1:0.0:0.7109:0.1891	.	744	Q9HCG8	CWC22_HUMAN	E	744	ENSP00000387006:Q744E;ENSP00000295749:Q744E;ENSP00000384159:Q744E	ENSP00000295749:Q744E	Q	-	1	0	CWC22	180518598	0.298000	0.24417	0.675000	0.29917	0.305000	0.27757	1.816000	0.38992	1.195000	0.43115	0.655000	0.94253	CAA			0.388	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000334537.1		NM_020943	
ITGA4	3676	mdanderson.org	37	2	182350641	182350641	+	Missense_Mutation	SNP	G	G	T	rs35419274		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:182350641G>T	ENST00000397033.2	+	10	1505	c.1075G>T	c.(1075-1077)Gtt>Ttt	p.V359F		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	359					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	AACAAACCTCGTTGGAAGTGA	0.368																																					p.V359F													.	.			0			c.G1075T												157.0	148.0	151.0					2																	182350641		1860	4110	5970	SO:0001583	missense	3676	exon10			AACCTCGTTGGAA		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1075G>T	2.37:g.182350641G>T	ENSP00000380227:p.Val359Phe		93	0	0		89	0.04	4	NM_000885	23	0.00	0	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886596	0.33348	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.11277	2.79;2.79	5.87	-1.47	0.08772	.	0.823951	0.11454	N	0.562509	T	0.09379	0.0231	L	0.41632	1.29	0.09310	N	1	P;P	0.40266	0.64;0.71	B;B	0.43658	0.426;0.187	T	0.24190	-1.0167	10	0.45353	T	0.12	.	3.2132	0.06690	0.4355:0.1113:0.3444:0.1087	.	359;359	E7EP60;P13612	.;ITA4_HUMAN	F	359	ENSP00000380227:V359F;ENSP00000233573:V359F	ENSP00000233573:V359F	V	+	1	0	ITGA4	182058886	0.000000	0.05858	0.955000	0.39395	0.905000	0.53344	0.183000	0.16919	-0.085000	0.12573	-0.438000	0.05819	GTT			0.368	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334427.1			
Unknown	0	bcgsc.ca	37	2	194141679	194141679	+	IGR	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:194141679C>T								PCGEM1 (500054 upstream) : RP11-764E7.1 (621411 downstream)																							TACTGGAAAGCACCAGGTTGA	0.537																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGAAAGCACCAGG																													2.37:g.194141679C>T			62	0	0		59	0.08	5	.	0		0		RNA	SNP		37																																																																																					0	0.537										
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228884665	228884665	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr2:228884665G>A	ENST00000392056.3	-	7	951	c.905C>T	c.(904-906)tCa>tTa	p.S302L	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S302L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	302						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGGCTTGGCTGAGGGATCTAG	0.403																																					p.S302L													.	.			0			c.C905T												213.0	221.0	218.0					2																	228884665		2203	4300	6503	SO:0001583	missense	80309	exon7			TTGGCTGAGGGAT		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.905C>T	2.37:g.228884665G>A	ENSP00000375909:p.Ser302Leu		118	0	0		168	0.11	18	NM_030623	0		0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	2.782	-0.253253	0.05829	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12569	2.67;2.67	5.6	2.77	0.32553	.	1.081400	0.07012	N	0.825341	T	0.15565	0.0375	L	0.55103	1.725	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.13407	0.004;0.009	T	0.35176	-0.9799	10	0.26408	T	0.33	.	9.569	0.39416	0.2267:0.0:0.7733:0.0	.	302;302	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	L	302	ENSP00000375909:S302L;ENSP00000339886:S302L	ENSP00000339886:S302L	S	-	2	0	SPHKAP	228592909	0.007000	0.16637	0.002000	0.10522	0.005000	0.04900	1.559000	0.36320	0.707000	0.31934	-0.145000	0.13849	TCA			0.403	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000331750.1		NM_030623	
MCM8	84515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	5935892	5935892	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr20:5935892C>T	ENST00000378896.3	+	5	858	c.481C>T	c.(481-483)Cat>Tat	p.H161Y	MCM8_ENST00000378886.2_Missense_Mutation_p.H161Y|MCM8_ENST00000378883.1_Missense_Mutation_p.H161Y|MCM8_ENST00000265187.4_Missense_Mutation_p.H161Y	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	161					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						TTTGGCAATACATCAGGTAAC	0.368																																					p.H161Y													.	.			0			c.C481T												174.0	162.0	166.0					20																	5935892		2203	4300	6503	SO:0001583	missense	84515	exon5			GCAATACATCAGG	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.481C>T	20.37:g.5935892C>T	ENSP00000368174:p.His161Tyr		129	0	0		109	0.15	16	NM_032485	40	0.23	9	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Missense_Mutation	SNP	ENST00000378896.3	37	CCDS13094.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674402	0.47781	.	.	ENSG00000125885	ENST00000378896;ENST00000378883;ENST00000399350;ENST00000378886;ENST00000265187	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	5.76	5.76	0.90799	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	L	0.58925	1.835	0.80722	D	1	P;B;B;B	0.37636	0.603;0.188;0.285;0.33	B;B;B;B	0.38842	0.283;0.062;0.132;0.084	T	0.04454	-1.0950	10	0.05351	T	0.99	-18.5568	20.3431	0.98773	0.0:1.0:0.0:0.0	.	161;161;161;161	Q9UJA3-2;E7EQU7;Q9UJA3-3;Q9UJA3	.;.;.;MCM8_HUMAN	Y	161	ENSP00000368174:H161Y;ENSP00000368161:H161Y;ENSP00000368164:H161Y;ENSP00000265187:H161Y	ENSP00000265187:H161Y	H	+	1	0	MCM8	5883892	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.515000	0.73751	2.880000	0.98712	0.650000	0.86243	CAT			0.368	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000077900.1		NM_032485	
RRBP1	6238	mdanderson.org	37	20	17596600	17596600	+	Missense_Mutation	SNP	G	G	A	rs372710056		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr20:17596600G>A	ENST00000377813.1	-	22	4225	c.3922C>T	c.(3922-3924)Cgg>Tgg	p.R1308W	RRBP1_ENST00000470422.1_5'UTR|RRBP1_ENST00000377807.2_Missense_Mutation_p.R875W|RRBP1_ENST00000246043.4_Missense_Mutation_p.R1308W|RRBP1_ENST00000360807.4_Missense_Mutation_p.R875W|RRBP1_ENST00000455029.2_Missense_Mutation_p.R649W			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1308					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						AGCTTCTGCCGCTGTGTCTGC	0.627																																					p.R875W													.	.			0			c.C2623T							G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	74.0	58.0	64.0		2623,2623	-0.3	0.1	20		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RRBP1	NM_001042576.1,NM_004587.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	875/978,875/978	17596600	1,13005	2203	4300	6503	SO:0001583	missense	6238	exon23			TCTGCCGCTGTGT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3922C>T	20.37:g.17596600G>A	ENSP00000367044:p.Arg1308Trp		26	0	0		40	0.08	3	NM_001042576	280	0.00	1	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	G	14.84	2.654809	0.47467	0.0	1.16E-4	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.38	-0.273	0.12915	.	0.000000	0.31989	N	0.006742	T	0.51890	0.1701	M	0.67953	2.075	0.39878	D	0.973607	D;D	0.89917	1.0;1.0	D;D	0.87578	0.987;0.998	T	0.51020	-0.8758	10	0.72032	D	0.01	-36.5779	9.5331	0.39207	0.0692:0.0:0.3317:0.5991	.	875;1308	Q9P2E9-3;Q9P2E9	.;RRBP1_HUMAN	W	875;1308;875;1308;649	ENSP00000354045:R875W;ENSP00000367044:R1308W;ENSP00000367038:R875W;ENSP00000246043:R1308W;ENSP00000401206:R649W	ENSP00000246043:R1308W	R	-	1	2	RRBP1	17544600	0.917000	0.31117	0.149000	0.22428	0.442000	0.32017	0.868000	0.27982	-0.266000	0.09339	-0.310000	0.09108	CGG			0.627	RRBP1-002	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000078125.1		NM_001042576	
ZNF217	7764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	52198674	52198675	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr20:52198674_52198675delAG	ENST00000371471.2	-	2	1116_1117	c.691_692delCT	c.(691-693)ctafs	p.L231fs	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Frame_Shift_Del_p.L231fs			O75362	ZN217_HUMAN	zinc finger protein 217	231					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GTGCTCAATTAGACTTTCTTTA	0.52																																					p.231_231del													.	ZNF217	227		0			c.692_693del																																									SO:0001589	frameshift_variant	7764	exon1			TCAATTAGACTTT	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.691_692delCT	20.37:g.52198674_52198675delAG	ENSP00000360526:p.Leu231fs		88	0	0		102	0.10	10	NM_006526	91	0.00	0	E1P5Y6|Q14DB8	Frame_Shift_Del	DEL	ENST00000371471.2	37	CCDS13443.1																																																																																					0.520	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079757.2		NM_006526	
LAMA5	3911	mdanderson.org	37	20	60890262	60890262	+	Splice_Site	SNP	G	G	T	rs201926183		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr20:60890262G>T	ENST00000252999.3	-	59	7935	c.7869C>A	c.(7867-7869)gaC>gaA	p.D2623E		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2623	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGCTTGTCTCGTCTGTGGTGG	0.617																																					p.D2623E													.	.			0			c.C7869A												33.0	33.0	33.0					20																	60890262		2197	4288	6485	SO:0001630	splice_region_variant	3911	exon59			TGTCTCGTCTGTG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7868-1C>A	20.37:g.60890262G>T			46	0	0		40	0.08	3	NM_005560	121	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	g	9.813	1.183574	0.21870	.	.	ENSG00000130702	ENST00000252999	T	0.18657	2.2	4.02	-2.71	0.05986	.	0.619195	0.16448	U	0.214007	T	0.12390	0.0301	L	0.59436	1.845	0.22185	N	0.999305	P	0.43024	0.798	B	0.26202	0.067	T	0.14254	-1.0479	10	0.45353	T	0.12	.	6.7608	0.23540	0.6613:0.1507:0.188:0.0	.	2623	O15230	LAMA5_HUMAN	E	2623	ENSP00000252999:D2623E	ENSP00000252999:D2623E	D	-	3	2	LAMA5	60323657	0.000000	0.05858	0.515000	0.27774	0.507000	0.33981	-1.726000	0.01861	-0.370000	0.08016	0.457000	0.33378	GAC			0.617	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	Missense_Mutation
APP	351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	27327999	27327999	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr21:27327999T>C	ENST00000346798.3	-	12	1562	c.1529A>G	c.(1528-1530)aAg>aGg	p.K510R	APP_ENST00000359726.3_Missense_Mutation_p.K454R|APP_ENST00000440126.3_Missense_Mutation_p.K486R|APP_ENST00000439274.2_Missense_Mutation_p.K454R|APP_ENST00000348990.5_Missense_Mutation_p.K435R|APP_ENST00000358918.3_Missense_Mutation_p.K510R|APP_ENST00000357903.3_Missense_Mutation_p.K491R|APP_ENST00000448388.2_Missense_Mutation_p.K400R|APP_ENST00000354192.3_Missense_Mutation_p.K379R	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	510	Heparin-binding.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				CTCGAAATGCTTTAGGGTGTG	0.488																																					p.K510R													.	.			0			c.A1529G												222.0	174.0	190.0					21																	27327999		2203	4300	6503	SO:0001583	missense	351	exon12			AAATGCTTTAGGG	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1529A>G	21.37:g.27327999T>C	ENSP00000284981:p.Lys510Arg		141	0	0		171	0.05	8	NM_000484	354	0.08	27	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	ENST00000346798.3	37	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	T	6.691	0.496180	0.12762	.	.	ENSG00000142192	ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274;ENST00000456209	T;T;T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.45	5.45	0.79879	Amyloidogenic glycoprotein, E2 domain (2);	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	N	0.03224	-0.385	0.80722	D	1	D;D;D;D;D;D;D	0.69078	0.997;0.994;0.974;0.996;0.968;0.968;0.972	D;D;D;P;D;D;P	0.69654	0.923;0.923;0.965;0.875;0.942;0.942;0.833	T	0.24261	-1.0165	10	0.02654	T	1	-37.3801	14.4813	0.67585	0.0:0.0:0.0:1.0	.	400;454;486;379;435;491;510	E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067	.;.;.;.;.;.;A4_HUMAN	R	510;379;435;491;510;454;400;486;454;97	ENSP00000284981:K510R;ENSP00000346129:K379R;ENSP00000345463:K435R;ENSP00000350578:K491R;ENSP00000351796:K510R;ENSP00000352760:K454R;ENSP00000388538:K400R;ENSP00000387483:K486R;ENSP00000398879:K454R;ENSP00000397795:K97R	ENSP00000284981:K510R	K	-	2	0	APP	26249870	1.000000	0.71417	0.990000	0.47175	0.548000	0.35241	5.740000	0.68629	2.288000	0.76882	0.533000	0.62120	AAG			0.488	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000171340.1		NM_000484	
ATP5O	539	ucsc.edu	37	21	35288044	35288044	+	Silent	SNP	C	C	T	rs144779561	byFrequency	TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr21:35288044C>T	ENST00000290299.2	-	1	240	c.24G>A	c.(22-24)ggG>ggA	p.G8G	ATP5O_ENST00000496044.1_5'Flank|LINC00649_ENST00000610236.1_RNA|LINC00649_ENST00000597626.1_RNA|LINC00649_ENST00000598119.1_RNA|LINC00649_ENST00000596365.1_RNA	NM_001697.2	NP_001688.1	P48047	ATPO_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	8					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	5						GCCGGGAGAGCCCGGACACTG	0.642																																					p.G8G													.	ATP5O	9		0			c.G24A												29.0	22.0	25.0					21																	35288044		2199	4292	6491	SO:0001819	synonymous_variant	539	exon1			GGAGAGCCCGGAC	AF088071	CCDS13634.1	21q22	2012-10-12	2008-07-31		ENSG00000241837	ENSG00000241837	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	850	protein-coding gene	gene with protein product	"""oligomycin sensitivity conferring protein"""	600828				7490082	Standard	NM_001697		Approved	OSCP, ATPO		P48047	OTTHUMG00000065186	ENST00000290299.2:c.24G>A	21.37:g.35288044C>T			30	0	0		41	0.10	4	NM_001697	696	0.00	1	B2R4E2|Q5U042|Q6IBI2	Silent	SNP	ENST00000290299.2	37	CCDS13634.1																																																																																					0.642	ATP5O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000139907.1		NM_001697	
COL6A2	1292	mdanderson.org	37	21	47552285	47552285	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr21:47552285C>T	ENST00000300527.4	+	28	2983	c.2879C>T	c.(2878-2880)tCg>tTg	p.S960L		NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	960	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTGCACGAGTCGGCGCACTCC	0.687																																					p.S960L													.	.			0			c.C2879T												67.0	61.0	63.0					21																	47552285		2203	4300	6503	SO:0001583	missense	1292	exon28			ACGAGTCGGCGCA	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2879C>T	21.37:g.47552285C>T	ENSP00000300527:p.Ser960Leu		30	0	0		32	0.09	3	NM_001849	298	0.00	0	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	7.951	0.744812	0.15710	.	.	ENSG00000142173	ENST00000300527	T	0.76968	-1.06	4.16	4.16	0.48862	von Willebrand factor, type A (3);	0.564741	0.16440	N	0.214321	T	0.69557	0.3124	L	0.36672	1.1	0.80722	D	1	B	0.33940	0.433	B	0.31869	0.137	T	0.68047	-0.5512	10	0.30854	T	0.27	-4.1229	16.468	0.84090	0.0:1.0:0.0:0.0	.	960	P12110	CO6A2_HUMAN	L	960	ENSP00000300527:S960L	ENSP00000300527:S960L	S	+	2	0	COL6A2	46376713	1.000000	0.71417	0.272000	0.24630	0.009000	0.06853	5.493000	0.66899	1.881000	0.54492	0.297000	0.19635	TCG			0.687	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206971.1			
CECR2	27443	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18016810	18016810	+	Missense_Mutation	SNP	A	A	T	rs369723376		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr22:18016810A>T	ENST00000400585.2	+	10	1076	c.638A>T	c.(637-639)aAg>aTg	p.K213M	CECR2_ENST00000342247.5_Missense_Mutation_p.K326M|CECR2_ENST00000400573.5_Missense_Mutation_p.K354M|CECR2_ENST00000262608.8_Missense_Mutation_p.K355M			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	396					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AAGAGGAGAAAGCTCAGGGAA	0.512																																					.													.	CECR2	233		0			.												69.0	74.0	72.0					22																	18016810		2000	4167	6167	SO:0001583	missense	27443	.			GGAGAAAGCTCAG	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.638A>T	22.37:g.18016810A>T	ENSP00000383428:p.Lys213Met		87	0.0114942529	1		102	0.16	16	.	51	0.29	15	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	ENST00000400585.2	37		.	.	.	.	.	.	.	.	.	.	A	18.98	3.737891	0.69304	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.30714	1.96;1.64;1.68;1.52	5.43	4.4	0.53042	.	0.119294	0.37483	N	0.002072	T	0.26085	0.0636	L	0.43152	1.355	0.48571	D	0.999673	P;P;P	0.45348	0.745;0.856;0.856	B;B;B	0.39971	0.315;0.315;0.315	T	0.02115	-1.1211	10	0.39692	T	0.17	-25.4719	11.3416	0.49535	0.9292:0.0:0.0708:0.0	.	396;213;354	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	M	326;213;354;355	ENSP00000341219:K326M;ENSP00000383428:K213M;ENSP00000383417:K354M;ENSP00000262608:K355M	ENSP00000262608:K355M	K	+	2	0	CECR2	16396810	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.559000	0.67326	1.076000	0.40961	0.533000	0.62120	AAG			0.512	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000316226.2		NM_031413	
AC008132.13	0	broad.mit.edu	37	22	18842554	18842554	+	Intron	SNP	G	G	A	rs3983984		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr22:18842554G>A	ENST00000412938.1	+	4	2208																											CCTTACAGTGGGACGGGGGTG	0.597																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			ACAGTGGGACGGG																												ENST00000412938.1:c.2209-749G>A	22.37:g.18842554G>A			22	0	0		27	0.19	5	.	0		0		RNA	SNP	ENST00000412938.1	37																																																																																						0.597	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
MEI1	150365	mdanderson.org	37	22	42128256	42128256	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr22:42128256G>T	ENST00000401548.3	+	10	1144	c.1104G>T	c.(1102-1104)gaG>gaT	p.E368D	MEI1_ENST00000540833.1_Missense_Mutation_p.E108D|MEI1_ENST00000400107.1_5'UTR|MEI1_ENST00000300398.4_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TAGGGATCGAGGCAGTGGTGA	0.562																																					p.E368D													.	.			0			c.G1104T												49.0	54.0	52.0					22																	42128256		2080	4214	6294	SO:0001583	missense	150365	exon10			GATCGAGGCAGTG	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1104G>T	22.37:g.42128256G>T	ENSP00000384115:p.Glu368Asp		54	0	0		42	0.07	3	NM_152513	0		0		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761794	0.49468	.	.	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.16743	2.32;2.32	5.74	5.74	0.90152	Armadillo-like helical (1);Armadillo-type fold (1);	0.060578	0.64402	D	0.000005	T	0.34803	0.0910	M	0.61703	1.905	0.80722	D	1	P;D	0.89917	0.607;1.0	B;D	0.83275	0.3;0.996	T	0.02352	-1.1172	10	0.31617	T	0.26	-7.3322	9.3146	0.37926	0.1256:0.0:0.8744:0.0	.	368;368	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	D	368;108	ENSP00000384115:E368D;ENSP00000444225:E108D	ENSP00000384115:E368D	E	+	3	2	MEI1	40458202	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	3.109000	0.50345	2.716000	0.92895	0.563000	0.77884	GAG			0.562	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000074937.3		NM_152513	
TREX1	11277	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	48508121	48508121	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr3:48508121G>A	ENST00000422277.2	+	1	893	c.232G>A	c.(232-234)Ggc>Agc	p.G78S	TREX1_ENST00000436480.2_Missense_Mutation_p.G23S|TREX1_ENST00000296443.9_Missense_Mutation_p.G23S|TREX1_ENST00000444177.1_Missense_Mutation_p.G13S|TREX1_ENST00000492235.1_Intron|TREX1_ENST00000456089.1_Intron|SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000433541.1_Intron	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	78					cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGAGGCCACTGGCTTGCCCTT	0.662																																					p.G78S													.	.			0			c.G232A												105.0	120.0	115.0					3																	48508121		2203	4300	6503	SO:0001583	missense	11277	exon1			GCCACTGGCTTGC	AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.232G>A	3.37:g.48508121G>A	ENSP00000390478:p.Gly78Ser		110	0	0		128	0.07	9	NM_016381	43	0.07	3	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	37	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861071	0.91433	.	.	ENSG00000213689	ENST00000296443;ENST00000436480;ENST00000422277;ENST00000444177	D;D;D;D	0.99089	-5.41;-5.41;-5.41;-5.41	5.26	5.26	0.73747	Ribonuclease H-like (1);	0.000000	0.48767	U	0.000174	D	0.99127	0.9699	M	0.72894	2.215	0.42572	D	0.993183	D	0.89917	1.0	D	0.97110	1.0	D	0.99859	1.1081	10	0.62326	D	0.03	.	16.3593	0.83251	0.0:0.0:1.0:0.0	.	78	Q9NSU2	TREX1_HUMAN	S	23;23;78;13	ENSP00000296443:G23S;ENSP00000392569:G23S;ENSP00000390478:G78S;ENSP00000415972:G13S	ENSP00000296443:G23S	G	+	1	0	TREX1	48483125	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.314000	0.72848	2.452000	0.82932	0.655000	0.94253	GGC			0.662	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_016381	
KLHDC8B	200942	mdanderson.org	37	3	49213207	49213207	+	Silent	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr3:49213207G>A	ENST00000332780.2	+	6	1247	c.1038G>A	c.(1036-1038)gaG>gaA	p.E346E	C3orf84_ENST00000443990.1_5'Flank	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	346						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGCCGTGGAGGCACTGTGTC	0.617																																					p.E346E													.	.			0			c.G1038A												49.0	46.0	47.0					3																	49213207		2203	4300	6503	SO:0001819	synonymous_variant	200942	exon6			CGTGGAGGCACTG		CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.1038G>A	3.37:g.49213207G>A			64	0	0		50	0.06	3	NM_173546	49	0.00	0		Silent	SNP	ENST00000332780.2	37	CCDS2791.1																																																																																					0.617	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345974.1		NM_173546	
IL17RD	54756	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	57132107	57132107	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr3:57132107G>C	ENST00000296318.7	-	12	1712	c.1624C>G	c.(1624-1626)Cta>Gta	p.L542V	IL17RD_ENST00000320057.5_Missense_Mutation_p.L398V|IL17RD_ENST00000463523.1_Missense_Mutation_p.L398V|IL17RD_ENST00000427856.2_Missense_Mutation_p.L518V	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	542					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GCGACGTATAGGGACCGGCCT	0.597																																					p.L542V													.	.			0			c.C1624G												90.0	80.0	84.0					3																	57132107		2203	4300	6503	SO:0001583	missense	54756	exon12			CGTATAGGGACCG	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.1624C>G	3.37:g.57132107G>C	ENSP00000296318:p.Leu542Val		112	0	0		171	0.09	16	NM_017563	18	0.06	1	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262867	0.80358	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.30981	1.55;1.51;1.56;1.51	5.64	5.64	0.86602	.	0.133902	0.49916	D	0.000127	T	0.55305	0.1912	L	0.59436	1.845	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.996;0.991;0.998	T	0.55328	-0.8158	10	0.87932	D	0	-26.8228	19.7154	0.96115	0.0:0.0:1.0:0.0	.	398;542;518	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	V	542;398;518;398	ENSP00000296318:L542V;ENSP00000322250:L398V;ENSP00000399209:L518V;ENSP00000417516:L398V	ENSP00000296318:L542V	L	-	1	2	IL17RD	57107147	1.000000	0.71417	0.975000	0.42487	0.940000	0.58332	6.038000	0.70964	2.664000	0.90586	0.655000	0.94253	CTA			0.597	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316680.1		NM_017563	
GPR160	26996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	169802035	169802035	+	Missense_Mutation	SNP	A	A	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr3:169802035A>T	ENST00000355897.5	+	4	883	c.275A>T	c.(274-276)tAc>tTc	p.Y92F		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTCACTAAATACCACATCTGC	0.313																																					p.Y92F													.	.			0			c.A275T												69.0	72.0	71.0					3																	169802035		2201	4294	6495	SO:0001583	missense	26996	exon4			CTAAATACCACAT	AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.275A>T	3.37:g.169802035A>T	ENSP00000348161:p.Tyr92Phe		198	0	0		165	0.25	41	NM_014373	26	0.46	12	D3DNQ2	Missense_Mutation	SNP	ENST00000355897.5	37	CCDS3211.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.106316	0.56291	.	.	ENSG00000173890	ENST00000355897;ENST00000485735;ENST00000473675	T;T;T	0.18810	2.19;2.19;2.19	5.77	5.77	0.91146	GPCR, rhodopsin-like superfamily (1);	0.248184	0.35067	N	0.003474	T	0.43853	0.1266	M	0.63843	1.955	0.37496	D	0.91656	D	0.76494	0.999	D	0.67548	0.952	T	0.48937	-0.8990	10	0.62326	D	0.03	.	16.0902	0.81086	1.0:0.0:0.0:0.0	.	92	Q9UJ42	GP160_HUMAN	F	92	ENSP00000348161:Y92F;ENSP00000419546:Y92F;ENSP00000420751:Y92F	ENSP00000348161:Y92F	Y	+	2	0	GPR160	171284729	1.000000	0.71417	0.982000	0.44146	0.063000	0.16089	6.778000	0.75043	2.194000	0.70268	0.528000	0.53228	TAC			0.313	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352167.1		NM_014373	
FNDC3B	64778	broad.mit.edu	37	3	172062023	172062023	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr3:172062023G>T	ENST00000336824.4	+	19	2324	c.2225G>T	c.(2224-2226)cGg>cTg	p.R742L	FNDC3B_ENST00000416957.1_Missense_Mutation_p.R742L|FNDC3B_ENST00000415807.2_Missense_Mutation_p.R742L	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	742	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TATCGCTTCCGGGTGAGGGCT	0.542																																					p.R742L													.	FNDC3B	118		0			c.G2225T												139.0	128.0	132.0					3																	172062023		2203	4300	6503	SO:0001583	missense	64778	exon19			GCTTCCGGGTGAG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.2225G>T	3.37:g.172062023G>T	ENSP00000338523:p.Arg742Leu		111	0	0		118	0.03	3	NM_001135095	26	0.00	0	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.405812	0.62288	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.60920	0.15;0.15;0.15	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.092869	0.64402	D	0.000001	D	0.82870	0.5131	H	0.94925	3.6	0.80722	D	1	D	0.52996	0.957	D	0.63033	0.91	D	0.86317	0.1690	10	0.66056	D	0.02	-21.2522	20.2985	0.98592	0.0:0.0:1.0:0.0	.	742	Q53EP0	FND3B_HUMAN	L	742	ENSP00000411242:R742L;ENSP00000338523:R742L;ENSP00000389094:R742L	ENSP00000338523:R742L	R	+	2	0	FNDC3B	173544717	1.000000	0.71417	0.967000	0.41034	0.083000	0.17756	7.598000	0.82745	2.793000	0.96121	0.655000	0.94253	CGG			0.542	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345618.2		NM_022763	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	55599321	55599321	+	Missense_Mutation	SNP	A	A	T	rs121913507		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr4:55599321A>T	ENST00000288135.5	+	17	2544	c.2447A>T	c.(2446-2448)gAc>gTc	p.D816V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816V(758)|p.D816F(6)|p.D816I(2)|p.D816G(2)|p.D816>VVA(1)|p.D816A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTAGCCAGAGACATCAAGAAT	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816V			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,+1,932	KIT	1	932	770	Substitution - Missense(769)|Complex - insertion inframe(1)	haematopoietic_and_lymphoid_tissue(745)|testis(16)|ovary(5)|skin(2)|soft_tissue(1)|genital_tract(1)	c.A2447T	GRCh37	CM952169	KIT	M	rs121913507							145.0	146.0	145.0					4																	55599321		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CCAGAGACATCAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2447A>T	4.37:g.55599321A>T	ENSP00000288135:p.Asp816Val		49	0	0		66	0.09	6	NM_000222	144	0.26	37	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831107	0.91036	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83591	-1.74;-1.74	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.85093	0.5618	N	0.21097	0.63	0.80722	A	1	D;D	0.71674	0.998;0.991	D;D	0.68943	0.961;0.933	D	0.88419	0.3027	9	0.87932	D	0	.	15.8126	0.78576	1.0:0.0:0.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	V	816;812	ENSP00000288135:D816V;ENSP00000390987:D812V	ENSP00000288135:D816V	D	+	2	0	KIT	55294078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.181000	0.94874	2.148000	0.66965	0.477000	0.44152	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
CAMK2D	817	broad.mit.edu;bcgsc.ca	37	4	114378550	114378550	+	Silent	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr4:114378550C>A	ENST00000342666.5	-	17	1373	c.1374G>T	c.(1372-1374)cgG>cgT	p.R458R	CAMK2D_ENST00000296402.5_Silent_p.R458R|CAMK2D_ENST00000379773.2_Silent_p.R458R|CAMK2D_ENST00000514328.1_Silent_p.R457R|CAMK2D_ENST00000511664.1_Silent_p.R492R|CAMK2D_ENST00000505990.1_Silent_p.R492R|CAMK2D_ENST00000508738.1_Silent_p.R469R|CAMK2D_ENST00000429180.1_Silent_p.R478R|CAMK2D_ENST00000394524.3_Silent_p.R458R|CAMK2D_ENST00000515496.1_Silent_p.R469R|CAMK2D_ENST00000394522.3_Silent_p.R472R|CAMK2D_ENST00000454265.2_Silent_p.R483R|CAMK2D_ENST00000394526.2_Silent_p.R469R|CAMK2D_ENST00000418639.2_Silent_p.R472R			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	458					calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		ACTTTCCATCCCGGCGGTGCC	0.483																																					p.R472R													.	CAMK2D	55		0			c.G1416T												145.0	133.0	137.0					4																	114378550		2203	4300	6503	SO:0001819	synonymous_variant	817	exon18			TCCATCCCGGCGG	U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.1374G>T	4.37:g.114378550C>A			155	0.0064516129	1		135	0.07	10	NM_172114	27	0.15	4	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Silent	SNP	ENST00000342666.5	37	CCDS3703.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302339	0.23736	.	.	ENSG00000145349	ENST00000513132	.	.	.	5.93	-0.476	0.12100	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.925	0.05781	0.4415:0.2839:0.1474:0.1273	.	.	.	.	X	162	.	.	G	-	1	0	CAMK2D	114597999	0.206000	0.23470	0.999000	0.59377	0.923000	0.55619	-0.384000	0.07389	0.086000	0.17137	-0.226000	0.12346	GGA			0.483	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000256420.2			
FAM149A	25854	mdanderson.org	37	4	187077206	187077206	+	Nonsense_Mutation	SNP	A	A	T	rs4862653	byFrequency	TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr4:187077206A>T	ENST00000356371.5	+	7	1309	c.1309A>T	c.(1309-1311)Aaa>Taa	p.K437*	FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000502970.1_Nonsense_Mutation_p.K146*|FAM149A_ENST00000514153.1_Nonsense_Mutation_p.K146*|FAM149A_ENST00000227065.4_Nonsense_Mutation_p.K146*|FAM149A_ENST00000503432.1_Nonsense_Mutation_p.K146*|FAM149A_ENST00000389354.5_Nonsense_Mutation_p.K146*			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	437			K -> E (in dbSNP:rs4862653). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.							breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GAAATGGCGCAAACTCGGACT	0.443																																					p.K146X													.	.			0			c.A436T												117.0	108.0	111.0					4																	187077206		2203	4300	6503	SO:0001587	stop_gained	25854	exon7			TGGCGCAAACTCG	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1309A>T	4.37:g.187077206A>T	ENSP00000348732:p.Lys437*		96	0	0		85	0.04	3	NM_015398	4	0.00	0	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Nonsense_Mutation	SNP	ENST00000356371.5	37		.	.	.	.	.	.	.	.	.	.	G	38	6.678353	0.97755	.	.	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	.	.	.	5.46	3.0	0.34707	.	0.286996	0.34133	N	0.004229	.	.	.	.	.	.	0.09310	P	0.999999999999985	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5284	9.4042	0.38451	0.8092:0.1203:0.0705:0.0	.	.	.	.	X	146;437;146;146;146;146	.	ENSP00000227065:K146X	K	+	1	0	FAM149A	187314200	0.014000	0.17966	0.000000	0.03702	0.000000	0.00434	2.572000	0.45999	0.159000	0.19401	-1.066000	0.02275	AAA			0.443	FAM149A-201	KNOWN	basic	protein_coding	protein_coding				NM_001006655	
DNAH5	1767	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	13839638	13839638	+	Splice_Site	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr5:13839638C>A	ENST00000265104.4	-	35	5814		c.e35-1			NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCATATGACACTGAAATTCAA	0.338									Kartagener syndrome																												.													.	DNAH5	868		0			c.5710-1G>T												63.0	61.0	62.0					5																	13839638		2203	4300	6503	SO:0001630	splice_region_variant	1767	exon36	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ATGACACTGAAAT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5710-1G>T	5.37:g.13839638C>A			110	0	0		79	0.09	7	NM_001369	0		0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Splice_Site	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353474	0.82243	.	.	ENSG00000039139	ENST00000265104	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1545	0.86787	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH5	13892638	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.593000	0.82686	2.300000	0.77407	0.650000	0.86243	.			0.338	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207057.2		NM_001369	Intron
FGF10	2255	broad.mit.edu	37	5	44305289	44305289	+	Silent	SNP	T	T	C	rs200817529		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr5:44305289T>C	ENST00000264664.4	-	3	549	c.435A>G	c.(433-435)gaA>gaG	p.E145E		NM_004465.1	NP_004456.1	O15520	FGF10_HUMAN	fibroblast growth factor 10	145					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchiole morphogenesis (GO:0060436)|bud elongation involved in lung branching (GO:0060449)|bud outgrowth involved in lung branching (GO:0060447)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell migration (GO:0010631)|epithelial cell proliferation (GO:0050673)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|ERK1 and ERK2 cascade (GO:0070371)|establishment of mitotic spindle orientation (GO:0000132)|Fc-epsilon receptor signaling pathway (GO:0038095)|female genitalia morphogenesis (GO:0048807)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|hair follicle morphogenesis (GO:0031069)|Harderian gland development (GO:0070384)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte proliferation (GO:0043616)|lacrimal gland development (GO:0032808)|limb bud formation (GO:0060174)|lung epithelium development (GO:0060428)|lung proximal/distal axis specification (GO:0061115)|lung saccule development (GO:0060430)|male genitalia morphogenesis (GO:0048808)|mammary gland bud formation (GO:0060615)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal-epithelial cell signaling involved in lung development (GO:0060496)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|metanephros morphogenesis (GO:0003338)|muscle cell fate commitment (GO:0042693)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|pancreas development (GO:0031016)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of ATPase activity (GO:0032781)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urothelial cell proliferation (GO:0050677)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of white fat cell proliferation (GO:0070352)|prostatic bud formation (GO:0060513)|protein localization to cell surface (GO:0034394)|radial glial cell differentiation (GO:0060019)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of saliva secretion (GO:0046877)|regulation of smoothened signaling pathway (GO:0008589)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|salivary gland development (GO:0007431)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|semicircular canal fusion (GO:0060879)|smooth muscle cell differentiation (GO:0051145)|somatic stem cell maintenance (GO:0035019)|spleen development (GO:0048536)|submandibular salivary gland formation (GO:0060661)|tear secretion (GO:0070075)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tissue regeneration (GO:0042246)|Type II pneumocyte differentiation (GO:0060510)|urothelial cell proliferation (GO:0050674)|white fat cell differentiation (GO:0050872)|wound healing (GO:0042060)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chemoattractant activity (GO:0042056)|fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|type 2 fibroblast growth factor receptor binding (GO:0005111)			haematopoietic_and_lymphoid_tissue(1)|lung(11)|skin(1)	13	Lung NSC(6;1.12e-06)					CATTGTTAAATTCTTTCTGCA	0.378																																					p.E145E													FGF10,caecum,carcinoma,-2,1	FGF10	40	1	0			c.A435G												153.0	139.0	144.0					5																	44305289		2203	4300	6503	SO:0001819	synonymous_variant	2255	exon3			GTTAAATTCTTTC		CCDS3950.1	5p13-p12	2008-02-05			ENSG00000070193	ENSG00000070193			3666	protein-coding gene	gene with protein product		602115				9287324	Standard	NM_004465		Approved		uc003jog.1	O15520	OTTHUMG00000131153	ENST00000264664.4:c.435A>G	5.37:g.44305289T>C			152	0	0		158	0.03	5	NM_004465	0		0	C7FDY0|Q6FHR3|Q6FHT6|Q96P59	Silent	SNP	ENST00000264664.4	37	CCDS3950.1																																																																																					0.378	FGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253845.2		NM_004465	
PPT2	9374	broad.mit.edu	37	6	32122905	32122905	+	Silent	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:32122905G>T	ENST00000324816.6	+	3	850	c.282G>T	c.(280-282)gtG>gtT	p.V94V	PPT2-EGFL8_ENST00000453656.2_3'UTR|PPT2-EGFL8_ENST00000422437.1_Silent_p.V94V|PRRT1_ENST00000375150.2_5'Flank|PPT2_ENST00000375143.2_Silent_p.V94V|PPT2_ENST00000437001.2_Intron|PPT2_ENST00000445576.2_Silent_p.V94V|PPT2_ENST00000395523.1_Silent_p.V94V|PPT2_ENST00000375137.2_Silent_p.V94V|PPT2_ENST00000361568.2_Silent_p.V100V|PPT2_ENST00000493548.1_3'UTR			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	94					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						GAGAGGCTGTGGTCCCCATCA	0.602																																					p.V100V													.	PPT2	19		0			c.G300T												98.0	84.0	89.0					6																	32122905		1510	2709	4219	SO:0001819	synonymous_variant	0	exon3			GGCTGTGGTCCCC	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.282G>T	6.37:g.32122905G>T			118	0	0		127	0.03	4	NM_138717	33	0.00	0	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Silent	SNP	ENST00000324816.6	37	CCDS4742.1																																																																																					0.602	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076552.4		NM_138717	
KIF6	221458	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	39513397	39513397	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:39513397C>T	ENST00000287152.7	-	11	1343	c.1249G>A	c.(1249-1251)Gat>Aat	p.D417N	KIF6_ENST00000373215.3_Missense_Mutation_p.D417N|KIF6_ENST00000373213.4_Missense_Mutation_p.D256N|KIF6_ENST00000373216.3_Missense_Mutation_p.D417N|KIF6_ENST00000538893.1_Missense_Mutation_p.D417N	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	417					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TTACGCATATCCGCGCCAACC	0.363																																					p.D417N													.	.			0			c.G1249A												117.0	113.0	114.0					6																	39513397		2203	4300	6503	SO:0001583	missense	221458	exon11			GCATATCCGCGCC	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1249G>A	6.37:g.39513397C>T	ENSP00000287152:p.Asp417Asn		156	0	0		134	0.08	11	NM_145027	0		0	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	CCDS4844.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.638672	0.67130	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893	T;T;T;T;T	0.72505	-0.65;-0.63;-0.49;-0.65;-0.66	5.56	5.56	0.83823	.	.	.	.	.	T	0.75481	0.3855	L	0.55213	1.73	0.80722	D	1	D;D;D;D	0.89917	0.997;0.972;0.972;1.0	D;P;P;D	0.97110	0.955;0.868;0.868;1.0	T	0.72833	-0.4173	9	0.33141	T	0.24	.	15.0307	0.71705	0.0:1.0:0.0:0.0	.	417;417;417;417	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9	.;.;.;KIF6_HUMAN	N	417;417;256;417;417	ENSP00000287152:D417N;ENSP00000362312:D417N;ENSP00000362309:D256N;ENSP00000362311:D417N;ENSP00000441435:D417N	ENSP00000287152:D417N	D	-	1	0	KIF6	39621375	0.994000	0.37717	0.943000	0.38184	0.483000	0.33249	4.095000	0.57728	2.609000	0.88269	0.561000	0.74099	GAT			0.363	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040455.2		NM_145027	
APOBEC2	10930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41029397	41029397	+	Silent	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:41029397C>G	ENST00000244669.2	+	2	506	c.462C>G	c.(460-462)ctC>ctG	p.L154L		NM_006789.3	NP_006780.1	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2	154					cytidine deamination (GO:0009972)|DNA demethylation (GO:0080111)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)		cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)	10	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGGGTCGACTCTTCATGTGGG	0.547																																					p.L154L	Ovarian(118;1320 2185 8096 29684)												.	.			0			c.C462G												86.0	89.0	88.0					6																	41029397		2203	4300	6503	SO:0001819	synonymous_variant	10930	exon2			TCGACTCTTCATG	AF161698	CCDS4848.1	6p21	2008-02-05			ENSG00000124701	ENSG00000124701		"""Apolipoprotein B mRNA editing enzymes"""	605	protein-coding gene	gene with protein product		604797				10403781	Standard	NM_006789		Approved	ARCD1, ARP1	uc003opl.3	Q9Y235	OTTHUMG00000014670	ENST00000244669.2:c.462C>G	6.37:g.41029397C>G			196	0	0		150	0.14	21	NM_006789	0		0	B2R899|Q53F28|Q5TGU5|Q5TGU6	Silent	SNP	ENST00000244669.2	37	CCDS4848.1	.	.	.	.	.	.	.	.	.	.	C	8.298	0.819251	0.16607	.	.	ENSG00000124701	ENST00000426505	.	.	.	5.76	4.89	0.63831	.	.	.	.	.	T	0.63260	0.2496	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69643	-0.5090	5	0.87932	D	0	.	10.9547	0.47351	0.1462:0.7132:0.1406:0.0	.	.	.	.	C	119	.	ENSP00000395214:S119C	S	+	2	0	APOBEC2	41137375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.452000	0.35156	1.417000	0.47077	0.655000	0.94253	TCT			0.547	APOBEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040498.1		NM_006789	
MCM9	254394	ucsc.edu	37	6	119136914	119136914	+	Missense_Mutation	SNP	T	T	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:119136914T>A	ENST00000316316.6	-	13	2791	c.2505A>T	c.(2503-2505)aaA>aaT	p.K835N		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	835					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CTGAGTCTGGTTTATCAGCAG	0.502																																					p.K835N													.	MCM9	73		0			c.A2505T																																									SO:0001583	missense	254394	exon12			GTCTGGTTTATCA	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2505A>T	6.37:g.119136914T>A	ENSP00000314505:p.Lys835Asn		18	0	0		20	0.05	1	NM_017696	19	0.37	7	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	37	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.276987	0.23307	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.03717	3.83	6.17	-7.94	0.01152	.	0.334109	0.26727	U	0.022816	T	0.00637	0.0021	N	0.22421	0.69	0.09310	N	1	B	0.23806	0.091	B	0.16289	0.015	T	0.39143	-0.9628	10	0.21540	T	0.41	.	12.1437	0.54012	0.0:0.708:0.1639:0.1281	.	835	Q9NXL9	MCM9_HUMAN	N	835;454	ENSP00000314505:K835N	ENSP00000243218:K454N	K	-	3	2	MCM9	119243617	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.698000	0.01908	-1.887000	0.01115	-1.119000	0.02030	AAA			0.502	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042005.4		NM_153255	
SERINC1	57515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	122766308	122766308	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:122766308C>T	ENST00000339697.4	-	10	1327	c.1243G>A	c.(1243-1245)Gag>Aag	p.E415K		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	415					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		CTTTTCATCTCACGAGAGGGT	0.428																																					p.E415K													.	.			0			c.G1243A												81.0	75.0	77.0					6																	122766308		2203	4300	6503	SO:0001583	missense	57515	exon10			TCATCTCACGAGA	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.1243G>A	6.37:g.122766308C>T	ENSP00000342962:p.Glu415Lys		77	0	0		81	0.11	9	NM_020755	117	0.14	16	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	37	CCDS5125.1	.	.	.	.	.	.	.	.	.	.	C	7.911	0.736426	0.15574	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.12984	2.63;2.63	5.64	4.77	0.60923	.	0.458443	0.22268	N	0.062307	T	0.01765	0.0056	N	0.12182	0.205	0.31425	N	0.673889	B	0.02656	0.0	B	0.09377	0.004	T	0.43491	-0.9388	10	0.05833	T	0.94	-0.787	8.8528	0.35210	0.0:0.7623:0.0:0.2377	.	415	Q9NRX5	SERC1_HUMAN	K	415	ENSP00000342962:E415K;ENSP00000357439:E415K	ENSP00000342962:E415K	E	-	1	0	SERINC1	122808007	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	2.362000	0.44169	1.391000	0.46566	0.655000	0.94253	GAG			0.428	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042031.2		NM_020755	
LAMA2	3908	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	129609102	129609102	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:129609102C>G	ENST00000421865.2	+	19	2697	c.2648C>G	c.(2647-2649)tCt>tGt	p.S883C		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	883	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GACAGCTTGTCTGGCTCCTGT	0.498																																					p.S883C													.	.			0			c.C2648G												279.0	232.0	248.0					6																	129609102		2203	4300	6503	SO:0001583	missense	3908	exon19			GCTTGTCTGGCTC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2648C>G	6.37:g.129609102C>G	ENSP00000400365:p.Ser883Cys		141	0	0		152	0.08	12	NM_000426	3	0.00	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830626	0.91036	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.62788	0.0	5.93	5.93	0.95920	EGF-like, laminin (3);	0.068607	0.64402	D	0.000010	T	0.79834	0.4514	M	0.83692	2.655	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.982	T	0.81200	-0.1041	10	0.87932	D	0	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	883;883	A6NF00;P24043	.;LAMA2_HUMAN	C	883	ENSP00000400365:S883C	ENSP00000346769:S883C	S	+	2	0	LAMA2	129650795	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.798000	0.96311	0.655000	0.94253	TCT			0.498	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042180.1			
KIAA1244	57221	mdanderson.org	37	6	138655582	138655582	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:138655582G>T	ENST00000251691.4	+	33	5765	c.5599G>T	c.(5599-5601)Gcc>Tcc	p.A1867S		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGAGGAAACCGCCCAGGTCAG	0.577																																					p.A1867S													.	.			0			c.G5599T												25.0	26.0	25.0					6																	138655582		2203	4300	6503	SO:0001583	missense	57221	exon33			GAAACCGCCCAGG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5599G>T	6.37:g.138655582G>T	ENSP00000251691:p.Ala1867Ser		54	0	0		46	0.07	3	NM_020340	0		0		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149337	0.78001	.	.	ENSG00000112379	ENST00000251691;ENST00000367706	T	0.28255	1.62	5.36	5.36	0.76844	.	0.436705	0.27245	N	0.020253	T	0.35653	0.0939	L	0.40543	1.245	0.58432	D	0.999991	D	0.65815	0.995	P	0.59056	0.851	T	0.07385	-1.0775	10	0.52906	T	0.07	-21.8379	19.0985	0.93265	0.0:0.0:1.0:0.0	.	1867	Q5TH69	BIG3_HUMAN	S	1867;32	ENSP00000251691:A1867S	ENSP00000251691:A1867S	A	+	1	0	KIAA1244	138697275	1.000000	0.71417	0.736000	0.30914	0.798000	0.45092	9.212000	0.95126	2.522000	0.85027	0.411000	0.27672	GCC			0.577	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042425.4		NM_020340	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	145148508	145148508	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:145148508G>A	ENST00000367545.3	+	66	9519	c.9519G>A	c.(9517-9519)tgG>tgA	p.W3173*	UTRN_ENST00000367526.4_Nonsense_Mutation_p.W728*	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3173					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCAGTATGTGGCCAGAGCACT	0.453																																					p.W3173X													.	.			0			c.G9519A												180.0	161.0	167.0					6																	145148508		2203	4300	6503	SO:0001587	stop_gained	7402	exon66			TATGTGGCCAGAG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9519G>A	6.37:g.145148508G>A	ENSP00000356515:p.Trp3173*		71	0	0		70	0.13	9	NM_007124	32	0.06	2	Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	41	8.614499	0.98886	.	.	ENSG00000152818	ENST00000367545;ENST00000367526;ENST00000432686	.	.	.	5.63	5.63	0.86233	.	0.000000	0.48286	D	0.000198	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6652	0.95890	0.0:0.0:1.0:0.0	.	.	.	.	X	3173;728;132	.	ENSP00000356496:W728X	W	+	3	0	UTRN	145190201	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.721000	0.61951	2.646000	0.89796	0.557000	0.71058	TGG			0.453	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042551.1			
ULBP3	79465	bcgsc.ca	37	6	150390212	150390212	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr6:150390212G>T	ENST00000367339.2	-	0	19				ULBP3_ENST00000438272.2_5'Flank			Q9BZM4	N2DL3_HUMAN	UL16 binding protein 3						antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)|viral process (GO:0016032)	anchored component of plasma membrane (GO:0046658)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			central_nervous_system(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	9		Ovarian(120;0.12)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.45e-12)		TTGTAGACCAGGAGCGCCCGG	0.662																																					.													.	ULBP3	22		0			.												15.0	19.0	18.0					6																	150390212		2199	4292	6491			79465	.			AGACCAGGAGCGC	AF304379	CCDS5225.1	6q25	2008-04-11			ENSG00000131019	ENSG00000131019			14895	protein-coding gene	gene with protein product		605699				11239445, 11827464	Standard	NM_024518		Approved	RAET1N	uc003qns.3	Q9BZM4	OTTHUMG00000015811	ENST00000367339.2:c.-10C>A	6.37:g.150390212G>T			40	0	0		46	0.09	4	.	1	0.00	0	Q5VY82|Q8IZX5|Q8TE75	Missense_Mutation	SNP	ENST00000367339.2	37	CCDS5225.1																																																																																					0.662	ULBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042678.2			
ZNF273	10793	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	64389258	64389258	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr7:64389258G>T	ENST00000476120.1	+	4	1623	c.1552G>T	c.(1552-1554)Gaa>Taa	p.E518*	ZNF273_ENST00000319636.5_Nonsense_Mutation_p.E453*|ZNF273_ENST00000527278.1_3'UTR	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CAAATGTGAAGAATGTGGCAA	0.378																																					p.E518X	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												.	.			0			c.G1552T												56.0	61.0	59.0					7																	64389258		2203	4300	6503	SO:0001587	stop_gained	10793	exon4			TGTGAAGAATGTG	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1552G>T	7.37:g.64389258G>T	ENSP00000418719:p.Glu518*		67	0	0		85	0.07	6	NM_021148	80	0.11	9	B3KQZ5|Q6P3V4	Nonsense_Mutation	SNP	ENST00000476120.1	37	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	22.8	4.332780	0.81801	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	.	.	.	1.16	1.16	0.20824	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	7.3527	0.26700	0.0:0.0:1.0:0.0	.	.	.	.	X	518;453	.	ENSP00000324518:E453X	E	+	1	0	ZNF273	64026693	0.000000	0.05858	0.822000	0.32727	0.822000	0.46500	0.294000	0.19047	0.202000	0.20498	0.205000	0.17691	GAA			0.378	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313502.1			
YWHAG	7532	broad.mit.edu	37	7	75959211	75959211	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr7:75959211T>C	ENST00000307630.3	-	2	649	c.427A>G	c.(427-429)Agg>Ggg	p.R143G		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	143					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						ACCGTCGCCCTTTTCTCTCCG	0.577																																					p.R143G													.	YWHAG	24		0			c.A427G												140.0	141.0	141.0					7																	75959211		2203	4300	6503	SO:0001583	missense	7532	exon2			TCGCCCTTTTCTC	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.427A>G	7.37:g.75959211T>C	ENSP00000306330:p.Arg143Gly		136	0	0		179	0.03	5	NM_012479	621	0.00	0	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	SNP	ENST00000307630.3	37	CCDS5584.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.238434	0.58886	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	T	0.48522	0.81	5.55	-3.65	0.04502	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.57666	0.2069	H	0.95712	3.71	0.80722	D	1	P	0.46277	0.875	B	0.38264	0.269	T	0.77913	-0.2410	10	0.87932	D	0	-24.4553	19.0428	0.93008	0.0:0.0:0.7121:0.2879	.	143	P61981	1433G_HUMAN	G	143;121;103	ENSP00000306330:R143G	ENSP00000306330:R143G	R	-	1	2	YWHAG	75797147	0.542000	0.26426	0.109000	0.21407	0.971000	0.66376	-0.288000	0.08377	-0.759000	0.04684	-0.340000	0.08031	AGG			0.577	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253002.1		NM_012479	
TTC26	79989	broad.mit.edu	37	7	138874119	138874119	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr7:138874119G>T	ENST00000464848.1	+	18	1686	c.1606G>T	c.(1606-1608)Gta>Tta	p.V536L	TTC26_ENST00000495038.1_Missense_Mutation_p.V405L|TTC26_ENST00000478836.2_Missense_Mutation_p.V429L|TTC26_ENST00000343187.4_Missense_Mutation_p.V505L|TTC26_ENST00000430935.1_3'UTR			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	536					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						TAACACCCAAGTAGAATACAT	0.413																																					p.V536L													.	TTC26	50		0			c.G1606T												154.0	152.0	153.0					7																	138874119		2203	4300	6503	SO:0001583	missense	79989	exon18			ACCCAAGTAGAAT	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.1606G>T	7.37:g.138874119G>T	ENSP00000419279:p.Val536Leu		414	0.0024154589	1		522	0.02	9	NM_024926	18	0.00	0	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	ENST00000464848.1	37	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203240	0.79127	.	.	ENSG00000105948	ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	T;T;T;T	0.50277	0.75;0.78;0.8;0.79	5.43	5.43	0.79202	.	0.060928	0.64402	D	0.000004	T	0.59595	0.2205	M	0.87900	2.915	0.80722	D	1	P;P;P	0.44260	0.83;0.663;0.533	B;B;B	0.42422	0.387;0.269;0.138	T	0.68104	-0.5497	10	0.52906	T	0.07	.	18.0152	0.89238	0.0:0.0:1.0:0.0	.	405;505;536	B7Z2T3;F8W724;A0AVF1	.;.;TTC26_HUMAN	L	405;429;536;505	ENSP00000418788:V405L;ENSP00000419178:V429L;ENSP00000419279:V536L;ENSP00000339135:V505L	ENSP00000339135:V505L	V	+	1	0	TTC26	138524659	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.524000	0.98036	2.527000	0.85204	0.563000	0.77884	GTA			0.413	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348919.2		NM_024926	
EZH2	2146	broad.mit.edu	37	7	148512600	148512600	+	Missense_Mutation	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr7:148512600T>C	ENST00000460911.1	-	13	1617	c.1529A>G	c.(1528-1530)aAg>aGg	p.K510R	EZH2_ENST00000483967.1_Missense_Mutation_p.K501R|EZH2_ENST00000320356.2_Missense_Mutation_p.K515R|EZH2_ENST00000476773.1_Missense_Mutation_p.K501R|EZH2_ENST00000541220.1_Missense_Mutation_p.K501R|EZH2_ENST00000350995.2_Missense_Mutation_p.K471R|EZH2_ENST00000478654.1_Missense_Mutation_p.K501R			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	510	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Interaction with CDYL.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ATGCTAACCCTTTTTCAGCTG	0.368			Mis		DLBCL																																p.K515R				Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823		0			c.A1544G												150.0	144.0	146.0					7																	148512600		2203	4300	6503	SO:0001583	missense	0	exon13			TAACCCTTTTTCA		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1529A>G	7.37:g.148512600T>C	ENSP00000419711:p.Lys510Arg		211	0	0		286	0.01	4	NM_004456	79	0.00	0	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	t	27.5	4.839567	0.91117	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	D;D;D;D;D;D;D	0.94687	-3.44;-3.49;-3.49;-3.48;-3.44;-3.44;-3.49	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.96244	0.8775	L	0.60455	1.87	0.80722	D	1	P;P;D;P;D	0.76494	0.635;0.799;0.992;0.635;0.999	B;P;P;B;D	0.80764	0.347;0.465;0.765;0.347;0.994	D	0.95704	0.8752	10	0.38643	T	0.18	.	15.542	0.76057	0.0:0.0:0.0:1.0	.	501;501;510;471;515	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	R	501;515;510;471;501;501;501	ENSP00000417062:K501R;ENSP00000320147:K515R;ENSP00000419711:K510R;ENSP00000223193:K471R;ENSP00000443219:K501R;ENSP00000419050:K501R;ENSP00000419856:K501R	ENSP00000320147:K515R	K	-	2	0	EZH2	148143533	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.351000	0.79395	2.064000	0.61679	0.533000	0.62120	AAG			0.368	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000352744.1		NM_004456	
KRBA1	84626	broad.mit.edu	37	7	149430561	149430561	+	Missense_Mutation	SNP	A	A	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr7:149430561A>G	ENST00000485033.2	+	15	2335	c.2335A>G	c.(2335-2337)Agg>Ggg	p.R779G	KRBA1_ENST00000255992.10_Missense_Mutation_p.R839G|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.R779G			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	840	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCGGCTGGGGAGGCGCCCCCA	0.682																																					.													.	KRBA1	68		0			.												6.0	8.0	7.0					7																	149430561		1959	4113	6072	SO:0001583	missense	84626	.			CTGGGGAGGCGCC	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.2335A>G	7.37:g.149430561A>G	ENSP00000420112:p.Arg779Gly		47	0.085106383	4		54	0.17	9	.	17	0.06	1	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	A	12.36	1.914005	0.33815	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.43688	0.96;0.94;0.94	5.13	1.68	0.24146	.	0.152767	0.30901	N	0.008643	T	0.57755	0.2075	.	.	.	0.09310	N	0.999999	D;D	0.63046	0.992;0.992	P;P	0.62740	0.906;0.906	T	0.54417	-0.8297	9	0.59425	D	0.04	-19.7927	12.4425	0.55634	0.2897:0.7103:0.0:0.0	.	779;840	E7ENE9;A5PL33	.;KRBA1_HUMAN	G	839;779;779	ENSP00000255992:R839G;ENSP00000317165:R779G;ENSP00000420112:R779G	ENSP00000255992:R839G	R	+	1	2	KRBA1	149061494	0.993000	0.37304	0.106000	0.21319	0.300000	0.27592	0.270000	0.18607	-0.010000	0.14271	0.383000	0.25322	AGG			0.682	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000349841.3		NM_032534	
MFHAS1	9258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	8750110	8750110	+	Missense_Mutation	SNP	C	C	G			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:8750110C>G	ENST00000276282.6	-	1	1045	c.459G>C	c.(457-459)caG>caC	p.Q153H		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	153										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GAGCGCCCAGCTGGGCGGGCA	0.692																																					p.Q153H	Melanoma(103;1201 2045 17515 28966)												.	.			0			c.G459C												15.0	22.0	20.0					8																	8750110		2193	4296	6489	SO:0001583	missense	9258	exon1			GCCCAGCTGGGCG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.459G>C	8.37:g.8750110C>G	ENSP00000276282:p.Gln153His		51	0	0		53	0.17	9	NM_004225	10	0.30	3	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410637	0.25465	.	.	ENSG00000147324	ENST00000276282	T	0.32023	1.47	5.29	4.4	0.53042	.	0.086182	0.48767	D	0.000165	T	0.25158	0.0611	L	0.29908	0.895	0.54753	D	0.999982	P	0.37864	0.61	B	0.38106	0.265	T	0.02942	-1.1091	10	0.40728	T	0.16	.	13.9164	0.63899	0.0:0.7095:0.2904:0.0	.	153	Q9Y4C4	MFHA1_HUMAN	H	153	ENSP00000276282:Q153H	ENSP00000276282:Q153H	Q	-	3	2	MFHAS1	8787520	1.000000	0.71417	0.994000	0.49952	0.695000	0.40330	2.513000	0.45494	1.190000	0.43042	0.563000	0.77884	CAG			0.692	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
MTMR7	9108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17163456	17163456	+	Missense_Mutation	SNP	G	G	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:17163456G>C	ENST00000180173.5	-	11	1196	c.1162C>G	c.(1162-1164)Cta>Gta	p.L388V	MTMR7_ENST00000398099.3_De_novo_Start_OutOfFrame|MTMR7_ENST00000521857.1_Missense_Mutation_p.L388V	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	388	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		TCACCATCTAGATTGCCATAT	0.348																																					p.L388V													.	.			0			c.C1162G												74.0	74.0	74.0					8																	17163456		2203	4300	6503	SO:0001583	missense	9108	exon11			CATCTAGATTGCC	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.1162C>G	8.37:g.17163456G>C	ENSP00000180173:p.Leu388Val		62	0	0		88	0.23	20	NM_004686	9	0.44	4	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265174	0.40095	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.90732	-2.72;-2.72	4.87	0.814	0.18756	Myotubularin phosphatase domain (1);	0.073513	0.56097	D	0.000036	D	0.91556	0.7333	M	0.72353	2.195	0.80722	D	1	D;B	0.76494	0.999;0.323	D;B	0.81914	0.995;0.092	D	0.86602	0.1867	10	0.13853	T	0.58	.	4.109	0.10050	0.5182:0.0:0.3141:0.1677	.	388;388	Q9Y216-2;Q9Y216	.;MTMR7_HUMAN	V	388	ENSP00000180173:L388V;ENSP00000429733:L388V	ENSP00000180173:L388V	L	-	1	2	MTMR7	17207827	0.999000	0.42202	0.996000	0.52242	0.990000	0.78478	1.152000	0.31663	0.029000	0.15352	0.563000	0.77884	CTA			0.348	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375311.1		NM_004686	
DUSP4	1846	mdanderson.org	37	8	29194794	29194794	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:29194794G>T	ENST00000240100.2	-	4	1323	c.934C>A	c.(934-936)Cag>Aag	p.Q312K	DUSP4_ENST00000240101.2_Missense_Mutation_p.Q221K	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	312	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		CTGCGGCGCTGCTTAACGAAC	0.632																																					p.Q312K													.	.			0			c.C934A												73.0	60.0	64.0					8																	29194794		2203	4300	6503	SO:0001583	missense	1846	exon4			GGCGCTGCTTAAC	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.934C>A	8.37:g.29194794G>T	ENSP00000240100:p.Gln312Lys		25	0	0		33	0.09	3	NM_001394	9	0.00	0	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	37	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081898	0.76528	.	.	ENSG00000120875	ENST00000240100;ENST00000240101	D;D	0.85411	-1.98;-1.98	4.67	4.67	0.58626	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.053896	0.85682	D	0.000000	T	0.79551	0.4465	N	0.21142	0.635	0.80722	D	1	P;B	0.42827	0.791;0.364	B;B	0.43052	0.406;0.132	T	0.82257	-0.0547	10	0.54805	T	0.06	.	15.8673	0.79074	0.0:0.0:1.0:0.0	.	312;221	Q13115;G5E930	DUS4_HUMAN;.	K	312;221	ENSP00000240100:Q312K;ENSP00000240101:Q221K	ENSP00000240100:Q312K	Q	-	1	0	DUSP4	29250713	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.703000	0.98714	2.514000	0.84764	0.462000	0.41574	CAG			0.632	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257249.1		NM_001394	
Unknown	0	bcgsc.ca	37	8	88801690	88801690	+	IGR	SNP	T	T	C			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:88801690T>C								AF121898.3 (33744 upstream) : DCAF4L2 (81282 downstream)																							TTGCCGAGCTTCTTGGATTGC	0.453																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	6661	.			CGAGCTTCTTGGA																													8.37:g.88801690T>C			55	0	0		80	0.08	6	.	0		0		RNA	SNP		37																																																																																					0	0.453										
MAFA	389692	broad.mit.edu	37	8	144512336	144512338	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	CGC	CGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:144512336_144512338delCGC	ENST00000333480.2	-	1	238_240	c.239_241delGCG	c.(238-243)ggcgcg>gcg	p.G80del	MAFA_ENST00000528185.1_5'Flank	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	80	Poly-Gly.				insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			ccgccccccgcgccgccgccgcc	0.837										HNSCC(29;0.082)																											p.80_81del													.	MAFA	9		0			c.239_241del																																									SO:0001651	inframe_deletion	389692	exon1			CCCCCGCGCCGCC	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.239_241delGCG	8.37:g.144512345_144512347delCGC	ENSP00000328364:p.Gly80del		4	0	0		6	0.33	2	NM_201589	0		0		In_Frame_Del	DEL	ENST00000333480.2	37	CCDS34955.1																																																																																					0.837	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381511.2		NM_201589	
TIGD5	84948	bcgsc.ca	37	8	144681321	144681321	+	Silent	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:144681321G>A	ENST00000504548.2	+	1	1248	c.1248G>A	c.(1246-1248)ccG>ccA	p.P416P	EEF1D_ENST00000528610.1_5'Flank|EEF1D_ENST00000524624.1_5'Flank|EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000531621.1_5'Flank|TIGD5_ENST00000321385.3_Silent_p.P367P|EEF1D_ENST00000423316.2_5'Flank|EEF1D_ENST00000532400.1_5'Flank|EEF1D_ENST00000526838.1_5'Flank|RP11-661A12.14_ENST00000606452.1_lincRNA|EEF1D_ENST00000442189.2_5'Flank|EEF1D_ENST00000531770.1_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	416	DDE 2.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TCCCCGCACCGCTGGAGCAGG	0.687																																					p.P416P													.	TIGD5	22		0			c.G1248A												14.0	15.0	14.0					8																	144681321		2182	4288	6470	SO:0001819	synonymous_variant	84948	exon1			CGCACCGCTGGAG	AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.1248G>A	8.37:g.144681321G>A			45	0	0		45	0.09	4	NM_032862	25	0.00	0	E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Silent	SNP	ENST00000504548.2	37	CCDS6406.2																																																																																					0.687	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368269.1		NM_032862	
EPPK1	83481	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	144940450	144940450	+	Silent	SNP	G	G	C	rs56258403		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:144940450G>C	ENST00000525985.1	-	2	7043	c.6972C>G	c.(6970-6972)gcC>gcG	p.A2324A				P58107	EPIPL_HUMAN	epiplakin 1	2324						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTTCTGCATGGCCTGGAAGA	0.697																																					p.A2324A													.	.			0			c.C6972G												198.0	193.0	195.0					8																	144940450		2181	4258	6439	SO:0001819	synonymous_variant	83481	exon1			CTGCATGGCCTGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6972C>G	8.37:g.144940450G>C			121	0	0		167	0.06	10	NM_031308	43	0.07	3	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.697	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
EPPK1	83481	bcgsc.ca;mdanderson.org	37	8	144940462	144940462	+	Silent	SNP	G	G	A	rs56146920		TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr8:144940462G>A	ENST00000525985.1	-	2	7031	c.6960C>T	c.(6958-6960)tcC>tcT	p.S2320S				P58107	EPIPL_HUMAN	epiplakin 1	2320						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGGAAGAGGGAGATCTGCT	0.701																																					p.S2320S													.	EPPK1	199		0			c.C6960T							G		13,4351		0,13,2169	199.0	190.0	193.0		6960	-0.8	1.0	8	dbSNP_129	193	1,8519		0,1,4259	no	coding-synonymous	EPPK1	NM_031308.1		0,14,6428	AA,AG,GG		0.0117,0.2979,0.1087		2320/2420	144940462	14,12870	2182	4260	6442	SO:0001819	synonymous_variant	83481	exon1			GAAGAGGGAGATC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6960C>T	8.37:g.144940462G>A			116	0.0172413793	2		158	0.09	14	NM_031308	35	0.03	1	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
FREM1	158326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14819320	14819320	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr9:14819320G>A	ENST00000380880.3	-	14	3241	c.2458C>T	c.(2458-2460)Cct>Tct	p.P820S	FREM1_ENST00000422223.2_Missense_Mutation_p.P820S|FREM1_ENST00000380881.4_Missense_Mutation_p.P821S			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	820					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CCGTGCAGAGGCAATTCCCGC	0.463																																					p.P820S													.	.			0			c.C2458T												111.0	107.0	108.0					9																	14819320		1933	4136	6069	SO:0001583	missense	158326	exon15			GCAGAGGCAATTC	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2458C>T	9.37:g.14819320G>A	ENSP00000370262:p.Pro820Ser		76	0	0		85	0.09	8	NM_144966	0		0	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203780	0.58234	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.38887	1.11;1.11;1.11	5.86	5.86	0.93980	.	0.092677	0.85682	D	0.000000	T	0.71626	0.3362	M	0.91818	3.245	0.80722	D	1	D	0.64830	0.994	P	0.61328	0.887	T	0.77368	-0.2614	10	0.72032	D	0.01	-7.7754	20.1931	0.98233	0.0:0.0:1.0:0.0	.	820	Q5H8C1	FREM1_HUMAN	S	821;820;820	ENSP00000370263:P821S;ENSP00000412940:P820S;ENSP00000370262:P820S	ENSP00000370257:P823S	P	-	1	0	FREM1	14809320	1.000000	0.71417	0.119000	0.21687	0.012000	0.07955	8.558000	0.90704	2.771000	0.95319	0.563000	0.77884	CCT			0.463	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000339474.2		NM_144966	
HAUS6	54801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19070216	19070216	+	Splice_Site	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr9:19070216C>A	ENST00000380502.3	-	12	1844		c.e12+1		HAUS6_ENST00000380496.1_Splice_Site	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ATTTGTTTTACCTGTTGGCTA	0.348																																					.													.	.			0			c.1376+1G>T												74.0	68.0	70.0					9																	19070216		2203	4300	6503	SO:0001630	splice_region_variant	54801	exon13			GTTTTACCTGTTG	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.1376+1G>T	9.37:g.19070216C>A			226	0	0		251	0.19	47	NM_017645	0		0	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Splice_Site	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682768	0.68157	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1399	0.81515	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HAUS6	19060216	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	3.527000	0.53517	2.880000	0.98712	0.650000	0.86243	.			0.348	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051825.1		NM_017645	Intron
CNTFR	1271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	34552324	34552324	+	Missense_Mutation	SNP	G	G	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr9:34552324G>A	ENST00000378980.3	-	9	1246	c.953C>T	c.(952-954)aCc>aTc	p.T318I	CNTFR_ENST00000351266.4_Missense_Mutation_p.T318I	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	318					brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		GCTGGTCGTGGTCTCTGGGGA	0.637																																					p.T318I													.	.			0			c.C953T												25.0	34.0	31.0					9																	34552324		2114	4147	6261	SO:0001583	missense	1271	exon9			GTCGTGGTCTCTG	M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.953C>T	9.37:g.34552324G>A	ENSP00000368265:p.Thr318Ile		13	0	0		10	0.50	5	NM_147164	5	0.40	2	Q5U050	Missense_Mutation	SNP	ENST00000378980.3	37	CCDS6558.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689826	0.68271	.	.	ENSG00000122756	ENST00000378980;ENST00000351266	T;T	0.53640	0.61;0.61	4.55	4.55	0.56014	.	1.379500	0.04930	N	0.456725	T	0.65354	0.2683	L	0.53249	1.67	0.32991	D	0.524906	D	0.58970	0.984	P	0.59595	0.86	T	0.58912	-0.7552	9	0.62326	D	0.03	.	14.7832	0.69781	0.0:0.0:1.0:0.0	.	318	P26992	CNTFR_HUMAN	I	318	ENSP00000368265:T318I;ENSP00000242338:T318I	ENSP00000242338:T318I	T	-	2	0	CNTFR	34542324	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.234000	0.58658	2.078000	0.62432	0.455000	0.32223	ACC			0.637	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052176.1			
TMEM38B	55151	hgsc.bcm.edu	37	9	108510399	108510399	+	Missense_Mutation	SNP	G	G	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chr9:108510399G>T	ENST00000374692.3	+	5	705	c.588G>T	c.(586-588)caG>caT	p.Q196H	TMEM38B_ENST00000374688.1_Missense_Mutation_p.Q142H	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	196						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						TCACATTCCAGCACACCCAGC	0.358																																					p.Q196H													.	.			0			c.G588T												99.0	90.0	93.0					9																	108510399		2203	4300	6503	SO:0001583	missense	55151	exon5			ATTCCAGCACACC	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.588G>T	9.37:g.108510399G>T	ENSP00000363824:p.Gln196His		80	0	0		100	0.04	4	NM_018112	95	0.00	0	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	ENST00000374692.3	37	CCDS6768.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.72|17.72|17.72	3.459379|3.459379|3.459379	0.63401|0.63401|0.63401	.|.|.	.|.|.	ENSG00000095209|ENSG00000095209|ENSG00000095209	ENST00000451560|ENST00000374692;ENST00000374688|ENST00000435034	.|T;T|.	.|0.50548|.	.|0.74;0.74|.	5.57|5.57|5.57	4.45|4.45|4.45	0.53987|0.53987|0.53987	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.60314|0.60314|0.60314	0.2259|0.2259|0.2259	M|M|M	0.62266|0.62266|0.62266	1.93|1.93|1.93	0.47621|0.47621|0.47621	D|D|D	0.999474|0.999474|0.999474	.|D|.	.|0.89917|.	.|1.0|.	.|D|.	.|0.91635|.	.|0.999|.	T|T|T	0.59144|0.59144|0.59144	-0.7509|-0.7509|-0.7509	5|10|5	.|0.52906|.	.|T|.	.|0.07|.	-12.0868|-12.0868|-12.0868	5.8675|5.8675|5.8675	0.18783|0.18783|0.18783	0.2233:0.0:0.7767:0.0|0.2233:0.0:0.7767:0.0|0.2233:0.0:0.7767:0.0	.|.|.	.|196|.	.|Q9NVV0|.	.|TM38B_HUMAN|.	S|H|I	57|196;142|133	.|ENSP00000363824:Q196H;ENSP00000363820:Q142H|.	.|ENSP00000363820:Q142H|.	A|Q|S	+|+|+	1|3|2	0|2|0	TMEM38B|TMEM38B|TMEM38B	107550220|107550220|107550220	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.829000|0.829000|0.829000	0.46940|0.46940|0.46940	1.500000|1.500000|1.500000	0.35682|0.35682|0.35682	2.767000|2.767000|2.767000	0.95098|0.95098|0.95098	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|CAG|AGC			0.358	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053517.1		NM_018112	
WNK3	65267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54265469	54265469	+	Missense_Mutation	SNP	C	C	T			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chrX:54265469C>T	ENST00000375159.2	-	17	3714	c.3715G>A	c.(3715-3717)Ggt>Agt	p.G1239S	WNK3_ENST00000354646.2_Missense_Mutation_p.G1239S|WNK3_ENST00000375169.3_Missense_Mutation_p.G1239S			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1239					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						ATGGCTCCACCGCTTGACACA	0.448																																					p.G1239S													.	.			0			c.G3715A												63.0	59.0	60.0					X																	54265469		2203	4300	6503	SO:0001583	missense	65267	exon18			CTCCACCGCTTGA	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3715G>A	X.37:g.54265469C>T	ENSP00000364301:p.Gly1239Ser		46	0	0		73	0.25	18	NM_001002838	19	0.42	8	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486242	0.44147	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.72167	-0.44;-0.63;-0.63	5.02	3.2	0.36748	.	0.584613	0.15074	N	0.282037	T	0.65491	0.2696	L	0.27053	0.805	0.19300	N	0.999975	D;D	0.76494	0.999;0.995	P;P	0.58454	0.839;0.492	T	0.53648	-0.8409	10	0.08837	T	0.75	0.202	8.816	0.34996	0.0:0.7647:0.1477:0.0875	.	1239;1239	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	S	1239	ENSP00000364312:G1239S;ENSP00000346667:G1239S;ENSP00000364301:G1239S	ENSP00000346667:G1239S	G	-	1	0	WNK3	54282194	0.002000	0.14202	0.507000	0.27676	0.736000	0.42039	0.569000	0.23638	0.342000	0.23796	0.538000	0.68166	GGT			0.448	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056799.2		NM_020922	
PPP1R12BP1	360021	bcgsc.ca	37	Y	28475241	28475241	+	IGR	SNP	C	C	A			TCGA-WZ-A7V5-01A-11D-A435-10	TCGA-WZ-A7V5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37a3292a-c941-4ab7-b62d-fdde242a0b26	69293349-62fd-45e6-9658-5177162c214f	g.chrY:28475241C>A								SNORA70 (81573 upstream) : RNU6-1314P (31894 downstream)																							GCTGTTTTCTCTGCTGTTGAG	0.478																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	360021	.			TTTTCTCTGCTGT																													Y.37:g.28475241C>A			53	0	0		31	0.13	4	.	0		0		RNA	SNP		37																																																																																					0	0.478										
