#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MEGF6	1953	mdanderson.org	37	1	3411238	3411238	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:3411238G>A	ENST00000356575.4	-	31	4165	c.3939C>T	c.(3937-3939)tgC>tgT	p.C1313C	MEGF6_ENST00000294599.4_Silent_p.C1078C	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	1313	EGF-like 24. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TGCTGGCGTGGCACAGGCCCC	0.697																																					p.C1313C	Ovarian(73;978 3658)												.	.			0			c.C3939T												10.0	14.0	13.0					1																	3411238		2005	4148	6153	SO:0001819	synonymous_variant	1953	exon31			GGCGTGGCACAGG	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.3939C>T	1.37:g.3411238G>A			54	0	0		39	0.08	3	NM_001409	8	0.00	0	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	37	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	G	1.146	-0.648074	0.03506	.	.	ENSG00000162591	ENST00000491842	.	.	.	3.72	-2.71	0.05986	.	.	.	.	.	T	0.49779	0.1577	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43861	-0.9365	4	.	.	.	-14.4627	5.9535	0.19261	0.39:0.1279:0.4821:0.0	.	.	.	.	V	87	.	.	A	-	2	0	MEGF6	3401098	0.071000	0.21146	0.608000	0.28969	0.126000	0.20510	0.133000	0.15912	-0.414000	0.07495	0.462000	0.41574	GCC			0.697	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354866.1		NM_001409	
AGTRAP	57085	broad.mit.edu	37	1	11810282	11810282	+	3'UTR	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:11810282G>T	ENST00000314340.5	+	0	567				AGTRAP_ENST00000452018.2_3'UTR|AGTRAP_ENST00000376637.3_3'UTR|AGTRAP_ENST00000491346.1_3'UTR|AGTRAP_ENST00000376627.2_3'UTR|AGTRAP_ENST00000376629.4_3'UTR|AGTRAP_ENST00000400895.2_3'UTR|AGTRAP_ENST00000510878.1_Missense_Mutation_p.G136V	NM_020350.4	NP_065083.3	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein						regulation of blood pressure (GO:0008217)|response to hypoxia (GO:0001666)	cell cortex (GO:0005938)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)		AGTRAP/BRAF(2)	endometrium(1)|lung(3)|prostate(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGCCCCGGGCCTTCCTCGT	0.637																																					.													.	AGTRAP	9		0			.																																									SO:0001624	3_prime_UTR_variant	57085	.			CCCCGGGCCTTCC	AF165187	CCDS136.1, CCDS30585.1, CCDS30586.1, CCDS41248.1, CCDS44056.1	1p36.22	2008-02-05			ENSG00000177674	ENSG00000177674			13539	protein-coding gene	gene with protein product		608729				11733189	Standard	NM_001040194		Approved	ATRAP	uc001asv.3	Q6RW13	OTTHUMG00000002230	ENST00000314340.5:c.*33G>T	1.37:g.11810282G>T			29	0	0		24	0.25	6	.	227	0.01	2	A8MVQ5|Q5SNV4|Q5SNV5|Q96AC0|Q96PL4|Q9NRW9	Missense_Mutation	SNP	ENST00000314340.5	37	CCDS136.1	.	.	.	.	.	.	.	.	.	.	G	8.859	0.946404	0.18356	.	.	ENSG00000177674	ENST00000510878	.	.	.	4.07	-1.48	0.08745	.	.	.	.	.	T	0.36936	0.0985	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41822	-0.9487	5	0.87932	D	0	.	4.6476	0.12579	0.3623:0.1656:0.4721:0.0	.	.	.	.	V	136	.	ENSP00000422647:G136V	G	+	2	0	AGTRAP	11732869	0.000000	0.05858	0.000000	0.03702	0.142000	0.21351	-0.802000	0.04545	-0.267000	0.09325	-0.350000	0.07774	GGC			0.637	AGTRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006335.1		NM_020350	
C1orf177	163747	mdanderson.org	37	1	55271837	55271837	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:55271837C>T	ENST00000371273.3	+	1	63	c.48C>T	c.(46-48)gtC>gtT	p.V16V	C1orf177_ENST00000358193.3_Silent_p.V16V	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	16										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						GGAACCGCGTCGGCTCCACGG	0.716																																					p.V16V													.	.			0			c.C48T												9.0	12.0	11.0					1																	55271837		2135	4207	6342	SO:0001819	synonymous_variant	163747	exon1			CCGCGTCGGCTCC	AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.48C>T	1.37:g.55271837C>T			13	0	0		11	0.18	2	NM_001110533	0		0	B7WPL2|Q8N7Y9	Silent	SNP	ENST00000371273.3	37	CCDS44153.1																																																																																					0.716	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000027674.1		NM_152607	
ADH5P2	343296	bcgsc.ca	37	1	79987485	79987485	+	IGR	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:79987485T>C								RP4-726F1.1 (196937 upstream) : RP11-339A11.2 (593142 downstream)																							GCTGAATGCATTAGTCCTCAG	0.438																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	343296	.			AATGCATTAGTCC																													1.37:g.79987485T>C			49	0	0		39	0.15	6	.	0		0		RNA	SNP		37																																																																																					0	0.438										
CELF3	11189	mdanderson.org	37	1	151678746	151678746	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:151678746C>T	ENST00000290583.4	-	10	1873	c.1080G>A	c.(1078-1080)caG>caA	p.Q360Q	CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000290585.4_Silent_p.Q310Q|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_Silent_p.Q155Q	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	360	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgctgttgAGGTG	0.652																																					p.Q360Q													.	.			0			c.G1080A												19.0	21.0	20.0					1																	151678746		2199	4294	6493	SO:0001819	synonymous_variant	11189	exon10			CTGCTGCTGTTGA	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1080G>A	1.37:g.151678746C>T			27	0	0		29	0.10	3	NM_007185	12	0.00	0	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	8.446	0.851874	0.17034	.	.	ENSG00000159409	ENST00000420342	.	.	.	4.18	3.18	0.36537	.	.	.	.	.	T	0.45994	0.1370	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41910	-0.9482	4	.	.	.	-1.649	8.7523	0.34622	0.0:0.876:0.0:0.124	.	.	.	.	N	361	.	.	S	-	2	0	CELF3	149945370	.	.	1.000000	0.80357	0.943000	0.58893	.	.	2.183000	0.69458	0.655000	0.94253	AGC			0.652	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036663.2		NM_007185	
RPTN	126638	broad.mit.edu	37	1	152127961	152127961	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:152127961C>T	ENST00000316073.3	-	3	1678	c.1614G>A	c.(1612-1614)atG>atA	p.M538I		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	538	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.M538I(2)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						CTTGTCTGTCCATCTGACTGT	0.517																																					p.M538I													RPTN,NS,carcinoma,-1,2	RPTN	123	2	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.G1614A												789.0	691.0	721.0					1																	152127961		1568	3582	5150	SO:0001583	missense	126638	exon3			TCTGTCCATCTGA	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1614G>A	1.37:g.152127961C>T	ENSP00000317895:p.Met538Ile		143	0.013986014	2		149	0.05	7	NM_001122965	0		0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	C	9.026	0.986041	0.18889	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.10668	2.85	4.58	-1.48	0.08745	.	0.699242	0.11116	U	0.597994	T	0.02342	0.0072	L	0.47716	1.5	0.09310	N	1	B	0.21753	0.06	B	0.17979	0.02	T	0.44267	-0.9339	10	0.32370	T	0.25	0.2313	3.0744	0.06241	0.449:0.1983:0.0:0.3527	.	538	Q6XPR3	RPTN_HUMAN	I	538;193	ENSP00000317895:M538I	ENSP00000317895:M538I	M	-	3	0	RPTN	150394585	0.000000	0.05858	0.217000	0.23759	0.005000	0.04900	-1.468000	0.02350	-0.146000	0.11274	-0.715000	0.03620	ATG			0.517	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333867.1		XM_371312	
THBS3	7059	broad.mit.edu	37	1	155165017	155165017	+	IGR	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:155165017T>C	ENST00000368378.3	-	0	3145				RP11-263K19.4_ENST00000454348.1_RNA|MUC1_ENST00000343256.5_5'Flank|MIR92B_ENST00000607575.1_RNA|MUC1_ENST00000368392.3_5'Flank|RP11-263K19.4_ENST00000447623.1_RNA|MUC1_ENST00000368396.4_5'Flank|MUC1_ENST00000457295.2_5'Flank|MUC1_ENST00000338684.5_5'Flank|MUC1_ENST00000368398.3_5'Flank|MUC1_ENST00000438413.1_5'Flank|MUC1_ENST00000368393.3_5'Flank|MUC1_ENST00000462215.1_5'Flank|MUC1_ENST00000342482.4_5'Flank|MUC1_ENST00000368389.2_5'Flank|MUC1_ENST00000368395.1_5'Flank|MUC1_ENST00000337604.5_5'Flank|MUC1_ENST00000368390.3_5'Flank	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGTTGTTTTTTCCCCCGCCAA	0.771																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTTTTTTCCCCCG	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710		1.37:g.155165017T>C			116	0.1120689655	13		120	0.13	16	.	0		0	B1AVR8|B4DQ20|Q8WV34	RNA	SNP	ENST00000368378.3	37	CCDS1099.1																																																																																					0.771	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086856.1		NM_007112	
RRNAD1	51093	mdanderson.org	37	1	156706437	156706437	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:156706437G>T	ENST00000368216.4	+	8	1950	c.1320G>T	c.(1318-1320)gaG>gaT	p.E440D	RRNAD1_ENST00000476229.1_3'UTR|RRNAD1_ENST00000368218.4_3'UTR|MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000481920.1_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	440						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						TCCATGCTGAGCTCCTGCCCA	0.527																																					p.E440D													.	.			0			c.G1320T												132.0	122.0	126.0					1																	156706437		2203	4300	6503	SO:0001583	missense	51093	exon8			TGCTGAGCTCCTG	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1320G>T	1.37:g.156706437G>T	ENSP00000357199:p.Glu440Asp		62	0	0		44	0.07	3	NM_015997	51	0.00	0	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	ENST00000368216.4	37	CCDS1154.1	.	.	.	.	.	.	.	.	.	.	G	6.846	0.525352	0.13066	.	.	ENSG00000143303	ENST00000368216	T	0.46063	0.88	5.87	1.37	0.22104	.	0.245281	0.41712	D	0.000823	T	0.07548	0.0190	L	0.28192	0.835	0.80722	D	1	B	0.33103	0.397	B	0.24974	0.057	T	0.13818	-1.0495	10	0.15066	T	0.55	-21.7508	2.2736	0.04096	0.2467:0.1333:0.4834:0.1367	.	440	Q96FB5	RRNAD_HUMAN	D	440	ENSP00000357199:E440D	ENSP00000357199:E440D	E	+	3	2	RRNAD1	154973061	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	1.883000	0.39658	0.394000	0.25230	-0.136000	0.14681	GAG			0.527	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098973.1		NM_015997	
B3GALT2	8707	broad.mit.edu	37	1	193150315	193150315	+	Silent	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:193150315T>C	ENST00000367434.4	-	2	1133	c.378A>G	c.(376-378)aaA>aaG	p.K126K	CDC73_ENST00000367435.3_Intron	NM_003783.3	NP_003774.1	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2	126					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	16						GTCCAGTACCTTTTTCATTGT	0.358																																					p.K126K													.	B3GALT2	44		0			c.A378G												118.0	123.0	121.0					1																	193150315		2203	4299	6502	SO:0001819	synonymous_variant	8707	exon2			AGTACCTTTTTCA	Y15060	CCDS1383.1	1q31	2013-02-19			ENSG00000162630	ENSG00000162630		"""Beta 3-glycosyltransferases"""	917	protein-coding gene	gene with protein product		603018				9582303, 9417100	Standard	NM_003783		Approved	beta3Gal-T2	uc001gtc.4	O43825	OTTHUMG00000035687	ENST00000367434.4:c.378A>G	1.37:g.193150315T>C			120	0	0		109	0.04	4	NM_003783	0		0	B2RAB1|Q9BZQ9	Silent	SNP	ENST00000367434.4	37	CCDS1383.1																																																																																					0.358	B3GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086759.1		NM_003783	
OR2L13	284521	hgsc.bcm.edu	37	1	248153755	248153755	+	Intron	SNP	A	A	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr1:248153755A>C	ENST00000366478.2	+	1	194					NM_175911.2	NP_787107.1	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTTCCTACTTAGTCAGCTCTC	0.378																																					.													.	.			0			.																																									SO:0001627	intron_variant	26247	.			CTACTTAGTCAGC	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000366478.2:c.-144+53069A>C	1.37:g.248153755A>C			169	0	0		134	0.05	7	.	0		0	Q5VUR5	RNA	SNP	ENST00000366478.2	37	CCDS1637.1																																																																																					0.378	OR2L13-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_175911	
LDB3	11155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	88476312	88476312	+	Missense_Mutation	SNP	G	G	A	rs146265188	byFrequency	TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr10:88476312G>A	ENST00000361373.4	+	9	1481	c.1460G>A	c.(1459-1461)cGt>cAt	p.R487H	LDB3_ENST00000263066.6_Missense_Mutation_p.R377H|LDB3_ENST00000429277.2_Missense_Mutation_p.R492H|LDB3_ENST00000458213.2_Missense_Mutation_p.R377H|LDB3_ENST00000352360.5_Missense_Mutation_p.R230H	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CCTGCCAGCCGTCCACCCTGG	0.662													G|||	8	0.00159744	0.0061	0.0	5008	,	,		11210	0.0		0.0	False		,,,				2504	0.0				p.R492H													.	.			0			c.G1475A							G	HIS/ARG,HIS/ARG,HIS/ARG	20,4386	28.1+/-56.4	0,20,2183	75.0	81.0	79.0		1130,1475,1460	5.2	1.0	10	dbSNP_134	79	0,8600		0,0,4300	yes	missense,missense,missense	LDB3	NM_001080114.1,NM_001171610.1,NM_007078.2	29,29,29	0,20,6483	AA,AG,GG		0.0,0.4539,0.1538	probably-damaging,probably-damaging,probably-damaging	377/618,492/733,487/728	88476312	20,12986	2203	4300	6503	SO:0001583	missense	11155	exon10			CCAGCCGTCCACC	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1460G>A	10.37:g.88476312G>A	ENSP00000355296:p.Arg487His		170	0	0		124	0.19	24	NM_001171610	0		0		Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	14.57	2.574757	0.45902	0.004539	0.0	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	T;T;T;T;T	0.55234	0.75;0.61;0.57;0.61;0.53	5.17	5.17	0.71159	.	0.000000	0.32935	N	0.005474	T	0.69287	0.3094	M	0.83012	2.62	0.80722	D	1	D;D;D;P;D	0.89917	1.0;1.0;1.0;0.796;0.999	D;D;D;B;D	0.79784	0.959;0.993;0.966;0.35;0.95	T	0.75590	-0.3265	10	0.51188	T	0.08	.	19.0198	0.92908	0.0:0.0:1.0:0.0	.	492;408;230;487;377	B4E3K3;F5H0C2;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	H	408;492;377;230;377;487	ENSP00000401437:R492H;ENSP00000409148:R377H;ENSP00000263067:R230H;ENSP00000263066:R377H;ENSP00000355296:R487H	ENSP00000263066:R377H	R	+	2	0	LDB3	88466292	1.000000	0.71417	0.998000	0.56505	0.530000	0.34684	6.318000	0.72866	2.561000	0.86390	0.650000	0.86243	CGT	0.002		0.662	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000049160.2			
COL17A1	1308	mdanderson.org	37	10	105793940	105793940	+	Missense_Mutation	SNP	A	A	G	rs143582088		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr10:105793940A>G	ENST00000353479.5	-	52	4209	c.3919T>C	c.(3919-3921)Tac>Cac	p.Y1307H	COL17A1_ENST00000369733.3_Missense_Mutation_p.Y1225H	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1307	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GAAGAGCTGTAGGAGCTGCCC	0.652																																					p.Y1307H													.	.			0			c.T3919C							A	HIS/TYR	0,4406		0,0,2203	33.0	29.0	30.0		3919	2.5	1.0	10	dbSNP_134	30	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL17A1	NM_000494.3	83	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	1307/1498	105793940	1,13005	2203	4300	6503	SO:0001583	missense	1308	exon52			AGCTGTAGGAGCT	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3919T>C	10.37:g.105793940A>G	ENSP00000340937:p.Tyr1307His		57	0	0		47	0.06	3	NM_000494	11	0.00	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	A	7.841	0.721963	0.15372	0.0	1.16E-4	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.91843	-2.92;-2.84	4.98	2.55	0.30701	.	0.000000	0.35407	N	0.003224	D	0.87481	0.6188	L	0.46614	1.455	0.80722	D	1	B	0.15930	0.015	B	0.17433	0.018	T	0.80721	-0.1256	10	0.87932	D	0	-2.4909	7.8046	0.29195	0.8246:0.0:0.1754:0.0	.	1307	Q9UMD9	COHA1_HUMAN	H	1307;1225	ENSP00000340937:Y1307H;ENSP00000358748:Y1225H	ENSP00000340937:Y1307H	Y	-	1	0	COL17A1	105783930	1.000000	0.71417	0.999000	0.59377	0.650000	0.38633	2.246000	0.43142	0.246000	0.21394	0.459000	0.35465	TAC	0		0.652	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050181.1		NM_130778, NM_000494	
NKX1-2	390010	mdanderson.org	37	10	126136092	126136092	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr10:126136092G>T	ENST00000451024.3	-	2	1079	c.839C>A	c.(838-840)gCc>gAc	p.A280D	RP13-238F13.3_ENST00000604581.1_RNA|NKX1-2_ENST00000440536.2_Missense_Mutation_p.A302D|RP13-238F13.5_ENST00000602332.1_lincRNA	NM_001146340.1	NP_001139812.1	Q9UD57	NKX12_HUMAN	NK1 homeobox 2	280					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										CGGGAAGGAGGCGGCGGACGG	0.706																																					p.A280D													.	.			0			c.C839A												32.0	55.0	48.0					10																	126136092		692	1587	2279	SO:0001583	missense	390010	exon2			AAGGAGGCGGCGG	CN285329	CCDS59221.1	10q26.13	2012-03-09	2007-07-09	2006-06-29		ENSG00000229544		"""Homeoboxes / ANTP class : NKL subclass"""	31652	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 121"", ""NK1 transcription factor related, locus 2 (Drosophila)"""	C10orf121		10681422	Standard	NM_001146340		Approved	bB238F13.2	uc010quf.2	Q9UD57		ENST00000451024.3:c.839C>A	10.37:g.126136092G>T	ENSP00000451945:p.Ala280Asp		62	0	0		45	0.07	3	NM_001146340	15	0.00	0		Missense_Mutation	SNP	ENST00000451024.3	37	CCDS59221.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827074	0.50739	.	.	ENSG00000229544	ENST00000451024;ENST00000440536	D;D	0.90385	-2.64;-2.66	3.2	1.17	0.20885	.	.	.	.	.	D	0.83889	0.5352	L	0.27053	0.805	0.22034	N	0.999401	P	0.47409	0.895	B	0.43838	0.433	T	0.72839	-0.4171	8	.	.	.	.	9.0674	0.36471	0.0:0.161:0.6723:0.1667	.	280	Q9UD57	NKX12_HUMAN	D	280;302	ENSP00000451945:A280D;ENSP00000450924:A302D	.	A	-	2	0	NKX1-2	126126082	0.853000	0.29707	0.892000	0.35008	0.478000	0.33099	4.258000	0.58822	0.160000	0.19432	0.455000	0.32223	GCC			0.706	NKX1-2-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050861.3		XM_372331	
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127789652	127789652	+	Silent	SNP	C	C	T	rs377680010		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr10:127789652C>T	ENST00000368679.4	-	9	1218	c.909G>A	c.(907-909)gcG>gcA	p.A303A	ADAM12_ENST00000368676.4_Silent_p.A303A	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	303	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.A303A(3)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TGACAAGCTGCGCATTGTCAT	0.507																																					p.A303A													ADAM12_ENST00000368679,NS,carcinoma,0,9	ADAM12_ENST00000368679	0	9	3	Substitution - coding silent(3)	lung(3)	c.G909A							C	,	0,4406		0,0,2203	85.0	75.0	78.0		909,909	-10.6	0.0	10		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ADAM12	NM_003474.4,NM_021641.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	303/910,303/739	127789652	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8038	exon9			AAGCTGCGCATTG	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.909G>A	10.37:g.127789652C>T			115	0	0		76	0.13	10	NM_021641	1	0.00	0	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	ENST00000368679.4	37	CCDS7653.1																																																																																					0.507	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050961.1			
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	129911726	129911726	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr10:129911726T>C	ENST00000368654.3	-	8	1996	c.1621A>G	c.(1621-1623)Atg>Gtg	p.M541V	MKI67_ENST00000368653.3_Missense_Mutation_p.M181V|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	541					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGAGTGTGCATTACCAGAGAC	0.483																																					p.M541V													.	.			0			c.A1621G												242.0	217.0	226.0					10																	129911726		2203	4300	6503	SO:0001583	missense	4288	exon8			TGTGCATTACCAG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1621A>G	10.37:g.129911726T>C	ENSP00000357643:p.Met541Val		86	0	0		69	0.45	31	NM_002417	2	0.50	1	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	0.504	-0.869435	0.02570	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01240	5.17;5.12	4.95	-2.94	0.05581	.	2.059880	0.01881	N	0.037899	T	0.00875	0.0029	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.48736	-0.9009	10	0.29301	T	0.29	.	10.599	0.45356	0.0:0.4106:0.0:0.5894	.	541;181;541	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	V	541;181;541;116	ENSP00000357643:M541V;ENSP00000357642:M181V	ENSP00000357641:M116V	M	-	1	0	MKI67	129801716	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.451000	0.06795	-0.778000	0.04566	-2.152000	0.00332	ATG			0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000050999.1		NM_002417	
MRGPRG	386746	mdanderson.org	37	11	3239532	3239532	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:3239532G>T	ENST00000332314.3	-	1	511	c.512C>A	c.(511-513)gCc>gAc	p.A171D	MRGPRG-AS1_ENST00000434798.1_RNA|MRGPRG-AS1_ENST00000420873.2_RNA	NM_001164377.1	NP_001157849.1	Q86SM5	MRGRG_HUMAN	MAS-related GPR, member G	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)										GGCGACGCGGGCCAGCACCAG	0.731																																					p.A171D													.	.			0			c.C512A												9.0	12.0	11.0					11																	3239532		684	1581	2265	SO:0001583	missense	386746	exon1			ACGCGGGCCAGCA	AY255583	CCDS44520.1	11p15.4	2012-08-21	2004-03-25		ENSG00000182170	ENSG00000182170		"""GPCR / Class A : Orphans"""	24829	protein-coding gene	gene with protein product		607234	"""G protein-coupled receptor 169"""	GPR169		12679517	Standard	NM_001164377		Approved	mrgG	uc001lxp.2	Q86SM5	OTTHUMG00000011709	ENST00000332314.3:c.512C>A	11.37:g.3239532G>T	ENSP00000330612:p.Ala171Asp		25	0	0		19	0.11	2	NM_001164377	0		0		Missense_Mutation	SNP	ENST00000332314.3	37	CCDS44520.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262104	0.39995	.	.	ENSG00000182170	ENST00000332314	T	0.38240	1.15	4.36	-1.37	0.09056	.	.	.	.	.	T	0.44561	0.1299	M	0.71581	2.175	0.09310	N	1	.	.	.	.	.	.	T	0.47736	-0.9094	7	0.56958	D	0.05	-3.8405	9.962	0.41701	0.4093:0.0:0.5907:0.0	.	.	.	.	D	171	ENSP00000330612:A171D	ENSP00000330612:A171D	A	-	2	0	MRGPRG	3196108	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.106000	0.03319	-0.169000	0.10834	-0.300000	0.09419	GCC			0.731	MRGPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032347.1			
OR6A2	8590	mdanderson.org	37	11	6816715	6816715	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:6816715G>T	ENST00000332601.3	-	1	413	c.225C>A	c.(223-225)gtC>gtA	p.V75V		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	75					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TAGTGACAGTGACATACCAGA	0.423																																					p.V75V													.	.			0			c.C225A												159.0	147.0	151.0					11																	6816715		2201	4296	6497	SO:0001819	synonymous_variant	8590	exon1			GACAGTGACATAC	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.225C>A	11.37:g.6816715G>T			74	0	0		69	0.06	4	NM_003696	0		0	Q3MJC7|Q6IF35|Q9H206	Silent	SNP	ENST00000332601.3	37	CCDS7772.1																																																																																					0.423	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385981.1		NM_003696	
TNKS1BP1	85456	broad.mit.edu	37	11	57088152	57088152	+	Missense_Mutation	SNP	T	T	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:57088152T>G	ENST00000532437.1	-	2	440	c.129A>C	c.(127-129)aaA>aaC	p.K43N	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.K43N			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	43	Arg/Glu/Lys/Pro-rich (charged).				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GGGCCCGGGGTTTGGGCTTGA	0.627																																					p.K43N													.	TNKS1BP1	148		0			c.A129C												14.0	17.0	16.0					11																	57088152		2181	4266	6447	SO:0001583	missense	85456	exon3			CCGGGGTTTGGGC	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.129A>C	11.37:g.57088152T>G	ENSP00000437271:p.Lys43Asn		33	0.2121212121	7		27	0.19	5	NM_033396	12	0.08	1	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.612394	0.66672	.	.	ENSG00000149115	ENST00000358252;ENST00000532437;ENST00000527207	T;T	0.57907	0.37;0.37	4.58	0.458	0.16670	.	0.000000	0.40908	D	0.000982	T	0.52693	0.1750	N	0.24115	0.695	0.27451	N	0.953443	D	0.89917	1.0	D	0.87578	0.998	T	0.48103	-0.9064	10	0.59425	D	0.04	-13.6809	8.2281	0.31582	0.0:0.4684:0.0:0.5316	.	43	Q9C0C2	TB182_HUMAN	N	43	ENSP00000350990:K43N;ENSP00000437271:K43N	ENSP00000350990:K43N	K	-	3	2	TNKS1BP1	56844728	0.934000	0.31675	0.998000	0.56505	0.988000	0.76386	-0.322000	0.08007	-0.084000	0.12595	0.460000	0.39030	AAA			0.627	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392455.1		NM_033396	
RTN4RL2	349667	mdanderson.org	37	11	57243890	57243890	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:57243890C>T	ENST00000335099.3	+	3	1086	c.769C>T	c.(769-771)Cgg>Tgg	p.R257W	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CGAGTTCCTGCGGCTCAACGC	0.726																																					p.R257W													.	.			0			c.C769T												8.0	10.0	9.0					11																	57243890		2125	4242	6367	SO:0001583	missense	349667	exon3			TTCCTGCGGCTCA	BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.769C>T	11.37:g.57243890C>T	ENSP00000335397:p.Arg257Trp		17	0	0		18	0.11	2	NM_178570	2	0.00	0		Missense_Mutation	SNP	ENST00000335099.3	37	CCDS7957.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146192	0.77888	.	.	ENSG00000186907	ENST00000335099	T	0.58060	0.36	4.43	2.19	0.27852	.	0.000000	0.36002	U	0.002855	T	0.57489	0.2057	N	0.21373	0.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62609	-0.6818	10	0.87932	D	0	.	13.7108	0.62667	0.2922:0.7078:0.0:0.0	.	257	Q86UN3	R4RL2_HUMAN	W	257	ENSP00000335397:R257W	ENSP00000335397:R257W	R	+	1	2	RTN4RL2	57000466	0.972000	0.33761	1.000000	0.80357	0.984000	0.73092	0.785000	0.26830	0.804000	0.34136	-0.500000	0.04577	CGG			0.726	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392537.1		NM_178570	
ADRBK1	156	broad.mit.edu	37	11	67051341	67051341	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:67051341T>C	ENST00000308595.5	+	17	1702	c.1412T>C	c.(1411-1413)aTc>aCc	p.I471T	ADRBK1_ENST00000527176.1_3'UTR|ADRBK1_ENST00000526285.1_Intron	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	471	AGC-kinase C-terminal.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	CCCCCGCTGATCCCCCCACGA	0.632																																					p.I471T													.	ADRBK1	51		0			c.T1412C												30.0	32.0	32.0					11																	67051341		2197	4294	6491	SO:0001583	missense	156	exon17			CGCTGATCCCCCC	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1412T>C	11.37:g.67051341T>C	ENSP00000312262:p.Ile471Thr		91	0.021978022	2		61	0.10	6	NM_001619	108	0.00	0	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.088709	0.55968	.	.	ENSG00000173020	ENST00000308595	T	0.52295	0.67	5.17	5.17	0.71159	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.49916	D	0.000135	T	0.47002	0.1422	L	0.59436	1.845	0.80722	D	1	B	0.15473	0.013	B	0.19666	0.026	T	0.42481	-0.9449	10	0.45353	T	0.12	-7.4197	14.9808	0.71309	0.0:0.0:0.0:1.0	.	471	P25098	ARBK1_HUMAN	T	471	ENSP00000312262:I471T	ENSP00000312262:I471T	I	+	2	0	ADRBK1	66807917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.540000	0.82074	2.083000	0.62718	0.459000	0.35465	ATC			0.632	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393153.1		NM_001619	
FOLR1	2348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71906977	71906977	+	Missense_Mutation	SNP	C	C	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:71906977C>A	ENST00000393679.1	+	5	966	c.530C>A	c.(529-531)cCt>cAt	p.P177H	FOLR1_ENST00000393676.3_Missense_Mutation_p.P177H|FOLR1_ENST00000312293.4_Missense_Mutation_p.P177H|RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Missense_Mutation_p.P177H			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	177					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)			cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	GCCTGCCAACCTTTCCATTTC	0.552																																					p.P177H													.	.			0			c.C530A												101.0	97.0	98.0					11																	71906977		2200	4293	6493	SO:0001583	missense	2348	exon4			GCCAACCTTTCCA	J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.530C>A	11.37:g.71906977C>A	ENSP00000377284:p.Pro177His		121	0	0		85	0.16	14	NM_016729	45	0.33	15	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Missense_Mutation	SNP	ENST00000393679.1	37	CCDS8211.1	.	.	.	.	.	.	.	.	.	.	c	2.643	-0.283799	0.05642	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	4.11	1.02	0.19986	Folate receptor-like (1);	0.386760	0.28940	N	0.013649	T	0.72684	0.3491	M	0.62088	1.915	0.09310	N	1	B	0.27700	0.186	B	0.34418	0.182	T	0.63470	-0.6630	10	0.45353	T	0.12	-7.7963	7.9093	0.29780	0.0:0.3678:0.5341:0.0981	.	177	P15328	FOLR1_HUMAN	H	177	ENSP00000308137:P177H;ENSP00000377286:P177H;ENSP00000377284:P177H;ENSP00000377281:P177H	ENSP00000308137:P177H	P	+	2	0	FOLR1	71584625	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	-0.768000	0.04715	0.102000	0.17638	0.563000	0.77884	CCT			0.552	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396773.1		NM_016725	
RSF1	51773	broad.mit.edu	37	11	77378419	77378421	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:77378419_77378421delTCC	ENST00000308488.6	-	16	4169_4171	c.3867_3869delGGA	c.(3865-3870)gaggaa>gaa	p.1289_1290EE>E	RSF1_ENST00000480887.1_In_Frame_Del_p.1037_1038EE>E|RSF1_ENST00000360355.2_In_Frame_Del_p.1258_1259EE>E			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1289	Poly-Glu.				CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GCCTTCCTCTTCCTCCTCCTCCT	0.517																																					p.1289_1290del													.	RSF1	105		0			c.3867_3869del																																									SO:0001651	inframe_deletion	51773	exon16			TCCTCTTCCTCCT	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3867_3869delGGA	11.37:g.77378428_77378430delTCC	ENSP00000311513:p.Glu1292del		192	0	0		144	0.05	7	NM_016578	33	0.00	0	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	In_Frame_Del	DEL	ENST00000308488.6	37	CCDS8253.1																																																																																					0.517	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318075.2		NM_016578	
PIWIL4	143689	mdanderson.org	37	11	94337214	94337214	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:94337214G>T	ENST00000299001.6	+	13	1841	c.1630G>T	c.(1630-1632)Gtt>Ttt	p.V544F	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	544					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGATCCTGATGTTCAGCTGGT	0.313																																					p.V544F													.	.			0			c.G1630T												95.0	95.0	95.0					11																	94337214		2198	4296	6494	SO:0001583	missense	143689	exon13			CCTGATGTTCAGC	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1630G>T	11.37:g.94337214G>T	ENSP00000299001:p.Val544Phe		89	0	0		49	0.06	3	NM_152431	0		0	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	G	4.105	0.017564	0.07959	.	.	ENSG00000134627	ENST00000299001	T	0.04234	3.67	5.11	1.04	0.20106	Ribonuclease H-like (1);	0.373259	0.21862	N	0.068016	T	0.05547	0.0146	M	0.67953	2.075	0.18873	N	0.999985	P	0.43973	0.823	B	0.38880	0.284	T	0.29058	-1.0024	10	0.51188	T	0.08	-21.4306	5.2079	0.15300	0.2674:0.3074:0.4251:0.0	.	544	Q7Z3Z4	PIWL4_HUMAN	F	544	ENSP00000299001:V544F	ENSP00000299001:V544F	V	+	1	0	PIWIL4	93976862	0.019000	0.18553	0.717000	0.30585	0.031000	0.12232	0.026000	0.13599	0.749000	0.32854	-0.126000	0.14955	GTT			0.313	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396388.1		NM_152431	
ARHGAP32	9743	mdanderson.org	37	11	128839438	128839438	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:128839438C>T	ENST00000310343.9	-	22	5627	c.5628G>A	c.(5626-5628)gaG>gaA	p.E1876E	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Silent_p.E1527E|ARHGAP32_ENST00000392657.3_Silent_p.E1527E	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1876	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GTGCCCTGTGCTCAGGAAGAC	0.577																																					p.E1876E													.	.			0			c.G5628A												75.0	67.0	70.0					11																	128839438		2201	4297	6498	SO:0001819	synonymous_variant	9743	exon22			CCTGTGCTCAGGA	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5628G>A	11.37:g.128839438C>T			52	0	0		42	0.07	3	NM_001142685	2	0.00	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	37	CCDS44769.1																																																																																					0.577	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386151.3		NM_014715	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	133789875	133789875	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr11:133789875G>A	ENST00000321016.8	-	18	3975	c.3745C>T	c.(3745-3747)Cga>Tga	p.R1249*	IGSF9B_ENST00000533871.2_Nonsense_Mutation_p.R1249*			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1249	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTAGACTTTCGAGAAAAGCTG	0.692																																					p.R1249X													IGSF9B_ENST00000321016,NS,carcinoma,+1,2	IGSF9B_ENST00000321016	1	2	0			c.C3745T												19.0	25.0	23.0					11																	133789875		1867	4091	5958	SO:0001587	stop_gained	22997	exon18			ACTTTCGAGAAAA	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3745C>T	11.37:g.133789875G>A	ENSP00000317980:p.Arg1249*		88	0	0		53	0.17	9	NM_014987	1	0.00	0	G5EA26	Nonsense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	G	39	7.606933	0.98387	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	.	.	.	5.11	3.11	0.35812	.	0.165528	0.28828	N	0.014006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	9.7797	0.40640	0.0781:0.1407:0.7812:0.0	.	.	.	.	X	1249;1091	.	ENSP00000317980:R1249X	R	-	1	2	IGSF9B	133295085	1.000000	0.71417	0.603000	0.28903	0.180000	0.23129	3.412000	0.52679	1.152000	0.42452	0.555000	0.69702	CGA			0.692	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				XM_290502	
DDX12P	440081	hgsc.bcm.edu;bcgsc.ca	37	12	9571098	9571098	+	IGR	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:9571098G>A								RP13-735L24.1 (20885 upstream) : SNORA75 (26555 downstream)																							TTTCTCCTACGGGAGCTAACG	0.577																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	440081	.			TCCTACGGGAGCT																													12.37:g.9571098G>A			107	0	0		247	0.09	21	.	60	0.00	0		RNA	SNP		37																																																																																					0	0.577										
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	18544127	18544127	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:18544127G>T	ENST00000266497.5	+	13	1982	c.1944G>T	c.(1942-1944)gaG>gaT	p.E648D	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.E689D|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.E648D			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	648	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ATCTTGAAGAGCCACTAAAGG	0.383																																					p.E648D													.	.			0			c.G1944T												73.0	70.0	71.0					12																	18544127		1833	4088	5921	SO:0001583	missense	5288	exon14			TGAAGAGCCACTA	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1944G>T	12.37:g.18544127G>T	ENSP00000266497:p.Glu648Asp		53	0	0		113	0.05	6	NM_004570	0		0	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	G	9.187	1.025155	0.19433	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.61392	0.11;0.11;0.12	5.03	2.72	0.32119	Phosphoinositide 3-kinase, accessory (PIK) domain (2);Armadillo-type fold (1);	0.241676	0.33382	N	0.004976	T	0.62478	0.2431	L	0.51422	1.61	0.36036	D	0.83977	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72075	0.976;0.96;0.976	T	0.63296	-0.6669	10	0.21540	T	0.41	-22.1581	6.0048	0.19541	0.6577:0.0:0.3423:0.0	.	688;689;648	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	D	648;648;689	ENSP00000404845:E648D;ENSP00000266497:E648D;ENSP00000445381:E689D	ENSP00000266497:E648D	E	+	3	2	PIK3C2G	18435394	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	1.807000	0.38902	0.502000	0.28037	-0.312000	0.09012	GAG			0.383	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401316.1		NM_004570	
PLCZ1	89869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	18872383	18872383	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:18872383T>C	ENST00000266505.7	-	5	814	c.551A>G	c.(550-552)gAc>gGc	p.D184G	RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000447925.2_Missense_Mutation_p.D182G|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000541695.1_Missense_Mutation_p.D47G					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TCCCCAAAGGTCACTTGGTCC	0.308																																					p.D184G													.	.			0			c.A551G												51.0	52.0	52.0					12																	18872383		2202	4288	6490	SO:0001583	missense	89869	exon5			CAAAGGTCACTTG	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.551A>G	12.37:g.18872383T>C	ENSP00000266505:p.Asp184Gly		186	0	0		419	0.14	60	NM_033123	0		0		Missense_Mutation	SNP	ENST00000266505.7	37	CCDS8680.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855239	0.51376	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000541695	T;T;T	0.53206	0.63;0.63;0.63	5.28	5.28	0.74379	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.055738	0.64402	D	0.000001	T	0.54095	0.1837	M	0.64630	1.985	0.37168	D	0.902898	P	0.37061	0.58	B	0.44108	0.441	T	0.65100	-0.6250	10	0.72032	D	0.01	.	14.3734	0.66857	0.0:0.0:0.0:1.0	.	184	Q86YW0	PLCZ1_HUMAN	G	184;182;47	ENSP00000266505:D184G;ENSP00000402358:D182G;ENSP00000443349:D47G	ENSP00000266505:D184G	D	-	2	0	PLCZ1	18763650	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.922000	0.56462	1.994000	0.58287	0.482000	0.46254	GAC			0.308	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000401667.3		NM_033123	
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	22012586	22012586	+	Missense_Mutation	SNP	A	A	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:22012586A>T	ENST00000261201.4	-	20	2438	c.2439T>A	c.(2437-2439)agT>agA	p.S813R	RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Missense_Mutation_p.S813R|ABCC9_ENST00000345162.2_Missense_Mutation_p.S777R	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	813	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TCTGTCCCCCACTCAGGTTGA	0.388																																					p.S813R													.	.			0			c.T2439A												173.0	173.0	173.0					12																	22012586		2203	4300	6503	SO:0001583	missense	10060	exon20			TCCCCCACTCAGG	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2439T>A	12.37:g.22012586A>T	ENSP00000261201:p.Ser813Arg		141	0	0		336	0.07	23	NM_005691	0		0	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393609	0.62066	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18	4.71	3.44	0.39384	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.99411	0.9792	H	0.99211	4.47	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.98032	1.0377	10	0.87932	D	0	-17.5591	6.7847	0.23668	0.7823:0.0:0.2177:0.0	.	813;813	O60706;O60706-2	ABCC9_HUMAN;.	R	813;440;813;777	ENSP00000261200:S813R;ENSP00000440521:S440R;ENSP00000261201:S813R;ENSP00000261202:S777R	ENSP00000261200:S813R	S	-	3	2	ABCC9	21903853	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.961000	0.40432	0.704000	0.31869	0.383000	0.25322	AGT			0.388	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000402230.1		NM_005691	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	40713816	40713816	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:40713816T>A	ENST00000298910.7	+	34	4912	c.4854T>A	c.(4852-4854)tgT>tgA	p.C1618*	LRRK2_ENST00000481256.1_3'UTR	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1618					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGGAAGGTTGTCCAAAACACC	0.308											OREG0003827	type=REGULATORY REGION|Gene=LOC486608|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.C1618X													.	.			0			c.T4854A												61.0	72.0	68.0					12																	40713816		2201	4298	6499	SO:0001587	stop_gained	120892	exon34			AGGTTGTCCAAAA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4854T>A	12.37:g.40713816T>A	ENSP00000298910:p.Cys1618*		305	0	0	895	376	0.20	75	NM_198578	1	0.00	0	A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	T	41	9.139492	0.99078	.	.	ENSG00000188906	ENST00000298910	.	.	.	5.54	-0.887	0.10587	.	0.947166	0.09016	N	0.860821	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	10.8654	0.46851	0.0:0.414:0.0:0.586	.	.	.	.	X	1618	.	ENSP00000298910:C1618X	C	+	3	2	LRRK2	39000083	0.004000	0.15560	0.077000	0.20336	0.919000	0.55068	0.395000	0.20850	-0.154000	0.11118	-0.334000	0.08254	TGT			0.308	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000277179.1		XM_058513	
ITGA7	3679	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	56088587	56088587	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:56088587G>T	ENST00000555728.1	-	16	2331	c.2303C>A	c.(2302-2304)tCa>tAa	p.S768*	ITGA7_ENST00000257879.6_Nonsense_Mutation_p.S724*|ITGA7_ENST00000257880.7_Nonsense_Mutation_p.S768*|ITGA7_ENST00000394229.2_Nonsense_Mutation_p.S724*|ITGA7_ENST00000452168.2_Nonsense_Mutation_p.S631*|ITGA7_ENST00000553804.1_Nonsense_Mutation_p.S728*|ITGA7_ENST00000394230.2_Nonsense_Mutation_p.S728*|ITGA7_ENST00000347027.6_Nonsense_Mutation_p.S718*			Q13683	ITA7_HUMAN	integrin, alpha 7	768					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCGGACCCCTGAGTAGTGCAG	0.647																																					p.S728X													.	.			0			c.C2183A												52.0	52.0	52.0					12																	56088587		2203	4300	6503	SO:0001587	stop_gained	3679	exon15			ACCCCTGAGTAGT		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2303C>A	12.37:g.56088587G>T	ENSP00000452387:p.Ser768*		93	0	0		111	0.06	7	NM_001144996	31	0.00	0	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Nonsense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	G	37	6.044430	0.97231	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000555728	.	.	.	4.66	3.74	0.42951	.	0.722636	0.12319	N	0.479478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4342	0.50058	0.0971:0.0:0.9029:0.0	.	.	.	.	X	728;724;718;631;768;728;724;768	.	ENSP00000257879:S724X	S	-	2	0	ITGA7	54374854	1.000000	0.71417	0.995000	0.50966	0.591000	0.36615	5.687000	0.68219	2.297000	0.77311	0.555000	0.69702	TCA			0.647	ITGA7-014	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000410138.1		NM_002206	
DDX54	79039	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	113623183	113623183	+	Missense_Mutation	SNP	C	C	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:113623183C>A	ENST00000306014.5	-	1	101	c.74G>T	c.(73-75)gGg>gTg	p.G25V	C12orf52_ENST00000548278.1_5'Flank|RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000549621.1_5'Flank|DDX54_ENST00000314045.7_Missense_Mutation_p.G25V|C12orf52_ENST00000552495.1_5'Flank	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	25					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTTCCGGAGCCCTTTCTTCTT	0.721																																					p.G25V													.	.			0			c.G74T												6.0	8.0	7.0					12																	113623183		2141	4216	6357	SO:0001583	missense	79039	exon1			CGGAGCCCTTTCT	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.74G>T	12.37:g.113623183C>A	ENSP00000304072:p.Gly25Val		56	0	0		42	0.14	6	NM_024072	25	0.08	2	Q86YT8|Q9BRZ1	Missense_Mutation	SNP	ENST00000306014.5	37	CCDS31907.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.660266	0.29515	.	.	ENSG00000123064	ENST00000314045;ENST00000306014	T;T	0.09255	3.0;3.0	3.63	3.63	0.41609	.	0.593238	0.16025	N	0.233144	T	0.09247	0.0228	N	0.22421	0.69	0.48571	D	0.99967	P;P	0.45176	0.852;0.769	P;B	0.45232	0.474;0.282	T	0.31779	-0.9931	10	0.22109	T	0.4	.	11.1002	0.48170	0.0:1.0:0.0:0.0	.	25;25	Q8TDD1-2;Q8TDD1	.;DDX54_HUMAN	V	25	ENSP00000323858:G25V;ENSP00000304072:G25V	ENSP00000304072:G25V	G	-	2	0	DDX54	112107566	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	2.992000	0.49417	2.333000	0.79357	0.462000	0.41574	GGG			0.721	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000405435.1		NM_024072	
EP400	57634	broad.mit.edu	37	12	132446460	132446460	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr12:132446460G>A	ENST00000333577.4	+	2	1405	c.1296G>A	c.(1294-1296)gaG>gaA	p.E432E	EP400_ENST00000389561.2_Silent_p.E432E|EP400_ENST00000330386.6_Silent_p.E432E|EP400_ENST00000332482.4_Silent_p.E432E|EP400_ENST00000389562.2_Silent_p.E432E			Q96L91	EP400_HUMAN	E1A binding protein p400	432	Poly-Glu.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		aggaggaggaggaagaggagg	0.383																																					p.E432E													EP400,NS,malignant_melanoma,0,1	EP400	370	1	0			c.G1296A												53.0	52.0	52.0					12																	132446460		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon2			GGAGGAGGAAGAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.1296G>A	12.37:g.132446460G>A			56	0	0		62	0.05	3	NM_015409	5	0.00	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																						0.383	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015409	
FRY	10129	hgsc.bcm.edu	37	13	32735280	32735280	+	Splice_Site	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr13:32735280G>T	ENST00000380250.3	+	17	2280		c.e17-1			NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCTAATTCTAGGGGTGAGAGA	0.353																																					.													.	.			0			c.1785-1G>T												119.0	108.0	111.0					13																	32735280		1839	4086	5925	SO:0001630	splice_region_variant	10129	exon17			ATTCTAGGGGTGA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1785-1G>T	13.37:g.32735280G>T			77	0	0		67	0.06	4	NM_023037	0		0	Q9Y3N6	Splice_Site	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413017	0.83449	.	.	ENSG00000073910	ENST00000380250	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7775	0.96400	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRY	31633280	1.000000	0.71417	0.992000	0.48379	0.819000	0.46315	9.869000	0.99810	2.680000	0.91292	0.655000	0.94253	.			0.353	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044405.1		NM_023037	Intron
IRF9	10379	mdanderson.org	37	14	24634116	24634116	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr14:24634116C>T	ENST00000396864.3	+	7	1230	c.943C>T	c.(943-945)Ccc>Tcc	p.P315S	IRF9_ENST00000557894.1_Missense_Mutation_p.P213S|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	315					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		GCATCTGCTGCCCAGCAACGA	0.632																																					p.P315S													.	.			0			c.C943T												57.0	58.0	57.0					14																	24634116		2203	4300	6503	SO:0001583	missense	10379	exon7			CTGCTGCCCAGCA	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.943C>T	14.37:g.24634116C>T	ENSP00000380073:p.Pro315Ser		43	0	0		30	0.10	3	NM_006084	288	0.00	0	D3DS61	Missense_Mutation	SNP	ENST00000396864.3	37	CCDS9615.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661665	0.67700	.	.	ENSG00000213928	ENST00000396864	D	0.95103	-3.61	5.71	5.71	0.89125	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.344507	0.23577	U	0.046690	D	0.94072	0.8100	M	0.63428	1.95	0.31343	N	0.683404	P	0.35124	0.485	B	0.40741	0.339	D	0.94276	0.7515	10	0.48119	T	0.1	-17.2048	15.3433	0.74314	0.0:1.0:0.0:0.0	.	315	Q00978	IRF9_HUMAN	S	315	ENSP00000380073:P315S	ENSP00000380073:P315S	P	+	1	0	IRF9	23703956	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.616000	0.46376	2.700000	0.92200	0.462000	0.41574	CCC			0.632	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071927.2			
MAP3K9	4293	mdanderson.org	37	14	71275530	71275530	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr14:71275530C>T	ENST00000554752.2	-	1	358	c.359G>A	c.(358-360)cGc>cAc	p.R120H	RP6-65G23.3_ENST00000557691.1_lincRNA|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R120H|MAP3K9_ENST00000555993.2_Missense_Mutation_p.R120H	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	120					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GGGCTGGCAGCGGCTGGAGAA	0.721																																					p.R120H	GBM(114;411 1587 13539 28235 50070)												.	.			0			c.G359A												9.0	11.0	11.0					14																	71275530		2025	4064	6089	SO:0001583	missense	4293	exon1			TGGCAGCGGCTGG	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.359G>A	14.37:g.71275530C>T	ENSP00000451612:p.Arg120His		30	0	0		38	0.08	3	NM_033141	5	0.00	0	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37		.	.	.	.	.	.	.	.	.	.	c	13.73	2.323685	0.41096	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000381250	T;T	0.30182	1.54;1.54	3.36	2.45	0.29901	Src homology-3 domain (1);	0.321128	0.27270	U	0.020131	T	0.22475	0.0542	L	0.29908	0.895	0.80722	D	1	B;B	0.13594	0.003;0.008	B;B	0.10450	0.002;0.005	T	0.05566	-1.0877	10	0.44086	T	0.13	.	12.3395	0.55085	0.0:0.8276:0.1724:0.0	.	120;120	P80192;P80192-4	M3K9_HUMAN;.	H	120	ENSP00000451612:R120H;ENSP00000370649:R120H	ENSP00000005198:R120H	R	-	2	0	MAP3K9	70345283	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.247000	0.32815	0.722000	0.32252	0.556000	0.70494	CGC			0.721	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000412550.2			
PAPLN	89932	mdanderson.org	37	14	73727426	73727426	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr14:73727426C>T	ENST00000554301.1	+	16	2158	c.1995C>T	c.(1993-1995)tgC>tgT	p.C665C	PAPLN_ENST00000555445.1_Silent_p.C665C|PAPLN_ENST00000340738.5_Silent_p.C638C|PAPLN_ENST00000381166.3_Silent_p.C665C|PAPLN_ENST00000427855.1_Silent_p.C665C			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	665						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GGTACGGGTGCTGCCCTGACA	0.662																																					p.C638C													.	.			0			c.C1914T												63.0	57.0	59.0					14																	73727426		2203	4300	6503	SO:0001819	synonymous_variant	89932	exon16			CGGGTGCTGCCCT	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1995C>T	14.37:g.73727426C>T			33	0	0		42	0.07	3	NM_173462	6	0.00	0	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Silent	SNP	ENST00000554301.1	37																																																																																						0.662	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000413182.1		NM_173462	
MARK3	4140	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	103946751	103946751	+	Nonsense_Mutation	SNP	C	C	T	rs372126503		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr14:103946751C>T	ENST00000429436.2	+	14	2020	c.1510C>T	c.(1510-1512)Cga>Tga	p.R504*	MARK3_ENST00000561071.1_Intron|MARK3_ENST00000416682.2_Nonsense_Mutation_p.R527*|MARK3_ENST00000216288.7_Nonsense_Mutation_p.R488*|MARK3_ENST00000440884.3_Nonsense_Mutation_p.R425*|MARK3_ENST00000553942.1_Nonsense_Mutation_p.R504*|MARK3_ENST00000303622.9_Nonsense_Mutation_p.R504*|MARK3_ENST00000335102.5_Nonsense_Mutation_p.R527*	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	504						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			TGGAATGACACGACGAAATAC	0.343																																					p.R504X													.	MARK3	86		0			c.C1510T							C	stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,3718		0,0,1859	170.0	166.0	167.0		1510,1510,1462,1273,1510	3.9	0.9	14		167	1,8229		0,1,4114	no	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	MARK3	NM_001128918.1,NM_001128919.1,NM_001128920.1,NM_001128921.1,NM_002376.5	,,,,	0,1,5973	TT,TC,CC		0.0122,0.0,0.0084	,,,,	504/754,504/745,488/714,425/660,504/730	103946751	1,11947	1859	4115	5974	SO:0001587	stop_gained	4140	exon14			ATGACACGACGAA	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.1510C>T	14.37:g.103946751C>T	ENSP00000411397:p.Arg504*		208	0.0048076923	1		233	0.12	27	NM_001128919	88	0.08	7	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Nonsense_Mutation	SNP	ENST00000429436.2	37	CCDS45165.1	.	.	.	.	.	.	.	.	.	.	C	44	10.748922	0.99460	0.0	1.22E-4	ENSG00000075413	ENST00000335102;ENST00000411530;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942;ENST00000556744	.	.	.	5.81	3.91	0.45181	.	0.105865	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8154	0.70031	0.2632:0.7368:0.0:0.0	.	.	.	.	X	527;153;425;527;504;504;488;504;39	.	ENSP00000216288:R504X	R	+	1	2	MARK3	103016504	0.019000	0.18553	0.898000	0.35279	0.972000	0.66771	0.233000	0.17911	0.731000	0.32448	0.644000	0.83932	CGA			0.343	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415144.1		NM_001128918	
CKMT1B	1159	hgsc.bcm.edu	37	15	43891085	43891085	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr15:43891085G>T	ENST00000441322.1	+	8	1432	c.1072G>T	c.(1072-1074)Gtg>Ttg	p.V358L	CKMT1B_ENST00000300283.6_Missense_Mutation_p.V358L			P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B	358	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			large_intestine(1)|lung(3)|skin(1)	5		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TACTGGAGGAGTGGACACTGC	0.488																																					p.V358L													.	.			0			c.G1072T												101.0	112.0	108.0					15																	43891085		2199	4297	6496	SO:0001583	missense	1159	exon9			GGAGGAGTGGACA	AK094322, J04469	CCDS10097.1	15q15	2005-04-15		2005-04-15	ENSG00000237289	ENSG00000237289	2.7.3.2		1995	protein-coding gene	gene with protein product		123290	"""creatine kinase, mitochondrial 1 (ubiquitous)"""	CKMT, CKMT1			Standard	XM_005254150		Approved	UMTCK	uc001zsc.3	P12532	OTTHUMG00000059900	ENST00000441322.1:c.1072G>T	15.37:g.43891085G>T	ENSP00000413255:p.Val358Leu		99	0	0		94	0.04	4	NM_020990	15	0.00	0	B4DIT8|B7ZA09|Q0VAM3|Q32NF6|Q53FC4	Missense_Mutation	SNP	ENST00000441322.1	37	CCDS10097.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388974	0.82902	.	.	ENSG00000237289	ENST00000300283;ENST00000441322	T;T	0.11495	2.77;2.77	4.58	4.58	0.56647	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	H	0.96889	3.9	0.80722	D	1	P;P	0.52463	0.953;0.559	P;P	0.51453	0.67;0.577	T	0.61695	-0.7010	10	0.51188	T	0.08	0.1549	17.551	0.87875	0.0:0.0:1.0:0.0	.	389;358	P12532-2;P12532	.;KCRU_HUMAN	L	358	ENSP00000300283:V358L;ENSP00000413255:V358L	ENSP00000300283:V358L	V	+	1	0	CKMT1B	41678377	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.800000	0.85949	2.373000	0.80994	0.491000	0.48974	GTG			0.488	CKMT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000133147.2		NM_020990	
TELO2	9894	mdanderson.org	37	16	1552719	1552719	+	Missense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:1552719G>A	ENST00000262319.6	+	14	2006	c.1727G>A	c.(1726-1728)cGc>cAc	p.R576H	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	576					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GCAGGGCTGCGCCAGAGAGCC	0.667																																					p.R576H													.	.			0			c.G1727A												98.0	104.0	102.0					16																	1552719		2199	4300	6499	SO:0001583	missense	9894	exon14			GGCTGCGCCAGAG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1727G>A	16.37:g.1552719G>A	ENSP00000262319:p.Arg576His		44	0	0		37	0.08	3	NM_016111	50	0.00	0	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623748	0.66901	.	.	ENSG00000100726	ENST00000262319	T	0.33654	1.4	5.3	5.3	0.74995	Telomere length regulation protein, conserved domain (1);	0.047684	0.85682	D	0.000000	T	0.68302	0.2986	M	0.89968	3.075	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.75619	-0.3255	10	0.72032	D	0.01	-16.5969	17.7218	0.88353	0.0:0.0:1.0:0.0	.	576	Q9Y4R8	TELO2_HUMAN	H	576	ENSP00000262319:R576H	ENSP00000262319:R576H	R	+	2	0	TELO2	1492720	1.000000	0.71417	0.955000	0.39395	0.033000	0.12548	8.260000	0.89857	2.502000	0.84385	0.462000	0.41574	CGC			0.667	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000103602.2		NM_016111	
NDE1	54820	mdanderson.org	37	16	15790697	15790697	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:15790697C>T	ENST00000396353.2	+	9	1753	c.927C>T	c.(925-927)agC>agT	p.S309S	NDE1_ENST00000396355.1_Silent_p.S309S|NDE1_ENST00000342673.5_Silent_p.S309S|NDE1_ENST00000396354.1_Silent_p.S309S			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	309					centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)			endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						GCAGCACCAGCGTGCCTTTGG	0.617																																					p.S309S													.	.			0			c.C927T												75.0	76.0	76.0					16																	15790697		2197	4300	6497	SO:0001819	synonymous_variant	54820	exon9			CACCAGCGTGCCT	AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.927C>T	16.37:g.15790697C>T			46	0	0		46	0.07	3	NM_001143979	72	0.00	0	Q49AQ2	Silent	SNP	ENST00000396353.2	37																																																																																						0.617	NDE1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017668	
EEF2K	29904	bcgsc.ca;mdanderson.org	37	16	22274454	22274454	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:22274454C>T	ENST00000263026.5	+	12	1797	c.1323C>T	c.(1321-1323)agC>agT	p.S441S		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	441					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GTGGGGACAGCGGATACCCCA	0.567																																					p.S441S	NSCLC(195;1411 2157 20319 27471 51856)												.	EEF2K	142		0			c.C1323T												80.0	67.0	71.0					16																	22274454		2197	4300	6497	SO:0001819	synonymous_variant	29904	exon12			GGACAGCGGATAC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1323C>T	16.37:g.22274454C>T			97	0	0		70	0.07	5	NM_013302	5	0.00	0	Q8N588	Silent	SNP	ENST00000263026.5	37	CCDS10604.1																																																																																					0.567	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211580.2		NM_013302	
PLK1	5347	mdanderson.org	37	16	23703328	23703328	+	IGR	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:23703328G>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000256797.4_Missense_Mutation_p.H826N|ERN2_ENST00000457008.2_Missense_Mutation_p.H726N	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		AAGAAGGGGTGGGCCAGCACC	0.607																																					p.H826N	Colon(12;240 564 27038 33155)												ERN2_ENST00000256797,colon,carcinoma,0,1	ERN2_ENST00000256797	0	1	0			c.C2476A												125.0	150.0	141.0					16																	23703328		2197	4300	6497	SO:0001628	intergenic_variant	10595	exon19			AGGGGTGGGCCAG		CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23703328G>T			45	0	0		44	0.07	3	NM_033266	2	0.00	0	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996887	0.93167	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.59083	0.29;0.29	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.83766	0.0217	10	0.72032	D	0.01	.	17.0183	0.86425	0.0:0.0:1.0:0.0	.	726;778	E7ETG2;A5YM65	.;.	N	826;726	ENSP00000256797:H826N;ENSP00000413812:H726N	ENSP00000256797:H826N	H	-	1	0	ERN2	23610829	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.415000	0.97375	2.608000	0.88229	0.655000	0.94253	CAC			0.607	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214057.2		NM_005030	
IRX3	79191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	54319129	54319129	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:54319129C>T	ENST00000329734.3	-	2	1376	c.664G>A	c.(664-666)Ggc>Agc	p.G222S		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	222	Asp/Glu-rich (acidic).			G -> C (in Ref. 1; AAQ16549). {ECO:0000305}.	mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						TCGCGTTTGCCGtcctcctcg	0.652																																					p.G222S	GBM(143;1830 1866 4487 4646 37383)												IRX3,NS,carcinoma,+1,1	IRX3	1	1	0			c.G664A												65.0	42.0	50.0					16																	54319129		2198	4300	6498	SO:0001583	missense	79191	exon2			GTTTGCCGTCCTC	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.664G>A	16.37:g.54319129C>T	ENSP00000331608:p.Gly222Ser		42	0	0		37	0.16	6	NM_024336	9	0.00	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	.	.	.	.	.	.	.	.	.	.	C	0.198	-1.047338	0.01981	.	.	ENSG00000177508	ENST00000329734	T	0.52295	0.67	4.44	-8.89	0.00785	.	1.137180	0.06750	N	0.779806	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22487	-1.0215	10	0.18276	T	0.48	-0.1425	8.9126	0.35563	0.1138:0.6252:0.0:0.261	.	222	P78415	IRX3_HUMAN	S	222	ENSP00000331608:G222S	ENSP00000331608:G222S	G	-	1	0	IRX3	52876630	0.232000	0.23762	0.001000	0.08648	0.000000	0.00434	0.513000	0.22770	-2.071000	0.00880	-0.251000	0.11542	GGC			0.652	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256910.2			
LRRC36	55282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67416139	67416139	+	Missense_Mutation	SNP	T	T	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:67416139T>A	ENST00000329956.6	+	13	2053	c.2034T>A	c.(2032-2034)caT>caA	p.H678Q	LRRC36_ENST00000541146.1_Missense_Mutation_p.H150Q|LRRC36_ENST00000290940.7_3'UTR|LRRC36_ENST00000563189.1_Missense_Mutation_p.H557Q|LRRC36_ENST00000435835.3_Missense_Mutation_p.H453Q	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	678										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		CCATTCTCCATGAAAGTCAGA	0.443																																					p.H678Q													LRRC36,scalp,carcinoma,+2,1	LRRC36	2	1	0			c.T2034A												57.0	55.0	56.0					16																	67416139		2198	4300	6498	SO:0001583	missense	55282	exon13			TCTCCATGAAAGT	BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.2034T>A	16.37:g.67416139T>A	ENSP00000329943:p.His678Gln		130	0	0		113	0.27	31	NM_018296	0		0	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	37	CCDS32467.1	.	.	.	.	.	.	.	.	.	.	T	2.254	-0.370756	0.05069	.	.	ENSG00000159708	ENST00000329956;ENST00000541146;ENST00000435835	T;T;T	0.46819	3.6;0.86;1.59	5.73	-10.6	0.00265	.	0.280189	0.34555	N	0.003873	T	0.15696	0.0378	N	0.05441	-0.05	0.19575	N	0.999965	B;B;B;B	0.29136	0.011;0.234;0.01;0.011	B;B;B;B	0.35240	0.006;0.198;0.011;0.006	T	0.37478	-0.9704	10	0.02654	T	1	-4.4746	7.4238	0.27088	0.0977:0.538:0.199:0.1653	.	150;453;557;678	B7Z4G3;B7Z7B3;Q1X8D7-2;Q1X8D7	.;.;.;LRC36_HUMAN	Q	678;150;453	ENSP00000329943:H678Q;ENSP00000445861:H150Q;ENSP00000411122:H453Q	ENSP00000329943:H678Q	H	+	3	2	LRRC36	65973640	0.002000	0.14202	0.015000	0.15790	0.273000	0.26683	-1.530000	0.02221	-1.826000	0.01205	-0.899000	0.02877	CAT			0.443	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421770.1		NM_018296	
ENKD1	84080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67697165	67697165	+	Missense_Mutation	SNP	C	C	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:67697165C>G	ENST00000243878.4	-	7	1261	c.940G>C	c.(940-942)Gcc>Ccc	p.A314P	ACD_ENST00000219251.8_5'Flank|ACD_ENST00000393919.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000602644.1_3'UTR	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	314	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											TGGCTCTGGGCTCTCAGTGAG	0.607																																					p.A314P													.	.			0			c.G940C												84.0	78.0	80.0					16																	67697165		2198	4300	6498	SO:0001583	missense	84080	exon7			TCTGGGCTCTCAG	BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.940G>C	16.37:g.67697165C>G	ENSP00000243878:p.Ala314Pro		54	0	0		68	0.16	11	NM_032140	43	0.19	8	Q6UWD7	Missense_Mutation	SNP	ENST00000243878.4	37	CCDS10844.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420096	0.62622	.	.	ENSG00000124074	ENST00000243878	.	.	.	4.94	4.94	0.65067	.	0.313591	0.32081	N	0.006618	T	0.59932	0.2230	L	0.55481	1.735	0.31312	N	0.687003	D;D	0.76494	0.996;0.999	P;D	0.67548	0.852;0.952	T	0.64141	-0.6477	9	0.48119	T	0.1	-3.4915	11.3289	0.49465	0.0:0.9157:0.0:0.0843	.	314;196	Q9H0I2;Q9H0I2-2	CP048_HUMAN;.	P	314	.	ENSP00000243878:A314P	A	-	1	0	C16orf48	66254666	0.014000	0.17966	0.983000	0.44433	0.863000	0.49368	0.797000	0.26999	2.281000	0.76405	0.561000	0.74099	GCC			0.607	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268884.1		NM_032140	
BANP	54971	mdanderson.org	37	16	88014644	88014644	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr16:88014644G>T	ENST00000393207.1	+	3	294	c.73G>T	c.(73-75)Gtt>Ttt	p.V25F	BANP_ENST00000538234.1_Missense_Mutation_p.V25F|BANP_ENST00000355022.4_Missense_Mutation_p.V25F|BANP_ENST00000355163.5_Missense_Mutation_p.V31F|BANP_ENST00000393208.2_Missense_Mutation_p.V25F|BANP_ENST00000479780.2_Missense_Mutation_p.V25F|BANP_ENST00000286122.7_Missense_Mutation_p.V25F	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	25					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GATTTCAGTTGTTTTGGAGAA	0.343																																					p.V31F													.	.			0			c.G91T												88.0	80.0	83.0					16																	88014644		2198	4300	6498	SO:0001583	missense	54971	exon3			TCAGTTGTTTTGG	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.73G>T	16.37:g.88014644G>T	ENSP00000376902:p.Val25Phe		44	0	0		23	0.13	3	NM_001173540	17	0.00	0	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	ENST00000393207.1	37	CCDS54054.1	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138682	0.21123	.	.	ENSG00000172530	ENST00000423252;ENST00000439677;ENST00000286122;ENST00000355163;ENST00000289484;ENST00000454563;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000412691;ENST00000355022;ENST00000436970;ENST00000538234;ENST00000436274;ENST00000456902;ENST00000393207	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	4.56	4.56	0.56223	.	0.062472	0.64402	D	0.000005	T	0.47303	0.1438	N	0.24115	0.695	0.58432	D	0.999993	D;D;D;D;D;D	0.89917	0.976;0.993;0.972;0.997;0.984;1.0	P;P;D;D;P;D	0.91635	0.462;0.877;0.954;0.986;0.904;0.999	T	0.54043	-0.8352	10	0.87932	D	0	.	16.6775	0.85283	0.0:0.0:1.0:0.0	.	25;31;25;25;25;25	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	F	25;31;25;31;25;36;25;25;25;25;25;25;25;25;25;25	ENSP00000401718:V25F;ENSP00000411479:V31F;ENSP00000286122:V25F;ENSP00000347290:V31F;ENSP00000413717:V36F;ENSP00000432508:V25F;ENSP00000376903:V25F;ENSP00000390504:V25F;ENSP00000347125:V25F;ENSP00000399576:V25F;ENSP00000444352:V25F;ENSP00000401454:V25F;ENSP00000410089:V25F;ENSP00000376902:V25F	ENSP00000286122:V25F	V	+	1	0	BANP	86572145	1.000000	0.71417	0.985000	0.45067	0.399000	0.30720	6.927000	0.75840	2.255000	0.74692	0.455000	0.32223	GTT			0.343	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000269166.1		NM_017869	
ZZEF1	23140	mdanderson.org	37	17	3916822	3916822	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:3916822C>T	ENST00000381638.2	-	52	8624	c.8500G>A	c.(8500-8502)Gtg>Atg	p.V2834M		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2834							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGACAGGCCACGCCCACCAGC	0.542																																					p.V2834M													.	.			0			c.G8500A												82.0	76.0	78.0					17																	3916822		2203	4300	6503	SO:0001583	missense	23140	exon52			AGGCCACGCCCAC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8500G>A	17.37:g.3916822C>T	ENSP00000371051:p.Val2834Met		83	0.0120481928	1		67	0.06	4	NM_015113	14	0.00	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	33	5.237377	0.95240	.	.	ENSG00000074755	ENST00000381638	T	0.33865	1.39	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.53254	0.1785	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52931	-0.8509	10	0.87932	D	0	-17.3197	20.3214	0.98679	0.0:1.0:0.0:0.0	.	2834	O43149	ZZEF1_HUMAN	M	2834	ENSP00000371051:V2834M	ENSP00000371051:V2834M	V	-	1	0	ZZEF1	3863571	1.000000	0.71417	0.980000	0.43619	0.980000	0.70556	5.600000	0.67599	2.804000	0.96469	0.655000	0.94253	GTG			0.542	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207480.1		NM_015113	
SPNS3	201305	mdanderson.org	37	17	4352590	4352590	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:4352590G>T	ENST00000355530.2	+	7	1111	c.831G>T	c.(829-831)ctG>ctT	p.L277L	SPNS3_ENST00000333476.2_Silent_p.L150L|SPNS3_ENST00000576069.1_Intron	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	277					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						CTGGAGCCCTGGGGTTCTGGG	0.657																																					p.L277L													.	.			0			c.G831T												84.0	76.0	79.0					17																	4352590		2203	4300	6503	SO:0001819	synonymous_variant	201305	exon7			AGCCCTGGGGTTC		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.831G>T	17.37:g.4352590G>T			41	0	0		33	0.09	3	NM_182538	2	0.00	0	Q8IZ31	Silent	SNP	ENST00000355530.2	37	CCDS11045.1																																																																																					0.657	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438793.1		NM_182538	
NLRP1	22861	mdanderson.org	37	17	5462911	5462911	+	Missense_Mutation	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:5462911A>G	ENST00000572272.1	-	4	1104	c.1105T>C	c.(1105-1107)Tgc>Cgc	p.C369R	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Missense_Mutation_p.C369R|NLRP1_ENST00000269280.4_Missense_Mutation_p.C369R|NLRP1_ENST00000354411.3_Missense_Mutation_p.C369R|NLRP1_ENST00000345221.3_Missense_Mutation_p.C369R|NLRP1_ENST00000262467.5_Missense_Mutation_p.C369R			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	369	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				AGCTCTCTGCAGCTGAAGTAG	0.582																																					p.C369R													.	.			0			c.T1105C												63.0	63.0	63.0					17																	5462911		2203	4300	6503	SO:0001583	missense	22861	exon4			CTCTGCAGCTGAA	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1105T>C	17.37:g.5462911A>G	ENSP00000460475:p.Cys369Arg		94	0	0		52	0.06	3	NM_014922	10	0.00	0	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	A	15.92	2.976630	0.53720	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	4.33	3.25	0.37280	NACHT nucleoside triphosphatase (1);	0.000000	0.44097	D	0.000491	D	0.90273	0.6958	M	0.93283	3.4	0.52099	D	0.999944	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	D	0.89090	0.3482	10	0.87932	D	0	.	6.6379	0.22893	0.8913:0.0:0.1087:0.0	.	369;369;369;369;369	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	R	369	ENSP00000442029:C369R;ENSP00000262467:C369R;ENSP00000269280:C369R;ENSP00000346390:C369R;ENSP00000324366:C369R	ENSP00000262467:C369R	C	-	1	0	NLRP1	5403635	1.000000	0.71417	0.996000	0.52242	0.646000	0.38490	4.706000	0.61845	0.815000	0.34398	0.529000	0.55759	TGC			0.582	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000439517.1		NM_033004	
MYH13	8735	mdanderson.org	37	17	10236459	10236459	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:10236459G>T	ENST00000418404.3	-	18	2269	c.2106C>A	c.(2104-2106)gtC>gtA	p.V702V	MYH13_ENST00000252172.4_Silent_p.V702V|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	702	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGCCCTCGAGGACCCCGTTAC	0.577																																					p.V702V													.	.			0			c.C2106A												30.0	35.0	33.0					17																	10236459		1920	3900	5820	SO:0001819	synonymous_variant	8735	exon19			CTCGAGGACCCCG	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2106C>A	17.37:g.10236459G>T			52	0	0		41	0.07	3	NM_003802	0		0	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	CCDS45613.1																																																																																					0.577	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442255.1		NM_003802	
FLII	2314	broad.mit.edu;mdanderson.org	37	17	18150241	18150241	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:18150241G>A	ENST00000327031.4	-	22	3027	c.2802C>T	c.(2800-2802)taC>taT	p.Y934Y	FLII_ENST00000545457.2_Silent_p.Y879Y|FLII_ENST00000379450.4_Silent_p.Y848Y|FLII_ENST00000579294.1_Silent_p.Y923Y|FLII_ENST00000578558.1_Intron	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	934	Glu-rich.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AGAGGAAGACGTAGCAGTCCT	0.617																																					p.Y934Y													.	FLII	79		0			c.C2802T												113.0	101.0	105.0					17																	18150241		2203	4300	6503	SO:0001819	synonymous_variant	2314	exon22			GAAGACGTAGCAG	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2802C>T	17.37:g.18150241G>A			93	0	0		39	0.08	3	NM_002018	180	0.04	7	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1																																																																																					0.617	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132032.2		NM_002018	
SLFN12	55106	broad.mit.edu	37	17	33749877	33749877	+	Silent	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:33749877T>C	ENST00000394562.1	-	4	694	c.171A>G	c.(169-171)ggA>ggG	p.G57G	SLFN12_ENST00000452764.3_Silent_p.G57G|SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000304905.5_Silent_p.G57G			Q8IYM2	SLN12_HUMAN	schlafen family member 12	57							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTTGATCACTCCCCCTCCAG	0.358																																					p.G57G													.	SLFN12	56		0			c.A171G												125.0	115.0	118.0					17																	33749877		2203	4300	6503	SO:0001819	synonymous_variant	55106	exon2			GATCACTCCCCCT	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.171A>G	17.37:g.33749877T>C			148	0.0135135135	2		214	0.02	5	NM_018042	1	0.00	0	A8K711|Q9NP47	Silent	SNP	ENST00000394562.1	37	CCDS11295.1																																																																																					0.358	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256491.1		NM_018042	
FMNL1	752	ucsc.edu	37	17	43323271	43323271	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:43323271G>A	ENST00000331495.3	+	24	3357	c.3021G>A	c.(3019-3021)tgG>tgA	p.W1007*	MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|CTD-2020K17.4_ENST00000589518.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|FMNL1_ENST00000587489.1_Nonsense_Mutation_p.W585*|MAP3K14-AS1_ENST00000590100.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA|CTD-2020K17.4_ENST00000591361.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|FMNL1_ENST00000328118.3_Nonsense_Mutation_p.W1007*|MAP3K14-AS1_ENST00000591263.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1007	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						TGGAACAGTGGAAAAAAGAAG	0.632																																					p.W1007X	GBM(164;1247 1997 8702 11086 51972)												.	FMNL1	78		0			c.G3021A												21.0	23.0	23.0					17																	43323271		2202	4300	6502	SO:0001587	stop_gained	752	exon24			ACAGTGGAAAAAA	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.3021G>A	17.37:g.43323271G>A	ENSP00000329219:p.Trp1007*		84	0.0119047619	1		134	0.03	4	NM_005892	96	0.16	15	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Nonsense_Mutation	SNP	ENST00000331495.3	37	CCDS11497.1	.	.	.	.	.	.	.	.	.	.	G	41	9.032697	0.99042	.	.	ENSG00000184922	ENST00000328118;ENST00000331495	.	.	.	5.21	4.24	0.50183	.	0.238842	0.44285	D	0.000473	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	11.918	0.52776	0.0853:0.0:0.9147:0.0	.	.	.	.	X	1007	.	ENSP00000327442:W1007X	W	+	3	0	FMNL1	40679054	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.918000	0.69996	2.431000	0.82371	0.462000	0.41574	TGG			0.632	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450198.1	rescued with RNA-seq	NM_005892	
SAMD14	201191	broad.mit.edu	37	17	48195666	48195666	+	Silent	SNP	C	C	T	rs145637965		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:48195666C>T	ENST00000330175.4	-	3	386	c.69G>A	c.(67-69)acG>acA	p.T23T	SAMD14_ENST00000503734.1_5'UTR|SAMD14_ENST00000503131.1_Silent_p.T23T	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	23										breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						CCAGTCTGGCCGTCTCTGGCA	0.662																																					p.T23T													.	SAMD14	36		0			c.G69A												33.0	36.0	35.0					17																	48195666		2203	4300	6503	SO:0001819	synonymous_variant	201191	exon3			TCTGGCCGTCTCT		CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.69G>A	17.37:g.48195666C>T			49	0	0		63	0.06	4	NM_001257359	6	0.00	0	A5D8V1|Q8N2X0	Silent	SNP	ENST00000330175.4	37	CCDS58562.1																																																																																					0.662	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366661.1		NM_174920	
SMURF2	64750	broad.mit.edu;ucsc.edu	37	17	62543750	62543750	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:62543750C>T	ENST00000262435.9	-	17	2226	c.2039G>A	c.(2038-2040)cGa>cAa	p.R680Q		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	680	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			CAGAGGCACTCGAGAGGATCC	0.552																																					p.R680Q													.	SMURF2	63		0			c.G2039A												112.0	103.0	106.0					17																	62543750		2203	4300	6503	SO:0001583	missense	64750	exon17			GGCACTCGAGAGG	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.2039G>A	17.37:g.62543750C>T	ENSP00000262435:p.Arg680Gln		89	0.0112359551	1		97	0.04	4	NM_022739	66	0.11	7	Q52LL1|Q9H260	Missense_Mutation	SNP	ENST00000262435.9	37	CCDS32707.1	.	.	.	.	.	.	.	.	.	.	C	36	5.833487	0.97003	.	.	ENSG00000108854	ENST00000262435	T	0.63255	-0.03	5.89	5.89	0.94794	HECT (4);	0.046223	0.85682	D	0.000000	D	0.83751	0.5322	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85704	0.1315	10	0.87932	D	0	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	680	Q9HAU4	SMUF2_HUMAN	Q	680	ENSP00000262435:R680Q	ENSP00000262435:R680Q	R	-	2	0	SMURF2	59974212	1.000000	0.71417	0.937000	0.37676	0.917000	0.54804	7.729000	0.84864	2.793000	0.96121	0.561000	0.74099	CGA			0.552	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445227.1		NM_022739	
RBFOX3	146713	mdanderson.org	37	17	77090551	77090551	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr17:77090551G>T	ENST00000453134.2	-	14	1430	c.918C>A	c.(916-918)acC>acA	p.T306T	RBFOX3_ENST00000584778.1_Silent_p.T306T|RBFOX3_ENST00000582043.1_Silent_p.T322T|RBFOX3_ENST00000583458.1_Silent_p.T352T|RBFOX3_ENST00000415831.1_Silent_p.T306T|RBFOX3_ENST00000580155.1_Silent_p.T306T			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	306					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						CAATGCTGTAGGTCGCCGCGG	0.672																																					p.E306E													.	.			0			c.G918A												42.0	44.0	44.0					17																	77090551		692	1591	2283	SO:0001819	synonymous_variant	146713	exon14			GCTGTAGGTCGCC		CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.918C>A	17.37:g.77090551G>T			38	0	0		44	0.07	3	NM_001082575	5	0.00	0	B4DEG6|B4DF29	Silent	SNP	ENST00000453134.2	37	CCDS45805.1																																																																																					0.672	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437658.1		NM_001082575	
OSBPL1A	114876	mdanderson.org	37	18	21912990	21912990	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr18:21912990G>T	ENST00000319481.3	-	7	747	c.541C>A	c.(541-543)Cat>Aat	p.H181N		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	181	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					GCTGCACAATGCAAGGGTGTA	0.393																																					p.H181N													.	.			0			c.C541A												125.0	111.0	116.0					18																	21912990		2203	4300	6503	SO:0001583	missense	114876	exon7			CACAATGCAAGGG	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.541C>A	18.37:g.21912990G>T	ENSP00000320291:p.His181Asn		126	0	0		124	0.04	5	NM_080597	3	0.00	0	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572327	0.86542	.	.	ENSG00000141447	ENST00000319481	D	0.87256	-2.23	4.84	4.84	0.62591	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.95271	0.8466	M	0.93939	3.475	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.96450	0.9333	10	0.72032	D	0.01	-23.4929	18.2723	0.90072	0.0:0.0:1.0:0.0	.	181	Q9BXW6	OSBL1_HUMAN	N	181	ENSP00000320291:H181N	ENSP00000320291:H181N	H	-	1	0	OSBPL1A	20166988	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.855000	0.92236	2.379000	0.81126	0.650000	0.86243	CAT			0.393	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254902.1		NM_080597	
C2CD4C	126567	broad.mit.edu	37	19	408019	408019	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:408019C>T	ENST00000332235.6	-	2	516	c.343G>A	c.(343-345)Gag>Aag	p.E115K		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	115										large_intestine(1)|pancreas(1)	2						TCGGCACTCTCGATCTGGATC	0.711																																					p.E115K													.	C2CD4C	13		0			c.G343A												12.0	14.0	14.0					19																	408019		689	1580	2269	SO:0001583	missense	126567	exon2			CACTCTCGATCTG	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.343G>A	19.37:g.408019C>T	ENSP00000328677:p.Glu115Lys		47	0	0		38	0.08	3	NM_001136263	22	0.05	1	Q8N3H7	Missense_Mutation	SNP	ENST00000332235.6	37	CCDS45890.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646516	0.67358	.	.	ENSG00000183186	ENST00000332235	T	0.78707	-1.2	3.56	3.56	0.40772	.	0.000000	0.85682	U	0.000000	D	0.85847	0.5792	M	0.70595	2.14	0.53005	D	0.999963	D	0.89917	1.0	D	0.74674	0.984	D	0.86550	0.1834	10	0.48119	T	0.1	.	14.1264	0.65222	0.0:1.0:0.0:0.0	.	115	Q8TF44	C2C4C_HUMAN	K	115	ENSP00000328677:E115K	ENSP00000328677:E115K	E	-	1	0	C2CD4C	359019	1.000000	0.71417	0.978000	0.43139	0.575000	0.36095	4.533000	0.60615	1.514000	0.48869	0.556000	0.70494	GAG			0.711	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451789.2		XM_065166	
DIRAS1	148252	mdanderson.org	37	19	2717287	2717287	+	Missense_Mutation	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:2717287A>G	ENST00000323469.4	-	2	701	c.518T>C	c.(517-519)aTg>aCg	p.M173T	DIRAS1_ENST00000585334.1_Missense_Mutation_p.M173T	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	173					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTGAGGCTCATGTTCCGGCG	0.612																																					p.M173T													.	.			0			c.T518C												126.0	117.0	120.0					19																	2717287		2203	4299	6502	SO:0001583	missense	148252	exon2			AGGCTCATGTTCC	BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.518T>C	19.37:g.2717287A>G	ENSP00000325836:p.Met173Thr		33	0	0		23	0.13	3	NM_145173	10	0.00	0		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	.	.	.	.	.	.	.	.	.	.	A	10.66	1.413914	0.25465	.	.	ENSG00000176490	ENST00000323469	T	0.68903	-0.36	3.69	3.69	0.42338	.	0.144872	0.64402	D	0.000009	T	0.42765	0.1217	N	0.08118	0	0.53005	D	0.999966	B	0.09022	0.002	B	0.23150	0.044	T	0.24297	-1.0164	10	0.14252	T	0.57	.	10.357	0.43969	1.0:0.0:0.0:0.0	.	173	O95057	DIRA1_HUMAN	T	173	ENSP00000325836:M173T	ENSP00000325836:M173T	M	-	2	0	DIRAS1	2668287	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	6.987000	0.76206	1.547000	0.49401	0.448000	0.29417	ATG			0.612	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451350.1			
SIRT6	51548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4179130	4179130	+	Silent	SNP	G	G	A	rs200245532		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:4179130G>A	ENST00000337491.2	-	3	412	c.348C>T	c.(346-348)gaC>gaT	p.D116D	SIRT6_ENST00000381935.3_Silent_p.D44D|SIRT6_ENST00000305232.6_Silent_p.D116D|SIRT6_ENST00000601488.1_Intron|SIRT6_ENST00000594279.1_Silent_p.D44D	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	116	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGGAGCCCGTCCACGTTCT	0.652																																					p.D116D													SIRT6,NS,carcinoma,-2,1	SIRT6	-2	1	0			c.C348T												25.0	23.0	24.0					19																	4179130		2203	4300	6503	SO:0001819	synonymous_variant	51548	exon3			GAGCCCGTCCACG	AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.348C>T	19.37:g.4179130G>A			49	0	0		34	0.24	8	NM_016539	53	0.09	5	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Silent	SNP	ENST00000337491.2	37	CCDS12122.1																																																																																					0.652	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457931.2			
TMED1	11018	mdanderson.org	37	19	10943839	10943839	+	Silent	SNP	G	G	T	rs142246182		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:10943839G>T	ENST00000214869.2	-	4	614	c.516C>A	c.(514-516)ctC>ctA	p.L172L	TMED1_ENST00000588289.1_Silent_p.L27L|TMED1_ENST00000591695.1_Nonsense_Mutation_p.S111*	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	172					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						GCAGTAGCGTGAGCATCTGGA	0.647																																					p.L172L													.	.			0			c.C516A							G		1,4405	2.1+/-5.4	0,1,2202	51.0	47.0	49.0		516	0.5	0.6	19	dbSNP_134	49	0,8600		0,0,4300	no	coding-synonymous	TMED1	NM_006858.2		0,1,6502	TT,TG,GG		0.0,0.0227,0.0077		172/228	10943839	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11018	exon4			TAGCGTGAGCATC	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.516C>A	19.37:g.10943839G>T			71	0	0		48	0.06	3	NM_006858	91	0.00	0		Silent	SNP	ENST00000214869.2	37	CCDS12249.1																																																																																			0		0.647	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452614.1		NM_006858	
DOCK6	57572	mdanderson.org	37	19	11323902	11323902	+	Missense_Mutation	SNP	C	C	T	rs140032702		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:11323902C>T	ENST00000294618.7	-	35	4452	c.4441G>A	c.(4441-4443)Gcc>Acc	p.A1481T	DOCK6_ENST00000319867.7_Missense_Mutation_p.A820T|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1481					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GAGGCGCTGGCGTGCGTGCGG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18330	0.0		0.0	False		,,,				2504	0.0				p.A1481T													.	.			0			c.G4441A												45.0	53.0	51.0					19																	11323902		2192	4287	6479	SO:0001583	missense	57572	exon35			CGCTGGCGTGCGT		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4441G>A	19.37:g.11323902C>T	ENSP00000294618:p.Ala1481Thr		47	0	0		39	0.08	3	NM_020812	57	0.00	0	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	23.5	4.428471	0.83667	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.01933	4.55;4.55	4.94	3.9	0.45041	.	0.112294	0.64402	N	0.000014	T	0.11922	0.0290	M	0.90483	3.12	0.80722	D	1	D;P	0.57571	0.98;0.534	P;B	0.57152	0.814;0.355	T	0.00992	-1.1488	10	0.87932	D	0	-11.7589	12.2099	0.54373	0.0:0.9145:0.0:0.0855	.	820;1481	C9IZV6;Q96HP0	.;DOCK6_HUMAN	T	1481;820	ENSP00000294618:A1481T;ENSP00000321556:A820T	ENSP00000294618:A1481T	A	-	1	0	DOCK6	11184902	1.000000	0.71417	0.984000	0.44739	0.559000	0.35586	5.937000	0.70162	1.083000	0.41159	-0.145000	0.13849	GCC	0		0.647	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453155.1		NM_020812	
DOCK6	57572	mdanderson.org	37	19	11361651	11361651	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:11361651G>T	ENST00000294618.7	-	6	630	c.619C>A	c.(619-621)Cta>Ata	p.L207I		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	207					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCCCGCTCTAGCAGAGAGGGC	0.662																																					p.L207I													.	.			0			c.C619A												28.0	34.0	32.0					19																	11361651		1952	4121	6073	SO:0001583	missense	57572	exon6			GCTCTAGCAGAGA		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.619C>A	19.37:g.11361651G>T	ENSP00000294618:p.Leu207Ile		75	0	0		37	0.08	3	NM_020812	17	0.00	0	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584162	0.46110	.	.	ENSG00000130158	ENST00000294618	T	0.22945	1.93	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000004	T	0.48768	0.1518	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.49072	-0.8977	10	0.54805	T	0.06	-16.2373	11.1378	0.48386	0.0913:0.0:0.9087:0.0	.	207	Q96HP0	DOCK6_HUMAN	I	207	ENSP00000294618:L207I	ENSP00000294618:L207I	L	-	1	2	DOCK6	11222651	1.000000	0.71417	0.997000	0.53966	0.039000	0.13416	4.202000	0.58446	2.250000	0.74265	0.462000	0.41574	CTA			0.662	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453155.1		NM_020812	
SLC27A1	376497	mdanderson.org	37	19	17597498	17597498	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:17597498C>T	ENST00000252595.7	+	2	391	c.294C>T	c.(292-294)gcC>gcT	p.A98A	SLC27A1_ENST00000598424.1_5'UTR|SLC27A1_ENST00000442725.1_Silent_p.A98A|CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	98					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						TGGTGGATGCCGGGACCGGCG	0.706																																					p.A98A													.	.			0			c.C294T												18.0	17.0	18.0					19																	17597498		2180	4259	6439	SO:0001819	synonymous_variant	376497	exon2			GGATGCCGGGACC	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.294C>T	19.37:g.17597498C>T			30	0	0		23	0.13	3	NM_198580	7	0.00	0	A6NIH2|B7Z662	Silent	SNP	ENST00000252595.7	37	CCDS32953.1																																																																																					0.706	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464145.1		NM_198580	
KIAA0355	9710	broad.mit.edu;bcgsc.ca	37	19	34818343	34818346	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	AGAA	AGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:34818343_34818346delAGAA	ENST00000299505.6	+	4	1596_1599	c.723_726delAGAA	c.(721-726)agagaafs	p.RE241fs		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	241										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CTAGACTAAGAGAAAGAGGCTGTG	0.397																																					p.241_242del													.	KIAA0355	105		0			c.723_726del																																									SO:0001589	frameshift_variant	9710	exon4			ACTAAGAGAAAGA		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.723_726delAGAA	19.37:g.34818343_34818346delAGAA	ENSP00000299505:p.Arg241fs		80	0	0		47	0.19	9	NM_014686	6	0.00	0	Q2M3W4	Frame_Shift_Del	DEL	ENST00000299505.6	37	CCDS12436.1																																																																																					0.397	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451678.4		NM_014686	
BCL3	602	mdanderson.org	37	19	45261637	45261637	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:45261637C>T	ENST00000164227.5	+	7	1270	c.1026C>T	c.(1024-1026)aaC>aaT	p.N342N		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	342					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				ACTGCCACAACGACACGCCGC	0.716			T	IGH@	CLL																																p.N342N				Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	.			0			c.C1026T												6.0	6.0	6.0					19																	45261637		2058	3991	6049	SO:0001819	synonymous_variant	602	exon7			CCACAACGACACG	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.1026C>T	19.37:g.45261637C>T			16	0	0		21	0.14	3	NM_005178	60	0.05	3		Silent	SNP	ENST00000164227.5	37	CCDS12642.2	.	.	.	.	.	.	.	.	.	.	C	11.26	1.586642	0.28268	.	.	ENSG00000069399	ENST00000444487	.	.	.	4.88	-1.47	0.08772	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.3985	9.2408	0.37495	0.0:0.4821:0.0:0.5179	.	.	.	.	X	226	.	.	R	+	1	2	BCL3	49953477	0.098000	0.21812	0.997000	0.53966	0.977000	0.68977	-0.846000	0.04336	-0.127000	0.11661	-0.424000	0.05967	CGA			0.716	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322976.1		NM_005178	
PNMAL2	57469	broad.mit.edu;mdanderson.org	37	19	46998785	46998785	+	5'Flank	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:46998785G>T	ENST00000377655.2	-	0	0				PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_De_novo_Start_InFrame|AC011484.1_ENST00000377652.3_3'UTR			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GTGGGCTGCAGCGCACGGTGT	0.652																																					.													.	PNMAL2	44		0			.																																									SO:0001631	upstream_gene_variant	57469	.			GCTGCAGCGCACG	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7			19.37:g.46998785G>T	Exception_encountered		73	0	0		73	0.05	4	.	1	0.00	0	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Translation_Start_Site	SNP	ENST00000377655.2	37																																																																																						0.652	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding				NM_020709	
PRKD2	25865	broad.mit.edu;mdanderson.org	37	19	47214195	47214195	+	Silent	SNP	G	G	A	rs143631618		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr19:47214195G>A	ENST00000291281.4	-	3	705	c.480C>T	c.(478-480)ttC>ttT	p.F160F	PRKD2_ENST00000600194.1_Silent_p.F3F|PRKD2_ENST00000601806.1_Silent_p.F3F|MIR320E_ENST00000390179.3_RNA|PRKD2_ENST00000433867.1_Silent_p.F160F|PRKD2_ENST00000595515.1_Silent_p.F160F			Q9BZL6	KPCD2_HUMAN	protein kinase D2	160					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GCACTAGGCCGAAGAGCATCT	0.682																																					p.F160F													.	PRKD2	94		0			c.C480T							G	,,,	0,4378		0,0,2189	26.0	22.0	23.0		480,480,9,480	-0.4	1.0	19	dbSNP_134	23	2,8568		0,2,4283	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PRKD2	NM_001079880.1,NM_001079881.1,NM_001079882.1,NM_016457.4	,,,	0,2,6472	AA,AG,GG		0.0233,0.0,0.0154	,,,	160/879,160/879,3/722,160/879	47214195	2,12946	2189	4285	6474	SO:0001819	synonymous_variant	25865	exon3			TAGGCCGAAGAGC	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.480C>T	19.37:g.47214195G>A			48	0	0		39	0.08	3	NM_016457	36	0.17	6	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000291281.4	37	CCDS12689.1																																																																																					0.682	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466591.1		NM_016457	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21230922	21230922	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:21230922C>T	ENST00000233242.1	-	26	8945	c.8818G>A	c.(8818-8820)Gga>Aga	p.G2940R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2940					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATGTGTTCCCTCATCTGAG	0.448																																					p.G2940R													.	.			0			c.G8818A												165.0	163.0	164.0					2																	21230922		2203	4300	6503	SO:0001583	missense	338	exon26			GTGTTCCCTCATC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8818G>A	2.37:g.21230922C>T	ENSP00000233242:p.Gly2940Arg		217	0	0		176	0.28	50	NM_000384	12	0.50	6	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455305	0.63401	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01287	5.05	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000017	T	0.09512	0.0234	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.00341	-1.1804	10	0.66056	D	0.02	.	19.919	0.97077	0.0:1.0:0.0:0.0	.	2940	P04114	APOB_HUMAN	R	2940	ENSP00000233242:G2940R	ENSP00000233242:G2940R	G	-	1	0	APOB	21084427	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.005000	0.70716	2.712000	0.92718	0.561000	0.74099	GGA			0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207571.1			
DNMT3A	1788	mdanderson.org	37	2	25462078	25462078	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:25462078G>T	ENST00000264709.3	-	20	2666	c.2329C>A	c.(2329-2331)Cct>Act	p.P777T	DNMT3A_ENST00000402667.1_Missense_Mutation_p.P554T|DNMT3A_ENST00000474887.1_5'UTR|DNMT3A_ENST00000321117.5_Missense_Mutation_p.P777T|DNMT3A_ENST00000380746.4_Missense_Mutation_p.P588T	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	777	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCATCACAGGGTTGGACTAC	0.547			"""Mis, F, N, S"""		AML																																p.P777T				Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	.			0			c.C2329A												59.0	54.0	56.0					2																	25462078		2203	4300	6503	SO:0001583	missense	1788	exon20			TCACAGGGTTGGA		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2329C>A	2.37:g.25462078G>T	ENSP00000264709:p.Pro777Thr		53	0	0		53	0.06	3	NM_175629	97	0.00	0	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029555	0.75504	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.88377	2.95	0.80722	D	1	D;P	0.67145	0.996;0.919	D;P	0.73708	0.981;0.701	D	0.99260	1.0890	10	0.87932	D	0	-4.0677	16.8043	0.85622	0.0:0.0:1.0:0.0	.	777;588	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	T	588;777;777;554	ENSP00000370122:P588T;ENSP00000324375:P777T;ENSP00000264709:P777T;ENSP00000384237:P554T	ENSP00000264709:P777T	P	-	1	0	DNMT3A	25315582	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	2.578000	0.87016	0.561000	0.74099	CCT			0.547	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000211587.1		NM_022552	
POLE4	56655	broad.mit.edu;bcgsc.ca	37	2	75185871	75185871	+	Missense_Mutation	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:75185871C>T	ENST00000483063.1	+	1	253	c.65C>T	c.(64-66)gCa>gTa	p.A22V	POLE4_ENST00000459636.1_3'UTR	NM_019896.2	NP_063949.2	Q9NR33	DPOE4_HUMAN	polymerase (DNA-directed), epsilon 4, accessory subunit	22					DNA-dependent DNA replication (GO:0006261)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|epsilon DNA polymerase complex (GO:0008622)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|sequence-specific DNA binding (GO:0043565)			lung(1)	1					Cladribine(DB00242)	GCTGGGGAGGCAGCGGCCTCG	0.736																																					p.A22V													.	POLE4	2		0			c.C65T												8.0	9.0	9.0					2																	75185871		1998	3854	5852	SO:0001583	missense	56655	exon1			GGGAGGCAGCGGC	AF261688	CCDS1957.1	2p12	2012-05-18	2012-05-18		ENSG00000115350	ENSG00000115350		"""DNA polymerases"""	18755	protein-coding gene	gene with protein product		607269	"""polymerase (DNA-directed), epsilon 4 (p12 subunit)"""			10801849	Standard	NM_019896		Approved	p12	uc002snf.3	Q9NR33	OTTHUMG00000129971	ENST00000483063.1:c.65C>T	2.37:g.75185871C>T	ENSP00000420176:p.Ala22Val		100	0.01	1		98	0.24	24	NM_019896	67	0.28	19	Q53TR2	Missense_Mutation	SNP	ENST00000483063.1	37	CCDS1957.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110180	0.56398	.	.	ENSG00000115350	ENST00000483063	T	0.34072	1.38	5.41	3.51	0.40186	Histone-fold (1);	0.218762	0.45867	D	0.000332	T	0.23171	0.0560	N	0.24115	0.695	0.35014	D	0.757145	B	0.25904	0.137	B	0.27170	0.077	T	0.25467	-1.0131	10	0.87932	D	0	0.1047	6.6311	0.22857	0.0:0.7231:0.1813:0.0956	.	22	Q9NR33	DPOE4_HUMAN	V	22	ENSP00000420176:A22V	ENSP00000420176:A22V	A	+	2	0	POLE4	75039379	0.899000	0.30636	0.956000	0.39512	0.657000	0.38888	0.734000	0.26101	1.285000	0.44548	0.591000	0.81541	GCA			0.736	POLE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252237.2		NM_019896	
RETSAT	54884	hgsc.bcm.edu	37	2	85571180	85571180	+	Missense_Mutation	SNP	G	G	A	rs149307146		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:85571180G>A	ENST00000295802.4	-	9	1587	c.1475C>T	c.(1474-1476)tCc>tTc	p.S492F	RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Missense_Mutation_p.S431F|RETSAT_ENST00000475624.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	492					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)	p.S492F(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	TTCCACAAAGGAGTTTTTGAA	0.537																																					p.S492F													RETSAT,NS,carcinoma,0,1	RETSAT	0	1	1	Substitution - Missense(1)	endometrium(1)	c.C1475T							G	PHE/SER	0,4406		0,0,2203	98.0	106.0	104.0		1475	5.1	0.4	2	dbSNP_134	104	4,8596	3.0+/-9.4	0,4,4296	yes	missense	RETSAT	NM_017750.3	155	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	492/611	85571180	4,13002	2203	4300	6503	SO:0001583	missense	54884	exon9			ACAAAGGAGTTTT	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1475C>T	2.37:g.85571180G>A	ENSP00000295802:p.Ser492Phe		171	0.0058479532	1		154	0.05	8	NM_017750	29	0.00	0	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.76|15.76	2.928287|2.928287	0.52759|0.52759	0.0|0.0	4.65E-4|4.65E-4	ENSG00000042445|ENSG00000042445	ENST00000449375|ENST00000295802;ENST00000457495	.|T;T	.|0.23552	.|1.9;1.9	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.852245	.|0.10867	.|N	.|0.625371	T|T	0.36303|0.36303	0.0962|0.0962	M|M	0.65975|0.65975	2.015|2.015	0.35609|0.35609	D|D	0.808519|0.808519	.|P;P;P	.|0.48089	.|0.905;0.905;0.748	.|P;P;B	.|0.46585	.|0.521;0.521;0.243	T|T	0.45760|0.45760	-0.9239|-0.9239	5|10	.|0.56958	.|D	.|0.05	-8.7214|-8.7214	12.225|12.225	0.54455|0.54455	0.0:0.1718:0.8282:0.0|0.0:0.1718:0.8282:0.0	.|.	.|431;431;492	.|G5E9N3;B4DKE1;Q6NUM9	.|.;.;RETST_HUMAN	S|F	281|492;431	.|ENSP00000295802:S492F;ENSP00000405040:S431F	.|ENSP00000295802:S492F	P|S	-|-	1|2	0|0	RETSAT|RETSAT	85424691|85424691	0.967000|0.967000	0.33354|0.33354	0.392000|0.392000	0.26245|0.26245	0.722000|0.722000	0.41435|0.41435	3.004000|3.004000	0.49513|0.49513	2.561000|2.561000	0.86390|0.86390	0.561000|0.561000	0.74099|0.74099	CCT|TCC	0		0.537	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252489.1		NM_017750	
MAP3K2	10746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128066276	128066276	+	Missense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:128066276G>A	ENST00000409947.1	-	16	1801	c.1519C>T	c.(1519-1521)Cgg>Tgg	p.R507W	MAP3K2_ENST00000344908.5_Missense_Mutation_p.R507W			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	507	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	GTCTGAAGCCGTTTGCTGGCC	0.458																																					p.R507W													.	.			0			c.C1519T												138.0	139.0	138.0					2																	128066276		1958	4160	6118	SO:0001583	missense	10746	exon15			GAAGCCGTTTGCT	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1519C>T	2.37:g.128066276G>A	ENSP00000387246:p.Arg507Trp		82	0	0		81	0.27	22	NM_006609	8	0.25	2	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	37	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661370	0.88154	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.66099	-0.19;-0.19	5.64	2.74	0.32292	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66446	0.2790	L	0.35593	1.075	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.65298	-0.6202	10	0.87932	D	0	.	9.3303	0.38018	0.0673:0.0:0.6737:0.259	.	507	Q9Y2U5	M3K2_HUMAN	W	507	ENSP00000387246:R507W;ENSP00000343463:R507W	ENSP00000343463:R507W	R	-	1	2	MAP3K2	127782746	1.000000	0.71417	0.772000	0.31596	0.995000	0.86356	7.855000	0.86950	0.270000	0.21984	0.561000	0.74099	CGG			0.458	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331014.1		NM_006609	
CYTIP	9595	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	158287440	158287440	+	Missense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:158287440G>A	ENST00000264192.3	-	4	435	c.314C>T	c.(313-315)tCg>tTg	p.S105L	CYTIP_ENST00000497432.1_5'UTR|CYTIP_ENST00000540637.1_5'UTR	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	105	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						GAACATTTCCGAGGAGCAGGC	0.383																																					p.S105L													.	CYTIP	45		0			c.C314T												48.0	50.0	50.0					2																	158287440		2203	4300	6503	SO:0001583	missense	9595	exon4			ATTTCCGAGGAGC	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.314C>T	2.37:g.158287440G>A	ENSP00000264192:p.Ser105Leu		187	0	0		166	0.04	6	NM_004288	32	0.00	0	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	G	7.256	0.604283	0.14002	.	.	ENSG00000115165	ENST00000264192;ENST00000439355	T;T	0.28069	2.3;1.63	6.17	-1.53	0.08611	PDZ/DHR/GLGF (4);	1.093640	0.06753	N	0.780343	T	0.12305	0.0299	N	0.04787	-0.16	0.09310	N	0.999993	B	0.10296	0.003	B	0.06405	0.002	T	0.25984	-1.0116	10	0.23891	T	0.37	2.1577	2.8555	0.05571	0.2092:0.3746:0.3055:0.1107	.	105	O60759	CYTIP_HUMAN	L	105;70	ENSP00000264192:S105L;ENSP00000402771:S70L	ENSP00000264192:S105L	S	-	2	0	CYTIP	157995686	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	0.026000	0.13599	-0.267000	0.09325	-0.176000	0.13171	TCG			0.383	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254926.1		NM_004288	
BAZ2B	29994	broad.mit.edu	37	2	160310243	160310243	+	Missense_Mutation	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:160310243A>G	ENST00000392783.2	-	4	710	c.215T>C	c.(214-216)gTc>gCc	p.V72A	BAZ2B_ENST00000355831.2_Missense_Mutation_p.V72A|BAZ2B_ENST00000343439.5_Missense_Mutation_p.V72A|BAZ2B_ENST00000392782.1_Missense_Mutation_p.V72A	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	72					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TGGGTGGCTGACCATTGGGAA	0.502																																					p.V72A													.	BAZ2B	196		0			c.T215C												84.0	81.0	82.0					2																	160310243		1919	4128	6047	SO:0001583	missense	29994	exon4			TGGCTGACCATTG	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.215T>C	2.37:g.160310243A>G	ENSP00000376534:p.Val72Ala		97	0.0412371134	4		113	0.04	4	NM_013450	4	0.00	0	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	A	19.66	3.868954	0.72065	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000437839	T;T;T;T;T	0.33216	2.66;2.66;2.66;2.66;1.42	5.46	5.46	0.80206	.	.	.	.	.	T	0.29556	0.0737	L	0.44542	1.39	0.33618	D	0.604479	P;B;B;P	0.37663	0.604;0.25;0.361;0.455	B;B;B;B	0.36134	0.218;0.075;0.131;0.062	T	0.49370	-0.8947	9	0.72032	D	0.01	-0.6902	14.5001	0.67716	1.0:0.0:0.0:0.0	.	72;72;72;72	Q6MZK7;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;BAZ2B_HUMAN	A	72	ENSP00000376533:V72A;ENSP00000376534:V72A;ENSP00000348087:V72A;ENSP00000339670:V72A;ENSP00000415613:V72A	ENSP00000339670:V72A	V	-	2	0	BAZ2B	160018489	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.256000	0.89848	2.066000	0.61787	0.533000	0.62120	GTC			0.502	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255037.2			
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170115533	170115533	+	Splice_Site	SNP	A	A	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr2:170115533A>C	ENST00000263816.3	-	17	2799		c.e17+1		LRP2_ENST00000443831.1_Splice_Site	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GAACACACTTACCCGGCAAAA	0.403																																					.													.	.			0			c.2513+2T>G												112.0	109.0	110.0					2																	170115533		2203	4300	6503	SO:0001630	splice_region_variant	4036	exon18			ACACTTACCCGGC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2513+1T>G	2.37:g.170115533A>C			186	0	0		222	0.30	67	NM_004525	0		0	O00711|Q16215	Splice_Site	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.363275	0.61513	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0958	0.81123	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP2	169823779	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	9.249000	0.95470	2.203000	0.70933	0.482000	0.46254	.			0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255231.2		NM_004525	Intron
BLCAP	10904	ucsc.edu	37	20	36147563	36147563	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr20:36147563T>C	ENST00000373537.2	-	2	328	c.14A>G	c.(13-15)cAg>cGg	p.Q5R	BLCAP_ENST00000414542.2_Missense_Mutation_p.Q5R|NNAT_ENST00000062104.2_5'Flank|BLCAP_ENST00000397131.1_Missense_Mutation_p.Q5R|NNAT_ENST00000346199.2_5'Flank|BLCAP_ENST00000397134.1_Missense_Mutation_p.Q5R|BLCAP_ENST00000397137.1_Missense_Mutation_p.Q5R|BLCAP_ENST00000397135.1_Missense_Mutation_p.Q5R	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	P62952	BLCAP_HUMAN	bladder cancer associated protein	5			Q -> R (in RNA edited version).		apoptotic nuclear changes (GO:0030262)|cell cycle (GO:0007049)	integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(2)|stomach(1)	5		Myeloproliferative disorder(115;0.00878)				CAGCAGCCACTGGAGGCAATA	0.652																																					p.Q5R													.	BLCAP	7		0			c.A14G												12.0	15.0	14.0					20																	36147563		2199	4296	6495	SO:0001583	missense	10904	exon2			AGCCACTGGAGGC	AF053470	CCDS13295.1	20q11.23	2006-01-29			ENSG00000166619	ENSG00000166619			1055	protein-coding gene	gene with protein product		613110				10197429	Standard	NM_006698		Approved	BC10	uc021wdf.1	P62952	OTTHUMG00000032419	ENST00000373537.2:c.14A>G	20.37:g.36147563T>C	ENSP00000362637:p.Gln5Arg		126	0	0		118	0.01	1	NM_006698	65	0.12	8	A2A2K7|O60629|Q9D3B5	Missense_Mutation	SNP	ENST00000373537.2	37	CCDS13295.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132039	0.77662	.	.	ENSG00000166619	ENST00000373537;ENST00000397137;ENST00000414542;ENST00000397135;ENST00000397134;ENST00000397131;ENST00000432507;ENST00000445723;ENST00000414080;ENST00000456058	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.77968	0.4210	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.80141	-0.1506	8	0.56958	D	0.05	-4.7884	12.8156	0.57663	0.0:0.0:0.0:1.0	.	5	P62952	BLCAP_HUMAN	R	5	.	ENSP00000362637:Q5R	Q	-	2	0	BLCAP	35580977	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.843000	0.86859	2.122000	0.65172	0.477000	0.44152	CAG			0.652	BLCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079113.2		NM_006698	
TIAM1	7074	broad.mit.edu	37	21	32508274	32508274	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr21:32508274T>C	ENST00000286827.3	-	24	4331	c.3860A>G	c.(3859-3861)aAg>aGg	p.K1287R	TIAM1_ENST00000541036.1_Missense_Mutation_p.K1227R	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1287	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTCTGGTTCCTTTTTCCACTT	0.483																																					p.K1287R													.	TIAM1	522		0			c.A3860G												108.0	103.0	105.0					21																	32508274		2203	4300	6503	SO:0001583	missense	7074	exon24			GGTTCCTTTTTCC		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3860A>G	21.37:g.32508274T>C	ENSP00000286827:p.Lys1287Arg		204	0	0		192	0.03	5	NM_003253	37	0.00	0	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.746979	0.49257	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.50001	0.76;0.78	5.49	5.49	0.81192	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.43787	0.1263	L	0.47016	1.485	0.80722	D	1	B;B;B	0.21905	0.062;0.037;0.037	B;B;B	0.16722	0.016;0.007;0.007	T	0.30909	-0.9962	10	0.45353	T	0.12	.	15.6133	0.76744	0.0:0.0:0.0:1.0	.	1227;1227;1287	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	R	1287;1227	ENSP00000286827:K1287R;ENSP00000441570:K1227R	ENSP00000286827:K1287R	K	-	2	0	TIAM1	31430145	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	6.214000	0.72200	2.076000	0.62316	0.533000	0.62120	AAG			0.483	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000192552.1		NM_003253	
GAB4	128954	bcgsc.ca;mdanderson.org	37	22	17473065	17473065	+	Splice_Site	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr22:17473065G>T	ENST00000400588.1	-	2	283	c.176C>A	c.(175-177)gCc>gAc	p.A59D	GAB4_ENST00000523144.1_5'UTR	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	59	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TTTCCTCCAGGCCTAAGGAAG	0.498																																					p.A59D													.	GAB4	95		0			c.C176A												95.0	100.0	98.0					22																	17473065		2167	4291	6458	SO:0001630	splice_region_variant	128954	exon2			CTCCAGGCCTAAG	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.175-1C>A	22.37:g.17473065G>T			114	0	0		97	0.05	5	NM_001037814	0		0		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475712	0.63737	.	.	ENSG00000215568	ENST00000400588	T	0.75367	-0.93	1.81	1.81	0.25067	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.352807	0.28453	N	0.015300	T	0.80793	0.4691	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80555	-0.1330	10	0.59425	D	0.04	.	9.5993	0.39593	0.0:0.0:1.0:0.0	.	59	Q2WGN9	GAB4_HUMAN	D	59	ENSP00000383431:A59D	ENSP00000383431:A59D	A	-	2	0	GAB4	15853065	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	8.691000	0.91279	1.301000	0.44836	0.591000	0.81541	GCC			0.498	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315426.1		XM_372882	Missense_Mutation
KIAA0930	23313	mdanderson.org	37	22	45596869	45596869	+	Intron	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr22:45596869G>T	ENST00000336156.5	-	8	918				KIAA0930_ENST00000251993.7_Intron|KIAA0930_ENST00000391627.2_Intron|MIR1249_ENST00000408671.1_RNA|KIAA0930_ENST00000443310.3_Intron|KIAA0930_ENST00000474515.1_Intron	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930											endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						gttccagccagagggaacTTG	0.607																																					.													.	.			0			.												51.0	53.0	52.0					22																	45596869		1568	3582	5150	SO:0001627	intron_variant	100302149	.			CAGCCAGAGGGAA	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.853-953C>A	22.37:g.45596869G>T			53	0	0		42	0.07	3	.	0		0	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	RNA	SNP	ENST00000336156.5	37	CCDS33665.1																																																																																					0.607	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321975.2		NM_001009880	
HDAC11	79885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	13545733	13545733	+	Silent	SNP	C	C	T	rs145222745		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:13545733C>T	ENST00000295757.3	+	9	972	c.789C>T	c.(787-789)ctC>ctT	p.L263L	HDAC11_ENST00000405025.1_Missense_Mutation_p.S103L|HDAC11_ENST00000433119.1_Missense_Mutation_p.S221L|HDAC11_ENST00000404040.1_Silent_p.L163L|HDAC11_ENST00000402259.1_Silent_p.L97L|HDAC11_ENST00000404548.1_Missense_Mutation_p.S131L|HDAC11_ENST00000437379.2_Silent_p.L235L|HDAC11_ENST00000446613.2_Silent_p.L71L|HDAC11_ENST00000402271.1_Silent_p.L184L|HDAC11_ENST00000522202.1_Silent_p.L212L	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	263	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						CCGACATCCTCGAGGGGGACC	0.602																																					p.L263L													.	.			0			c.C789T							C	,	1,4405	2.1+/-5.4	0,1,2202	60.0	56.0	57.0		636,789	-11.0	0.1	3	dbSNP_134	57	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	HDAC11	NM_001136041.2,NM_024827.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	212/297,263/348	13545733	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79885	exon9			CATCCTCGAGGGG	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.789C>T	3.37:g.13545733C>T			127	0	0		125	0.22	28	NM_024827	28	0.29	8	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Silent	SNP	ENST00000295757.3	37	CCDS2615.1	.	.	.	.	.	.	.	.	.	.	C	4.888	0.165121	0.09339	2.27E-4	0.0	ENSG00000163517	ENST00000433119;ENST00000404548;ENST00000405025	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.41743	0.1172	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40720	-0.9548	6	.	.	.	-0.0141	14.8264	0.70117	0.0:0.1011:0.5897:0.3092	.	221	Q658J9	.	L	221;131;103	.	.	S	+	2	0	HDAC11	13520733	0.014000	0.17966	0.107000	0.21349	0.959000	0.62525	-2.004000	0.01461	-3.686000	0.00121	-0.254000	0.11334	TCG	0		0.602	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252028.5		NM_024827	
TREX1	11277	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	48508314	48508314	+	Missense_Mutation	SNP	T	T	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:48508314T>C	ENST00000422277.2	+	1	1086	c.425T>C	c.(424-426)cTg>cCg	p.L142P	SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000436480.2_Missense_Mutation_p.L87P|TREX1_ENST00000492235.1_3'UTR|TREX1_ENST00000296443.9_Missense_Mutation_p.L87P|TREX1_ENST00000433541.1_5'UTR|TREX1_ENST00000444177.1_Missense_Mutation_p.L77P|TREX1_ENST00000456089.1_Intron	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	142					cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		ATCACAGGTCTGAGCACAGCT	0.637																																					p.L142P													TREX1,lower_third,carcinoma,-1,1	TREX1	-1	1	0			c.T425C												72.0	70.0	71.0					3																	48508314		2203	4300	6503	SO:0001583	missense	11277	exon1			CAGGTCTGAGCAC	AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.425T>C	3.37:g.48508314T>C	ENSP00000390478:p.Leu142Pro		43	0	0		61	0.11	7	NM_016381	62	0.05	3	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	37	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.958611	0.74016	.	.	ENSG00000213689	ENST00000296443;ENST00000436480;ENST00000422277;ENST00000444177	D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.000000	0.38492	U	0.001665	D	0.98118	0.9379	M	0.77712	2.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98936	1.0789	10	0.87932	D	0	.	12.6519	0.56766	0.0:0.0:0.0:1.0	.	142	Q9NSU2	TREX1_HUMAN	P	87;87;142;77	ENSP00000296443:L87P;ENSP00000392569:L87P;ENSP00000390478:L142P;ENSP00000415972:L77P	ENSP00000296443:L87P	L	+	2	0	TREX1	48483318	1.000000	0.71417	0.991000	0.47740	0.929000	0.56500	5.194000	0.65125	1.866000	0.54105	0.533000	0.62120	CTG			0.637	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_016381	
USP19	10869	mdanderson.org	37	3	49154692	49154692	+	Intron	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:49154692G>T	ENST00000398888.2	-	5	925				USP19_ENST00000488993.1_5'UTR|USP19_ENST00000417901.1_Silent_p.R237R|USP19_ENST00000434032.2_Silent_p.R237R|USP19_ENST00000398892.3_Silent_p.R174R|USP19_ENST00000398898.2_Silent_p.R174R|USP19_ENST00000398896.1_Intron|USP19_ENST00000453664.1_Silent_p.R227R	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCTTAGCCCGGTGGGGCTCA	0.716																																					p.R237R													.	.			0			c.C709A																																									SO:0001627	intron_variant	10869	exon6			TAGCCCGGTGGGG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.606+177C>A	3.37:g.49154692G>T			19	0	0		30	0.10	3	NM_001199160	43	0.00	0	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	ENST00000398888.2	37	CCDS43090.1																																																																																					0.716	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000257721.1		NM_006677	
CCDC54	84692	broad.mit.edu	37	3	107096725	107096725	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:107096725G>T	ENST00000261058.1	+	1	538	c.291G>T	c.(289-291)aaG>aaT	p.K97N		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	97										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						TCCAGGAAAAGACTGACTTGT	0.378																																					p.K97N													.	CCDC54	56		0			c.G291T												70.0	69.0	69.0					3																	107096725		2203	4300	6503	SO:0001583	missense	84692	exon1			GGAAAAGACTGAC	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.291G>T	3.37:g.107096725G>T	ENSP00000261058:p.Lys97Asn		116	0	0		145	0.03	4	NM_032600	0		0	Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	G	8.794	0.931355	0.18131	.	.	ENSG00000138483	ENST00000261058	T	0.65178	-0.14	5.08	-0.908	0.10517	.	0.239294	0.28859	N	0.013911	T	0.48466	0.1501	L	0.46157	1.445	0.09310	N	1	B	0.29646	0.253	B	0.34242	0.178	T	0.42015	-0.9476	10	0.54805	T	0.06	-0.1794	3.522	0.07745	0.4749:0.0:0.3435:0.1816	.	97	Q8NEL0	CCD54_HUMAN	N	97	ENSP00000261058:K97N	ENSP00000261058:K97N	K	+	3	2	CCDC54	108579415	0.012000	0.17670	0.003000	0.11579	0.013000	0.08279	0.068000	0.14531	-0.067000	0.12976	-0.225000	0.12378	AAG			0.378	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353651.1		NM_032600	
MGLL	11343	mdanderson.org	37	3	127440001	127440001	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:127440001G>A	ENST00000434178.2	-	5	1271	c.375C>T	c.(373-375)ggC>ggT	p.G125G	MGLL_ENST00000453507.2_Silent_p.G135G|MGLL_ENST00000398104.1_Silent_p.G125G|MGLL_ENST00000398101.3_Silent_p.G99G|MGLL_ENST00000265052.5_Silent_p.G135G			Q99685	MGLL_HUMAN	monoglyceride lipase	125					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						TGGCGATGGCGCCTCCCTGTA	0.542																																					p.G135G													.	.			0			c.C405T												39.0	43.0	42.0					3																	127440001		2032	4184	6216	SO:0001819	synonymous_variant	11343	exon5			GATGGCGCCTCCC	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.375C>T	3.37:g.127440001G>A			35	0	0		32	0.09	3	NM_001256585	22	0.00	0	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Silent	SNP	ENST00000434178.2	37	CCDS43148.1	.	.	.	.	.	.	.	.	.	.	G	0.508	-0.867866	0.02590	.	.	ENSG00000074416	ENST00000496306	.	.	.	5.35	-10.7	0.00240	.	.	.	.	.	T	0.41050	0.1142	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53301	-0.8458	4	.	.	.	-16.4568	4.731	0.12964	0.0903:0.1284:0.4135:0.3678	.	.	.	.	V	5	.	.	A	-	2	0	MGLL	128922691	0.000000	0.05858	0.021000	0.16686	0.062000	0.15995	-2.324000	0.01116	-3.669000	0.00123	-2.177000	0.00319	GCG			0.542	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356637.2		NM_007283	
EPHB1	2047	mdanderson.org	37	3	134960009	134960009	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr3:134960009G>T	ENST00000398015.3	+	13	2736	c.2366G>T	c.(2365-2367)aGa>aTa	p.R789I	EPHB1_ENST00000493838.1_Missense_Mutation_p.R350I	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	789	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ATCCCTGTGAGATGGACAGCT	0.507																																					p.R789I													.	.			0			c.G2366T												117.0	120.0	119.0					3																	134960009		2093	4247	6340	SO:0001583	missense	2047	exon13			CTGTGAGATGGAC	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2366G>T	3.37:g.134960009G>T	ENSP00000381097:p.Arg789Ile		92	0	0		79	0.06	5	NM_004441	8	0.00	0	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085508	0.94100	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	D;D	0.83673	-1.75;-1.75	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92003	0.5612	10	0.87932	D	0	.	18.2129	0.89876	0.0:0.0:1.0:0.0	.	789	P54762	EPHB1_HUMAN	I	789;350	ENSP00000381097:R789I;ENSP00000419574:R350I	ENSP00000381097:R789I	R	+	2	0	EPHB1	136442699	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.652000	0.98499	2.517000	0.84864	0.655000	0.94253	AGA			0.507	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357671.1		NM_004441	
TRMT44	152992	mdanderson.org	37	4	8470062	8470062	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr4:8470062G>T	ENST00000389737.4	+	9	1916	c.1916G>T	c.(1915-1917)tGg>tTg	p.W639L	TRMT44_ENST00000513449.2_Missense_Mutation_p.W398L	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	639					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										TTGAAGACCTGGAATGGGGGA	0.473																																					p.W639L													.	.			0			c.G1916T												58.0	66.0	63.0					4																	8470062		2203	4300	6503	SO:0001583	missense	152992	exon9			AGACCTGGAATGG	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1916G>T	4.37:g.8470062G>T	ENSP00000374387:p.Trp639Leu		44	0	0		40	0.08	3	NM_152544	16	0.00	0	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	37	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088389	0.55968	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.41758	0.99;1.65	4.05	4.05	0.47172	.	0.317533	0.33180	N	0.005193	T	0.64125	0.2570	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70178	-0.4943	10	0.87932	D	0	-26.1399	16.7967	0.85604	0.0:0.0:1.0:0.0	.	639;398	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	L	398;639;247	ENSP00000424643:W398L;ENSP00000374387:W639L	ENSP00000285635:W247L	W	+	2	0	METTL19	8520962	1.000000	0.71417	0.998000	0.56505	0.106000	0.19336	6.970000	0.76099	2.274000	0.75844	0.462000	0.41574	TGG			0.473	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000359197.2		NM_152544	
OTUD4	54726	hgsc.bcm.edu	37	4	146059041	146059041	+	Silent	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr4:146059041A>G	ENST00000447906.2	-	21	3073	c.2886T>C	c.(2884-2886)caT>caC	p.H962H	OTUD4_ENST00000454497.2_Silent_p.H897H|OTUD4_ENST00000455611.2_Intron			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	962					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GAGTGGGAGGATGAGCCTTTC	0.478																																					p.H897H													OTUD4,bladder,carcinoma,0,2	OTUD4	0	2	0			c.T2691C												118.0	118.0	118.0					4																	146059041		2203	4300	6503	SO:0001819	synonymous_variant	54726	exon21			GGGAGGATGAGCC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2886T>C	4.37:g.146059041A>G			111	0	0		106	0.06	6	NM_001102653	7	0.00	0	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37																																																																																						0.478	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365117.2		NM_017493	
SLC25A4	291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	186066080	186066080	+	Missense_Mutation	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr4:186066080A>G	ENST00000281456.6	+	2	406	c.274A>G	c.(274-276)Aag>Gag	p.K92E		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	92					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	CTTCGCCTTCAAGGACAAGTA	0.582																																					p.K92E													.	.			0			c.A274G												143.0	141.0	142.0					4																	186066080		2203	4300	6503	SO:0001583	missense	291	exon2			GCCTTCAAGGACA	BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.274A>G	4.37:g.186066080A>G	ENSP00000281456:p.Lys92Glu		157	0	0		71	0.21	15	NM_001151	39	0.21	8	D3DP59	Missense_Mutation	SNP	ENST00000281456.6	37	CCDS34114.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.877086	0.91664	.	.	ENSG00000151729	ENST00000281456	T	0.79247	-1.25	5.37	5.37	0.77165	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.92912	0.7745	H	0.99325	4.515	0.80722	D	1	D	0.69078	0.997	D	0.67548	0.952	D	0.95783	0.8818	10	0.87932	D	0	-4.0514	15.5421	0.76062	1.0:0.0:0.0:0.0	.	92	P12235	ADT1_HUMAN	E	92	ENSP00000281456:K92E	ENSP00000281456:K92E	K	+	1	0	SLC25A4	186303074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.254000	0.74563	0.460000	0.39030	AAG			0.582	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259170.3		NM_001151	
SLC6A18	348932	mdanderson.org	37	5	1246014	1246014	+	Missense_Mutation	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr5:1246014G>T	ENST00000324642.3	+	12	1831	c.1708G>T	c.(1708-1710)Gcc>Tcc	p.A570S		NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	570					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGCGCGCGCCGCCTGTGTGCT	0.721																																					p.A570S													.	.			0			c.G1708T												19.0	22.0	21.0					5																	1246014		2200	4297	6497	SO:0001583	missense	348932	exon12			CGCGCCGCCTGTG	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1708G>T	5.37:g.1246014G>T	ENSP00000323549:p.Ala570Ser		33	0	0		28	0.11	3	NM_182632	0		0		Missense_Mutation	SNP	ENST00000324642.3	37	CCDS3860.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.331952	0.41297	.	.	ENSG00000164363	ENST00000324642	T	0.74421	-0.84	4.6	-4.7	0.03288	.	1.175870	0.06460	N	0.729304	T	0.67767	0.2928	L	0.55990	1.75	0.09310	N	1	B	0.30104	0.268	B	0.29942	0.109	T	0.60687	-0.7214	10	0.87932	D	0	.	10.616	0.45451	0.4349:0.0:0.5651:0.0	.	570	Q96N87	S6A18_HUMAN	S	570	ENSP00000323549:A570S	ENSP00000323549:A570S	A	+	1	0	SLC6A18	1299014	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.528000	0.06193	-1.224000	0.02581	0.305000	0.20034	GCC			0.721	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206728.3		NM_182632	
PCDHB14	56122	mdanderson.org	37	5	140604725	140604725	+	Missense_Mutation	SNP	C	C	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr5:140604725C>G	ENST00000239449.4	+	1	1648	c.1648C>G	c.(1648-1650)Ctg>Gtg	p.L550V	PCDHB14_ENST00000515856.2_Missense_Mutation_p.L397V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCGCGTGCTGGTGCTGGA	0.716																																					p.L550V	Ovarian(141;50 1831 27899 33809 37648)												.	.			0			c.C1648G												33.0	36.0	35.0					5																	140604725		2202	4297	6499	SO:0001583	missense	56122	exon1			CGCGTGCTGGTGC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1648C>G	5.37:g.140604725C>G	ENSP00000239449:p.Leu550Val		44	0.0227272727	1		37	0.14	5	NM_018934	1	0.00	0	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	0.019	-1.449387	0.01080	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.01685	4.69;4.69	4.15	-1.52	0.08637	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.00695	0.0023	N	0.01267	-0.92	0.09310	N	1	B	0.13145	0.007	B	0.17979	0.02	T	0.47484	-0.9114	9	0.09084	T	0.74	.	7.1111	0.25390	0.1345:0.6339:0.1362:0.0954	.	550	Q9Y5E9	PCDBE_HUMAN	V	397;550	ENSP00000444518:L397V;ENSP00000239449:L550V	ENSP00000239449:L550V	L	+	1	2	PCDHB14	140584909	0.000000	0.05858	0.270000	0.24601	0.959000	0.62525	-3.811000	0.00360	-0.286000	0.09076	-0.321000	0.08615	CTG			0.716	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251814.2		NM_018934	
SAP30L	79685	mdanderson.org	37	5	153826274	153826274	+	Missense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr5:153826274G>A	ENST00000297109.6	+	1	758	c.110G>A	c.(109-111)cGc>cAc	p.R37H	SAP30L_ENST00000440364.2_Missense_Mutation_p.R37H|SAP30L_ENST00000426761.2_Missense_Mutation_p.R37H|SAP30L-AS1_ENST00000501280.3_RNA|SAP30L_ENST00000523198.1_3'UTR|SAP30L-AS1_ENST00000524264.1_RNA|SAP30L-AS1_ENST00000522312.1_RNA|SAP30L-AS1_ENST00000519727.1_RNA	NM_024632.5	NP_078908.1	Q9HAJ7	SP30L_HUMAN	SAP30-like	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GACGGCGAGCGCTGCGTCCGG	0.687																																					p.R37H													.	.			0			c.G110A												11.0	10.0	10.0					5																	153826274		2160	4243	6403	SO:0001583	missense	79685	exon1			GCGAGCGCTGCGT	AY341060	CCDS4326.1, CCDS47321.1, CCDS47322.1	5q33.2	2008-02-05			ENSG00000164576	ENSG00000164576			25663	protein-coding gene	gene with protein product		610398				14680513	Standard	NM_001131062		Approved	FLJ11526, NS4ATP2	uc003lvk.3	Q9HAJ7	OTTHUMG00000130146	ENST00000297109.6:c.110G>A	5.37:g.153826274G>A	ENSP00000297109:p.Arg37His		17	0	0		17	0.12	2	NM_024632	10	0.00	0	E9PAU7|E9PAY2	Missense_Mutation	SNP	ENST00000297109.6	37	CCDS4326.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849061	0.91277	.	.	ENSG00000164576	ENST00000297109;ENST00000440364;ENST00000426761	.	.	.	3.33	2.44	0.29823	.	0.000000	0.85682	D	0.000000	T	0.75649	0.3878	M	0.75615	2.305	0.80722	D	1	B;B;D	0.89917	0.009;0.009;1.0	B;B;D	0.87578	0.008;0.008;0.998	T	0.78907	-0.2019	9	0.87932	D	0	-14.626	11.3179	0.49403	0.0984:0.0:0.9016:0.0	.	37;37;37	E9PAY2;E9PAU7;Q9HAJ7	.;.;SP30L_HUMAN	H	37	.	ENSP00000297109:R37H	R	+	2	0	SAP30L	153806467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.652000	0.91083	1.871000	0.54225	0.491000	0.48974	CGC			0.687	SAP30L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252454.3		NM_024632	
LOC101929006	101929006	broad.mit.edu	37	6	29232126	29232126	+	lincRNA	DEL	A	A	-	rs199582604	byFrequency	TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr6:29232126delA	ENST00000441381.1	+	0	309																											ATACCAAGGCAAAAAAAAAAA	0.303													|||unknown(HR)	727	0.145168	0.2262	0.1599	5008	,	,		14001	0.1062		0.1153	False		,,,				2504	0.0961				.													.	.			0			.																																											0	.			CAAGGCAAAAAAA																													6.37:g.29232126delA			7	0	0		6	0.50	3	.	0		0		RNA	DEL	ENST00000441381.1	37																																																																																						0.303	XXbac-BPG308J9.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000192829.1			
DST	667	hgsc.bcm.edu	37	6	56504477	56504477	+	Intron	SNP	T	T	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr6:56504477T>A	ENST00000361203.3	-	16	2072				DST_ENST00000370788.2_Intron|DST_ENST00000370765.6_Intron|DST_ENST00000518935.1_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000446842.2_Intron			Q03001	DYST_HUMAN	dystonin						axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACAGAAGGTTTAAAAAAAAAA	0.328																																					.													.	.			0			.												105.0	121.0	116.0					6																	56504477		2199	4298	6497	SO:0001627	intron_variant	100873774	.			AAGGTTTAAAAAA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2064+16A>T	6.37:g.56504477T>A			158	0	0		149	0.03	5	.	0		0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	SNP	ENST00000361203.3	37																																																																																						0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000041021.3		NM_001723	
TULP4	56995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	158873228	158873228	+	Missense_Mutation	SNP	A	A	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr6:158873228A>G	ENST00000367097.3	+	5	2144	c.787A>G	c.(787-789)Acc>Gcc	p.T263A	TULP4_ENST00000367094.2_Missense_Mutation_p.T263A	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	263					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CGTCAGCTTCACCTCGGGAGA	0.537																																					p.T263A													.	.			0			c.A787G												184.0	145.0	158.0					6																	158873228		2203	4300	6503	SO:0001583	missense	56995	exon5			AGCTTCACCTCGG		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.787A>G	6.37:g.158873228A>G	ENSP00000356064:p.Thr263Ala		128	0	0		104	0.10	10	NM_020245	3	0.00	0	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.782867	0.49891	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.03094	4.05;4.05	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.051293	0.85682	D	0.000000	T	0.00608	0.0020	N	0.02011	-0.69	0.80722	D	1	B;B;B	0.33549	0.13;0.417;0.016	B;B;B	0.28011	0.024;0.085;0.018	T	0.51180	-0.8738	10	0.07813	T	0.8	-38.1146	16.0329	0.80593	1.0:0.0:0.0:0.0	.	263;263;263	B4E202;Q9NRJ4-2;Q9NRJ4	.;.;TULP4_HUMAN	A	263	ENSP00000356064:T263A;ENSP00000356061:T263A	ENSP00000356061:T263A	T	+	1	0	TULP4	158793216	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.131000	0.64751	2.197000	0.70478	0.533000	0.62120	ACC			0.537	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042869.1		NM_020245	
KCTD7	154881	mdanderson.org	37	7	66094066	66094066	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:66094066G>T	ENST00000275532.3	+	1	199	c.15G>T	c.(13-15)acG>acT	p.T5T	KCTD7_ENST00000443322.1_Silent_p.T5T	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	5					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						TGGTAGTCACGGGGCGGGAGC	0.736																																					p.T5T													.	.			0			c.G15T												13.0	14.0	14.0					7																	66094066		2157	4256	6413	SO:0001819	synonymous_variant	154881	exon1			AGTCACGGGGCGG	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.15G>T	7.37:g.66094066G>T			51	0	0		51	0.06	3	NM_001167961	0		0	A4D2M4|Q8IVR0	Silent	SNP	ENST00000275532.3	37	CCDS5534.1																																																																																					0.736	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251733.2		NM_153033	
PDK4	5166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	95225507	95225507	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:95225507G>A	ENST00000005178.5	-	1	296	c.99C>T	c.(97-99)tcC>tcT	p.S33S	AC002451.3_ENST00000416502.1_RNA|AC002451.3_ENST00000432265.1_RNA	NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	33					cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TGGACAGCGGGGACGGGCTGT	0.637																																					p.S33S													.	.			0			c.C99T												50.0	42.0	44.0					7																	95225507		2203	4300	6503	SO:0001819	synonymous_variant	5166	exon1			CAGCGGGGACGGG	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.99C>T	7.37:g.95225507G>A			175	0	0		165	0.12	20	NM_002612	2	0.00	0		Silent	SNP	ENST00000005178.5	37	CCDS5643.1																																																																																					0.637	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333298.1		NM_002612	
AP4M1	9179	broad.mit.edu	37	7	99699564	99699564	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:99699564G>A	ENST00000359593.4	+	2	278	c.120G>A	c.(118-120)ctG>ctA	p.L40L	AP4M1_ENST00000478501.1_3'UTR|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000421755.1_Silent_p.L40L|AP4M1_ENST00000429084.1_Silent_p.L40L|MCM7_ENST00000354230.3_5'Flank|MCM7_ENST00000303887.5_5'Flank|MCM7_ENST00000343023.6_5'Flank	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	40					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGACGGGACTGCCAGGAGACG	0.697																																					p.L40L	Pancreas(174;1182 2812 29595 49511)												.	AP4M1	39		0			c.G120A												29.0	34.0	32.0					7																	99699564		2203	4300	6503	SO:0001819	synonymous_variant	9179	exon2			GGGACTGCCAGGA	Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.120G>A	7.37:g.99699564G>A			288	0	0		259	0.02	6	NM_004722	42	0.00	0	D6W5U1|Q8WV65|Q9UHK9	Silent	SNP	ENST00000359593.4	37	CCDS5685.1																																																																																					0.697	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336772.4		NM_004722	
ZAN	7455	broad.mit.edu	37	7	100331551	100331552	+	RNA	INS	-	-	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:100331551_100331552insT	ENST00000348028.3	+	0	23				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			gtttctttctctttttttttct	0.347																																					.													.	ZAN	658		0			.																																											7455	.			CTTTCTCTTTTTT	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100331560_100331560dupT			16	0	0		9	0.33	3	.	0		0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	INS	ENST00000348028.3	37																																																																																						0.347	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
TRPV5	56302	mdanderson.org	37	7	142606735	142606735	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:142606735G>T	ENST00000265310.1	-	14	2164	c.1816C>A	c.(1816-1818)Cgg>Agg	p.R606R		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	606					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GGCAGCTTCCGCTCCAGCATC	0.607																																					p.R606R													TRPV5,NS,carcinoma,+1,1	TRPV5	1	1	0			c.C1816A												61.0	53.0	56.0					7																	142606735		2203	4300	6503	SO:0001819	synonymous_variant	56302	exon14			GCTTCCGCTCCAG	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1816C>A	7.37:g.142606735G>T			32	0	0		24	0.13	3	NM_019841	0		0	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	CCDS5875.1																																																																																					0.607	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347660.1		NM_019841	
REPIN1	29803	broad.mit.edu	37	7	150069590	150069590	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr7:150069590G>T	ENST00000425389.2	+	1	1338	c.1260G>T	c.(1258-1260)gcG>gcT	p.A420A	REPIN1_ENST00000540729.1_Silent_p.A420A|REPIN1_ENST00000397281.2_Silent_p.A420A|REPIN1_ENST00000489432.2_Silent_p.A477A|REPIN1_ENST00000444957.1_Silent_p.A420A|REPIN1_ENST00000479668.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	420					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			ACCTGGTGGCGCACTCGCGCG	0.731																																					p.A477A													.	REPIN1	74		0			c.G1431T												4.0	6.0	5.0					7																	150069590		1923	3986	5909	SO:0001819	synonymous_variant	29803	exon3			GGTGGCGCACTCG	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1260G>T	7.37:g.150069590G>T			16	0	0		6	0.33	2	NM_001099695	32	0.00	0	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Silent	SNP	ENST00000425389.2	37	CCDS43677.1																																																																																					0.731	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000376940.1		NM_014374	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	10468935	10468935	+	Silent	SNP	C	C	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr8:10468935C>A	ENST00000382483.3	-	4	2896	c.2673G>T	c.(2671-2673)ggG>ggT	p.G891G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	891					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCTGGCGTGTCCCCTCCTGCG	0.736																																					p.G891G													.	.			0			c.G2673T												5.0	7.0	6.0					8																	10468935		1814	4019	5833	SO:0001819	synonymous_variant	94137	exon4			GCGTGTCCCCTCC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2673G>T	8.37:g.10468935C>A			33	0	0		27	0.44	12	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																					0.736	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
TNFRSF10B	8795	mdanderson.org	37	8	22880439	22880439	+	Silent	SNP	C	C	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr8:22880439C>T	ENST00000276431.4	-	9	1352	c.1068G>A	c.(1066-1068)ccG>ccA	p.P356P	TNFRSF10B_ENST00000542226.1_Silent_p.P176P|TNFRSF10B_ENST00000347739.3_Silent_p.P327P	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	356	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		TCCTCATGAGCGGCTCCCAGG	0.547																																					p.P356P	GBM(94;1064 1342 1839 21060 42553)												.	.			0			c.G1068A												73.0	63.0	66.0					8																	22880439		2203	4300	6503	SO:0001819	synonymous_variant	8795	exon9			CATGAGCGGCTCC	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.1068G>A	8.37:g.22880439C>T			51	0	0		40	0.08	3	NM_003842	74	0.00	0	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Silent	SNP	ENST00000276431.4	37	CCDS6035.1																																																																																					0.547	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000215099.2		NM_147187	
ATAD2	29028	bcgsc.ca;mdanderson.org	37	8	124383532	124383532	+	Missense_Mutation	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr8:124383532G>A	ENST00000287394.5	-	5	690	c.583C>T	c.(583-585)Cgt>Tgt	p.R195C	ATAD2_ENST00000521903.1_5'UTR|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	195					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CGCTGTCTACGCATCTTCTTC	0.313																																					p.R195C													ATAD2,NS,carcinoma,+2,2	ATAD2	160	2	0			c.C583T												94.0	92.0	93.0					8																	124383532		2203	4298	6501	SO:0001583	missense	29028	exon5			GTCTACGCATCTT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.583C>T	8.37:g.124383532G>A	ENSP00000287394:p.Arg195Cys		264	0.0113636364	3		276	0.08	22	NM_014109	17	0.12	2	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984142	0.74474	.	.	ENSG00000156802	ENST00000287394	T	0.08102	3.13	5.06	4.16	0.48862	.	3.441010	0.01712	U	0.027766	T	0.33904	0.0879	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00003	-1.2586	10	0.87932	D	0	-11.072	13.9126	0.63876	0.0:0.0:0.8343:0.1657	.	25;195	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	C	195	ENSP00000287394:R195C	ENSP00000287394:R195C	R	-	1	0	ATAD2	124452713	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.008000	0.70739	1.057000	0.40506	0.555000	0.69702	CGT			0.313	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381766.2		NM_014109	
BAI1	575	mdanderson.org	37	8	143623718	143623718	+	Missense_Mutation	SNP	A	A	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr8:143623718A>C	ENST00000517894.1	+	28	5017	c.4123A>C	c.(4123-4125)Acc>Ccc	p.T1375P	BAI1_ENST00000323289.5_Missense_Mutation_p.T1375P			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1375	Necessary for interaction with MAGI1.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GATGCCGCAGACCCGCCTCAT	0.741																																					p.T1375P													.	.			0			c.A4123C												12.0	22.0	19.0					8																	143623718		2025	4153	6178	SO:0001583	missense	575	exon27			CCGCAGACCCGCC	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.4123A>C	8.37:g.143623718A>C	ENSP00000430945:p.Thr1375Pro		62	0.3064516129	19		35	0.40	14	NM_001702	8	0.50	4		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	A	18.68	3.675697	0.67928	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.29917	1.55;1.55	4.37	4.37	0.52481	.	0.067181	0.64402	U	0.000018	T	0.43233	0.1238	L	0.53249	1.67	0.41029	D	0.985148	D	0.64830	0.994	P	0.57911	0.829	T	0.28650	-1.0037	10	0.35671	T	0.21	.	12.7483	0.57293	1.0:0.0:0.0:0.0	.	1375	E9PBK0	.	P	1375	ENSP00000430945:T1375P;ENSP00000313046:T1375P	ENSP00000313046:T1375P	T	+	1	0	BAI1	143620720	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	2.321000	0.43805	1.598000	0.50083	0.533000	0.62120	ACC			0.741	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000379963.3		NM_001702	
KANK1	23189	broad.mit.edu	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000382293.3_Silent_p.E877E|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001				p.E1035E													KANK1_ENST00000382303,NS,carcinoma,0,4	KANK1	231	4	0			c.G3105A												153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	23189	exon10			AGAAGAGGAGGAG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A			90	0.0111111111	1		72	0.04	3	NM_001256876	16	0.00	0	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																					0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051484.2		NM_015158	
GSN	2934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	124094758	124094758	+	Silent	SNP	G	G	C			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:124094758G>C	ENST00000373818.4	+	17	2295	c.2226G>C	c.(2224-2226)acG>acC	p.T742T	GSN_ENST00000373823.3_Silent_p.T691T|GSN_ENST00000545652.1_Silent_p.T699T|GSN_ENST00000412819.1_Silent_p.T691T|GSN_ENST00000373806.1_Silent_p.T167T|GSN_ENST00000373808.2_Silent_p.T691T|GSN_ENST00000394353.2_Silent_p.T702T|GSN_ENST00000436847.1_Silent_p.T702T|GSN_ENST00000341272.2_Silent_p.T691T|GSN_ENST00000449733.1_Silent_p.T691T	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	742	Actin-binding, Ca-sensitive. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						ATCGGCGGACGCCCATCACCG	0.577											OREG0019445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T742T													.	.			0			c.G2226C												145.0	126.0	133.0					9																	124094758		2203	4300	6503	SO:0001819	synonymous_variant	2934	exon17			GCGGACGCCCATC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.2226G>C	9.37:g.124094758G>C			107	0	0	1531	103	0.18	19	NM_000177	980	0.16	153	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Silent	SNP	ENST00000373818.4	37	CCDS6828.1																																																																																					0.577	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053861.1		NM_000177	
OR1Q1	158131	broad.mit.edu	37	9	125376711	125376713	+	5'Flank	DEL	TAG	TAG	-	rs199841492|rs1928625	byFrequency	TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	TAG	TAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:125376711_125376713delTAG	ENST00000297913.2	+	0	0				RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1						detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						ataataataatagtagtagtagt	0.276																																					.													.	OR1Q1	46		0			.																																									SO:0001631	upstream_gene_variant	0	.			TAATAATAGTAGT		CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615		9.37:g.125376720_125376722delTAG	Exception_encountered		5	0	0		6	0.33	2	.	0		0	Q6IFN4|Q8NGR7|Q96R82	RNA	DEL	ENST00000297913.2	37	CCDS35125.1																																																																																					0.276	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053946.1			
OR1B1	347169	hgsc.bcm.edu	37	9	125391778	125391778	+	Missense_Mutation	SNP	C	C	A	rs77073101		TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:125391778C>A	ENST00000304833.3	-	1	74	c.37G>T	c.(37-39)Gtt>Ttt	p.V13F	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						AGCAAAAAAACCGGAGAGTGT	0.463																																					p.V13F													.	.			0			c.G37T												83.0	85.0	84.0					9																	125391778		2201	4296	6497	SO:0001583	missense	347169	exon1			AAAAAACCGGAGA	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.37G>T	9.37:g.125391778C>A	ENSP00000303151:p.Val13Phe		74	0	0		72	0.08	6	NM_001004450	0		0	Q6IFN3	Missense_Mutation	SNP	ENST00000304833.3	37	CCDS35126.1	.	.	.	.	.	.	.	.	.	.	C	10.05	1.244849	0.22796	.	.	ENSG00000171484	ENST00000304833	T	0.03004	4.08	4.22	2.26	0.28386	.	0.427504	0.17046	N	0.189112	T	0.03178	0.0093	L	0.27053	0.805	0.09310	N	1	B	0.24823	0.112	B	0.25140	0.058	T	0.40232	-0.9574	10	0.87932	D	0	-9.1841	7.1045	0.25356	0.1712:0.7326:0.0:0.0962	rs11421222;rs59467197	13	Q8NGR6	OR1B1_HUMAN	F	13	ENSP00000303151:V13F	ENSP00000303151:V13F	V	-	1	0	OR1B1	124431599	.	.	0.511000	0.27724	0.289000	0.27227	.	.	0.469000	0.27268	0.555000	0.69702	GTT			0.463	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053947.2		NM_001004450	
UCK1	83549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134404415	134404415	+	Silent	SNP	G	G	A			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:134404415G>A	ENST00000372215.4	-	5	612	c.519C>T	c.(517-519)gaC>gaT	p.D173D	UCK1_ENST00000372210.3_Silent_p.D164D|UCK1_ENST00000372208.3_Intron|UCK1_ENST00000372211.3_Silent_p.D178D|UCK1_ENST00000459858.1_5'UTR	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1	173					CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CTCGGCGCACGTCCCGGAGAA	0.687																																					p.D178D	Melanoma(42;523 1129 28385 43975 48113)												.	.			0			c.C534T												65.0	48.0	54.0					9																	134404415		2203	4300	6503	SO:0001819	synonymous_variant	83549	exon5			GCGCACGTCCCGG	AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.519C>T	9.37:g.134404415G>A			93	0	0		67	0.13	9	NM_001261451	61	0.20	12	Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	Silent	SNP	ENST00000372215.4	37	CCDS6944.1																																																																																					0.687	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054726.1		NM_031432	
BRD3	8019	mdanderson.org	37	9	136915676	136915676	+	Silent	SNP	G	G	T			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chr9:136915676G>T	ENST00000303407.7	-	5	719	c.534C>A	c.(532-534)tcC>tcA	p.S178S	BRD3_ENST00000357885.2_Silent_p.S178S|BRD3_ENST00000371834.2_Silent_p.S178S	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	178					chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		GGGTCGCTGGGGAGACAGAGG	0.597			T	C15orf55	lethal midline carcinoma of young people																																p.S178S				Dom	yes		9	9q34	8019	bromodomain containing 3		E	.	.			0			c.C534A												37.0	46.0	43.0					9																	136915676		2203	4300	6503	SO:0001819	synonymous_variant	8019	exon5			CGCTGGGGAGACA		CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.534C>A	9.37:g.136915676G>T			23	0	0		21	0.14	3	NM_007371	22	0.00	0	B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Silent	SNP	ENST00000303407.7	37	CCDS6980.1																																																																																					0.597	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055390.4		NM_007371	
ASB9	140462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	15276999	15277000	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	GG	GG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chrX:15276999_15277000GG>AT	ENST00000380488.4	-	2	435_436	c.162_163CC>AT	c.(160-165)aaCCtc>aaATtc	p.54_55NL>KF	ASB9_ENST00000380483.3_Missense_Mutation_p.54_55NL>KF|ASB9_ENST00000380485.3_Missense_Mutation_p.54_55NL>KF|ASB9_ENST00000473862.1_5'UTR|ASB9_ENST00000546332.1_Missense_Mutation_p.54_55NL>KF	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9	54					intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					TGGCTGATGAGGTTCCTCAGAG	0.381																																					p.NL54KF													.	.			0			c.C162A																																									SO:0001583	missense	140462	exon2			TGATGAGGTTCCT	AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.162_163delinsAT	X.37:g.15276999_15277000delinsAT	ENSP00000369855:p.N54_L55delinsKF		155	0	0		190	0.13	25	NM_001168530	6	0.00	0	A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	Missense_Mutation	DNP	ENST00000380488.4	37	CCDS35208.1																																																																																					0.381	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055844.1			
IL9R	3581	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	155239804	155239804	+	Missense_Mutation	SNP	C	C	G			TCGA-X3-A8G4-01A-11D-A435-10	TCGA-X3-A8G4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a9558e63-9b5c-4cd2-95a3-3a803277359f	e1afb0d5-ca80-4fdb-86c8-27443f74b3a6	g.chrX:155239804C>G	ENST00000244174.5	+	9	1475	c.1296C>G	c.(1294-1296)agC>agG	p.S432R	IL9R_ENST00000424344.3_Missense_Mutation_p.S411R|IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	432	Poly-Ser.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gcaggagcagcagcagcagca	0.627																																					p.S432R													.	.			0			c.C1296G												17.0	27.0	24.0					X																	155239804		2201	4295	6496	SO:0001583	missense	3581	exon9			GAGCAGCAGCAGC	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1296C>G	X.37:g.155239804C>G	ENSP00000244174:p.Ser432Arg		125	0	0		112	0.05	6	NM_002186	1	0.00	0	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	c	9.402	1.078258	0.20227	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10860	2.83;2.83	0.195	0.195	0.15151	.	3.852910	0.00870	N	0.002015	T	0.14356	0.0347	.	.	.	0.09310	N	1	P	0.42518	0.782	P	0.46110	0.504	T	0.20806	-1.0264	8	0.48119	T	0.1	-15.0951	.	.	.	.	432	Q01113	IL9R_HUMAN	R	432;411	ENSP00000244174:S432R;ENSP00000388918:S411R	ENSP00000244174:S432R	S	+	3	2	IL9R	154892998	0.001000	0.12720	0.005000	0.12908	0.005000	0.04900	-0.363000	0.07593	0.283000	0.22279	0.287000	0.19450	AGC			0.627	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058981.1		NM_002186	
