#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	mdanderson.org	37	1	1269365	1269365	+	Missense_Mutation	SNP	G	G	A	rs201157733		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr1:1269365G>A	ENST00000339381.5	+	6	2112	c.2080G>A	c.(2080-2082)Gca>Aca	p.A694T		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	694					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GGTGGAGGTCGCACTGTGCAC	0.697													g|||	1	0.000199681	0.0	0.0	5008	,	,		15716	0.001		0.0	False		,,,				2504	0.0				p.A694T													.	.			0			c.G2080A												32.0	30.0	31.0					1																	1269365		2198	4292	6490	SO:0001583	missense	83756	exon6			GAGGTCGCACTGT	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.2080G>A	1.37:g.1269365G>A	ENSP00000344411:p.Ala694Thr		18	0	0		17	0.12	2	NM_152228	3	0.00	0	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	8.491	0.862056	0.17178	.	.	ENSG00000169962	ENST00000339381	D	0.88201	-2.35	4.2	2.32	0.28847	GPCR, family 3, C-terminal (2);	10.619200	0.00669	N	0.000633	D	0.82440	0.5037	L	0.46157	1.445	0.18873	N	0.999988	P	0.39157	0.662	B	0.26202	0.067	T	0.70468	-0.4863	10	0.49607	T	0.09	.	2.8302	0.05497	0.1491:0.1468:0.5538:0.1503	.	694	Q7RTX0	TS1R3_HUMAN	T	694	ENSP00000344411:A694T	ENSP00000344411:A694T	A	+	1	0	TAS1R3	1259228	0.108000	0.22018	0.053000	0.19242	0.285000	0.27093	1.164000	0.31810	0.441000	0.26529	0.456000	0.33151	GCA	0.001		0.697	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
EIF2B3	8891	broad.mit.edu;mdanderson.org	37	1	45341312	45341312	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr1:45341312G>T	ENST00000360403.2	-	9	1157	c.1031C>A	c.(1030-1032)gCc>gAc	p.A344D	EIF2B3_ENST00000372183.3_Missense_Mutation_p.A344D	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	344					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					GACAATCTGGGCTGACGAATG	0.483																																					p.A344D	Colon(26;357 658 2581 11857 12657)												.	EIF2B3	43		0			c.C1031A												156.0	137.0	144.0					1																	45341312		2203	4300	6503	SO:0001583	missense	8891	exon9			ATCTGGGCTGACG	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.1031C>A	1.37:g.45341312G>T	ENSP00000353575:p.Ala344Asp		89	0	0		91	0.05	5	NM_020365	262	0.00	1	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	CCDS517.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.061923|4.061923	0.76187|0.76187	.|.	.|.	ENSG00000070785|ENSG00000070785	ENST00000360403;ENST00000372183|ENST00000439363	T;D|.	0.90504|.	0.59;-2.68|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.047903|.	0.85682|.	D|.	0.000000|.	D|D	0.83524|0.83524	0.5273|0.5273	M|M	0.86502|0.86502	2.82|2.82	0.80722|0.80722	D|D	1|1	P;D|.	0.63046|.	0.811;0.992|.	P;D|.	0.66351|.	0.749;0.943|.	D|D	0.85403|0.85403	0.1132|0.1132	10|5	0.44086|.	T|.	0.13|.	-1.7926|-1.7926	18.7825|18.7825	0.91939|0.91939	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	344;344|.	Q9NR50-2;Q9NR50|.	.;EI2BG_HUMAN|.	D|T	344|165	ENSP00000353575:A344D;ENSP00000361257:A344D|.	ENSP00000353575:A344D|.	A|P	-|-	2|1	0|0	EIF2B3|EIF2B3	45113899|45113899	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.840000|0.840000	0.47671|0.47671	7.310000|7.310000	0.78947|0.78947	2.528000|2.528000	0.85240|0.85240	0.655000|0.655000	0.94253|0.94253	GCC|CCC			0.483	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000023724.1		NM_020365	
PKP1	5317	bcgsc.ca	37	1	201291157	201291157	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr1:201291157G>T	ENST00000352845.3	+	9	1462	c.1462G>T	c.(1462-1464)Gcc>Tcc	p.A488S	PKP1_ENST00000263946.3_Missense_Mutation_p.A488S|PKP1_ENST00000367324.3_Missense_Mutation_p.A467S			Q13835	PKP1_HUMAN	plakophilin 1	488					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CCGCCTGGACGCCGAGGTGCC	0.617																																					p.A488S													.	PKP1	127		0			c.G1462T												122.0	97.0	105.0					1																	201291157		2203	4300	6503	SO:0001583	missense	5317	exon9			CTGGACGCCGAGG	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1462G>T	1.37:g.201291157G>T	ENSP00000295597:p.Ala488Ser		88	0.0113636364	1		56	0.07	4	NM_000299	0		0	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096990	0.76870	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.76578	-1.03;-1.03;-1.03	5.12	4.21	0.49690	Armadillo-like helical (1);Armadillo-type fold (1);	0.322569	0.32533	N	0.005971	T	0.70527	0.3234	L	0.40543	1.245	0.42641	D	0.993411	P;P;P	0.47841	0.593;0.901;0.87	B;P;B	0.46510	0.237;0.519;0.418	T	0.65915	-0.6052	10	0.11182	T	0.66	0.4573	11.6185	0.51104	0.0835:0.0:0.9165:0.0	.	75;467;488	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	S	467;488;488	ENSP00000356293:A467S;ENSP00000263946:A488S;ENSP00000295597:A488S	ENSP00000263946:A488S	A	+	1	0	PKP1	199557780	0.697000	0.27767	0.661000	0.29709	0.874000	0.50279	1.454000	0.35178	1.173000	0.42796	0.650000	0.86243	GCC			0.617	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000086897.1		NM_000299	
OR14K1	343170	broad.mit.edu	37	1	247902370	247902370	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr1:247902370G>T	ENST00000283225.2	+	1	454	c.454G>T	c.(454-456)Gcc>Tcc	p.A152S	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						CAACAGAGGGGCCTTGGGACT	0.527																																					.													.	.			0			.												90.0	94.0	93.0					1																	247902370		2120	4239	6359	SO:0001583	missense	343170	.			AGAGGGGCCTTGG	BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.454G>T	1.37:g.247902370G>T	ENSP00000283225:p.Ala152Ser		150	0	0		129	0.04	5	.	0		0	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	ENST00000283225.2	37		.	.	.	.	.	.	.	.	.	.	G	10.90	1.480199	0.26598	.	.	ENSG00000153230	ENST00000283225	T	0.00107	8.72	3.81	-3.26	0.05064	.	0.971136	0.08316	U	0.964600	T	0.00109	0.0003	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.06661	-1.0814	7	0.59425	D	0.04	.	3.1117	0.06361	0.0873:0.3504:0.2119:0.3505	.	.	.	.	S	152	ENSP00000283225:A152S	ENSP00000283225:A152S	A	+	1	0	OR14K1	245968993	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.156000	0.10100	-0.426000	0.07360	-0.324000	0.08512	GCC			0.527	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000096868.1		NM_001004732	
SKIDA1	387640	broad.mit.edu	37	10	21805483	21805483	+	Silent	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr10:21805483C>T	ENST00000449193.2	-	4	3521	c.1269G>A	c.(1267-1269)gaG>gaA	p.E423E	SKIDA1_ENST00000444772.3_Silent_p.E344E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	342						nucleus (GO:0005634)											cctcctcttcctcctcctcct	0.627																																					p.E423E													.	.			0			c.G1269A												5.0	6.0	6.0					10																	21805483		2007	4123	6130	SO:0001819	synonymous_variant	387640	exon4			CTCTTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1269G>A	10.37:g.21805483C>T			56	0	0		49	0.08	4	NM_207371	0		0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																					0.627	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
RET	5979	mdanderson.org	37	10	43596103	43596103	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr10:43596103G>T	ENST00000355710.3	+	2	502	c.270G>T	c.(268-270)gaG>gaT	p.E90D	RET_ENST00000340058.5_Missense_Mutation_p.E90D	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	90					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GCATCCAGGAGGACACCGGCC	0.647		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.E90D	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	.			0			c.G270T												53.0	43.0	46.0					10																	43596103		2203	4300	6503	SO:0001583	missense	5979	exon2	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	CCAGGAGGACACC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.270G>T	10.37:g.43596103G>T	ENSP00000347942:p.Glu90Asp		51	0	0		45	0.07	3	NM_020975	23	0.00	0	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918539	0.52546	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.80393	-1.25;-1.37	5.51	3.42	0.39159	.	0.302273	0.35838	N	0.002952	T	0.75729	0.3889	M	0.68952	2.095	0.40170	D	0.97716	B;B	0.25850	0.098;0.136	B;B	0.20184	0.026;0.028	T	0.75022	-0.3464	10	0.51188	T	0.08	.	9.4049	0.38455	0.2557:0.0:0.7443:0.0	.	90;90	P07949;P07949-2	RET_HUMAN;.	D	90	ENSP00000347942:E90D;ENSP00000344798:E90D	ENSP00000344798:E90D	E	+	3	2	RET	42916109	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.322000	0.33689	1.340000	0.45581	0.655000	0.94253	GAG			0.647	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047694.2		NM_020975	
RP11-464F9.1	0	broad.mit.edu	37	10	75476823	75476824	+	RNA	INS	-	-	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr10:75476823_75476824insA	ENST00000399449.3	-	0	1252				RP11-574K11.28_ENST00000580790.1_RNA|BMS1P4_ENST00000584747.1_RNA																							ACTTGGGTAAGAAAAAAAAAAT	0.332																																					.													.	.			0			.																																											0	.			GGGTAAGAAAAAA																													10.37:g.75476833_75476833dupA			6	0	0		5	0.20	1	.	7	0.00	0		RNA	INS	ENST00000399449.3	37																																																																																						0.332	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000048674.2			
SORCS1	114815	mdanderson.org	37	10	108469042	108469042	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr10:108469042G>T	ENST00000263054.6	-	7	1089	c.1082C>A	c.(1081-1083)cCt>cAt	p.P361H	SORCS1_ENST00000344440.6_Missense_Mutation_p.P361H	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	361					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCCTGGAAAAGGCTGATTCCT	0.403																																					p.P361H													.	.			0			c.C1082A												126.0	117.0	120.0					10																	108469042		2203	4300	6503	SO:0001583	missense	114815	exon7			GGAAAAGGCTGAT	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1082C>A	10.37:g.108469042G>T	ENSP00000263054:p.Pro361His		66	0	0		53	0.06	3	NM_001206572	0		0	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548698	0.86127	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.36520	1.25;1.25	5.71	5.71	0.89125	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.77820	2.39	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.993;0.998;0.998;0.993;0.998	T	0.62882	-0.6760	9	.	.	.	-14.8856	19.8673	0.96808	0.0:0.0:1.0:0.0	.	361;361;361;361;361	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	H	361	ENSP00000263054:P361H;ENSP00000345964:P361H	.	P	-	2	0	SORCS1	108459032	1.000000	0.71417	0.995000	0.50966	0.855000	0.48748	6.298000	0.72763	2.709000	0.92574	0.655000	0.94253	CCT			0.403	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050232.4		NM_052918	
MUC6	4588	bcgsc.ca	37	11	1017280	1017280	+	Missense_Mutation	SNP	G	G	T	rs199539548		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:1017280G>T	ENST00000421673.2	-	31	5571	c.5521C>A	c.(5521-5523)Cca>Aca	p.P1841T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1841	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAGAAAGATGGAACGTGAGTG	0.537																																					p.P1841T													.	MUC6	408		0			c.C5521A												652.0	616.0	628.0					11																	1017280		2199	4282	6481	SO:0001583	missense	4588	exon31			AAGATGGAACGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5521C>A	11.37:g.1017280G>T	ENSP00000406861:p.Pro1841Thr		236	0.0169491525	4		200	0.09	17	NM_005961	0		0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	7.317	0.616153	0.14129	.	.	ENSG00000184956	ENST00000421673	T	0.57595	0.39	3.21	-3.93	0.04143	.	.	.	.	.	T	0.56963	0.2021	M	0.68317	2.08	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50092	-0.8868	9	0.16420	T	0.52	.	1.0186	0.01513	0.1779:0.254:0.3105:0.2576	.	1841	Q6W4X9	MUC6_HUMAN	T	1841	ENSP00000406861:P1841T	ENSP00000406861:P1841T	P	-	1	0	MUC6	1007280	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.710000	0.05024	-1.011000	0.03391	0.313000	0.20887	CCA			0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
MUC2	4583	hgsc.bcm.edu	37	11	1092602	1092619	+	In_Frame_Del	DEL	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC	-	rs201595190|rs201608750|rs547682241	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:1092602_1092619delCCACCACTCCCAGCCCTC	ENST00000441003.2	+	30	4448_4465	c.4421_4438delCCACCACTCCCAGCCCTC	c.(4420-4440)accaccactcccagccctcca>aca	p.TTPSPP1475del	MUC2_ENST00000359061.5_In_Frame_Del_p.TTPSPP1476del|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4210	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	agccctccaaccaccactcccagccctccaaccaccac	0.628																																					p.1474_1479del													.	MUC2	614		0			c.4420_4437del									764,1992		44,676,658						-2.6	0.0		dbSNP_134	244	1546,3660		46,1454,1103	no	coding	MUC2	NM_002457.2		90,2130,1761	A1A1,A1R,RR		29.6965,27.7213,29.0128				2310,5652				SO:0001651	inframe_deletion	4583	exon30			CTCCAACCACCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4421_4438delCCACCACTCCCAGCCCTC	11.37:g.1092602_1092619delCCACCACTCCCAGCCCTC	ENSP00000415183:p.Thr1475_Pro1480del		126	0	0		98	0.00	0	NM_002457	0		0	Q14878	In_Frame_Del	DEL	ENST00000441003.2	37																																																																																						0.628	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
LSP1	4046	mdanderson.org	37	11	1901421	1901421	+	Missense_Mutation	SNP	G	G	A	rs558867326		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:1901421G>A	ENST00000311604.3	+	2	333	c.158G>A	c.(157-159)gGc>gAc	p.G53D	LSP1_ENST00000406638.2_5'UTR|LSP1_ENST00000381775.1_Missense_Mutation_p.G181D|LSP1_ENST00000405957.2_5'UTR	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	53					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		GAGGGAGGCGGCCATGTCCCC	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17691	0.0		0.0	False		,,,				2504	0.001				p.G181D													.	.			0			c.G542A												72.0	57.0	62.0					11																	1901421		2201	4299	6500	SO:0001583	missense	4046	exon3			GAGGCGGCCATGT	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.158G>A	11.37:g.1901421G>A	ENSP00000308383:p.Gly53Asp		52	0	0		43	0.07	3	NM_001242932	594	0.00	0	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	37	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	.	11.86	1.763549	0.31228	.	.	ENSG00000130592	ENST00000311604;ENST00000381775;ENST00000457279;ENST00000429923;ENST00000418975	T;T;T;T;T	0.50813	1.93;1.86;1.93;1.28;0.73	3.75	2.79	0.32731	.	0.212335	0.22290	U	0.062013	T	0.33177	0.0854	L	0.44542	1.39	0.28790	N	0.899372	B;B	0.21225	0.053;0.002	B;B	0.14023	0.01;0.003	T	0.16600	-1.0397	10	0.19147	T	0.46	-0.3837	6.5185	0.22262	0.146:0.0:0.854:0.0	.	181;53	E9PFP3;P33241	.;LSP1_HUMAN	D	53;181;44;36;71	ENSP00000308383:G53D;ENSP00000371194:G181D;ENSP00000400346:G44D;ENSP00000400999:G36D;ENSP00000403460:G71D	ENSP00000308383:G53D	G	+	2	0	LSP1	1857997	0.001000	0.12720	0.032000	0.17829	0.003000	0.03518	0.270000	0.18607	0.867000	0.35654	0.491000	0.48974	GGC			0.662	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000034045.3		NM_002339	
TAF6L	10629	mdanderson.org	37	11	62545499	62545499	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:62545499G>T	ENST00000294168.3	+	4	485	c.284G>T	c.(283-285)aGg>aTg	p.R95M	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	95					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						CGCCCCGCCAGGGAGGGTGAA	0.592																																					p.R95M													.	.			0			c.G284T												87.0	79.0	82.0					11																	62545499		2201	4299	6500	SO:0001583	missense	10629	exon4			CCGCCAGGGAGGG	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.284G>T	11.37:g.62545499G>T	ENSP00000294168:p.Arg95Met		74	0	0		43	0.07	3	NM_006473	15	0.00	0	B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	CCDS8035.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066028	0.55539	.	.	ENSG00000162227	ENST00000294168;ENST00000529509	T;T	0.44482	0.92;0.93	5.78	4.87	0.63330	.	0.059637	0.64402	D	0.000003	T	0.19208	0.0461	N	0.08118	0	0.80722	D	1	P;B	0.36495	0.556;0.371	B;B	0.31016	0.123;0.061	T	0.04029	-1.0983	10	0.40728	T	0.16	-0.105	7.8759	0.29592	0.1698:0.0:0.8302:0.0	.	95;95	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	M	95	ENSP00000294168:R95M;ENSP00000434662:R95M	ENSP00000294168:R95M	R	+	2	0	TAF6L	62302075	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.876000	0.56115	2.740000	0.93945	0.455000	0.32223	AGG			0.592	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395352.1		NM_006473	
SNX32	254122	mdanderson.org	37	11	65620365	65620365	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:65620365G>A	ENST00000308342.6	+	12	1519	c.1094G>A	c.(1093-1095)cGc>cAc	p.R365H		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	365					intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		TTCAAGTCCCGCCGGGTCTCC	0.642																																					p.R365H													.	.			0			c.G1094A												84.0	90.0	88.0					11																	65620365		2201	4297	6498	SO:0001583	missense	254122	exon12			AGTCCCGCCGGGT	AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.1094G>A	11.37:g.65620365G>A	ENSP00000310620:p.Arg365His		92	0	0		52	0.06	3	NM_152760	0		0	Q8IW53|Q96NG4	Missense_Mutation	SNP	ENST00000308342.6	37	CCDS8113.2	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995804	0.54147	.	.	ENSG00000172803	ENST00000308342	T	0.19250	2.16	4.19	2.26	0.28386	.	0.678099	0.12942	N	0.426533	T	0.24928	0.0605	M	0.78049	2.395	0.33195	D	0.551402	B	0.15141	0.012	B	0.13407	0.009	T	0.19386	-1.0307	10	0.72032	D	0.01	-7.3309	6.7482	0.23472	0.0971:0.0:0.728:0.1749	.	365	Q86XE0	SNX32_HUMAN	H	365	ENSP00000310620:R365H	ENSP00000310620:R365H	R	+	2	0	SNX32	65376941	0.107000	0.21998	0.175000	0.22980	0.993000	0.82548	2.243000	0.43115	0.396000	0.25283	0.561000	0.74099	CGC			0.642	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250295.3		NM_152760	
BRMS1	25855	mdanderson.org	37	11	66108711	66108711	+	Silent	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:66108711C>T	ENST00000359957.3	-	4	484	c.324G>A	c.(322-324)ctG>ctA	p.L108L	RP11-867G23.12_ENST00000526655.1_RNA|BRMS1_ENST00000425825.2_Silent_p.L108L	NM_015399.3	NP_056214.1	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1	108					apoptotic process (GO:0006915)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of anoikis (GO:2000210)|positive regulation of protein deacetylation (GO:0090312)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)			large_intestine(1)|liver(1)|lung(1)|prostate(1)|skin(1)	5						GGCTCCGCTGCAGCCCCCCAA	0.627																																					p.L108L	GBM(7;55 307 2662 20856 28942)												.	.			0			c.G324A												38.0	42.0	41.0					11																	66108711		2200	4295	6495	SO:0001819	synonymous_variant	25855	exon4			CCGCTGCAGCCCC	AF147350	CCDS8135.1, CCDS44654.1	11q13-q13.2	2008-02-05				ENSG00000174744			17262	protein-coding gene	gene with protein product		606259				10850410	Standard	XM_005273883		Approved	DKFZP564A063	uc001oho.1	Q9HCU9		ENST00000359957.3:c.324G>A	11.37:g.66108711C>T			56	0	0		33	0.09	3	NM_015399	100	0.00	0	Q6IAI2	Silent	SNP	ENST00000359957.3	37	CCDS8135.1	.	.	.	.	.	.	.	.	.	.	C	8.370	0.835197	0.16820	.	.	ENSG00000174744	ENST00000524699	.	.	.	4.17	2.25	0.28309	.	.	.	.	.	T	0.57489	0.2057	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50825	-0.8782	4	.	.	.	-17.3769	8.6877	0.34247	0.0:0.8042:0.0:0.1958	.	.	.	.	T	71	.	.	A	-	1	0	BRMS1	65865287	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	0.835000	0.27531	0.506000	0.28125	-0.251000	0.11542	GCA			0.627	BRMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392958.2		NM_015399	
PPP6R3	55291	mdanderson.org	37	11	68331885	68331885	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:68331885G>T	ENST00000393800.2	+	9	1214	c.960G>T	c.(958-960)ctG>ctT	p.L320L	PPP6R3_ENST00000529710.1_Silent_p.L320L|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000524845.1_Silent_p.L320L|PPP6R3_ENST00000265637.4_Silent_p.L320L|PPP6R3_ENST00000265636.5_Silent_p.L320L|PPP6R3_ENST00000393799.2_Silent_p.L320L|PPP6R3_ENST00000393801.3_Silent_p.L320L|PPP6R3_ENST00000527403.2_Silent_p.L320L|PPP6R3_ENST00000524904.1_Silent_p.L320L	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	320					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ATGAACTCCTGCTGGAGCCAC	0.493																																					p.L320L													.	.			0			c.G960T												105.0	104.0	104.0					11																	68331885		2200	4294	6494	SO:0001819	synonymous_variant	55291	exon9			ACTCCTGCTGGAG	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.960G>T	11.37:g.68331885G>T			68	0	0		40	0.08	3	NM_001164161	42	0.00	0	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	ENST00000393800.2	37	CCDS53672.1																																																																																					0.493	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395275.1		NM_018312	
C11orf54	28970	bcgsc.ca	37	11	93492996	93492996	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:93492996G>T	ENST00000331239.4	+	8	925	c.746G>T	c.(745-747)tGt>tTt	p.C249F	C11orf54_ENST00000528099.1_Missense_Mutation_p.C249F|C11orf54_ENST00000528288.1_Missense_Mutation_p.C199F|C11orf54_ENST00000354421.3_Missense_Mutation_p.C249F|C11orf54_ENST00000540113.1_Missense_Mutation_p.C230F			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	249					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCTTTGGTTTGTCTACCAGTT	0.343																																					p.C199F													.	C11orf54	23		0			c.G596T												143.0	149.0	147.0					11																	93492996		2201	4298	6499	SO:0001583	missense	28970	exon7			TGGTTTGTCTACC	AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.746G>T	11.37:g.93492996G>T	ENSP00000331209:p.Cys249Phe		65	0	0		45	0.09	4	NM_014039	17	0.00	0	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Missense_Mutation	SNP	ENST00000331239.4	37		.	.	.	.	.	.	.	.	.	.	G	19.27	3.795464	0.70452	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000524485;ENST00000533154	.	.	.	5.64	5.64	0.86602	Domain of unknown function DUF1907 (1);	0.045054	0.85682	D	0.000000	T	0.71888	0.3393	.	.	.	0.80722	D	1	P;B;P	0.49961	0.93;0.193;0.93	P;B;P	0.50231	0.635;0.168;0.635	T	0.73729	-0.3891	8	0.56958	D	0.05	-13.2992	19.7643	0.96334	0.0:0.0:1.0:0.0	.	249;199;249	Q9H0W9;Q9H0W9-3;A8K718	CK054_HUMAN;.;.	F	199;249;249;249;230;230;230;138	.	ENSP00000331209:C249F	C	+	2	0	C11orf54	93132644	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.181000	0.77682	2.660000	0.90430	0.644000	0.83932	TGT			0.343	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394671.1		NM_014039	
THY1	7070	mdanderson.org	37	11	119291054	119291054	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr11:119291054G>T	ENST00000284240.5	-	3	1119	c.80C>A	c.(79-81)gCc>gAc	p.A27D	USP2-AS1_ENST00000530002.1_RNA|USP2-AS1_ENST00000498979.2_RNA|THY1_ENST00000580275.1_Intron|THY1_ENST00000527590.1_5'UTR|USP2-AS1_ENST00000500970.1_RNA|THY1_ENST00000528522.1_Missense_Mutation_p.A27D|USP2-AS1_ENST00000578923.1_RNA|RP11-334E6.12_ENST00000578216.1_RNA	NM_006288.3	NP_006279.2	P04216	THY1_HUMAN	Thy-1 cell surface antigen	27	Ig-like V-type.				angiogenesis (GO:0001525)|cytoskeleton organization (GO:0007010)|focal adhesion assembly (GO:0048041)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of GTPase activity (GO:0043547)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell activation (GO:0050870)|retinal cone cell development (GO:0046549)|single organismal cell-cell adhesion (GO:0016337)|T cell receptor signaling pathway (GO:0050852)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|integrin binding (GO:0005178)|Rho GTPase activator activity (GO:0005100)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		CACTAGGCAGGCCGTTAGGCT	0.612																																					p.A27D													THY1,NS,carcinoma,+1,1	THY1	1	1	0			c.C80A												87.0	81.0	83.0					11																	119291054		2199	4295	6494	SO:0001583	missense	7070	exon3			AGGCAGGCCGTTA	M11749	CCDS8424.1	11q23.3	2013-01-14				ENSG00000154096		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11801	protein-coding gene	gene with protein product		188230				2864690	Standard	NM_006288		Approved	CD90	uc001pwr.3	P04216		ENST00000284240.5:c.80C>A	11.37:g.119291054G>T	ENSP00000284240:p.Ala27Asp		56	0	0		43	0.07	3	NM_006288	249	0.00	0	Q16008|Q9NSP1	Missense_Mutation	SNP	ENST00000284240.5	37	CCDS8424.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.265669|4.265669	0.80358|0.80358	.|.	.|.	ENSG00000154096|ENSG00000154096	ENST00000284240;ENST00000528522;ENST00000524970;ENST00000524659|ENST00000527590	.|.	.|.	.|.	5.13|5.13	5.13|5.13	0.70059|0.70059	Immunoglobulin subtype (1);Immunoglobulin-like (1);|.	0.188235|.	0.46145|.	D|.	0.000301|.	T|T	0.75737|0.75737	0.3890|0.3890	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.76919|0.76919	-0.2781|-0.2781	9|5	0.87932|.	D|.	0|.	-17.2105|-17.2105	15.7374|15.7374	0.77856|0.77856	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	27|.	P04216|.	THY1_HUMAN|.	D|T	27|35	.|.	ENSP00000284240:A27D|.	A|P	-|-	2|1	0|0	THY1|THY1	118796264|118796264	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.829000|0.829000	0.46940|0.46940	6.015000|6.015000	0.70791|0.70791	2.380000|2.380000	0.81148|0.81148	0.591000|0.591000	0.81541|0.81541	GCC|CCT			0.612	THY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388370.2		NM_006288	
WNK1	65125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	994308	994308	+	Silent	SNP	A	A	G			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:994308A>G	ENST00000315939.6	+	19	4981	c.4338A>G	c.(4336-4338)gcA>gcG	p.A1446A	WNK1_ENST00000535572.1_Silent_p.A1199A|WNK1_ENST00000530271.2_Silent_p.A1944A|WNK1_ENST00000340908.4_Silent_p.A1039A|WNK1_ENST00000537687.1_Silent_p.A1706A	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1446					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTAGTACAGCACTGTATCCTT	0.483																																					p.A1706A	Colon(19;451 567 6672 12618 28860)												.	.			0			c.A5118G												131.0	131.0	131.0					12																	994308		2203	4300	6503	SO:0001819	synonymous_variant	65125	exon19			TACAGCACTGTAT	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4338A>G	12.37:g.994308A>G			130	0	0		188	0.24	46	NM_001184985	99	0.31	31	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1																																																																																					0.483	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206683.1		NM_018979	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	KRAS_ENST00000311936.3_Missense_Mutation_p.A146T|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,+1,137	KRAS_ENST00000256078	1	137	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A												207.0	188.0	195.0					12																	25378562		2203	4300	6503	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TCTTTGCTGATGT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr		58	0	0		144	0.06	8	NM_004985	245	0.11	28	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA			0.323	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
SSPN	8082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	26383896	26383896	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:26383896C>T	ENST00000242729.2	+	3	796	c.619C>T	c.(619-621)Ctt>Ttt	p.L207F	SSPN_ENST00000540266.1_Missense_Mutation_p.L104F|RP11-283G6.4_ENST00000540392.1_RNA|RP11-283G6.5_ENST00000537525.1_RNA|SSPN_ENST00000422622.2_Missense_Mutation_p.L104F|RP11-283G6.5_ENST00000541940.1_RNA|SSPN_ENST00000535504.1_Intron|RP11-283G6.5_ENST00000540625.1_RNA	NM_005086.4	NP_005077.2	Q14714	SSPN_HUMAN	sarcospan	207					cell adhesion (GO:0007155)|muscle contraction (GO:0006936)	cell junction (GO:0030054)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10	Colorectal(261;0.0847)					GGTCTGCGGCCTTGTGTGCTT	0.507																																					p.L207F													.	.			0			c.C619T												197.0	175.0	183.0					12																	26383896		2203	4300	6503	SO:0001583	missense	8082	exon3			TGCGGCCTTGTGT	AF016028	CCDS8707.1, CCDS44850.1	12p11.2	2014-09-17	2012-03-14			ENSG00000123096			11322	protein-coding gene	gene with protein product		601599	"""Kras oncogene-associated gene"""	KRAG		9395445, 8661122	Standard	NM_005086		Approved	SPN1, SPN2	uc001rhe.3	Q14714		ENST00000242729.2:c.619C>T	12.37:g.26383896C>T	ENSP00000242729:p.Leu207Phe		62	0	0		131	0.07	9	NM_005086	7	0.00	0	B3KS67	Missense_Mutation	SNP	ENST00000242729.2	37	CCDS8707.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675824	0.47781	.	.	ENSG00000123096	ENST00000538142;ENST00000540266;ENST00000422622;ENST00000242729;ENST00000441067	T;T;T;T	0.02472	4.28;4.28;4.28;4.28	4.81	1.83	0.25207	.	0.313381	0.29424	N	0.012183	T	0.02610	0.0079	L	0.34521	1.04	0.80722	D	1	P	0.35793	0.521	B	0.36719	0.231	T	0.55952	-0.8059	10	0.54805	T	0.06	-7.4369	6.4387	0.21837	0.2347:0.6116:0.0:0.1537	.	207	Q14714	SSPN_HUMAN	F	104;104;104;207;181	ENSP00000445360:L104F;ENSP00000442893:L104F;ENSP00000396087:L104F;ENSP00000242729:L207F	ENSP00000242729:L207F	L	+	1	0	SSPN	26275163	0.986000	0.35501	0.968000	0.41197	0.997000	0.91878	0.471000	0.22100	1.173000	0.42796	0.563000	0.77884	CTT			0.507	SSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402654.2		NM_005086	
ANKRD33	341405	mdanderson.org	37	12	52282494	52282494	+	5'UTR	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:52282494G>T	ENST00000340970.4	+	0	258				ANKRD33_ENST00000547119.1_3'UTR|ANKRD33_ENST00000301190.6_Silent_p.L96L|ANKRD33_ENST00000538991.1_5'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		GCTGCAGGCTGGGGGCCCTGT	0.647																																					p.L96L													.	.			0			c.G288T												43.0	50.0	48.0					12																	52282494		2202	4300	6502	SO:0001623	5_prime_UTR_variant	341405	exon2			CAGGCTGGGGGCC		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.-114G>T	12.37:g.52282494G>T			53	0	0		51	0.06	3	NM_182608	0		0	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Silent	SNP	ENST00000340970.4	37	CCDS44892.1																																																																																					0.647	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404515.1		NM_182608	
APAF1	317	broad.mit.edu	37	12	99056499	99056499	+	Silent	SNP	A	A	G			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:99056499A>G	ENST00000551964.1	+	7	1606	c.870A>G	c.(868-870)aaA>aaG	p.K290K	APAF1_ENST00000547045.1_Silent_p.K290K|APAF1_ENST00000550527.1_Silent_p.K279K|APAF1_ENST00000333991.1_Silent_p.K290K|APAF1_ENST00000357310.1_Silent_p.K290K|APAF1_ENST00000549007.1_Silent_p.K290K|APAF1_ENST00000359972.2_Silent_p.K279K|APAF1_ENST00000552268.1_Silent_p.K290K|APAF1_ENST00000339433.3_Silent_p.K290K	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	290	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	GAAAGGAAAAAGGACTTGAAA	0.313																																					p.K290K													.	APAF1	111		0			c.A870G												58.0	60.0	59.0					12																	99056499		2201	4299	6500	SO:0001819	synonymous_variant	317	exon7			GGAAAAAGGACTT	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.870A>G	12.37:g.99056499A>G			202	0.004950495	1		190	0.02	4	NM_181868	6	0.00	0	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Silent	SNP	ENST00000551964.1	37	CCDS9069.1																																																																																					0.313	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408006.1		NM_181861.1	
MYL2	4633	mdanderson.org	37	12	111348947	111348947	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr12:111348947G>T	ENST00000228841.8	-	7	482	c.435C>A	c.(433-435)gaC>gaA	p.D145E	MYL2_ENST00000548438.1_Missense_Mutation_p.D131E	NM_000432.3	NP_000423.2	P10916	MLRV_HUMAN	myosin, light chain 2, regulatory, cardiac, slow	145	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle cell fate specification (GO:0042694)|muscle fiber development (GO:0048747)|muscle filament sliding (GO:0030049)|negative regulation of cell growth (GO:0030308)|post-embryonic development (GO:0009791)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|myofibril (GO:0030016)|myosin complex (GO:0016459)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)	p.D145D(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	12						TGCCAGTCACGTCAGGGGGGA	0.612																																					p.D145E	GBM(14;268 426 18829 21617 25540)												MYL2,NS,carcinoma,0,1	MYL2	0	1	1	Substitution - coding silent(1)	endometrium(1)	c.C435A												155.0	129.0	138.0					12																	111348947		2203	4300	6503	SO:0001583	missense	4633	exon7			AGTCACGTCAGGG		CCDS31901.1	12q24.11	2014-09-17	2006-09-29		ENSG00000111245	ENSG00000111245		"""Myosins / Light chain"", ""EF-hand domain containing"""	7583	protein-coding gene	gene with protein product	"""cardiac ventricular myosin light chain 2"""	160781	"""myosin, light polypeptide 2, regulatory, cardiac, slow"""			1386340	Standard	NM_000432		Approved	CMH10	uc001try.4	P10916	OTTHUMG00000169535	ENST00000228841.8:c.435C>A	12.37:g.111348947G>T	ENSP00000228841:p.Asp145Glu		65	0	0		48	0.06	3	NM_000432	0		0	Q16123	Missense_Mutation	SNP	ENST00000228841.8	37	CCDS31901.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560282	0.65538	.	.	ENSG00000111245	ENST00000228841;ENST00000548438	D;D	0.81908	-1.55;-1.55	4.95	-6.08	0.02151	EF-hand-like domain (1);	0.046467	0.85682	D	0.000000	D	0.89897	0.6848	M	0.84948	2.725	0.47407	D	0.999418	D	0.63046	0.992	D	0.87578	0.998	D	0.89619	0.3847	10	0.66056	D	0.02	.	17.4706	0.87645	0.1892:0.0:0.8108:0.0	.	145	P10916	MLRV_HUMAN	E	145;131	ENSP00000228841:D145E;ENSP00000447154:D131E	ENSP00000228841:D145E	D	-	3	2	MYL2	109833330	0.199000	0.23386	0.554000	0.28268	0.768000	0.43524	-0.376000	0.07465	-1.288000	0.02378	-1.079000	0.02226	GAC			0.612	MYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404677.2		NM_000432	
TUBA3C	7278	mdanderson.org	37	13	19751274	19751274	+	Silent	SNP	G	G	A	rs143115179	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr13:19751274G>A	ENST00000400113.3	-	4	953	c.849C>T	c.(847-849)caC>caT	p.H283H		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	283					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACAGCTGCTCGTGGTAGGCCT	0.607																																					p.H283H													.	.			0			c.C849T												143.0	128.0	133.0					13																	19751274		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			CTGCTCGTGGTAG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.849C>T	13.37:g.19751274G>A			113	0.0088495575	1		107	0.08	9	NM_006001	19	0.00	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			0.008		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044007.2		NM_006001	
TUBA3C	7278	mdanderson.org	37	13	19751292	19751292	+	Silent	SNP	T	T	C	rs147482964	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr13:19751292T>C	ENST00000400113.3	-	4	935	c.831A>G	c.(829-831)tcA>tcG	p.S277S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	277					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCTTCTCGGCTGAGATGACCG	0.612																																					p.S277S													.	.			0			c.A831G												131.0	119.0	123.0					13																	19751292		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			CTCGGCTGAGATG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.831A>G	13.37:g.19751292T>C			109	0.0091743119	1		115	0.10	11	NM_006001	18	0.00	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			0.006		0.612	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044007.2		NM_006001	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000400103.2_Splice_Site_p.M41V|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382977.4_Splice_Site_p.M41V|TPTE2_ENST00000382975.4_Splice_Site_p.M41V|TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000457266.2_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V													.	TPTE2	225		0			c.A121G												47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C			507	0.0019723866	1		387	0.04	15	NM_199254	1	0.00	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG			0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	Missense_Mutation
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45618040	45618040	+	Splice_Site	SNP	G	G	T	rs141336758		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr14:45618040G>T	ENST00000267430.5	+	4	845	c.760G>T	c.(760-762)Gct>Tct	p.A254S	FANCM_ENST00000556036.1_Splice_Site_p.A254S|FANCM_ENST00000542564.2_Splice_Site_p.A228S	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	254	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TTTCATATAGGCTGTGCAACA	0.289								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.A254S													FANCM,NS,carcinoma,-1,1	FANCM	-1	1	0			c.G760T												54.0	55.0	55.0					14																	45618040		2203	4300	6503	SO:0001630	splice_region_variant	57697	exon4	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ATATAGGCTGTGC	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.760-1G>T	14.37:g.45618040G>T			74	0	0		71	0.14	10	NM_020937	1	1.00	1	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118766	0.37436	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.14893	2.47;2.47;2.49	5.75	4.8	0.61643	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.059831	0.64402	D	0.000002	T	0.13243	0.0321	N	0.16478	0.41	0.45946	D	0.998772	B;B;B	0.32968	0.392;0.392;0.04	B;B;B	0.40982	0.345;0.345;0.036	T	0.15607	-1.0431	9	.	.	.	.	11.4643	0.50230	0.0:0.0:0.7193:0.2806	.	228;254;254	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	S	254;254;228	ENSP00000450596:A254S;ENSP00000267430:A254S;ENSP00000442493:A228S	.	A	+	1	0	FANCM	44687790	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.676000	0.46883	2.866000	0.98385	0.650000	0.86243	GCT			0.289	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410474.1		XM_048128	Missense_Mutation
ZBTB1	22890	mdanderson.org	37	14	64998614	64998614	+	Nonstop_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr14:64998614G>T	ENST00000358738.3	+	3	2325	c.1934G>T	c.(1933-1935)tGa>tTa	p.*645L	RP11-973N13.4_ENST00000554918.1_RNA	NM_014950.2	NP_055765.2	Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	0					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		GTGGAGAAGTGAGAGATCTGA	0.388																																					p.X645L													.	.			0			c.G1934T												161.0	153.0	156.0					14																	64998614		2203	4300	6503	SO:0001578	stop_lost	22890	exon3			AGAAGTGAGAGAT	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000358738.3:c.1934G>T	14.37:g.64998614G>T	ENSP00000351587:p.*645Leuext*3		92	0	0		110	0.05	5	NM_014950	3	0.00	0	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000358738.3	37	CCDS32097.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972478	0.53614	.	.	ENSG00000126804	ENST00000358738	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4282	0.87532	0.0:0.0:1.0:0.0	.	.	.	.	L	645	.	.	X	+	2	2	ZBTB1	64068367	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.750000	0.62162	2.793000	0.96121	0.563000	0.77884	TGA			0.388	ZBTB1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000411913.1			
TLN2	83660	mdanderson.org	37	15	62994394	62994394	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr15:62994394G>T	ENST00000561311.1	+	17	2130	c.1900G>T	c.(1900-1902)Gga>Tga	p.G634*	TLN2_ENST00000306829.6_Nonsense_Mutation_p.G634*			Q9Y4G6	TLN2_HUMAN	talin 2	634					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCCTACTTCTGGAGAGGTAAG	0.597																																					p.G634X													.	.			0			c.G1900T												37.0	35.0	36.0					15																	62994394		2201	4299	6500	SO:0001587	stop_gained	83660	exon15			ACTTCTGGAGAGG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.1900G>T	15.37:g.62994394G>T	ENSP00000453508:p.Gly634*		50	0	0		43	0.07	3	NM_015059	17	0.00	0	A6NLB8	Nonsense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	G	41	8.690017	0.98916	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.74	5.74	0.90152	.	0.147185	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-12.7762	20.2825	0.98528	0.0:0.0:1.0:0.0	.	.	.	.	X	634	.	ENSP00000303476:G634X	G	+	1	0	TLN2	60781686	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	8.009000	0.88606	2.873000	0.98535	0.561000	0.74099	GGA			0.597	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257878.2			
TMEM8A	58986	mdanderson.org	37	16	422283	422283	+	Splice_Site	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:422283C>T	ENST00000431232.2	-	13	2180	c.2020G>A	c.(2020-2022)Gct>Act	p.A674T	MRPL28_ENST00000199706.8_5'Flank|MRPL28_ENST00000389675.2_5'Flank|MRPL28_ENST00000429738.1_5'Flank|TMEM8A_ENST00000250930.3_Splice_Site_p.A481T	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	674					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						CAGCGGTAAGCCTGGAGAAAA	0.687																																					p.A674T													.	.			0			c.G2020A												23.0	23.0	23.0					16																	422283		2186	4296	6482	SO:0001630	splice_region_variant	58986	exon13			GGTAAGCCTGGAG	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.2020-1G>A	16.37:g.422283C>T			25	0	0		20	0.10	2	NM_021259	98	0.00	0	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Missense_Mutation	SNP	ENST00000431232.2	37	CCDS10407.1	.	.	.	.	.	.	.	.	.	.	C	1.234	-0.623234	0.03636	.	.	ENSG00000129925	ENST00000431232;ENST00000250930;ENST00000382942	T;T	0.42513	0.97;0.97	4.18	2.18	0.27775	.	0.653849	0.13867	N	0.357266	T	0.10766	0.0263	N	0.00368	-1.59	0.23107	N	0.998282	B	0.15719	0.014	B	0.17979	0.02	T	0.33445	-0.9868	10	0.05959	T	0.93	-1.056	9.8992	0.41338	0.0:0.7478:0.0:0.2522	.	674	Q9HCN3	TMM8A_HUMAN	T	674;481;162	ENSP00000401338:A674T;ENSP00000250930:A481T	ENSP00000250930:A481T	A	-	1	0	TMEM8A	362284	0.989000	0.36119	0.919000	0.36401	0.039000	0.13416	1.933000	0.40153	0.079000	0.16929	-1.644000	0.00765	GCT			0.687	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000109257.2		NM_021259	Missense_Mutation
PIGQ	9091	mdanderson.org	37	16	626176	626176	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:626176G>T	ENST00000026218.5	+	4	952	c.864G>T	c.(862-864)ctG>ctT	p.L288L	PIGQ_ENST00000321878.5_Silent_p.L288L|PIGQ_ENST00000470411.2_3'UTR|PIGQ_ENST00000409527.2_Silent_p.L288L	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	288	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				ACGTGGCCCTGGGCCTCATGC	0.701																																					p.L288L													.	.			0			c.G864T												33.0	30.0	31.0					16																	626176		2087	4114	6201	SO:0001819	synonymous_variant	9091	exon4			GGCCCTGGGCCTC	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.864G>T	16.37:g.626176G>T			30	0	0		36	0.08	3	NM_148920	41	0.00	0	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Silent	SNP	ENST00000026218.5	37	CCDS10411.1																																																																																					0.701	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000239270.2		NM_004204	
FAM86A	196483	ucsc.edu	37	16	5140488	5140488	+	Missense_Mutation	SNP	C	C	T	rs200021489	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:5140488C>T	ENST00000427587.4	-	5	489	c.421G>A	c.(421-423)Gcc>Acc	p.A141T	FAM86A_ENST00000458008.4_Missense_Mutation_p.A107T|FAM86A_ENST00000587133.1_Missense_Mutation_p.A80T	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	141						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TAGAGGGCGGCGTCCCATGTG	0.642																																					p.A141T													.	FAM86A	32		0			c.G421A												90.0	88.0	89.0					16																	5140488		2197	4300	6497	SO:0001583	missense	196483	exon5			GGGCGGCGTCCCA	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.421G>A	16.37:g.5140488C>T	ENSP00000398502:p.Ala141Thr		169	0.0177514793	3		127	0.02	2	NM_201400	69	0.25	17	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	37	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	c	20.2	3.953061	0.73902	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.14266	2.52;2.52	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.48554	0.1506	H	0.97077	3.935	0.80722	D	1	D;D	0.67145	0.996;0.987	P;P	0.60886	0.88;0.78	T	0.66101	-0.6007	10	0.72032	D	0.01	.	15.221	0.73310	0.0:1.0:0.0:0.0	.	107;141	Q96G04-2;Q96G04	.;FA86A_HUMAN	T	107;141	ENSP00000389710:A107T;ENSP00000398502:A141T	ENSP00000398502:A141T	A	-	1	0	FAM86A	5080489	1.000000	0.71417	0.506000	0.27664	0.137000	0.21094	6.686000	0.74548	2.620000	0.88729	0.450000	0.29827	GCC			0.642	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251713.1	rescued with RNA-seq	NM_201400	
KIAA0430	9665	mdanderson.org	37	16	15692880	15692880	+	Splice_Site	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:15692880C>T	ENST00000396368.3	-	26	5021	c.4815G>A	c.(4813-4815)ggG>ggA	p.G1605G	KIAA0430_ENST00000551742.1_Splice_Site_p.G1605G|KIAA0430_ENST00000540441.2_Splice_Site_p.G1440G|KIAA0430_ENST00000344181.3_Splice_Site_p.G1293G|KIAA0430_ENST00000548025.1_Splice_Site_p.G1602G|KIAA0430_ENST00000602337.1_Splice_Site_p.G1602G	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1605					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGTGACTGGGCCCTGGGCAAA	0.637																																					p.G1605G													.	.			0			c.G4815A												31.0	37.0	35.0					16																	15692880		2025	4164	6189	SO:0001630	splice_region_variant	9665	exon26			ACTGGGCCCTGGG	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4814-1G>A	16.37:g.15692880C>T			23	0	0		35	0.09	3	NM_001184998	46	0.00	0	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	ENST00000396368.3	37	CCDS10562.2																																																																																					0.637	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252131.2		NM_014647	Silent
BCL7C	9274	mdanderson.org	37	16	30904221	30904221	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:30904221G>T	ENST00000215115.4	-	3	1235	c.220C>A	c.(220-222)Cgt>Agt	p.R74S	MIR762_ENST00000390236.1_RNA|BCL7C_ENST00000380317.4_Missense_Mutation_p.R74S|MIR4519_ENST00000564901.1_RNA|AC106782.20_ENST00000572471.1_RNA|MIR4519_ENST00000570025.1_RNA|MIR4519_ENST00000565573.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	74					apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			CTGCCCCGACGTTCCCGGCCA	0.657																																					p.R74S													.	.			0			c.C220A												43.0	54.0	50.0					16																	30904221		2194	4297	6491	SO:0001583	missense	9274	exon3			CCCGACGTTCCCG	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.220C>A	16.37:g.30904221G>T	ENSP00000215115:p.Arg74Ser		42	0	0		27	0.11	3	NM_004765	171	0.00	0	O43770|Q6PD89	Missense_Mutation	SNP	ENST00000215115.4	37	CCDS10693.1	.	.	.	.	.	.	.	.	.	.	G	9.549	1.115336	0.20795	.	.	ENSG00000099385	ENST00000380317;ENST00000215115	T;T	0.43688	0.94;0.96	5.08	2.96	0.34315	.	0.260958	0.26432	N	0.024410	T	0.30759	0.0775	L	0.47716	1.5	0.29692	N	0.840877	P;P	0.45768	0.625;0.866	B;B	0.43274	0.17;0.414	T	0.17501	-1.0367	10	0.09338	T	0.73	-23.9961	6.1263	0.20182	0.0968:0.0:0.6669:0.2363	.	74;74	Q8WUZ0;Q8WUZ0-2	BCL7C_HUMAN;.	S	74	ENSP00000369674:R74S;ENSP00000215115:R74S	ENSP00000215115:R74S	R	-	1	0	BCL7C	30811722	0.988000	0.35896	0.967000	0.41034	0.982000	0.71751	1.553000	0.36255	0.498000	0.27948	0.561000	0.74099	CGT			0.657	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255547.3		NM_004765	
NRN1L	123904	ucsc.edu;bcgsc.ca	37	16	67918828	67918828	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:67918828C>T	ENST00000339176.3	+	1	121	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C	NRN1L_ENST00000576147.1_5'Flank|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_198443.1	NP_940845.1	Q496H8	NRN1L_HUMAN	neuritin 1-like	8					nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)		CTGCCGCCGCCGCTGCTGCTG	0.721																																					p.R8C													.	NRN1L	13		0			c.C22T												22.0	25.0	24.0					16																	67918828		2123	4215	6338	SO:0001583	missense	123904	exon1			CGCCGCCGCTGCT	AY358782	CCDS10850.1	16q22.1	2008-02-05			ENSG00000188038	ENSG00000188038			29811	protein-coding gene	gene with protein product						12975309	Standard	NM_198443		Approved	UNQ2446, MRCC2446	uc002euu.3	Q496H8	OTTHUMG00000137541	ENST00000339176.3:c.22C>T	16.37:g.67918828C>T	ENSP00000342411:p.Arg8Cys		22	0	0		22	0.18	4	NM_198443	29	0.00	0	Q6UWH7	Missense_Mutation	SNP	ENST00000339176.3	37	CCDS10850.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350829	0.41599	.	.	ENSG00000188038	ENST00000339176	.	.	.	4.79	-3.66	0.04489	.	1.412650	0.04618	N	0.401574	T	0.16642	0.0400	N	0.01705	-0.755	0.20196	N	0.999929	B	0.06786	0.001	B	0.04013	0.001	T	0.35276	-0.9795	9	0.87932	D	0	.	11.7331	0.51748	0.0:0.6868:0.0:0.3132	.	8	Q496H8	NRN1L_HUMAN	C	8	.	ENSP00000342411:R8C	R	+	1	0	NRN1L	66476329	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.305000	0.08188	-0.606000	0.05746	-0.672000	0.03802	CGC			0.721	NRN1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000268872.2		NM_198443	
TMED6	146456	mdanderson.org	37	16	69377514	69377514	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:69377514G>T	ENST00000288025.3	-	4	574	c.519C>A	c.(517-519)atC>atA	p.I173I	RP11-343C2.7_ENST00000564737.1_Intron|RP11-343C2.9_ENST00000563634.1_Intron	NM_144676.3	NP_653277.2	Q8WW62	TMED6_HUMAN	transmembrane emp24 protein transport domain containing 6	173					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	9						ACATGTGAAAGATATTGTTCT	0.458																																					p.I173I													.	.			0			c.C519A												136.0	130.0	132.0					16																	69377514		2198	4300	6498	SO:0001819	synonymous_variant	146456	exon4			GTGAAAGATATTG	BC020827	CCDS10878.1	16q22.1	2008-02-05			ENSG00000157315	ENSG00000157315			28331	protein-coding gene	gene with protein product						12477932	Standard	NM_144676		Approved	MGC23911	uc002exc.2	Q8WW62	OTTHUMG00000137571	ENST00000288025.3:c.519C>A	16.37:g.69377514G>T			86	0	0		85	0.06	5	NM_144676	6	0.00	0	Q6UXN5	Silent	SNP	ENST00000288025.3	37	CCDS10878.1																																																																																					0.458	TMED6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268951.1		NM_144676	
CDYL2	124359	mdanderson.org	37	16	80638332	80638332	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:80638332G>T	ENST00000570137.2	-	7	1629	c.1474C>A	c.(1474-1476)Ctt>Att	p.L492I	CDYL2_ENST00000562812.1_Missense_Mutation_p.L493I|CDYL2_ENST00000563890.1_Missense_Mutation_p.L493I|CDYL2_ENST00000566173.1_Missense_Mutation_p.L493I	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	492						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						AGGGAGTCAAGGCCTTTGGAG	0.547																																					p.L492I													.	.			0			c.C1474A												115.0	111.0	112.0					16																	80638332		2203	4300	6503	SO:0001583	missense	124359	exon7			AGTCAAGGCCTTT	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.1474C>A	16.37:g.80638332G>T	ENSP00000476295:p.Leu492Ile		42	0	0		41	0.07	3	NM_152342	12	0.00	0	Q7Z5I8	Missense_Mutation	SNP	ENST00000570137.2	37	CCDS32493.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.757034	0.31137	.	.	ENSG00000166446	ENST00000299564	T	0.56611	0.45	5.19	4.22	0.49857	.	0.000000	0.64402	D	0.000003	T	0.33644	0.0870	N	0.05554	-0.025	0.50313	D	0.999867	P	0.37370	0.592	B	0.41135	0.348	T	0.10177	-1.0641	10	0.14656	T	0.56	.	13.4315	0.61057	0.0771:0.0:0.9229:0.0	.	492	Q8N8U2	CDYL2_HUMAN	I	492	ENSP00000299564:L492I	ENSP00000299564:L492I	L	-	1	0	CDYL2	79195833	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.581000	0.53914	2.717000	0.92951	0.650000	0.86243	CTT			0.547	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434727.2		NM_152342	
BANP	54971	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	88068971	88068971	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr16:88068971G>C	ENST00000393207.1	+	10	1431	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q	BANP_ENST00000538234.1_Missense_Mutation_p.E415Q|BANP_ENST00000355022.4_Missense_Mutation_p.E376Q|BANP_ENST00000479780.2_Missense_Mutation_p.E373Q|BANP_ENST00000393208.2_Missense_Mutation_p.E376Q|BANP_ENST00000355163.5_Missense_Mutation_p.E382Q|BANP_ENST00000286122.7_Missense_Mutation_p.E404Q	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	404	Gln-rich.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GCCGCAGGGGGAGCAAGTCCA	0.572																																					p.E415Q													.	.			0			c.G1243C												36.0	29.0	31.0					16																	88068971		2195	4300	6495	SO:0001583	missense	54971	exon10			CAGGGGGAGCAAG	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1210G>C	16.37:g.88068971G>C	ENSP00000376902:p.Glu404Gln		125	0	0		118	0.09	11	NM_001173542	43	0.12	5	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	ENST00000393207.1	37	CCDS54054.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184394	0.57800	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	.	.	.	5.28	5.28	0.74379	.	0.048679	0.85682	D	0.000000	T	0.64768	0.2628	L	0.34521	1.04	0.49798	D	0.999827	B;B;D;B;P	0.64830	0.181;0.155;0.994;0.241;0.765	B;B;D;B;P	0.72982	0.1;0.064;0.979;0.136;0.555	T	0.64512	-0.6390	9	0.46703	T	0.11	.	12.9427	0.58354	0.0:0.0:0.8381:0.1618	.	412;373;404;376;376	B4DE54;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;BANP_HUMAN;.;.	Q	404;382;372;373;376;376;376;415;404	.	ENSP00000286122:E404Q	E	+	1	0	BANP	86626472	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	8.755000	0.91646	2.482000	0.83794	0.462000	0.41574	GAG			0.572	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000269166.1		NM_017869	
GUCY2D	3000	mdanderson.org	37	17	7915838	7915838	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:7915838G>T	ENST00000254854.4	+	10	2177	c.2027G>T	c.(2026-2028)gGc>gTc	p.G676V		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	676	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				ATAGTGGATGGCAGATTCGTA	0.582																																					p.G676V													.	.			0			c.G2027T												116.0	105.0	109.0					17																	7915838		2203	4300	6503	SO:0001583	missense	3000	exon10			TGGATGGCAGATT	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2027G>T	17.37:g.7915838G>T	ENSP00000254854:p.Gly676Val		52	0	0		30	0.10	3	NM_000180	1	0.00	0	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322146	0.60634	.	.	ENSG00000132518	ENST00000254854	D	0.82526	-1.62	5.35	4.36	0.52297	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000111	D	0.91754	0.7392	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93017	0.6437	10	0.62326	D	0.03	.	14.9766	0.71277	0.0:0.1438:0.8561:0.0	.	676	Q02846	GUC2D_HUMAN	V	676	ENSP00000254854:G676V	ENSP00000254854:G676V	G	+	2	0	GUCY2D	7856563	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	7.763000	0.85283	1.464000	0.47987	0.655000	0.94253	GGC			0.582	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226973.2			
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		182	0.043956044	8		176	0.06	10	NM_145301	22	0.45	10	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
SUPT6H	6830	broad.mit.edu	37	17	27010745	27010745	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:27010745G>T	ENST00000314616.6	+	17	2423	c.2140G>T	c.(2140-2142)Gaa>Taa	p.E714*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.E714*	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	714	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CATGGCCATCGAACGGGCTTT	0.493																																					p.E714X													.	SUPT6H	165		0			c.G2140T												75.0	74.0	75.0					17																	27010745		2203	4300	6503	SO:0001587	stop_gained	6830	exon17			GCCATCGAACGGG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2140G>T	17.37:g.27010745G>T	ENSP00000319104:p.Glu714*		182	0.0054945055	1		153	0.03	5	NM_003170	70	0.00	0	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	41	9.160849	0.99085	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.39	5.39	0.77823	.	0.051790	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-17.9078	19.2162	0.93780	0.0:0.0:1.0:0.0	.	.	.	.	X	714	.	ENSP00000319104:E714X	E	+	1	0	SUPT6H	24034872	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.557000	0.86248	0.650000	0.86243	GAA			0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446422.2		NM_003170	
SUPT6H	6830	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	27015153	27015153	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:27015153G>T	ENST00000314616.6	+	24	3334	c.3051G>T	c.(3049-3051)ctG>ctT	p.L1017L	SUPT6H_ENST00000347486.4_Silent_p.L1017L	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1017	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGACCCAGCTGGTCACCATGT	0.617																																					p.L1017L													.	SUPT6H	165		0			c.G3051T												88.0	82.0	84.0					17																	27015153		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon24			CCAGCTGGTCACC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3051G>T	17.37:g.27015153G>T			85	0	0		58	0.07	4	NM_003170	61	0.16	10	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																					0.617	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446422.2		NM_003170	
MRPL45P2	653479	broad.mit.edu	37	17	45567245	45567246	+	RNA	INS	-	-	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:45567245_45567246insA	ENST00000575291.1	-	0	385									mitochondrial ribosomal protein L45 pseudogene 2																		aactccatctcaaaaaaaaaaa	0.401																																					.													.	.			0			.																																											0	.			CCATCTCAAAAAA			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45567256_45567256dupA			8	0	0		12	0.42	5	.	0		0		RNA	INS	ENST00000575291.1	37																																																																																						0.401	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
PITPNC1	26207	mdanderson.org	37	17	65574359	65574359	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:65574359G>T	ENST00000581322.1	+	5	352	c.352G>T	c.(352-354)Gga>Tga	p.G118*	PITPNC1_ENST00000299954.9_Nonsense_Mutation_p.G118*|PITPNC1_ENST00000335257.6_Nonsense_Mutation_p.G118*|PITPNC1_ENST00000580974.1_Nonsense_Mutation_p.G118*			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	118					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			GGACAACAAAGGAAGCAATGA	0.473																																					p.G118X													.	.			0			c.G352T												69.0	68.0	68.0					17																	65574359		2017	4170	6187	SO:0001587	stop_gained	26207	exon5			AACAAAGGAAGCA	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.352G>T	17.37:g.65574359G>T	ENSP00000464006:p.Gly118*		43	0	0		32	0.09	3	NM_012417	226	0.00	0	A8K473|J3QR20|Q96I07	Nonsense_Mutation	SNP	ENST00000581322.1	37	CCDS58588.1	.	.	.	.	.	.	.	.	.	.	G	38	7.227598	0.98150	.	.	ENSG00000154217	ENST00000335257;ENST00000299954	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.2108	19.2729	0.94018	0.0:0.0:1.0:0.0	.	.	.	.	X	118	.	ENSP00000299954:G118X	G	+	1	0	PITPNC1	63004821	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.017000	0.93651	2.723000	0.93209	0.561000	0.74099	GGA			0.473	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000447194.1		NM_012417	
TBCD	6904	bcgsc.ca;mdanderson.org	37	17	80869665	80869665	+	Splice_Site	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr17:80869665G>T	ENST00000355528.4	+	23	2168	c.2038G>T	c.(2038-2040)Gtg>Ttg	p.V680L	TBCD_ENST00000539345.2_Splice_Site_p.V680L	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	680					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GAGACAAGCAGGTAAGTCTGA	0.532																																					p.V680L													.	TBCD	94		0			c.G2038T												81.0	83.0	83.0					17																	80869665		2054	4168	6222	SO:0001630	splice_region_variant	6904	exon23			CAAGCAGGTAAGT	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2038+1G>T	17.37:g.80869665G>T			71	0	0		75	0.07	5	NM_005993	138	0.00	0	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714451	0.68730	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000536182	T	0.69306	-0.39	4.56	4.56	0.56223	Armadillo-type fold (1);	0.181515	0.39341	N	0.001381	T	0.72431	0.3459	M	0.87269	2.87	0.80722	D	1	P;P;P;B	0.49090	0.919;0.786;0.864;0.215	B;B;P;B	0.44359	0.393;0.22;0.447;0.09	T	0.78150	-0.2316	9	.	.	.	.	12.9915	0.58622	0.0:0.0:1.0:0.0	.	680;680;680;680	B4DE53;Q9BTW9;Q9BTW9-4;F5H8C7	.;TBCD_HUMAN;.;.	L	680;431;680	ENSP00000347719:V680L	.	V	+	1	0	TBCD	78462954	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.819000	0.55686	2.523000	0.85059	0.591000	0.81541	GTG			0.532	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439415.1		NM_005993	Missense_Mutation
HCN2	610	mdanderson.org	37	19	590563	590563	+	Silent	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:590563G>A	ENST00000251287.2	+	1	671	c.618G>A	c.(616-618)ccG>ccA	p.P206P		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	206	Involved in subunit assembly. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATCCACCCGTACAGCGACT	0.736																																					p.P206P	Melanoma(145;1175 2427 8056 36306)												.	.			0			c.G618A												10.0	12.0	11.0					19																	590563		2095	4135	6230	SO:0001819	synonymous_variant	610	exon1			CCACCCGTACAGC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.618G>A	19.37:g.590563G>A			39	0	0		32	0.09	3	NM_001194	62	0.00	0	O60742|O60743|O75267|Q9UBS2	Silent	SNP	ENST00000251287.2	37	CCDS12035.1																																																																																					0.736	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452100.1		NM_001194	
RPL36	25873	broad.mit.edu;mdanderson.org	37	19	5693409	5693409	+	IGR	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:5693409G>A	ENST00000577222.1	+	0	874				LONP1_ENST00000585374.1_Missense_Mutation_p.A754V|LONP1_ENST00000540670.2_Missense_Mutation_p.A672V|LONP1_ENST00000593119.1_Missense_Mutation_p.A804V|LONP1_ENST00000360614.3_Missense_Mutation_p.A868V|LONP1_ENST00000590729.1_Missense_Mutation_p.A738V			Q9Y3U8	RL36_HUMAN	ribosomal protein L36						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|upper_aerodigestive_tract(1)	2						CCTGCCCATGGCCAGGGACAG	0.647																																					p.T868I													.	LONP1	66		0			c.C2603T												67.0	63.0	64.0					19																	5693409		2203	4300	6503	SO:0001628	intergenic_variant	9361	exon17			CCCATGGCCAGGG		CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8			19.37:g.5693409G>A			44	0.0227272727	1		41	0.07	3	NM_004793	427	0.00	0	B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	ENST00000577222.1	37	CCDS12147.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761029	0.89932	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.27256	1.68;1.68	4.75	4.75	0.60458	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51805	0.1696	M	0.77712	2.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.54036	-0.8353	10	0.45353	T	0.12	-30.7254	15.2387	0.73452	0.0:0.0:1.0:0.0	.	868;804;868	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	V	868;832;672	ENSP00000353826:A868V;ENSP00000441523:A672V	ENSP00000351177:A832V	A	-	2	0	LONP1	5644409	1.000000	0.71417	0.688000	0.30117	0.648000	0.38561	7.647000	0.83462	2.161000	0.67846	0.549000	0.68633	GCC			0.647	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442561.1		NM_015414	
PNPLA6	10908	mdanderson.org	37	19	7619921	7619921	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:7619921G>T	ENST00000221249.6	+	25	3094	c.2663G>T	c.(2662-2664)tGt>tTt	p.C888F	PNPLA6_ENST00000600737.1_Missense_Mutation_p.C926F|PNPLA6_ENST00000545201.2_Missense_Mutation_p.C861F|PNPLA6_ENST00000450331.3_Missense_Mutation_p.C888F|PNPLA6_ENST00000414982.3_Missense_Mutation_p.C936F	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	927					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CACCTGCGCTGTCCGCGCCGC	0.711																																					p.C936F													.	.			0			c.G2807T												9.0	11.0	10.0					19																	7619921		2193	4276	6469	SO:0001583	missense	10908	exon24			TGCGCTGTCCGCG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2663G>T	19.37:g.7619921G>T	ENSP00000221249:p.Cys888Phe		10	0	0		15	0.20	3	NM_001166111	65	0.00	0	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	37	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	g	25.7	4.666389	0.88251	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.959	D;D;D;P	0.83275	0.99;0.996;0.996;0.749	T	0.61158	-0.7119	10	0.54805	T	0.06	.	16.613	0.84899	0.0:0.0:1.0:0.0	.	927;861;926;888	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	F	888;861;936;888	ENSP00000221249:C888F;ENSP00000443323:C861F;ENSP00000407509:C936F;ENSP00000394348:C888F	ENSP00000221249:C888F	C	+	2	0	PNPLA6	7525921	1.000000	0.71417	0.991000	0.47740	0.587000	0.36485	9.869000	0.99810	2.523000	0.85059	0.555000	0.69702	TGT			0.711	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459275.1		NM_006702	
COL5A3	50509	mdanderson.org	37	19	10077257	10077257	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:10077257G>T	ENST00000264828.3	-	63	4709	c.4624C>A	c.(4624-4626)Ctc>Atc	p.L1542I		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1542	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TGGCACACGAGGCCCGGGCGC	0.726																																					p.L1542I													.	.			0			c.C4624A												3.0	3.0	3.0					19																	10077257		1934	3835	5769	SO:0001583	missense	50509	exon63			ACACGAGGCCCGG	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4624C>A	19.37:g.10077257G>T	ENSP00000264828:p.Leu1542Ile		24	0	0		13	0.15	2	NM_015719	16	0.00	0	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619674	0.66787	.	.	ENSG00000080573	ENST00000264828	T	0.73258	-0.73	4.07	4.07	0.47477	Fibrillar collagen, C-terminal (3);	0.095816	0.42964	D	0.000640	T	0.73992	0.3658	L	0.45581	1.43	0.27545	N	0.950686	D	0.63046	0.992	P	0.60173	0.87	T	0.66960	-0.5791	10	0.72032	D	0.01	.	9.1503	0.36959	0.0:0.0:0.7825:0.2175	.	1542	P25940	CO5A3_HUMAN	I	1542	ENSP00000264828:L1542I	ENSP00000264828:L1542I	L	-	1	0	COL5A3	9938257	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.116000	0.64661	2.111000	0.64477	0.456000	0.33151	CTC			0.726	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315788.1		NM_015719	
COL5A3	50509	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	10096522	10096522	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:10096522G>T	ENST00000264828.3	-	31	2487	c.2402C>A	c.(2401-2403)cCt>cAt	p.P801H		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	801	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCCTACCTTAGGTCCAGGGCG	0.582																																					p.P801H													.	COL5A3	243		0			c.C2402A												120.0	137.0	131.0					19																	10096522		2203	4300	6503	SO:0001583	missense	50509	exon31			ACCTTAGGTCCAG	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2402C>A	19.37:g.10096522G>T	ENSP00000264828:p.Pro801His		73	0	0		66	0.08	5	NM_015719	1	0.00	0	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014828	0.54468	.	.	ENSG00000080573	ENST00000264828	D	0.93189	-3.18	4.6	4.6	0.57074	.	0.260464	0.32244	U	0.006376	D	0.95918	0.8671	M	0.86573	2.825	0.41460	D	0.988038	D	0.54207	0.965	P	0.54238	0.746	D	0.96722	0.9533	10	0.66056	D	0.02	.	15.2861	0.73828	0.0:0.0:1.0:0.0	.	801	P25940	CO5A3_HUMAN	H	801	ENSP00000264828:P801H	ENSP00000264828:P801H	P	-	2	0	COL5A3	9957522	1.000000	0.71417	1.000000	0.80357	0.245000	0.25701	8.034000	0.88864	2.267000	0.75376	0.462000	0.41574	CCT			0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315788.1		NM_015719	
CHERP	10523	ucsc.edu	37	19	16641681	16641681	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:16641681G>A	ENST00000198939.6	-	6	754	c.718C>T	c.(718-720)Cag>Tag	p.Q240*	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Nonsense_Mutation_p.Q229*					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						TCCCGGGCCTGCTTGCGCTGG	0.692																																					p.Q229X													.	CHERP	70		0			c.C685T												29.0	35.0	33.0					19																	16641681		1987	4155	6142	SO:0001587	stop_gained	10523	exon6			GGGCCTGCTTGCG	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.718C>T	19.37:g.16641681G>A	ENSP00000198939:p.Gln240*		23	0	0		38	0.11	4	NM_006387	170	0.00	0		Nonsense_Mutation	SNP	ENST00000198939.6	37		.	.	.	.	.	.	.	.	.	.	G	39	7.312017	0.98203	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-18.6228	17.6877	0.88260	0.0:0.0:1.0:0.0	.	.	.	.	X	229;240	.	ENSP00000198939:Q240X	Q	-	1	0	CHERP	16502681	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.266000	0.78452	2.441000	0.82636	0.462000	0.41574	CAG			0.692	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000403372.1		NM_006387	
KIAA1683	80726	mdanderson.org	37	19	18368036	18368036	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:18368036G>T	ENST00000600328.3	-	4	3690	c.3497C>A	c.(3496-3498)gCa>gAa	p.A1166E	KIAA1683_ENST00000600359.3_Missense_Mutation_p.A1120E|PDE4C_ENST00000355502.3_5'Flank|KIAA1683_ENST00000392413.4_Missense_Mutation_p.A1353E|PDE4C_ENST00000596647.1_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1166						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CGAGGGGTCTGCTGGTCCCAA	0.617																																					p.A1353E													.	.			0			c.C4058A												87.0	75.0	79.0					19																	18368036		2203	4300	6503	SO:0001583	missense	80726	exon4			GGGTCTGCTGGTC	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3497C>A	19.37:g.18368036G>T	ENSP00000470780:p.Ala1166Glu		58	0	0		48	0.06	3	NM_001145304	3	0.00	0	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800252	0.31869	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.03441	4.02;4.01;3.93	3.31	-2.24	0.06909	.	1.114820	0.07082	N	0.837280	T	0.02970	0.0088	N	0.20986	0.625	0.09310	N	1	B;B	0.26081	0.126;0.141	B;B	0.20767	0.031;0.031	T	0.46331	-0.9199	10	0.66056	D	0.02	-0.0491	7.6148	0.28152	0.0:0.4108:0.4649:0.1243	.	1353;1166	E9PDE0;Q9H0B3	.;K1683_HUMAN	E	1353;1166;1120;430;780	ENSP00000376213:A1353E;ENSP00000352774:A1166E;ENSP00000404501:A1120E	ENSP00000352774:A1166E	A	-	2	0	KIAA1683	18229036	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.637000	0.05459	-0.235000	0.09767	0.462000	0.41574	GCA			0.617	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000466312.3			
TMEM161A	54929	mdanderson.org	37	19	19232386	19232386	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:19232386C>T	ENST00000162044.9	-	8	812	c.748G>A	c.(748-750)Gcc>Acc	p.A250T	TMEM161A_ENST00000587583.2_Missense_Mutation_p.A225T|TMEM161A_ENST00000450333.2_Missense_Mutation_p.A147T	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	250					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TGGGTCTGGGCCAGCCGCAGG	0.642																																					p.A250T													.	.			0			c.G748A												38.0	43.0	41.0					19																	19232386		2203	4300	6503	SO:0001583	missense	54929	exon8			TCTGGGCCAGCCG	BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.748G>A	19.37:g.19232386C>T	ENSP00000162044:p.Ala250Thr		52	0	0		41	0.07	3	NM_017814	51	0.00	0	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124345	0.94429	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.77116	0.4083	M	0.70842	2.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.79936	-0.1593	9	0.87932	D	0	-0.9432	13.438	0.61094	0.0:1.0:0.0:0.0	.	147;147;250	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	T	147;250	.	ENSP00000162044:A250T	A	-	1	0	TMEM161A	19093386	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	4.868000	0.63021	2.257000	0.74773	0.591000	0.81541	GCC			0.642	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460089.2		NM_017814	
WDR62	284403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36582162	36582162	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:36582162G>A	ENST00000270301.7	+	17	2095	c.2095G>A	c.(2095-2097)Gtg>Atg	p.V699M	WDR62_ENST00000401500.2_Missense_Mutation_p.V699M			O43379	WDR62_HUMAN	WD repeat domain 62	699					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AAGCATCTCAGTGATTGACTT	0.592																																					p.V699M													.	.			0			c.G2095A												102.0	81.0	88.0					19																	36582162		2203	4300	6503	SO:0001583	missense	284403	exon17			ATCTCAGTGATTG	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.2095G>A	19.37:g.36582162G>A	ENSP00000270301:p.Val699Met		97	0	0		93	0.11	10	NM_173636	145	0.28	40	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779747	0.70107	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.61040	0.73;0.14	5.35	3.15	0.36227	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.531530	0.18790	N	0.131084	T	0.59595	0.2205	L	0.49778	1.585	0.80722	D	1	D;D	0.59357	0.985;0.975	P;P	0.56751	0.805;0.804	T	0.58769	-0.7578	10	0.59425	D	0.04	-12.1109	4.2303	0.10599	0.0838:0.1591:0.592:0.1651	.	699;699	O43379-4;O43379	.;WDR62_HUMAN	M	699	ENSP00000384792:V699M;ENSP00000270301:V699M	ENSP00000270301:V699M	V	+	1	0	WDR62	41274002	0.969000	0.33509	0.866000	0.34008	0.999000	0.98932	2.038000	0.41184	0.773000	0.33404	0.655000	0.94253	GTG			0.592	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000457436.1		NM_015671	
DMWD	1762	mdanderson.org	37	19	46287528	46287528	+	Silent	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:46287528G>A	ENST00000270223.6	-	5	2043	c.1998C>T	c.(1996-1998)ggC>ggT	p.G666G	DMPK_ENST00000447742.2_5'Flank|DMPK_ENST00000458663.2_5'Flank|DMWD_ENST00000377735.3_Silent_p.G641G|AC011530.4_ENST00000593999.1_Intron|DMWD_ENST00000601370.1_5'Flank|DMPK_ENST00000354227.5_5'Flank|DMPK_ENST00000291270.4_5'Flank	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	666										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		TCGGGGAGTTGCCTGGTTGGG	0.632																																					p.G666G													.	.			0			c.C1998T												61.0	56.0	58.0					19																	46287528		2203	4300	6503	SO:0001819	synonymous_variant	1762	exon5			GGAGTTGCCTGGT	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1998C>T	19.37:g.46287528G>A			30	0	0		24	0.13	3	NM_004943	48	0.00	0		Silent	SNP	ENST00000270223.6	37	CCDS33054.1																																																																																					0.632	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402063.1		NM_004943	
SIGLEC9	27180	mdanderson.org	37	19	51630549	51630549	+	Silent	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:51630549G>A	ENST00000250360.3	+	4	1078	c.1011G>A	c.(1009-1011)ctG>ctA	p.L337L	SIGLEC9_ENST00000440804.3_Silent_p.L337L	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	337					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ACGTCTCCCTGCAGAGTGAGT	0.592																																					p.L337L													.	.			0			c.G1011A												19.0	18.0	18.0					19																	51630549		2203	4300	6503	SO:0001819	synonymous_variant	27180	exon4			CTCCCTGCAGAGT	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1011G>A	19.37:g.51630549G>A			38	0	0		47	0.06	3	NM_014441	31	0.00	0	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	CCDS12825.1																																																																																					0.592	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464224.1		NM_014441	
PPP2R1A	5518	mdanderson.org	37	19	52723049	52723049	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:52723049G>T	ENST00000322088.6	+	10	1292	c.1234G>T	c.(1234-1236)Gct>Tct	p.A412S	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.A357S|CTD-2525I3.3_ENST00000593857.1_RNA|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.A233S	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	412	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TGTGGAGCTGGCTGAGGACGC	0.622			Mis		clear cell ovarian carcinoma																																p.A412S				Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	PPP2R1A,NS,carcinoma,-1,1	PPP2R1A	-1	1	0			c.G1234T												67.0	60.0	62.0					19																	52723049		2203	4300	6503	SO:0001583	missense	5518	exon10			GAGCTGGCTGAGG		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1234G>T	19.37:g.52723049G>T	ENSP00000324804:p.Ala412Ser		38	0	0		42	0.10	4	NM_014225	805	0.00	0	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	G	32	5.165833	0.94768	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.18174	2.23;2.23	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000011	T	0.37404	0.1002	M	0.89214	3.015	0.58432	D	0.999999	P;P	0.38455	0.522;0.632	P;P	0.46049	0.502;0.463	T	0.39231	-0.9624	10	0.59425	D	0.04	-17.5729	15.5205	0.75862	0.0:0.0:1.0:0.0	.	357;412	F5H3X9;P30153	.;2AAA_HUMAN	S	402;332;412;357	ENSP00000324804:A412S;ENSP00000415067:A357S	ENSP00000324804:A412S	A	+	1	0	PPP2R1A	57414861	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.647000	0.91057	2.605000	0.88082	0.655000	0.94253	GCT			0.622	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000267967.2		NM_014225	
ZNF525	170958	broad.mit.edu	37	19	53879043	53879043	+	Silent	SNP	T	T	C	rs62115350		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:53879043T>C	ENST00000475179.1	+	3	150	c.36T>C	c.(34-36)gaT>gaC	p.D12D	ZNF525_ENST00000491101.1_Silent_p.D12D|ZNF525_ENST00000474037.1_Silent_p.D12D|ZNF525_ENST00000467003.1_5'UTR|ZNF525_ENST00000593918.1_Silent_p.D12D			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						CATTCAGGGATGTGGCCATAG	0.448																																					.													.	ZNF525	35		0			.																																									SO:0001819	synonymous_variant	170958	.			CAGGGATGTGGCC	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000475179.1:c.36T>C	19.37:g.53879043T>C			41	0.0487804878	2		47	0.06	3	.	8	0.00	0	Q8TF23	Silent	SNP	ENST00000475179.1	37																																																																																						0.448	ZNF525-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000350553.1		NR_003699	
NLRP8	126205	mdanderson.org	37	19	56487528	56487528	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr19:56487528G>T	ENST00000291971.3	+	8	2806	c.2735G>T	c.(2734-2736)tGc>tTc	p.C912F	NLRP8_ENST00000590542.1_Missense_Mutation_p.C893F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	912					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		ACCTTTAATTGCTGTCAGGAT	0.383																																					p.C912F													.	.			0			c.G2735T												112.0	106.0	108.0					19																	56487528		2203	4300	6503	SO:0001583	missense	126205	exon8			TTAATTGCTGTCA	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2735G>T	19.37:g.56487528G>T	ENSP00000291971:p.Cys912Phe		73	0	0		82	0.06	5	NM_176811	0		0	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	9.342	1.063227	0.19987	.	.	ENSG00000179709	ENST00000291971	T	0.52983	0.64	2.67	2.67	0.31697	.	.	.	.	.	T	0.45034	0.1322	N	0.08118	0	0.09310	N	1	D;D	0.76494	0.997;0.999	D;D	0.73380	0.975;0.98	T	0.27434	-1.0074	9	0.59425	D	0.04	.	8.9897	0.36017	0.0:0.0:1.0:0.0	.	893;912	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	912	ENSP00000291971:C912F	ENSP00000291971:C912F	C	+	2	0	NLRP8	61179340	0.981000	0.34729	0.020000	0.16555	0.062000	0.15995	2.336000	0.43938	1.827000	0.53221	0.514000	0.50259	TGC			0.383	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457462.1		NM_176811	
RNASEH1	246243	broad.mit.edu	37	2	3599780	3599780	+	Missense_Mutation	SNP	G	G	T	rs201104222		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr2:3599780G>T	ENST00000315212.3	-	3	718	c.363C>A	c.(361-363)agC>agA	p.S121R		NM_002936.3	NP_002927.2	O60930	RNH1_HUMAN	ribonuclease H1	121					mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	13	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		CCGGCTCCACGCTCGGCTTCA	0.512																																					p.S121R													.	RNASEH1	27		0			c.C363A												95.0	93.0	93.0					2																	3599780		2203	4300	6503	SO:0001583	missense	246243	exon3			CTCCACGCTCGGC	AF039652	CCDS1647.1	2p25	2008-03-11			ENSG00000171865	ENSG00000171865	3.1.26.-		18466	protein-coding gene	gene with protein product	"""RNase H1"""	604123				12036296, 17964265	Standard	XR_244873		Approved		uc002qxt.3	O60930	OTTHUMG00000090279	ENST00000315212.3:c.363C>A	2.37:g.3599780G>T	ENSP00000313350:p.Ser121Arg		79	0	0		95	0.03	3	NM_002936	158	0.00	0	B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Missense_Mutation	SNP	ENST00000315212.3	37	CCDS1647.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570454	0.28003	.	.	ENSG00000171865	ENST00000315212	T	0.46063	0.88	6.03	2.87	0.33458	.	1.746830	0.02220	N	0.063930	T	0.27489	0.0675	N	0.19112	0.55	0.09310	N	1	P	0.49635	0.926	B	0.41666	0.363	T	0.21861	-1.0233	10	0.17369	T	0.5	-30.7786	3.0247	0.06086	0.3013:0.2331:0.4656:0.0	.	121	O60930	RNH1_HUMAN	R	121	ENSP00000313350:S121R	ENSP00000313350:S121R	S	-	3	2	RNASEH1	3577655	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.487000	0.22356	0.804000	0.34136	-0.137000	0.14449	AGC			0.512	RNASEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206605.2			
EPAS1	2034	broad.mit.edu;mdanderson.org	37	2	46605204	46605204	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr2:46605204G>C	ENST00000263734.3	+	10	1931	c.1421G>C	c.(1420-1422)aGc>aCc	p.S474T		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	474	Poly-Ser.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AGTGCCACCAGCAGCAGCAGC	0.647																																					p.S474T													.	EPAS1	83		0			c.G1421C												11.0	11.0	11.0					2																	46605204		2187	4279	6466	SO:0001583	missense	2034	exon10			CCACCAGCAGCAG	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1421G>C	2.37:g.46605204G>C	ENSP00000263734:p.Ser474Thr		63	0	0		75	0.05	4	NM_001430	30	0.00	0	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	7.913	0.736896	0.15574	.	.	ENSG00000116016	ENST00000263734	T	0.52057	0.68	0.355	0.355	0.16069	.	0.384965	0.33875	N	0.004469	T	0.31606	0.0802	L	0.46157	1.445	0.26854	N	0.968104	B	0.31931	0.347	B	0.20577	0.03	T	0.15065	-1.0450	9	0.41790	T	0.15	.	.	.	.	.	474	Q99814	EPAS1_HUMAN	T	474	ENSP00000263734:S474T	ENSP00000263734:S474T	S	+	2	0	EPAS1	46458708	0.936000	0.31750	0.816000	0.32577	0.971000	0.66376	0.064000	0.14437	0.458000	0.26988	0.089000	0.15464	AGC			0.647	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250752.2		NM_001430	
STAT1	6772	mdanderson.org	37	2	191864377	191864377	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr2:191864377G>T	ENST00000361099.3	-	7	903	c.516C>A	c.(514-516)ttC>ttA	p.F172L	STAT1_ENST00000540176.1_Missense_Mutation_p.F172L|STAT1_ENST00000409465.1_Missense_Mutation_p.F172L|STAT1_ENST00000392323.2_Missense_Mutation_p.F174L|STAT1_ENST00000392322.3_Missense_Mutation_p.F172L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	172					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			TTTTGCATTTGAAGTCATATT	0.383																																					p.F172L													.	.			0			c.C516A												136.0	124.0	128.0					2																	191864377		2202	4299	6501	SO:0001583	missense	6772	exon7			GCATTTGAAGTCA		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.516C>A	2.37:g.191864377G>T	ENSP00000354394:p.Phe172Leu		98	0	0		84	0.05	4	NM_139266	648	0.00	0	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026340	0.75390	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000544783;ENST00000424722	T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18	5.79	-0.81	0.10860	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.000000	0.85682	D	0.000000	T	0.73760	0.3628	M	0.84683	2.71	0.50313	D	0.99986	D;P	0.76494	0.999;0.906	D;P	0.71656	0.974;0.703	T	0.73773	-0.3877	10	0.40728	T	0.16	-24.792	13.673	0.62436	0.4335:0.0:0.5665:0.0	.	172;172	P42224-2;P42224	.;STAT1_HUMAN	L	172;172;172;172;174;80;172	ENSP00000354394:F172L;ENSP00000386244:F172L;ENSP00000438703:F172L;ENSP00000376136:F172L;ENSP00000376137:F174L;ENSP00000402548:F172L	ENSP00000354394:F172L	F	-	3	2	STAT1	191572622	0.620000	0.27068	0.984000	0.44739	0.968000	0.65278	-0.083000	0.11286	-0.336000	0.08438	-0.982000	0.02568	TTC			0.383	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255997.3		NM_007315	
ENTPD6	955	mdanderson.org	37	20	25187787	25187787	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr20:25187787G>A	ENST00000376652.4	+	3	293	c.130G>A	c.(130-132)Gca>Aca	p.A44T	ENTPD6_ENST00000360031.2_Missense_Mutation_p.A43T|ENTPD6_ENST00000354989.5_Missense_Mutation_p.A27T|ENTPD6_ENST00000433259.2_Missense_Mutation_p.A44T			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	44					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						GGCGAAGGTGGCATACCCCCT	0.622																																					p.A44T													.	.			0			c.G130A												56.0	55.0	55.0					20																	25187787		2203	4300	6503	SO:0001583	missense	955	exon3			AAGGTGGCATACC	AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.130G>A	20.37:g.25187787G>A	ENSP00000365840:p.Ala44Thr		79	0.0126582278	1		42	0.07	3	NM_001247	54	0.00	0	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Missense_Mutation	SNP	ENST00000376652.4	37	CCDS13170.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053550	0.36277	.	.	ENSG00000197586	ENST00000354989;ENST00000360031;ENST00000376652;ENST00000439162;ENST00000417467;ENST00000433259;ENST00000435520;ENST00000418890;ENST00000425813	T;T;T;T;T;T;T;T;T	0.34072	2.07;2.21;2.21;1.7;1.38;2.14;1.42;1.38;2.32	4.95	3.96	0.45880	.	1.026250	0.07690	N	0.938507	T	0.24160	0.0585	L	0.29908	0.895	0.27211	N	0.959919	P;P;P;P;B;B;B;B	0.43094	0.651;0.651;0.651;0.799;0.449;0.181;0.181;0.321	B;B;B;B;B;B;B;B	0.33339	0.084;0.084;0.084;0.162;0.154;0.054;0.036;0.073	T	0.10222	-1.0639	10	0.42905	T	0.14	5.4442	7.8071	0.29209	0.1208:0.0:0.8792:0.0	.	26;44;44;44;27;43;43;44	B4DDM7;B4DNK6;E7EP89;Q5QPI9;O75354-2;D3DW49;Q5QPJ2;O75354	.;.;.;.;.;.;.;ENTP6_HUMAN	T	27;43;44;26;26;44;43;27;44	ENSP00000347084:A27T;ENSP00000353131:A43T;ENSP00000365840:A44T;ENSP00000408098:A26T;ENSP00000395064:A26T;ENSP00000401895:A44T;ENSP00000398844:A43T;ENSP00000390511:A27T;ENSP00000390646:A44T	ENSP00000347084:A27T	A	+	1	0	ENTPD6	25135787	0.995000	0.38212	0.730000	0.30809	0.745000	0.42441	2.125000	0.42016	1.223000	0.43536	0.462000	0.41574	GCA			0.622	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078414.2			
ANKRD20A11P	391267	broad.mit.edu	37	21	15343746	15343749	+	RNA	DEL	TCTG	TCTG	-	rs201012227|rs570464638	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	TCTG	TCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr21:15343746_15343749delTCTG	ENST00000344693.5	-	0	736				RNU6-954P_ENST00000411355.1_RNA	NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		CTCTGTGCTTTCTGATGTGCTGCT	0.407														730	0.145767	0.174	0.121	5008	,	,		17936	0.1806		0.0924	False		,,,				2504	0.1442				.													.	.			0			.																																											0	.			GTGCTTTCTGATG			21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15343746_15343749delTCTG			5	0	0		13	0.38	5	.	0		0		RNA	DEL	ENST00000344693.5	37																																																																																						0.407	ANKRD20A11P-005	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157750.1			
GGT3P	2679	broad.mit.edu	37	22	18770143	18770144	+	RNA	INS	-	-	T	rs372641507		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr22:18770143_18770144insT	ENST00000412448.1	-	0	834							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										aattttaattgtttttttttaG	0.421																																					.													.	.			0			.																																											0	.			TTAATTGTTTTTT			22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18770152_18770152dupT			5	0	0		10	0.20	2	.	1	0.00	0		RNA	INS	ENST00000412448.1	37																																																																																						0.421	GGT3P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000341281.1		NR_003267	
GAS2L1	10634	mdanderson.org	37	22	29704567	29704567	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr22:29704567G>T	ENST00000406549.3	+	2	622	c.472G>T	c.(472-474)Gtg>Ttg	p.V158L	GAS2L1_ENST00000471961.1_Missense_Mutation_p.V158L|GAS2L1_ENST00000341313.6_Missense_Mutation_p.V158L|GAS2L1_ENST00000360113.2_Missense_Mutation_p.V158L|GAS2L1_ENST00000403764.1_Missense_Mutation_p.V158L|GAS2L1_ENST00000407854.1_Missense_Mutation_p.V158L|GAS2L1_ENST00000407647.2_Missense_Mutation_p.V158L	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	158					cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)			endometrium(2)|lung(2)|prostate(1)	5						CCCACGCCTCGTGCAGTTTGA	0.701																																					p.V158L													.	.			0			c.G472T												24.0	27.0	26.0					22																	29704567		2194	4298	6492	SO:0001583	missense	10634	exon2			CGCCTCGTGCAGT	BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.472G>T	22.37:g.29704567G>T	ENSP00000383995:p.Val158Leu		22	0	0		24	0.13	3	NM_152237	101	0.00	0	B5MCR7|Q53EN7|Q92640|Q9BUY9	Missense_Mutation	SNP	ENST00000406549.3	37		.	.	.	.	.	.	.	.	.	.	G	21.4	4.150126	0.78001	.	.	ENSG00000185340	ENST00000407647;ENST00000333679;ENST00000406549;ENST00000360113;ENST00000341313;ENST00000403764;ENST00000471961;ENST00000407854	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	4.85	3.75	0.43078	Calponin homology domain (2);	0.085623	0.45361	D	0.000366	T	0.38692	0.1050	L	0.27053	0.805	0.35191	D	0.773414	D;D;P;P	0.55385	0.965;0.971;0.912;0.912	P;P;P;P	0.54965	0.687;0.756;0.765;0.765	T	0.51332	-0.8719	10	0.72032	D	0.01	-14.147	6.0291	0.19671	0.2957:0.0:0.7043:0.0	.	158;158;158;158	B5MCR7;E7EQM6;A0A5E8;Q99501	.;.;.;GA2L1_HUMAN	L	158	ENSP00000385554:V158L;ENSP00000383995:V158L;ENSP00000353229:V158L;ENSP00000344012:V158L;ENSP00000385358:V158L;ENSP00000450152:V158L;ENSP00000385023:V158L	ENSP00000332834:V158L	V	+	1	0	GAS2L1	28034567	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	2.772000	0.47678	2.250000	0.74265	0.491000	0.48974	GTG			0.701	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000321365.1		NM_006478	
CHL1	10752	mdanderson.org	37	3	407688	407688	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr3:407688G>T	ENST00000256509.2	+	15	2283	c.1641G>T	c.(1639-1641)atG>atT	p.M547I	CHL1_ENST00000397491.2_Missense_Mutation_p.M531I|CHL1-AS1_ENST00000417612.1_RNA|CHL1-AS1_ENST00000608098.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AATTGCATATGCTTGAATTAC	0.353																																					p.M547I													.	.			0			c.G1641T												103.0	99.0	100.0					3																	407688		2203	4300	6503	SO:0001583	missense	10752	exon13			GCATATGCTTGAA	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1641G>T	3.37:g.407688G>T	ENSP00000256509:p.Met547Ile		67	0	0		44	0.07	3	NM_001253388	0		0	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	2.498	-0.315917	0.05422	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.12465	2.68;2.68	5.18	-4.4	0.03600	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.929343	0.09216	N	0.832555	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.36553	-0.9743	10	0.48119	T	0.1	.	3.5384	0.07802	0.384:0.1083:0.4003:0.1074	.	531;531;547	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	I	547;531	ENSP00000256509:M547I;ENSP00000380628:M531I	ENSP00000256509:M547I	M	+	3	0	CHL1	382688	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.585000	0.05794	-0.723000	0.04915	-0.251000	0.11542	ATG			0.353	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207155.2		NM_006614	
IL17RC	84818	mdanderson.org	37	3	9974650	9974650	+	Silent	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr3:9974650C>T	ENST00000295981.3	+	19	1967	c.1749C>T	c.(1747-1749)ggC>ggT	p.G583G	CRELD1_ENST00000326434.5_5'Flank|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000397170.3_5'Flank|IL17RC_ENST00000498214.1_3'UTR|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000455057.1_Silent_p.G480G|CRELD1_ENST00000383811.3_5'Flank|IL17RC_ENST00000403601.3_Silent_p.G512G|IL17RC_ENST00000413608.1_Silent_p.G499G|IL17RC_ENST00000416074.2_Silent_p.G338G|IL17RC_ENST00000383812.4_Silent_p.G497G	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	583	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGCCAGGGGCCGCGCGGCTC	0.741											OREG0015383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G583G													.	.			0			c.C1749T												8.0	11.0	10.0					3																	9974650		1602	3502	5104	SO:0001819	synonymous_variant	84818	exon19			CAGGGGCCGCGCG	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1749C>T	3.37:g.9974650C>T			28	0	0	661	32	0.09	3	NM_153461	25	0.00	0	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	ENST00000295981.3	37	CCDS2590.1																																																																																					0.741	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250526.2		NM_032732	
FEZF2	55079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	62355878	62355878	+	Silent	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr3:62355878G>A	ENST00000283268.3	-	5	1554	c.1260C>T	c.(1258-1260)gcC>gcT	p.A420A	PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000475839.1_Silent_p.A420A|FEZF2_ENST00000486811.1_Silent_p.A420A	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	420					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		TGCCGCAAGTGGCGCACGTGA	0.522																																					p.A420A	NSCLC(170;1772 2053 12525 15604 23984)												.	.			0			c.C1260T												253.0	230.0	238.0					3																	62355878		2203	4300	6503	SO:0001819	synonymous_variant	55079	exon5			GCAAGTGGCGCAC	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1260C>T	3.37:g.62355878G>A			188	0	0		155	0.11	17	NM_018008	0		0	A8K349|Q9BZ91|Q9NWB9	Silent	SNP	ENST00000283268.3	37	CCDS2897.1																																																																																					0.522	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351813.1		NM_018008	
NEK11	79858	mdanderson.org	37	3	130947422	130947422	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr3:130947422G>T	ENST00000510769.1	+	11	1388	c.1135G>T	c.(1135-1137)Gat>Tat	p.D379Y	NEK11_ENST00000508196.1_Missense_Mutation_p.D484Y|NEK11_ENST00000412440.2_Missense_Mutation_p.D300Y|NEK11_ENST00000429253.2_Missense_Mutation_p.D484Y|NEK11_ENST00000510688.1_Missense_Mutation_p.D484Y|NEK11_ENST00000383366.4_Missense_Mutation_p.D484Y					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						TGATGCATTTGATTCCTATTG	0.398																																					p.D484Y													.	.			0			c.G1450T												139.0	132.0	135.0					3																	130947422		2203	4300	6503	SO:0001583	missense	79858	exon15			GCATTTGATTCCT	AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.1135G>T	3.37:g.130947422G>T	ENSP00000421549:p.Asp379Tyr		56	0	0		51	0.06	3	NM_024800	7	0.00	0		Missense_Mutation	SNP	ENST00000510769.1	37		.	.	.	.	.	.	.	.	.	.	G	14.64	2.596649	0.46318	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000510688;ENST00000383366;ENST00000412440;ENST00000508196	T;T;T;T;T;T	0.76578	-1.03;-0.78;-0.89;-0.78;-1.01;-0.78	5.67	4.79	0.61399	.	0.000000	0.43747	D	0.000525	D	0.84238	0.5428	L	0.50333	1.59	0.38296	D	0.942857	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.72338	0.973;0.963;0.977;0.95	D	0.87130	0.2196	10	0.87932	D	0	.	13.9377	0.64034	0.0:0.1523:0.8477:0.0	.	379;300;484;484	E9PHI8;B4DDN2;Q8NG66-4;Q8NG66	.;.;.;NEK11_HUMAN	Y	379;484;484;484;300;484	ENSP00000421549:D379Y;ENSP00000397180:D484Y;ENSP00000423458:D484Y;ENSP00000372857:D484Y;ENSP00000411888:D300Y;ENSP00000421851:D484Y	ENSP00000372857:D484Y	D	+	1	0	NEK11	132430112	1.000000	0.71417	0.996000	0.52242	0.184000	0.23303	3.812000	0.55628	1.366000	0.46076	0.655000	0.94253	GAT			0.398	NEK11-005	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000356757.1		NM_024800	
HPS3	84343	broad.mit.edu	37	3	148858028	148858028	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr3:148858028G>A	ENST00000296051.2	+	2	595	c.455G>A	c.(454-456)tGc>tAc	p.C152Y	HPS3_ENST00000460120.1_Intron	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	152					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CTCGTTGGCTGCACAAATAAA	0.388									Hermansky-Pudlak syndrome																												p.C152Y													.	HPS3	104		0			c.G455A												123.0	122.0	122.0					3																	148858028		2203	4300	6503	SO:0001583	missense	84343	exon2	Familial Cancer Database	HPS, HPS1-8	TTGGCTGCACAAA	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.455G>A	3.37:g.148858028G>A	ENSP00000296051:p.Cys152Tyr		174	0	0		159	0.03	5	NM_032383	8	0.00	0	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	ENST00000296051.2	37	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479905	0.84747	.	.	ENSG00000163755	ENST00000296051	T	0.65178	-0.14	5.55	5.55	0.83447	.	0.047486	0.85682	D	0.000000	T	0.79764	0.4502	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.80830	-0.1207	10	0.87932	D	0	-16.6143	19.8692	0.96843	0.0:0.0:1.0:0.0	.	152	Q969F9	HPS3_HUMAN	Y	152	ENSP00000296051:C152Y	ENSP00000296051:C152Y	C	+	2	0	HPS3	150340718	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	4.552000	0.60747	2.762000	0.94881	0.585000	0.79938	TGC			0.388	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356151.1		NM_032383	
PKD2	5311	mdanderson.org	37	4	88964595	88964595	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr4:88964595G>T	ENST00000237596.2	+	5	1371	c.1305G>T	c.(1303-1305)ctG>ctT	p.L435L	PKD2_ENST00000508588.1_5'UTR	NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		ACATTAACCTGTTCTGTGTGG	0.468																																					p.L435L													.	.			0			c.G1305T												133.0	93.0	107.0					4																	88964595		2203	4300	6503	SO:0001819	synonymous_variant	5311	exon5			TAACCTGTTCTGT	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.1305G>T	4.37:g.88964595G>T			65	0	0		42	0.07	3	NM_000297	14	0.00	0	Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	ENST00000237596.2	37	CCDS3627.1																																																																																					0.468	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253042.4		NM_000297	
UBE2D3	7323	broad.mit.edu	37	4	103730964	103730964	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr4:103730964G>T	ENST00000453744.2	-	3	586	c.73C>A	c.(73-75)Cca>Aca	p.P25T	UBE2D3_ENST00000502404.1_5'UTR|UBE2D3_ENST00000349311.8_Missense_Mutation_p.P25T|UBE2D3_ENST00000394801.4_Missense_Mutation_p.P25T|UBE2D3_ENST00000394804.2_Missense_Mutation_p.P25T|UBE2D3_ENST00000505207.1_5'UTR|UBE2D3_ENST00000507845.1_5'UTR|UBE2D3_ENST00000321805.7_Missense_Mutation_p.P25T|UBE2D3_ENST00000357194.6_Missense_Mutation_p.P27T|UBE2D3_ENST00000394803.5_Missense_Mutation_p.P25T|UBE2D3_ENST00000343106.5_Missense_Mutation_p.P25T|UBE2D3_ENST00000338145.3_Missense_Mutation_p.P25T|UBE2D3_ENST00000350435.7_Missense_Mutation_p.P19T|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000504211.1_5'UTR	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	25					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TCCCCAACTGGACCTGCAGAA	0.363																																					p.P27T													UBE2D3_ENST00000343106,right_upper_lobe,carcinoma,0,2	UBE2D3	25	2	0			c.C79A												111.0	114.0	113.0					4																	103730964		2203	4300	6503	SO:0001583	missense	7323	exon2			CAACTGGACCTGC	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.73C>A	4.37:g.103730964G>T	ENSP00000396901:p.Pro25Thr		301	0	0		256	0.02	4	NM_181893	475	0.00	0	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	ENST00000453744.2	37	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410624	0.83340	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000357194;ENST00000508238;ENST00000502690;ENST00000508249	T;T;T;T;T;T;T;T;T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25;0.25	5.58	5.58	0.84498	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.74061	0.3667	M	0.81112	2.525	0.80722	D	1	B;B;B	0.26935	0.164;0.122;0.164	B;P;B	0.44561	0.401;0.453;0.187	T	0.74569	-0.3622	10	0.87932	D	0	.	19.6572	0.95847	0.0:0.0:1.0:0.0	.	27;25;25	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	T	25;25;25;25;25;25;19;25;25;27;25;25;25	ENSP00000396901:P25T;ENSP00000378280:P25T;ENSP00000378282:P25T;ENSP00000378283:P25T;ENSP00000345285:P25T;ENSP00000318494:P25T;ENSP00000337262:P19T;ENSP00000337208:P25T;ENSP00000344069:P25T;ENSP00000349722:P27T;ENSP00000423487:P25T;ENSP00000425762:P25T;ENSP00000421310:P25T	ENSP00000318494:P25T	P	-	1	0	UBE2D3	103950075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.494000	0.97962	2.630000	0.89119	0.650000	0.86243	CCA			0.363	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253791.2		NM_181893	
LOC90768	90768	mdanderson.org	37	4	183064680	183064680	+	RNA	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr4:183064680C>T	ENST00000315302.2	-	0	382				AC108142.1_ENST00000505873.1_RNA|AC108142.1_ENST00000508968.1_RNA|AC108142.1_ENST00000509012.1_RNA|RP11-402C9.1_ENST00000505389.1_RNA|AC108142.1_ENST00000511052.1_RNA|AC108142.1_ENST00000513752.1_RNA	NR_027107.1																						GGTGACTCAGCTGACCTGAAA	0.507																																					.													.	.			0			.																																											0	.			ACTCAGCTGACCT																													4.37:g.183064680C>T			161	0	0		116	0.04	5	.	1	0.00	0		RNA	SNP	ENST00000315302.2	37																																																																																						0.507	AC108142.1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000257786.2			
PLEKHG4B	153478	bcgsc.ca;mdanderson.org	37	5	174144	174144	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr5:174144G>A	ENST00000283426.6	+	16	3315	c.3265G>A	c.(3265-3267)Gca>Aca	p.A1089T		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1089	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGCAAGCTCGGCAGAGGTCAA	0.587																																					p.A1089T													.	PLEKHG4B	167		0			c.G3265A												63.0	50.0	54.0					5																	174144		2203	4300	6503	SO:0001583	missense	153478	exon16			AGCTCGGCAGAGG	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3265G>A	5.37:g.174144G>A	ENSP00000283426:p.Ala1089Thr		101	0	0		96	0.05	5	NM_052909	1	0.00	0		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	G	2.443	-0.328148	0.05314	.	.	ENSG00000153404	ENST00000283426	T	0.11495	2.77	3.38	2.47	0.30058	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.	.	.	.	T	0.11153	0.0272	M	0.69185	2.1	0.09310	N	0.999999	P	0.37824	0.609	B	0.33690	0.168	T	0.21999	-1.0229	9	0.16896	T	0.51	.	9.4005	0.38428	0.0:0.4289:0.5711:0.0	.	1089	Q96PX9	PKH4B_HUMAN	T	1089	ENSP00000283426:A1089T	ENSP00000283426:A1089T	A	+	1	0	PLEKHG4B	227144	0.043000	0.20138	0.006000	0.13384	0.201000	0.24016	0.838000	0.27572	0.363000	0.24346	0.467000	0.42956	GCA			0.587	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365359.1		NM_052909	
PCDHB10	56126	mdanderson.org	37	5	140573922	140573922	+	Silent	SNP	C	C	T	rs376773467		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr5:140573922C>T	ENST00000239446.4	+	1	1981	c.1797C>T	c.(1795-1797)aaC>aaT	p.N599N		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCCAGAACGCCTGGCTGT	0.721																																					p.N599N													.	.			0			c.C1797T												4.0	6.0	5.0					5																	140573922		1101	2431	3532	SO:0001819	synonymous_variant	56126	exon1			CCAGAACGCCTGG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1797C>T	5.37:g.140573922C>T			20	0	0		15	0.13	2	NM_018930	1	0.00	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																					0.721	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251821.1		NM_018930	
SIMC1	375484	broad.mit.edu	37	5	175717431	175717431	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr5:175717431G>T	ENST00000443967.1	+	4	1254	c.847G>T	c.(847-849)Gtg>Ttg	p.V283L	SIMC1_ENST00000341199.6_Intron|SIMC1_ENST00000430704.2_Intron|SIMC1_ENST00000429602.2_Missense_Mutation_p.V302L			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	283	Pro-rich.						SUMO polymer binding (GO:0032184)										TCCACAAGATGTGGCATACCT	0.557																																					.													.	.			0			.												99.0	87.0	91.0					5																	175717431		2203	4300	6503	SO:0001583	missense	375484	.			CAAGATGTGGCAT	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.847G>T	5.37:g.175717431G>T	ENSP00000406571:p.Val283Leu		158	0	0		155	0.03	4	.	4	0.00	0	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	ENST00000443967.1	37		.	.	.	.	.	.	.	.	.	.	G	7.507	0.653813	0.14580	.	.	ENSG00000170085	ENST00000443967;ENST00000429602;ENST00000377277	T;T	0.34667	2.17;1.35	3.45	0.623	0.17654	.	2.330170	0.02018	N	0.047581	T	0.25938	0.0632	.	.	.	0.22581	N	0.998968	B;B	0.28291	0.206;0.082	B;B	0.24394	0.053;0.008	T	0.16541	-1.0399	9	0.31617	T	0.26	-0.3786	7.5911	0.28021	0.3093:0.0:0.6907:0.0	.	302;283	B4DRM7;Q8NDZ2	.;CE025_HUMAN	L	283;302;194	ENSP00000406571:V283L;ENSP00000410552:V302L	ENSP00000366489:V194L	V	+	1	0	C5orf25	175650037	0.001000	0.12720	0.012000	0.15200	0.026000	0.11368	-0.012000	0.12699	0.101000	0.17610	0.603000	0.83216	GTG			0.557	SIMC1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000253155.2		NM_198567	
FAM8A1	51439	hgsc.bcm.edu	37	6	17602826	17602826	+	Nonsense_Mutation	SNP	G	G	T	rs74444948	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr6:17602826G>T	ENST00000259963.3	+	2	773	c.718G>T	c.(718-720)Gaa>Taa	p.E240*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	240						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TACAGGCAGAGAATATGTTAT	0.328																																					p.E240X													FAM8A1,NS,carcinoma,-1,2	FAM8A1	-1	2	0			c.G718T												100.0	101.0	101.0					6																	17602826		2203	4299	6502	SO:0001587	stop_gained	51439	exon2			GGCAGAGAATATG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.718G>T	6.37:g.17602826G>T	ENSP00000259963:p.Glu240*		41	0.0487804878	2		56	0.05	3	NM_016255	16	0.00	0	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	37	6.420554	0.97555	.	.	ENSG00000137414	ENST00000259963	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.04	18.5673	0.91121	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000259963:E240X	E	+	1	0	FAM8A1	17710805	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.467000	0.97671	2.356000	0.79943	0.644000	0.83932	GAA	0.008		0.328	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039950.1			
EHMT2	10919	mdanderson.org	37	6	31860678	31860678	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr6:31860678G>T	ENST00000375537.4	-	5	598	c.592C>A	c.(592-594)Cct>Act	p.P198T	EHMT2_ENST00000395728.3_Missense_Mutation_p.P255T|EHMT2_ENST00000375530.4_Missense_Mutation_p.P198T|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Missense_Mutation_p.P255T	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	198					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CGCTTCTCAGGGACCGGGGGC	0.627																																					p.P198T													.	.			0			c.C592A												27.0	30.0	29.0					6																	31860678		1508	2708	4216	SO:0001583	missense	10919	exon5			TCTCAGGGACCGG	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.592C>A	6.37:g.31860678G>T	ENSP00000364687:p.Pro198Thr		76	0	0		45	0.07	3	NM_025256	29	0.00	0	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699823	0.68501	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.94	4.94	0.65067	.	0.000000	0.47455	D	0.000225	T	0.25121	0.0610	N	0.08118	0	0.45946	D	0.998772	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.78314	0.987;0.991;0.981	T	0.21895	-1.0232	10	0.42905	T	0.14	.	15.5524	0.76164	0.0:0.0:1.0:0.0	.	255;198;198	A2ABF8;Q96KQ7-2;Q96KQ7	.;.;EHMT2_HUMAN	T	255;255;198;198;12	ENSP00000379078:P255T;ENSP00000364678:P255T;ENSP00000364680:P198T;ENSP00000364687:P198T	ENSP00000364678:P255T	P	-	1	0	EHMT2	31968657	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	4.702000	0.61817	2.727000	0.93392	0.655000	0.94253	CCT			0.627	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000076355.5		NM_006709	
MEP1A	4224	mdanderson.org	37	6	46766384	46766384	+	Splice_Site	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr6:46766384G>T	ENST00000230588.4	+	4	195		c.e4+1			NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)						digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			CCTCTTGCAGGTGAGTACCTG	0.468																																					.													.	.			0			c.186+1G>T												72.0	71.0	71.0					6																	46766384		2203	4300	6503	SO:0001630	splice_region_variant	4224	exon4			TTGCAGGTGAGTA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.186+1G>T	6.37:g.46766384G>T			25	0	0		24	0.13	3	NM_005588	0		0	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Splice_Site	SNP	ENST00000230588.4	37	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514292	0.27123	.	.	ENSG00000112818	ENST00000230588	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5269	0.67894	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MEP1A	46874343	1.000000	0.71417	0.968000	0.41197	0.152000	0.21847	5.038000	0.64177	2.563000	0.86464	0.557000	0.71058	.			0.468	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040803.1		NM_005588	Intron
WIPI2	26100	broad.mit.edu	37	7	5266833	5266833	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:5266833T>C	ENST00000288828.4	+	10	1103	c.871T>C	c.(871-873)Tgg>Cgg	p.W291R	WIPI2_ENST00000404704.3_Missense_Mutation_p.W291R|WIPI2_ENST00000484262.1_Missense_Mutation_p.W232R|WIPI2_ENST00000401525.3_Missense_Mutation_p.W273R|WIPI2_ENST00000382384.2_Missense_Mutation_p.W273R	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	291					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		GCCCACCACCTGGACCGGGTA	0.627																																					p.W291R													.	WIPI2	41		0			c.T871C												83.0	82.0	82.0					7																	5266833		2203	4300	6503	SO:0001583	missense	26100	exon10			ACCACCTGGACCG		CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.871T>C	7.37:g.5266833T>C	ENSP00000288828:p.Trp291Arg		78	0	0		79	0.04	3	NM_015610	241	0.00	0	B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	ENST00000288828.4	37	CCDS5339.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228242	0.79576	.	.	ENSG00000157954	ENST00000288828;ENST00000401525;ENST00000404704;ENST00000382384;ENST00000484262;ENST00000315176	T;T;T;T;T	0.45276	1.2;1.24;1.19;1.24;0.9	5.93	5.93	0.95920	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64940	0.2644	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.998;0.998	T	0.62343	-0.6874	10	0.23302	T	0.38	-25.0015	16.3829	0.83481	0.0:0.0:0.0:1.0	.	285;273;273;291;291	E7EVF6;Q9Y4P8-2;Q9Y4P8-4;Q9Y4P8-6;Q9Y4P8	.;.;.;.;WIPI2_HUMAN	R	291;273;291;273;232;285	ENSP00000288828:W291R;ENSP00000384945:W273R;ENSP00000385297:W291R;ENSP00000371821:W273R;ENSP00000429654:W232R	ENSP00000288828:W291R	W	+	1	0	WIPI2	5233359	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.608000	0.82898	2.271000	0.75665	0.459000	0.35465	TGG			0.627	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000241669.2		NM_015610	
BZW2	28969	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	16725542	16725542	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:16725542C>T	ENST00000433922.2	+	6	596	c.418C>T	c.(418-420)Ctt>Ttt	p.L140F	BZW2_ENST00000452975.2_Intron|BZW2_ENST00000405202.1_Missense_Mutation_p.L64F|BZW2_ENST00000258761.3_Missense_Mutation_p.L140F|BZW2_ENST00000432311.1_Intron|BZW2_ENST00000407633.1_5'Flank	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	140					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		TCTCCTCTTCCTTAAAGCCTT	0.443																																					p.L140F													.	BZW2	35		0			c.C418T												24.0	23.0	23.0					7																	16725542		2186	4266	6452	SO:0001583	missense	28969	exon6			CTCTTCCTTAAAG	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.418C>T	7.37:g.16725542C>T	ENSP00000397249:p.Leu140Phe		49	0.0612244898	3		55	0.38	21	NM_014038	79	0.22	17	A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339979	0.60963	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9	4.98	4.09	0.47781	.	0.082842	0.49305	D	0.000147	T	0.42223	0.1193	M	0.76328	2.33	0.80722	D	1	B;B;B	0.29862	0.107;0.037;0.259	B;B;B	0.22386	0.032;0.039;0.032	T	0.50906	-0.8772	10	0.66056	D	0.02	-10.6239	12.7312	0.57199	0.0:0.9205:0.0:0.0795	.	140;140;140	E7ETZ4;Q96JW5;Q9Y6E2	.;.;BZW2_HUMAN	F	140;140;140;64;140;140;140	ENSP00000403481:L140F;ENSP00000258761:L140F;ENSP00000397249:L140F;ENSP00000385577:L64F;ENSP00000412750:L140F;ENSP00000415924:L140F;ENSP00000416531:L140F	ENSP00000258761:L140F	L	+	1	0	BZW2	16692067	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.035000	0.70940	2.328000	0.79073	0.467000	0.42956	CTT			0.443	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253256.2		NM_014038	
ZAN	7455	broad.mit.edu	37	7	100349595	100349595	+	RNA	SNP	T	T	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:100349595T>A	ENST00000348028.3	+	0	2032				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CACCATTCCCTCAGAAAAACC	0.473																																					.													ZAN_ENST00000542585,NS,carcinoma,-1,2	ZAN	658	2	0			.												243.0	272.0	263.0					7																	100349595		1859	4103	5962			7455	.			ATTCCCTCAGAAA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349595T>A			129	0	0		160	0.04	6	.	8	0.00	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	2.503	-0.314727	0.05422	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.58797	0.31;0.31;0.31	2.67	-4.12	0.03916	.	.	.	.	.	T	0.23611	0.0571	N	0.02736	-0.51	0.22693	N	0.998849	B;B	0.23735	0.0;0.09	B;B	0.20184	0.0;0.028	T	0.09487	-1.0672	9	0.29301	T	0.29	.	2.072	0.03615	0.4961:0.2633:0.0944:0.1463	.	623;623	F5H0T8;Q9Y493	.;ZAN_HUMAN	T	623	ENSP00000445943:S623T;ENSP00000445091:S623T;ENSP00000444427:S623T	ENSP00000423579:S623T	S	+	1	0	ZAN	100187531	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.553000	0.06012	-1.415000	0.02022	-2.992000	0.00078	TCA			0.473	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
RP11-274B21.1	0	broad.mit.edu	37	7	128210686	128210687	+	RNA	DEL	AT	AT	-	rs386717721|rs200185648|rs55946993|rs56180919		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:128210686_128210687delAT	ENST00000605862.1	+	0	189																											CACCATGACCATCCTCCTTAAA	0.525																																					.													.	.			0			.																																											0	.			ATGACCATCCTCC																													7.37:g.128210686_128210687delAT			8	0	0		5	0.40	2	.	3	0.00	0		RNA	DEL	ENST00000605862.1	37																																																																																						0.525	RP11-274B21.1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000468355.1			
EZH2	2146	mdanderson.org	37	7	148529746	148529746	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:148529746G>T	ENST00000460911.1	-	4	431	c.343C>A	c.(343-345)Ccc>Acc	p.P115T	EZH2_ENST00000320356.2_Missense_Mutation_p.P115T|EZH2_ENST00000478654.1_Missense_Mutation_p.P106T|EZH2_ENST00000483967.1_Missense_Mutation_p.P106T|EZH2_ENST00000350995.2_Intron|EZH2_ENST00000536783.1_Missense_Mutation_p.P6T|EZH2_ENST00000476773.1_Missense_Mutation_p.P106T|EZH2_ENST00000541220.1_Missense_Mutation_p.P106T			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	115	Interaction with DNMT1, DNMT3A and DNMT3B.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TGCTGTAGGGGAGACCAAGAA	0.338			Mis		DLBCL																																p.P115T				Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	.			0			c.C343A												93.0	102.0	99.0					7																	148529746		2203	4300	6503	SO:0001583	missense	2146	exon4			GTAGGGGAGACCA		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.343C>A	7.37:g.148529746G>T	ENSP00000419711:p.Pro115Thr		28	0	0		45	0.07	3	NM_001203247	54	0.00	0	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161526	0.78226	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000541220;ENST00000476773;ENST00000483967;ENST00000536783	D;D;D;D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57;-2.57;-2.57;-2.57	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	M	0.86953	2.85	0.80722	D	1	P;P;P;P;B	0.50819	0.819;0.939;0.919;0.867;0.342	B;P;P;P;B	0.60949	0.412;0.796;0.881;0.611;0.217	D	0.95101	0.8230	10	0.72032	D	0.01	.	19.8041	0.96521	0.0:0.0:1.0:0.0	.	115;106;106;115;115	B7Z8K5;Q15910-4;Q15910-5;Q15910;Q15910-2	.;.;.;EZH2_HUMAN;.	T	106;115;115;106;106;106;6	ENSP00000417062:P106T;ENSP00000320147:P115T;ENSP00000419711:P115T;ENSP00000443219:P106T;ENSP00000419050:P106T;ENSP00000419856:P106T;ENSP00000439305:P6T	ENSP00000320147:P115T	P	-	1	0	EZH2	148160679	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.556000	0.98127	2.748000	0.94277	0.591000	0.81541	CCC			0.338	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000352744.1		NM_004456	
CHPF2	54480	broad.mit.edu	37	7	150935559	150935559	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr7:150935559T>G	ENST00000035307.2	+	4	3624	c.2111T>G	c.(2110-2112)gTg>gGg	p.V704G	RP4-548D19.3_ENST00000607902.1_RNA|MIR671_ENST00000390183.1_RNA|CHPF2_ENST00000495645.1_Missense_Mutation_p.V696G	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	704					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GGGCTGGAGGTGATGGATGTT	0.647																																					p.V704G													.	CHPF2	52		0			c.T2111G												46.0	42.0	43.0					7																	150935559		2197	4298	6495	SO:0001583	missense	54480	exon4			TGGAGGTGATGGA	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.2111T>G	7.37:g.150935559T>G	ENSP00000035307:p.Val704Gly		104	0.0865384615	9		99	0.18	18	NM_019015	47	0.04	2	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946996	0.73672	.	.	ENSG00000033100	ENST00000495645;ENST00000035307	T;T	0.19105	2.17;2.17	4.81	4.81	0.61882	.	0.059849	0.64402	D	0.000002	T	0.39279	0.1072	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71184	0.972;0.917	T	0.18935	-1.0321	10	0.66056	D	0.02	-22.7599	13.7365	0.62821	0.0:0.0:0.0:1.0	.	704;696	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	G	696;704	ENSP00000418914:V696G;ENSP00000035307:V704G	ENSP00000035307:V704G	V	+	2	0	CHPF2	150566492	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.956000	0.70315	2.018000	0.59344	0.533000	0.62120	GTG			0.647	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348648.2		NM_019015	
BHLHE22	27319	mdanderson.org	37	8	65494205	65494205	+	Silent	SNP	G	G	T	rs543941490		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr8:65494205G>T	ENST00000321870.1	+	1	1392	c.858G>T	c.(856-858)ctG>ctT	p.L286L	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	286	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGCCACGCTGCTGCTCGCCA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		14296	0.0		0.0	False		,,,				2504	0.001				p.L286L	Colon(113;104 1586 2865 9855 18065)												.	.			0			c.G858T												27.0	25.0	25.0					8																	65494205		2203	4300	6503	SO:0001819	synonymous_variant	27319	exon1			CACGCTGCTGCTC	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.858G>T	8.37:g.65494205G>T			35	0	0		35	0.09	3	NM_152414	12	0.00	0		Silent	SNP	ENST00000321870.1	37	CCDS6179.1																																																																																					0.667	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378549.1		NM_152414	
FABP12	646486	broad.mit.edu	37	8	82437068	82437069	+	IGR	INS	-	-	TAT	rs541187571|rs10627097|rs200985804	byFrequency	TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr8:82437068_82437069insTAT	ENST00000360464.4	-	0	551				RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12								lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(3)	4						CTCTCTGAAAATATCCCAGCCT	0.371														2813	0.561701	0.8343	0.3847	5008	,	,		17644	0.8621		0.3042	False		,,,				2504	0.274				.													.	FABP12	20		0			.																																									SO:0001628	intergenic_variant	0	.			CTGAAAATATCCC		CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679		8.37:g.82437069_82437071dupTAT			6	0	0		7	0.71	5	.	0		0	B7SUN0	RNA	INS	ENST00000360464.4	37	CCDS47882.1																																																																																					0.371	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379720.1		NM_001105281	
PLEC	5339	mdanderson.org	37	8	144993686	144993686	+	Missense_Mutation	SNP	C	C	T	rs375044211		TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr8:144993686C>T	ENST00000322810.4	-	32	10883	c.10714G>A	c.(10714-10716)Ggc>Agc	p.G3572S	PLEC_ENST00000354589.3_Missense_Mutation_p.G3435S|PLEC_ENST00000398774.2_Missense_Mutation_p.G3403S|PLEC_ENST00000345136.3_Missense_Mutation_p.G3435S|PLEC_ENST00000356346.3_Missense_Mutation_p.G3421S|PLEC_ENST00000436759.2_Missense_Mutation_p.G3462S|PLEC_ENST00000527096.1_Missense_Mutation_p.G3458S|PLEC_ENST00000357649.2_Missense_Mutation_p.G3439S|PLEC_ENST00000354958.2_Missense_Mutation_p.G3413S	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3572	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCTCTGTAGCCGGTGACGGCC	0.677													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16591	0.0		0.0	False		,,,				2504	0.0				p.G3572S													PLEC_ENST00000436759,right_upper_lobe,carcinoma,0,3	PLEC_ENST00000436759	0	3	0			c.G10714A							C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	1,3939		0,1,1969	37.0	44.0	41.0		10384,10261,10237,10714,10207,10303,10315,10303	5.0	0.9	8		41	0,8290		0,0,4145	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	56,56,56,56,56,56,56,56	0,1,6114	TT,TC,CC		0.0,0.0254,0.0082	benign,benign,benign,benign,benign,benign,benign,benign	3462/4575,3421/4534,3413/4526,3572/4685,3403/4516,3435/4548,3439/4552,3435/4548	144993686	1,12229	1970	4145	6115	SO:0001583	missense	5339	exon32			TGTAGCCGGTGAC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10714G>A	8.37:g.144993686C>T	ENSP00000323856:p.Gly3572Ser		15	0	0		27	0.11	3	NM_201380	197	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610402	0.28712	2.54E-4	0.0	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67;-0.67;-0.67;-0.67	5.03	5.03	0.67393	.	0.000000	0.64402	U	0.000005	D	0.85630	0.5741	M	0.83223	2.63	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.87676	0.2544	10	0.87932	D	0	.	18.1723	0.89749	0.0:1.0:0.0:0.0	.	3462;3421;3413;3572;3403;3435;3439;3435	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	S	3435;3439;3435;3403;3572;3413;3421;3462;3458	ENSP00000344848:G3435S;ENSP00000350277:G3439S;ENSP00000346602:G3435S;ENSP00000381756:G3403S;ENSP00000323856:G3572S;ENSP00000347044:G3413S;ENSP00000348702:G3421S;ENSP00000388180:G3462S;ENSP00000434583:G3458S	ENSP00000323856:G3572S	G	-	1	0	PLEC	145065674	1.000000	0.71417	0.932000	0.37286	0.027000	0.11550	7.604000	0.82830	2.613000	0.88420	0.448000	0.29417	GGC			0.677	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
MPDZ	8777	mdanderson.org	37	9	13115250	13115250	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr9:13115250G>T	ENST00000319217.7	-	40	5710	c.5463C>A	c.(5461-5463)agC>agA	p.S1821R	MPDZ_ENST00000538841.1_Missense_Mutation_p.S680R|MPDZ_ENST00000381022.2_Intron|MPDZ_ENST00000546205.1_Missense_Mutation_p.S1835R|MPDZ_ENST00000541093.1_Missense_Mutation_p.S55R|MPDZ_ENST00000541718.1_Intron|MPDZ_ENST00000381015.4_Missense_Mutation_p.S1821R|MPDZ_ENST00000447879.1_Missense_Mutation_p.S1788R|MPDZ_ENST00000536827.1_Intron	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1821	Ser-rich.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TACCCACCTGGCTGCTTTGAG	0.552																																					p.S1788R													.	.			0			c.C5364A												49.0	43.0	45.0					9																	13115250		876	1991	2867	SO:0001583	missense	8777	exon39			CACCTGGCTGCTT	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5463C>A	9.37:g.13115250G>T	ENSP00000320006:p.Ser1821Arg		43	0	0		28	0.11	3	NM_001261406	28	0.00	0	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.118763	0.77323	.	.	ENSG00000107186	ENST00000319217;ENST00000438511;ENST00000541093;ENST00000545857;ENST00000538841;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T	0.15487	2.71;2.42;2.5;2.61;2.66;2.7;2.71;2.71	6.16	5.26	0.73747	.	0.000000	0.53938	D	0.000045	T	0.37839	0.1018	.	.	.	0.46458	D	0.99905	D;D;D;D;D	0.89917	1.0;0.999;0.998;0.998;0.999	D;D;D;D;D	0.77557	0.99;0.979;0.962;0.986;0.98	T	0.11867	-1.0570	9	0.41790	T	0.15	.	10.1296	0.42672	0.2059:0.0:0.7941:0.0	.	680;526;1788;1701;1821	B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970	.;.;.;.;MPDZ_HUMAN	R	1821;362;55;757;680;1788;1821;1701;1835	ENSP00000320006:S1821R;ENSP00000415964:S362R;ENSP00000445259:S55R;ENSP00000444230:S757R;ENSP00000444717:S680R;ENSP00000415208:S1788R;ENSP00000370403:S1821R;ENSP00000446358:S1835R	ENSP00000320006:S1821R	S	-	3	2	MPDZ	13105250	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.811000	0.38942	1.595000	0.50050	0.650000	0.86243	AGC			0.552	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000055485.2		NM_003829	
GNAQ	2776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	80430592	80430592	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr9:80430592G>C	ENST00000286548.4	-	3	638	c.416C>G	c.(415-417)cCt>cGt	p.P139R	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	139					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CTGGATTCCAGGATCATTCCA	0.388			Mis		uveal melanoma																																p.P139R				Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	.			0			c.C416G												122.0	109.0	113.0					9																	80430592		2203	4297	6500	SO:0001583	missense	2776	exon3			ATTCCAGGATCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.416C>G	9.37:g.80430592G>C	ENSP00000286548:p.Pro139Arg		109	0	0		83	0.41	34	NM_002072	45	0.69	31	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106551	0.56291	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.90444	-2.67;-2.67	6.01	6.01	0.97437	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.88130	0.6354	L	0.41906	1.305	0.80722	D	1	B	0.12013	0.005	B	0.17433	0.018	T	0.81562	-0.0876	10	0.33141	T	0.24	.	20.5211	0.99222	0.0:0.0:1.0:0.0	.	139	P50148	GNAQ_HUMAN	R	139;110	ENSP00000286548:P139R;ENSP00000391501:P110R	ENSP00000286548:P139R	P	-	2	0	GNAQ	79620412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.898000	0.87363	2.861000	0.98227	0.650000	0.86243	CCT			0.388	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052761.1		NM_002072	
ROR2	4920	mdanderson.org	37	9	94486405	94486405	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chr9:94486405G>T	ENST00000375708.3	-	9	2569	c.2371C>A	c.(2371-2373)Cag>Aag	p.Q791K	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	791	Pro-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGGGCCTTCTGCTTGGGCCCC	0.672																																					p.Q791K													.	.			0			c.C2371A												51.0	56.0	54.0					9																	94486405		2203	4300	6503	SO:0001583	missense	4920	exon9			CCTTCTGCTTGGG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2371C>A	9.37:g.94486405G>T	ENSP00000364860:p.Gln791Lys		34	0	0		34	0.09	3	NM_004560	29	0.00	0	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	9.248	1.039967	0.19669	.	.	ENSG00000169071	ENST00000375708	T	0.76709	-1.04	4.65	4.65	0.58169	.	0.183051	0.26324	N	0.025038	T	0.64216	0.2578	N	0.14661	0.345	0.25760	N	0.984953	B	0.02656	0.0	B	0.01281	0.0	T	0.51012	-0.8759	10	0.28530	T	0.3	.	17.7513	0.88435	0.0:0.0:1.0:0.0	.	791	Q01974	ROR2_HUMAN	K	791	ENSP00000364860:Q791K	ENSP00000364860:Q791K	Q	-	1	0	ROR2	93526226	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.226000	0.78060	2.415000	0.81967	0.561000	0.74099	CAG			0.672	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053040.1			
MT-ND1	4535	hgsc.bcm.edu	37	M	810	810	+	5'Flank	SNP	G	G	A			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chrM:810G>A	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CACACCCCCACGGGAAACAGC	0.493																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			CCCACGGGAAACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.810G>A	Exception_encountered		548	0	0		210	0.11	23	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.493	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
WNK3	65267	mdanderson.org	37	X	54320996	54320996	+	Silent	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chrX:54320996G>T	ENST00000375159.2	-	7	1682	c.1683C>A	c.(1681-1683)tcC>tcA	p.S561S	WNK3_ENST00000375169.3_Silent_p.S561S|WNK3_ENST00000354646.2_Silent_p.S561S			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	561					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTGTAACAGAGGAGCAGTGCT	0.408																																					p.S561S													.	.			0			c.C1683A												60.0	41.0	47.0					X																	54320996		2203	4299	6502	SO:0001819	synonymous_variant	65267	exon8			AACAGAGGAGCAG	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1683C>A	X.37:g.54320996G>T			36	0	0		40	0.08	3	NM_001002838	7	0.00	0	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	CCDS14357.1																																																																																					0.408	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056799.2		NM_020922	
Unknown	0	bcgsc.ca	37	X	89295592	89295592	+	IGR	SNP	G	G	T			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chrX:89295592G>T								TGIF2LX (117710 upstream) : RNU6-555P (556641 downstream)																							TCCCATGTCTGCTCACCAAGA	0.453																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ATGTCTGCTCACC																													X.37:g.89295592G>T			36	0	0		38	0.11	4	.	2	0.00	0		RNA	SNP		37																																																																																					0	0.453										
PAK3	5063	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	110385387	110385387	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H4-01A-31D-A435-10	TCGA-XE-A8H4-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	4f2cc915-3956-4c23-9ebc-a6e10b61529e	6423e32a-2e67-4707-a9ad-80324f8a4cc1	g.chrX:110385387T>G	ENST00000372010.1	+	6	681	c.239T>G	c.(238-240)aTt>aGt	p.I80S	PAK3_ENST00000518291.1_Missense_Mutation_p.I80S|PAK3_ENST00000446737.1_Missense_Mutation_p.I80S|PAK3_ENST00000417227.1_Missense_Mutation_p.I80S|PAK3_ENST00000360648.4_Missense_Mutation_p.I80S|PAK3_ENST00000425146.1_Missense_Mutation_p.I80S|PAK3_ENST00000372007.5_Missense_Mutation_p.I80S|PAK3_ENST00000519681.1_Missense_Mutation_p.I80S|PAK3_ENST00000262836.4_Missense_Mutation_p.I80S			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	80	Autoregulatory region. {ECO:0000250}.|CRIB. {ECO:0000255|PROSITE- ProRule:PRU00057}.|GTPase-binding. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						GAGCATACGATTCATGTGGGG	0.398										TSP Lung(19;0.15)																											p.I80S													.	PAK3	179		0			c.T239G												198.0	195.0	196.0					X																	110385387		2203	4300	6503	SO:0001583	missense	5063	exon4			ATACGATTCATGT	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.239T>G	X.37:g.110385387T>G	ENSP00000361080:p.Ile80Ser		79	0	0		72	0.07	5	NM_001128166	1	0.00	0	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.170719	0.78452	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	D;D;D;D;D;D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9;-1.9	5.96	4.78	0.61160	PAK-box/P21-Rho-binding (3);	0.053444	0.64402	D	0.000001	D	0.85695	0.5756	N	0.26042	0.785	0.80722	D	1	D;D;P;P	0.57899	0.961;0.981;0.915;0.896	P;P;P;P	0.62885	0.804;0.908;0.836;0.747	D	0.85902	0.1435	10	0.66056	D	0.02	.	11.6631	0.51358	0.1348:0.0:0.0:0.8652	.	80;80;80;80	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	S	80	ENSP00000410853:I80S;ENSP00000401982:I80S;ENSP00000361080:I80S;ENSP00000429113:I80S;ENSP00000361077:I80S;ENSP00000428921:I80S;ENSP00000405642:I80S;ENSP00000353864:I80S;ENSP00000389172:I80S;ENSP00000262836:I80S	ENSP00000262836:I80S	I	+	2	0	PAK3	110272043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	0.838000	0.34948	0.486000	0.48141	ATT			0.398	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000057918.1		NM_002578	
