#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CPTP	80772	mdanderson.org	37	1	1262375	1262375	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:1262375C>T	ENST00000343938.4	+	2	496	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	GLTPD1_ENST00000464957.1_Intron|CPSF3L_ENST00000540437.1_5'Flank|CPSF3L_ENST00000419704.1_5'Flank|CPSF3L_ENST00000421495.2_5'Flank|CPSF3L_ENST00000450926.2_5'Flank|CPSF3L_ENST00000435064.1_5'Flank|CPSF3L_ENST00000411962.1_5'Flank|CPSF3L_ENST00000545578.1_5'Flank	NM_001029885.1	NP_001025056.1	Q5TA50	CPTP_HUMAN		29					ceramide 1-phosphate transport (GO:1902389)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide 1-phosphate binding (GO:1902387)|ceramide 1-phosphate transporter activity (GO:1902388)|glycolipid binding (GO:0051861)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGAGGTCTTGCTGGACCCCTA	0.567																																					p.L29L													.	.			0			c.C85T												92.0	80.0	84.0					1																	1262375		2203	4295	6498	SO:0001819	synonymous_variant	80772	exon2			GTCTTGCTGGACC																												ENST00000343938.4:c.85C>T	1.37:g.1262375C>T			64	0	0		39	0.08	3	NM_001029885	51	0.00	0	Q4G0E6|Q7L5A4	Silent	SNP	ENST00000343938.4	37	CCDS30555.1																																																																																					0.567	GLTPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008742.1			
RPL22	6146	mdanderson.org	37	1	6253102	6253102	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:6253102G>A	ENST00000234875.4	-	3	168	c.130C>T	c.(130-132)Caa>Taa	p.Q44*	RPL22_ENST00000497965.1_Nonsense_Mutation_p.Q11*|RPL22_ENST00000484532.1_Nonsense_Mutation_p.Q11*	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	44					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		ATCCTTTCTTGCAAAAACTGC	0.438			T	RUNX1	"""AML, CML"""																																p.Q44X				Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	.	.			0			c.C130T												91.0	95.0	94.0					1																	6253102		2203	4300	6503	SO:0001587	stop_gained	6146	exon3			TTTCTTGCAAAAA	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.130C>T	1.37:g.6253102G>A	ENSP00000346088:p.Gln44*		33	0	0		32	0.09	3	NM_000983	2901	0.00	0	B2R495|Q6IBD1	Nonsense_Mutation	SNP	ENST00000234875.4	37	CCDS58.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536281	0.85812	.	.	ENSG00000116251	ENST00000234875	.	.	.	4.95	4.95	0.65309	.	0.242393	0.42682	D	0.000676	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-0.6239	18.5522	0.91069	0.0:0.0:1.0:0.0	.	.	.	.	X	44	.	ENSP00000346088:Q44X	Q	-	1	0	RPL22	6175689	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.378000	0.66190	2.453000	0.82957	0.591000	0.81541	CAA			0.438	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000002830.1		NM_000983	
Unknown	0	hgsc.bcm.edu;bcgsc.ca	37	1	16976573	16976573	+	IGR	SNP	A	A	G			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:16976573A>G								CROCCP2 (15519 upstream) : RNU1-3 (16706 downstream)																							TGCCAGGGTGACTACGGGGGC	0.567																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	11209	.			AGGGTGACTACGG																													1.37:g.16976573A>G			392	0	0		216	0.08	17	.	2	0.00	0		RNA	SNP		37																																																																																					0	0.567										
MST1L	11223	broad.mit.edu	37	1	17083884	17083884	+	RNA	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:17083884T>C	ENST00000455405.2	-	0	704							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GCCCCCGTAGTCACCCTGGCA	0.562																																					p.D638G													.	.			0			c.A1913G																																											0	exon15			CCGTAGTCACCCT	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083884T>C			337	0	0		191	0.08	15	NM_001271733	2	0.00	0	B7WPB1|Q13209	RNA	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	12.82	2.051972	0.36181	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.44688	D	0.000430	T	0.65333	0.2681	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	T	0.69903	-0.5019	6	0.87932	D	0	.	5.2253	0.15391	0.0:2.0E-4:0.0:0.9998	.	638;664	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	G	638;664	.	ENSP00000439273:D638G	D	-	2	0	MST1P9	16956471	1.000000	0.71417	0.982000	0.44146	0.000000	0.00434	4.881000	0.63114	0.419000	0.25927	0.000000	0.15137	GAC			0.562	MST1L-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000400328.1		NM_001271733	
CROCC	9696	broad.mit.edu	37	1	17280821	17280821	+	Missense_Mutation	SNP	G	G	C	rs6669627	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:17280821G>C	ENST00000375541.5	+	22	3359	c.3290G>C	c.(3289-3291)cGa>cCa	p.R1097P	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CGGCAGAAACGAGATGCCCAG	0.627																																					p.R1097P													.	CROCC	185		0			c.G3290C												43.0	48.0	46.0					1																	17280821		2203	4300	6503	SO:0001583	missense	9696	exon22			AGAAACGAGATGC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3290G>C	1.37:g.17280821G>C	ENSP00000364691:p.Arg1097Pro		76	0	0		41	0.20	8	NM_014675	80	0.01	1		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	18	0.008241758241758242	4	0.008130081300813009	3	0.008287292817679558	2	0.0034965034965034965	9	0.011873350923482849	G	17.39	3.377554	0.61735	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.56941	0.43	4.5	4.5	0.54988	.	.	.	.	.	T	0.65749	0.2721	M	0.77313	2.365	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.72839	-0.4171	9	0.52906	T	0.07	.	15.5037	0.75722	0.0:0.0:1.0:0.0	rs6669627	960;400;1097	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	P	1097;978	ENSP00000364691:R1097P	ENSP00000364691:R1097P	R	+	2	0	CROCC	17153408	0.997000	0.39634	1.000000	0.80357	0.750000	0.42670	2.928000	0.48908	2.428000	0.82296	0.561000	0.74099	CGA			0.627	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006249.2		NM_014675	
AIM1L	55057	mdanderson.org	37	1	26664517	26664517	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:26664517G>T	ENST00000308182.5	-	7	787	c.358C>A	c.(358-360)Cca>Aca	p.P120T	AIM1L_ENST00000527815.1_Missense_Mutation_p.P291T|AIM1L_ENST00000522993.1_5'UTR			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	120							carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGCTCCCCTGGCTTCTCCACA	0.572																																					p.P1165T													.	.			0			c.C3493A												46.0	38.0	41.0					1																	26664517		2203	4300	6503	SO:0001583	missense	55057	exon8			CCCCTGGCTTCTC			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.358C>A	1.37:g.26664517G>T	ENSP00000310435:p.Pro120Thr		87	0	0		39	0.08	3	NM_001039775	0		0	B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	ENST00000308182.5	37		.	.	.	.	.	.	.	.	.	.	G	22.8	4.336337	0.81801	.	.	ENSG00000176092	ENST00000527815;ENST00000308182	T;T	0.76578	-1.02;-1.03	5.13	5.13	0.70059	.	0.478172	0.23589	N	0.046565	D	0.83608	0.5291	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	0.991;1.0	D;D	0.87578	0.937;0.998	D	0.84474	0.0601	10	0.62326	D	0.03	.	16.1215	0.81361	0.0:0.0:1.0:0.0	.	37;120	Q9NTH7;Q8N1P7	.;AIM1L_HUMAN	T	291;120	ENSP00000433931:P291T;ENSP00000310435:P120T	ENSP00000310435:P120T	P	-	1	0	AIM1L	26537104	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.848000	0.62874	2.675000	0.91044	0.655000	0.94253	CCA			0.572	AIM1L-201	KNOWN	basic	protein_coding	protein_coding				NM_001039775.2	
CSMD2	114784	mdanderson.org	37	1	33998696	33998696	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:33998696G>T	ENST00000373381.4	-	64	10301	c.10125C>A	c.(10123-10125)acC>acA	p.T3375T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCGCCTTGCAGGTGCGGTGCT	0.657																																					p.T3231T													.	.			0			c.C9693A												35.0	33.0	34.0					1																	33998696		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon63			CTTGCAGGTGCGG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10125C>A	1.37:g.33998696G>T			28	0	0		20	0.10	2	NM_052896	5	0.00	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																						0.657	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_052896	
LOC100129620	100129620	broad.mit.edu	37	1	99474094	99474094	+	RNA	DEL	A	A	-	rs531849287|rs57656522	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:99474094delA	ENST00000425113.1	+	0	370					NR_033940.1																						AACAGCAACTAAAAAAAAAAA	0.353													|||unknown(HR)	1745	0.348442	0.32	0.3112	5008	,	,		17655	0.4415		0.3608	False		,,,				2504	0.3047				.													.	.			0			.																																											0	.			GCAACTAAAAAAA																													1.37:g.99474094delA			5	0	0		5	0.40	2	.	1	0.00	0		RNA	DEL	ENST00000425113.1	37																																																																																						0.353	RP5-896L10.1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000029675.2			
HSD3B1	3283	mdanderson.org	37	1	120054150	120054150	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr1:120054150C>T	ENST00000369413.3	+	3	315	c.170C>T	c.(169-171)aCa>aTa	p.T57I	HSD3B1_ENST00000528909.1_Missense_Mutation_p.T57I|HSD3B1_ENST00000235547.6_Missense_Mutation_p.T59I			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	57					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	ACCAAGCTGACAGTGCTGGAA	0.478																																					p.T57I													.	.			0			c.C170T												82.0	75.0	77.0					1																	120054150		2203	4300	6503	SO:0001583	missense	3283	exon3			AGCTGACAGTGCT	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.170C>T	1.37:g.120054150C>T	ENSP00000358421:p.Thr57Ile		42	0	0		34	0.09	3	NM_000862	0		0	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	37	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	8.846	0.943499	0.18281	.	.	ENSG00000203857	ENST00000531340;ENST00000369413;ENST00000235547;ENST00000528909	T;D;D;D	0.88741	-0.24;-2.42;-2.42;-2.42	3.27	3.27	0.37495	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.497312	0.21727	N	0.070022	D	0.85405	0.5689	M	0.89287	3.02	0.26569	N	0.973594	B;B	0.27351	0.097;0.176	B;B	0.35413	0.078;0.202	T	0.81858	-0.0739	10	0.56958	D	0.05	-5.9883	7.6574	0.28383	0.2524:0.7476:0.0:0.0	.	59;57	Q5TDG2;P14060	.;3BHS1_HUMAN	I	57;57;59;57	ENSP00000435999:T57I;ENSP00000358421:T57I;ENSP00000235547:T59I;ENSP00000432268:T57I	ENSP00000235547:T59I	T	+	2	0	HSD3B1	119855673	0.657000	0.27393	0.842000	0.33263	0.580000	0.36256	1.073000	0.30691	1.651000	0.50673	0.491000	0.48974	ACA			0.478	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000034993.3		NM_000862	
NMT2	9397	mdanderson.org	37	10	15174829	15174829	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr10:15174829G>T	ENST00000378165.4	-	6	786	c.706C>A	c.(706-708)Cgg>Agg	p.R236R	RPP38_ENST00000451677.1_Intron|NMT2_ENST00000535341.1_Silent_p.R223R|NMT2_ENST00000378150.1_Silent_p.R223R|NMT2_ENST00000540259.1_Silent_p.R48R	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	236					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						TCATAAATCCGAATGTTTGCT	0.418																																					p.R236R	Melanoma(117;1345 1645 4130 12688 30625)												.	.			0			c.C706A												102.0	100.0	101.0					10																	15174829		2203	4300	6503	SO:0001819	synonymous_variant	9397	exon6			AAATCCGAATGTT	AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.706C>A	10.37:g.15174829G>T			59	0	0		51	0.06	3	NM_004808	15	0.00	0	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Silent	SNP	ENST00000378165.4	37	CCDS7109.1																																																																																					0.418	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046958.2		NM_004808	
BMI1	648	mdanderson.org	37	10	22615381	22615381	+	Start_Codon_SNP	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr10:22615381G>T	ENST00000376663.3	+	2	508	c.3G>T	c.(1-3)atG>atT	p.M1I	COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.M144I	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	1					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						AAGCAGAAATGCATCGAACAA	0.398																																					p.M144I													.	.			0			c.G432T												173.0	155.0	161.0					10																	22615381		2203	4300	6503	SO:0001582	initiator_codon_variant	0	exon6			AGAAATGCATCGA	BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.3G>T	10.37:g.22615381G>T	ENSP00000365851:p.Met1Ile		47	0	0		25	0.12	3	NM_001204062	57	0.00	0	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	ENST00000376663.3	37	CCDS7138.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675207	0.88445	.	.	ENSG00000168283	ENST00000417470;ENST00000376663;ENST00000442508;ENST00000456675;ENST00000416820	T;T;T	0.37058	1.22;1.95;2.34	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.63885	0.2549	.	.	.	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.993;0.997	T	0.66160	-0.5993	9	0.72032	D	0.01	-8.1901	18.6272	0.91344	0.0:0.0:1.0:0.0	.	1;1	Q5U0M5;P35226	.;BMI1_HUMAN	I	1	ENSP00000365851:M1I;ENSP00000397912:M1I;ENSP00000399220:M1I	ENSP00000365851:M1I	M	+	3	0	BMI1	22655387	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.741000	0.98843	2.706000	0.92434	0.650000	0.86243	ATG			0.398	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047176.1		NM_005180	Missense_Mutation
BMS1	9790	broad.mit.edu	37	10	43318571	43318571	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr10:43318571G>A	ENST00000374518.5	+	20	3201	c.3138G>A	c.(3136-3138)atG>atA	p.M1046I		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1046					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.M1046I(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGTAGGGAATGTTTAATTCTG	0.393																																					p.M1046I													BMS1,NS,carcinoma,0,2	BMS1	132	2	1	Substitution - Missense(1)	endometrium(1)	c.G3138A												74.0	83.0	80.0					10																	43318571		2202	4297	6499	SO:0001583	missense	9790	exon20			GGGAATGTTTAAT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3138G>A	10.37:g.43318571G>A	ENSP00000363642:p.Met1046Ile		66	0.0151515152	1		41	0.07	3	NM_014753	86	0.00	0	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485181	0.63962	.	.	ENSG00000165733	ENST00000374518	T	0.26957	1.7	4.54	4.54	0.55810	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	M	0.86953	2.85	0.80722	D	1	B	0.14438	0.01	B	0.17433	0.018	T	0.48636	-0.9018	10	0.72032	D	0.01	.	17.7203	0.88349	0.0:0.0:1.0:0.0	.	1046	Q14692	BMS1_HUMAN	I	1046	ENSP00000363642:M1046I	ENSP00000363642:M1046I	M	+	3	0	BMS1	42638577	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.443000	0.97568	2.250000	0.74265	0.454000	0.30748	ATG			0.393	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047690.2		NM_014753	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70332658	70332658	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr10:70332658C>T	ENST00000373644.4	+	2	772	c.563C>T	c.(562-564)aCa>aTa	p.T188I		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	188					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AGCCAAGAGACAACTCAGTTT	0.463																																					p.T188I													.	.			0			c.C563T												65.0	65.0	65.0					10																	70332658		2203	4300	6503	SO:0001583	missense	80312	exon2			AAGAGACAACTCA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.563C>T	10.37:g.70332658C>T	ENSP00000362748:p.Thr188Ile		46	0	0		43	0.23	10	NM_030625	9	0.33	3	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.511208	0.00984	.	.	ENSG00000138336	ENST00000373644	T	0.05996	3.36	4.91	0.594	0.17485	.	1.182240	0.06302	N	0.701046	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42699	-0.9436	10	0.05959	T	0.93	.	3.2948	0.06963	0.1824:0.5074:0.0:0.3102	.	188	Q8NFU7	TET1_HUMAN	I	188	ENSP00000362748:T188I	ENSP00000362748:T188I	T	+	2	0	TET1	70002664	0.000000	0.05858	0.544000	0.28141	0.209000	0.24338	-0.486000	0.06513	0.206000	0.20587	0.563000	0.77884	ACA			0.463	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
PIDD1	55367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	802283	802283	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr11:802283G>A	ENST00000347755.5	-	6	1229	c.1088C>T	c.(1087-1089)cCg>cTg	p.P363L	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.P363L	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GCCTGGCTCCGGCAGCAGCAG	0.692																																					p.P363L													.	.			0			c.C1088T												23.0	30.0	28.0					11																	802283		2193	4286	6479	SO:0001583	missense	55367	exon6			GGCTCCGGCAGCA																												ENST00000347755.5:c.1088C>T	11.37:g.802283G>A	ENSP00000337797:p.Pro363Leu		60	0	0		61	0.23	14	NM_145887	47	0.34	16		Missense_Mutation	SNP	ENST00000347755.5	37	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968157	0.53614	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.41400	1.0;1.0	4.02	4.02	0.46733	ZU5 (2);	0.083794	0.47852	D	0.000209	T	0.53997	0.1831	L	0.34521	1.04	0.51233	D	0.999918	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.983	T	0.60136	-0.7322	10	0.72032	D	0.01	.	16.3431	0.83101	0.0:0.0:1.0:0.0	.	363;217;363	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	L	363	ENSP00000416801:P363L;ENSP00000337797:P363L	ENSP00000337797:P363L	P	-	2	0	PIDD	792283	1.000000	0.71417	0.784000	0.31847	0.107000	0.19398	4.219000	0.58561	2.082000	0.62665	0.561000	0.74099	CCG			0.692	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257103.1			
RPLP0P2	113157	broad.mit.edu	37	11	61405192	61405192	+	RNA	SNP	G	G	A	rs201678804		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr11:61405192G>A	ENST00000496593.1	+	0	1796					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		aaaaaaaaaagaaaagaaaaa	0.303																																					.													.	.			0			.																																											0	.			AAAAAAGAAAAGA	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405192G>A			42	0	0		27	0.15	4	.	0		0		RNA	SNP	ENST00000496593.1	37																																																																																						0.303	RPLP0P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000350911.1		NR_002775	
AHNAK	79026	hgsc.bcm.edu	37	11	62294254	62294254	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr11:62294254C>T	ENST00000378024.4	-	5	7909	c.7635G>A	c.(7633-7635)aaG>aaA	p.K2545K	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2545					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CAATGTCCACCTTGGGTCCTG	0.483																																					p.K2545K													AHNAK,NS,carcinoma,-1,1	AHNAK	-1	1	0			c.G7635A												140.0	142.0	141.0					11																	62294254		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			GTCCACCTTGGGT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7635G>A	11.37:g.62294254C>T			117	0	0		71	0.04	3	NM_001620	137	0.01	1	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																					0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395572.1		NM_024060	
BSCL2	26580	mdanderson.org	37	11	62473796	62473796	+	5'UTR	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr11:62473796T>C	ENST00000407022.3	-	0	20				BSCL2_ENST00000433053.1_Intron|BSCL2_ENST00000405837.1_Intron|GNG3_ENST00000294117.5_5'Flank|BSCL2_ENST00000421906.1_5'UTR|BSCL2_ENST00000537604.1_5'Flank|BSCL2_ENST00000360796.5_Intron|BSCL2_ENST00000278893.7_5'Flank|BSCL2_ENST00000403550.1_5'Flank|HNRNPUL2-BSCL2_ENST00000403734.2_Intron	NM_032667.6	NP_116056.3	Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)						cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GTCCCGCCCCTCTCCGCCGGC	0.771																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	0	.			CGCCCCTCTCCGC		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000407022.3:c.-227A>G	11.37:g.62473796T>C			16	0	0		12	0.33	4	.	0		0	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	RNA	SNP	ENST00000407022.3	37	CCDS8031.1																																																																																					0.771	BSCL2-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000319184.1		NM_032667	
DYNC2H1	79659	mdanderson.org	37	11	102992194	102992194	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr11:102992194G>T	ENST00000375735.2	+	10	1598	c.1454G>T	c.(1453-1455)aGt>aTt	p.S485I	DYNC2H1_ENST00000334267.7_Missense_Mutation_p.S485I|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.S485I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	485	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTTGTCAACAGTATAGTTTGG	0.348																																					p.S485I													.	.			0			c.G1454T												77.0	78.0	78.0					11																	102992194		1812	4068	5880	SO:0001583	missense	79659	exon10			TCAACAGTATAGT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.1454G>T	11.37:g.102992194G>T	ENSP00000364887:p.Ser485Ile		55	0	0		42	0.07	3	NM_001377	2	0.00	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.650085	0.47362	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093	T;T;T	0.56776	0.44;0.44;0.44	5.44	5.44	0.79542	Dynein heavy chain, domain-1 (1);	0.478882	0.17129	U	0.185909	T	0.39682	0.1087	N	0.14661	0.345	0.24748	N	0.992999	B;B;B	0.18310	0.011;0.027;0.012	B;B;B	0.28784	0.022;0.094;0.056	T	0.38802	-0.9644	10	0.59425	D	0.04	.	11.7023	0.51577	0.9306:0.0:0.0694:0.0	.	485;485;485	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	I	485	ENSP00000364887:S485I;ENSP00000334021:S485I;ENSP00000381167:S485I	ENSP00000334021:S485I	S	+	2	0	DYNC2H1	102497404	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.001000	0.76297	1.006000	0.39211	-0.269000	0.10298	AGT			0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387196.1		XM_370652	
ERC1	23085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	1137370	1137370	+	Missense_Mutation	SNP	G	G	A	rs370287516		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:1137370G>A	ENST00000397203.2	+	2	707	c.301G>A	c.(301-303)Ggt>Agt	p.G101S	ERC1_ENST00000546231.2_Missense_Mutation_p.G101S|ERC1_ENST00000589028.1_Missense_Mutation_p.G101S|ERC1_ENST00000355446.5_Missense_Mutation_p.G101S|ERC1_ENST00000360905.4_Missense_Mutation_p.G101S|ERC1_ENST00000543086.3_Missense_Mutation_p.G101S			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	101					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TCTGCCTTACGGTGTTCGGAT	0.512																																					p.G101S													.	.			0			c.G301A							G	SER/GLY,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	131.0	121.0	124.0		301,301	5.8	1.0	12		124	0,8600		0,0,4300	no	missense,missense	ERC1	NM_178039.2,NM_178040.2	56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	101/1089,101/1117	1137370	1,13005	2203	4300	6503	SO:0001583	missense	23085	exon2			CCTTACGGTGTTC	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.301G>A	12.37:g.1137370G>A	ENSP00000380386:p.Gly101Ser		85	0	0		136	0.07	9	NM_178039	30	0.03	1	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541721	0.85917	2.27E-4	0.0	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394	D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	5.81	5.81	0.92471	.	0.048655	0.85682	D	0.000000	D	0.89104	0.6620	N	0.20986	0.625	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.935	D;D;B	0.74348	0.983;0.957;0.364	D	0.86669	0.1909	10	0.25751	T	0.34	-16.6321	20.0621	0.97678	0.0:0.0:1.0:0.0	.	101;101;101	Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;RB6I2_HUMAN	S	101	ENSP00000340054:G101S;ENSP00000380386:G101S;ENSP00000438546:G101S;ENSP00000445336:G101S;ENSP00000442976:G101S;ENSP00000442739:G101S;ENSP00000347621:G101S;ENSP00000354158:G101S;ENSP00000410064:G101S	ENSP00000299183:G101S	G	+	1	0	ERC1	1007631	1.000000	0.71417	0.975000	0.42487	0.981000	0.71138	7.985000	0.88162	2.750000	0.94351	0.655000	0.94253	GGT			0.512	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398380.2		NM_015064	
PTPRO	5800	broad.mit.edu;bcgsc.ca	37	12	15669735	15669742	+	Frame_Shift_Del	DEL	GGTCCTAC	GGTCCTAC	-	rs1050646|rs137966245	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	GGTCCTAC	GGTCCTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:15669735_15669742delGGTCCTAC	ENST00000281171.4	+	9	1954_1961	c.1624_1631delGGTCCTAC	c.(1624-1632)ggtcctacgfs	p.GPT542fs	PTPRO_ENST00000348962.2_Frame_Shift_Del_p.GPT542fs|PTPRO_ENST00000543886.1_Frame_Shift_Del_p.GPT542fs	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	542	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				CTATCCTTTGGGTCCTACGGCCGTGGTT	0.438																																					p.542_544del													.	PTPRO	148		0			c.1624_1631del																																									SO:0001589	frameshift_variant	5800	exon9			CCTTTGGGTCCTA	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1624_1631delGGTCCTAC	12.37:g.15669735_15669742delGGTCCTAC	ENSP00000281171:p.Gly542fs		99	0	0		250	0.03	8	NM_002848	43	0.00	0	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Frame_Shift_Del	DEL	ENST00000281171.4	37	CCDS8675.1																																																																																					0.438	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401079.1			
PTPRO	5800	bcgsc.ca	37	12	15669741	15669742	+	Frame_Shift_Ins	INS	-	-	TTTAATG	rs137966245		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:15669741_15669742insTTTAATG	ENST00000281171.4	+	9	1960_1961	c.1630_1631insTTTAATG	c.(1630-1632)acgfs	p.T544fs	PTPRO_ENST00000348962.2_Frame_Shift_Ins_p.T544fs|PTPRO_ENST00000543886.1_Frame_Shift_Ins_p.T544fs	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	544	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TTTGGGTCCTACGGCCGTGGTT	0.431																																					p.T544_A545delinsIX													PTPRO,NS,carcinoma,-2,1	PTPRO	148	1	0			c.1630_1631insTTTAATG																																									SO:0001589	frameshift_variant	5800	exon9			GGTCCTACGGCCG	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	Exception_encountered	12.37:g.15669741_15669742insTTTAATG	ENSP00000281171:p.Thr544fs		102	0	0		243	0.02	6	NM_002848	47	0.00	0	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Frame_Shift_Ins	INS	ENST00000281171.4	37	CCDS8675.1																																																																																					0.431	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401079.1			
PTPRO	5800	bcgsc.ca	37	12	15669742	15669743	+	Frame_Shift_Ins	INS	-	-	TCTATCCTTTG	rs137966245		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:15669742_15669743insTCTATCCTTTG	ENST00000281171.4	+	9	1961_1962	c.1631_1632insTCTATCCTTTG	c.(1630-1635)acggccfs	p.A545fs	PTPRO_ENST00000348962.2_Frame_Shift_Ins_p.A545fs|PTPRO_ENST00000543886.1_Frame_Shift_Ins_p.A545fs	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	545	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)	p.T544T(1)		NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TTGGGTCCTACGGCCGTGGTTC	0.431																																					p.T544fs													PTPRO,NS,carcinoma,-1,1	PTPRO	148	1	1	Substitution - coding silent(1)	kidney(1)	c.1631_1632insTCTATCCTTTG																																									SO:0001589	frameshift_variant	5800	exon9			GTCCTACGGCCGT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	Exception_encountered	12.37:g.15669742_15669743insTCTATCCTTTG	ENSP00000281171:p.Ala545fs		101	0	0		240	0.03	6	NM_002848	47	0.00	0	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Frame_Shift_Ins	INS	ENST00000281171.4	37	CCDS8675.1																																																																																					0.431	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401079.1			
FAM186A	121006	broad.mit.edu	37	12	50746140	50746140	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:50746140C>T	ENST00000327337.5	-	4	4474	c.4475G>A	c.(4474-4476)gGg>gAg	p.G1492E	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.G1492E	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1492																	GAGAGGGATCCCCAATTCCTG	0.657																																					p.G1492E	NSCLC(138;1796 1887 12511 19463 37884)												.	FAM186A	181		0			c.G4475A												11.0	12.0	12.0					12																	50746140		692	1588	2280	SO:0001583	missense	121006	exon4			GGGATCCCCAATT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4475G>A	12.37:g.50746140C>T	ENSP00000329995:p.Gly1492Glu		155	0.0064516129	1		142	0.05	7	NM_001145475	0		0		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	12.93	2.086248	0.36855	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.03982	3.74;3.74	4.53	-2.85	0.05734	.	.	.	.	.	T	0.06462	0.0166	L	0.29908	0.895	0.09310	N	1	D;B	0.89917	1.0;0.297	D;B	0.80764	0.994;0.112	T	0.15378	-1.0439	9	0.02654	T	1	.	4.5237	0.11971	0.2364:0.448:0.0:0.3156	.	1492;1492	F5GYN0;A6NE01	.;F186A_HUMAN	E	1492	ENSP00000441337:G1492E;ENSP00000329995:G1492E	ENSP00000329995:G1492E	G	-	2	0	FAM186A	49032407	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.828000	0.27435	-0.426000	0.07360	-0.409000	0.06214	GGG			0.657	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396838.1		XM_001718353	
KRT80	144501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52567452	52567452	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:52567452C>A	ENST00000394815.2	-	5	860	c.763G>T	c.(763-765)Gtg>Ttg	p.V255L	KRT80_ENST00000313234.5_Missense_Mutation_p.V255L	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	255	Coil 2.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		TGGGCCTTCACCTCCTCCACG	0.652																																					p.V255L	GBM(178;2309 2916 15678 35873)												.	.			0			c.G763T												89.0	77.0	81.0					12																	52567452		2203	4300	6503	SO:0001583	missense	144501	exon5			CCTTCACCTCCTC	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.763G>T	12.37:g.52567452C>A	ENSP00000378292:p.Val255Leu		45	0	0		47	0.23	11	NM_182507	9	0.44	4	Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	37	CCDS8821.2	.	.	.	.	.	.	.	.	.	.	C	33	5.216458	0.95104	.	.	ENSG00000167767	ENST00000313234;ENST00000394815	D;D	0.89123	-2.47;-2.47	4.23	4.23	0.50019	Filament (1);	0.000000	0.34435	N	0.003969	D	0.95661	0.8589	M	0.92219	3.285	0.51233	D	0.999914	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.972;0.984;0.994	D	0.96747	0.9551	10	0.72032	D	0.01	.	17.1871	0.86869	0.0:1.0:0.0:0.0	.	255;255;290	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	L	255	ENSP00000369361:V255L;ENSP00000378292:V255L	ENSP00000369361:V255L	V	-	1	0	KRT80	50853719	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.847000	0.69451	2.375000	0.81037	0.561000	0.74099	GTG			0.652	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000316757.1		NM_182507	
SLC16A7	9194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	60168593	60168593	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:60168593G>A	ENST00000261187.4	+	4	681	c.517G>A	c.(517-519)Ggc>Agc	p.G173S	SLC16A7_ENST00000552024.1_Missense_Mutation_p.G173S|SLC16A7_ENST00000552432.1_Missense_Mutation_p.G173S|SLC16A7_ENST00000543448.1_Missense_Mutation_p.G74S|SLC16A7_ENST00000547379.1_Missense_Mutation_p.G173S	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	173					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	TAATACTTTTGGCTGGAAAGG	0.448																																					p.G173S													.	.			0			c.G517A												67.0	66.0	67.0					12																	60168593		2203	4300	6503	SO:0001583	missense	9194	exon5			ACTTTTGGCTGGA	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.517G>A	12.37:g.60168593G>A	ENSP00000261187:p.Gly173Ser		74	0	0		90	0.34	31	NM_001270622	0		0	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	G	34	5.373412	0.95923	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448;ENST00000548444	D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	6.06	6.06	0.98353	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.92770	0.7701	M	0.77486	2.375	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.91409	0.5149	9	.	.	.	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	173	O60669	MOT2_HUMAN	S	173;173;173;173;173;74;58	ENSP00000449547:G173S;ENSP00000448071:G173S;ENSP00000448742:G173S;ENSP00000446722:G173S;ENSP00000261187:G173S;ENSP00000443731:G74S;ENSP00000447814:G58S	.	G	+	1	0	SLC16A7	58454860	1.000000	0.71417	0.971000	0.41717	0.823000	0.46562	9.869000	0.99810	2.880000	0.98712	0.650000	0.86243	GGC			0.448	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406587.1		NM_004731	
TRPV4	59341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110230496	110230496	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:110230496C>T	ENST00000418703.2	-	10	1879	c.1785G>A	c.(1783-1785)ggG>ggA	p.G595G	TRPV4_ENST00000392719.2_Silent_p.G548G|TRPV4_ENST00000261740.2_Silent_p.G595G|TRPV4_ENST00000544971.1_Silent_p.G488G|TRPV4_ENST00000536838.1_Silent_p.G561G|TRPV4_ENST00000346520.2_Silent_p.G535G|TRPV4_ENST00000541794.1_Silent_p.G548G|TRPV4_ENST00000537083.1_Silent_p.G535G	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	595					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TCAGCTTCAGCCCACGGGTGA	0.597																																					p.G595G													.	.			0			c.G1785A												93.0	75.0	81.0					12																	110230496		2203	4300	6503	SO:0001819	synonymous_variant	59341	exon11			CTTCAGCCCACGG	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1785G>A	12.37:g.110230496C>T			73	0	0		84	0.30	25	NM_021625	38	0.26	10	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	CCDS9134.1																																																																																					0.597	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403270.1		NM_021625	
SRRM4	84530	mdanderson.org	37	12	119568524	119568524	+	Missense_Mutation	SNP	G	G	T	rs559217766	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr12:119568524G>T	ENST00000267260.4	+	8	1044	c.656G>T	c.(655-657)cGa>cTa	p.R219L	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	219	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						AAGTCCCGCCGAAGGCACTCC	0.657																																					p.R219L													.	.			0			c.G656T												19.0	24.0	22.0					12																	119568524		1916	4105	6021	SO:0001583	missense	84530	exon8			CCCGCCGAAGGCA	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.656G>T	12.37:g.119568524G>T	ENSP00000267260:p.Arg219Leu		19	0	0		27	0.07	2	NM_194286	9	0.00	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322913	0.81580	.	.	ENSG00000139767	ENST00000267260	T	0.25085	1.82	5.07	4.18	0.49190	.	0.282843	0.28403	N	0.015470	T	0.23094	0.0558	L	0.50333	1.59	0.35720	D	0.817044	P	0.44429	0.835	P	0.44732	0.459	T	0.14699	-1.0463	10	0.05436	T	0.98	-2.736	10.6863	0.45846	0.0886:0.0:0.9114:0.0	.	219	A7MD48	SRRM4_HUMAN	L	219	ENSP00000267260:R219L	ENSP00000267260:R219L	R	+	2	0	SRRM4	118052907	0.951000	0.32395	0.966000	0.40874	0.950000	0.60333	1.852000	0.39348	1.135000	0.42183	0.448000	0.29417	CGA			0.657	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401640.2		NM_194286	
MTIF3	219402	ucsc.edu	37	13	28014392	28014392	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr13:28014392C>T	ENST00000381116.1	-	5	428	c.194G>A	c.(193-195)gGa>gAa	p.G65E	MTIF3_ENST00000381120.3_Missense_Mutation_p.G65E|MTIF3_ENST00000431572.2_Missense_Mutation_p.G65E|MTIF3_ENST00000461838.1_5'UTR|MTIF3_ENST00000405591.2_Missense_Mutation_p.G65E			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	65					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		TGTCTTTTTTCCTTCATTCTG	0.403																																					p.G65E													.	MTIF3	21		0			c.G194A												106.0	109.0	108.0					13																	28014392		2203	4300	6503	SO:0001583	missense	219402	exon4			TTTTTTCCTTCAT	BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633	ENST00000381116.1:c.194G>A	13.37:g.28014392C>T	ENSP00000370508:p.Gly65Glu		123	0	0		74	0.01	1	NM_001166263	111	0.11	12	Q05BL8|Q5W0V0|Q86X68	Missense_Mutation	SNP	ENST00000381116.1	37	CCDS9322.1	.	.	.	.	.	.	.	.	.	.	C	3.884	-0.025346	0.07589	.	.	ENSG00000122033	ENST00000431572;ENST00000405591;ENST00000381116;ENST00000381120	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.82	-0.823	0.10815	.	0.504141	0.21766	N	0.069438	T	0.15912	0.0383	L	0.36672	1.1	0.09310	N	1	B	0.23806	0.091	B	0.19148	0.024	T	0.09357	-1.0678	10	0.32370	T	0.25	-6.0618	0.9703	0.01414	0.2413:0.3473:0.1435:0.2679	.	65	Q9H2K0	IF3M_HUMAN	E	65	ENSP00000400084:G65E;ENSP00000384659:G65E;ENSP00000370508:G65E;ENSP00000370512:G65E	ENSP00000370508:G65E	G	-	2	0	MTIF3	26912392	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.094000	0.01351	0.048000	0.15891	0.655000	0.94253	GGA			0.403	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044300.1		NM_152912	
MYH6	4624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23874338	23874338	+	Splice_Site	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr14:23874338T>C	ENST00000356287.3	-	5	532		c.e5-2		MYH6_ENST00000405093.3_Splice_Site			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha						adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCTCCCGATCTGGAAGAAAAA	0.592																																					.													.	.			0			c.503-2A>G												98.0	95.0	96.0					14																	23874338		2203	4300	6503	SO:0001630	splice_region_variant	4624	exon7			CCGATCTGGAAGA	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.503-2A>G	14.37:g.23874338T>C			73	0	0		60	0.37	22	NM_002471	0		0	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Splice_Site	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	T	18.50	3.638019	0.67130	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	.	.	.	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5626	0.61799	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH6	22944178	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.544000	0.82117	1.939000	0.56221	0.439000	0.28862	.			0.592	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071796.3			Intron
FOXA1	3169	mdanderson.org	37	14	38061627	38061627	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr14:38061627G>T	ENST00000250448.2	-	2	423	c.362C>A	c.(361-363)gCg>gAg	p.A121E	FOXA1_ENST00000540786.1_Missense_Mutation_p.A88E|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	121					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CATGGAGGCCGCCTGCTGCGC	0.741																																					p.A121E													.	.			0			c.C362A												10.0	12.0	11.0					14																	38061627		2101	4123	6224	SO:0001583	missense	3169	exon2			GAGGCCGCCTGCT	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.362C>A	14.37:g.38061627G>T	ENSP00000250448:p.Ala121Glu		18	0	0		13	0.15	2	NM_004496	5	0.00	0	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	ENST00000250448.2	37	CCDS9665.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.343890	0.82022	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	T;T	0.19394	2.15;2.15	4.29	4.29	0.51040	Fork-head N-terminal (1);	0.292387	0.32563	N	0.005930	T	0.23649	0.0572	L	0.46157	1.445	0.44871	D	0.997888	P	0.38535	0.635	B	0.42959	0.403	T	0.02161	-1.1203	10	0.46703	T	0.11	.	12.1151	0.53860	0.0:0.0:1.0:0.0	.	121	P55317	FOXA1_HUMAN	E	121;88	ENSP00000250448:A121E;ENSP00000440178:A88E	ENSP00000250448:A121E	A	-	2	0	FOXA1	37131378	0.922000	0.31269	0.578000	0.28575	0.956000	0.61745	3.374000	0.52402	2.217000	0.71921	0.505000	0.49811	GCG			0.741	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276735.1			
FOS	2353	mdanderson.org	37	14	75747998	75747998	+	Silent	SNP	G	G	T	rs558771086		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr14:75747998G>T	ENST00000303562.4	+	4	1223	c.1014G>T	c.(1012-1014)acG>acT	p.T338T	FOS_ENST00000555686.1_Silent_p.T224T|FOS_ENST00000555347.1_Silent_p.T190T|FOS_ENST00000535987.1_Silent_p.T302T	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	338					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	CTGCTTACACGTCTTCCTTCG	0.637																																					p.T338T													.	.			0			c.G1014T												78.0	80.0	79.0					14																	75747998		2203	4300	6503	SO:0001819	synonymous_variant	2353	exon4			TTACACGTCTTCC	K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.1014G>T	14.37:g.75747998G>T			50	0	0		35	0.09	3	NM_005252	958	0.00	0	A8K4E2|B4DQ65|P18849	Silent	SNP	ENST00000303562.4	37	CCDS9841.1																																																																																					0.637	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415044.1		NM_005252	
Unknown	0	bcgsc.ca	37	15	23182145	23182145	+	IGR	SNP	A	A	G	rs371836	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:23182145A>G								RP11-26F2.1 (50218 upstream) : WHAMMP3 (5582 downstream)																							ATGCACATCCAGTGAGTGGAT	0.512																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ACATCCAGTGAGT																													15.37:g.23182145A>G			44	0	0		29	0.17	5	.	3	0.00	0		RNA	SNP		37																																																																																					0	0.512										
Unknown	0	bcgsc.ca	37	15	23182149	23182149	+	IGR	SNP	A	A	G	rs371829	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:23182149A>G								RP11-26F2.1 (50222 upstream) : WHAMMP3 (5578 downstream)																							ACATCCAGTGAGTGGATGATG	0.512																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CCAGTGAGTGGAT																													15.37:g.23182149A>G			43	0.023255814	1		27	0.22	6	.	3	0.33	1		RNA	SNP		37																																																																																					0	0.512										
FAN1	22909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	31217365	31217365	+	Silent	SNP	G	G	A	rs141117593		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:31217365G>A	ENST00000362065.4	+	9	2499	c.2208G>A	c.(2206-2208)ccG>ccA	p.P736P	FAN1_ENST00000568145.1_3'UTR|RP11-540B6.6_ENST00000602886.1_RNA	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	736					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						TGGCGGATCCGGAAGTCAGAA	0.552								Direct reversal of damage																													p.P736P													.	.			0			c.G2208A							A		1,4403	2.1+/-5.4	0,1,2201	46.0	48.0	47.0		2208	-11.4	0.0	15	dbSNP_134	47	0,8600		0,0,4300	no	coding-synonymous	FAN1	NM_014967.4		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		736/1018	31217365	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	22909	exon9			GGATCCGGAAGTC		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.2208G>A	15.37:g.31217365G>A			62	0	0		36	0.42	15	NM_014967	31	0.42	13	A8K4M2|Q86WU8	Silent	SNP	ENST00000362065.4	37	CCDS32186.1																																																																																			0		0.552	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430740.1		NM_014967	
MGA	23269	ucsc.edu;bcgsc.ca	37	15	42058685	42058685	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:42058685C>T	ENST00000570161.1	+	23	8405	c.8405C>T	c.(8404-8406)gCa>gTa	p.A2802V	MGA_ENST00000389936.4_Missense_Mutation_p.A2763V|MGA_ENST00000566586.1_Missense_Mutation_p.A2593V|MGA_ENST00000545763.1_Missense_Mutation_p.A2593V|MGA_ENST00000219905.7_Missense_Mutation_p.A2802V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATAGAGGAAGCAGCTCTTGAT	0.378																																					p.A2802V													.	MGA	264		0			c.C8405T												92.0	90.0	90.0					15																	42058685		2041	4200	6241	SO:0001583	missense	23269	exon24			AGGAAGCAGCTCT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8405C>T	15.37:g.42058685C>T	ENSP00000457035:p.Ala2802Val		55	0	0		39	0.10	4	NM_001164273	26	0.00	0	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228323	0.79576	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.85258	-1.92;-1.9;-1.96	5.37	4.43	0.53597	.	0.121611	0.36134	N	0.002776	T	0.76586	0.4008	N	0.19112	0.55	0.26041	N	0.981604	B;B	0.20671	0.047;0.028	B;B	0.23419	0.046;0.02	T	0.70702	-0.4799	10	0.87932	D	0	.	13.3557	0.60627	0.0:0.922:0.0:0.078	.	2593;2802	F5H7K2;E7ENI0	.;.	V	2802;2763;2593	ENSP00000219905:A2802V;ENSP00000374586:A2763V;ENSP00000442467:A2593V	ENSP00000219905:A2802V	A	+	2	0	MGA	39845977	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.689000	0.46993	1.430000	0.47334	0.650000	0.86243	GCA			0.378	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000420229.1		NM_001164273.1	
UACA	55075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	70976695	70976695	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:70976695C>T	ENST00000322954.6	-	8	878	c.693G>A	c.(691-693)gcG>gcA	p.A231A	UACA_ENST00000539319.1_Intron|UACA_ENST00000559183.1_5'Flank|UACA_ENST00000379983.2_Silent_p.A218A|UACA_ENST00000560441.1_Silent_p.A218A	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	231					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						CATGGCCAAGCGCATCCAGCA	0.408																																					p.A231A													UACA_ENST00000322954,right_upper_lobe,carcinoma,-1,3	UACA_ENST00000322954	-1	3	0			c.G693A												192.0	182.0	185.0					15																	70976695		2199	4297	6496	SO:0001819	synonymous_variant	55075	exon8			GCCAAGCGCATCC	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.693G>A	15.37:g.70976695C>T			84	0	0		89	0.26	23	NM_018003	70	0.23	16	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	ENST00000322954.6	37	CCDS10235.1																																																																																					0.408	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257199.2			
SEC11A	23478	mdanderson.org	37	15	85234840	85234840	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr15:85234840G>T	ENST00000268220.7	-	2	727	c.87C>A	c.(85-87)gtC>gtA	p.V29V	SEC11A_ENST00000558134.1_Silent_p.V29V|SEC11A_ENST00000560266.1_Silent_p.V29V|SEC11A_ENST00000455959.3_Silent_p.V3V	NM_014300.2	NP_055115.1	P67812	SC11A_HUMAN	SEC11 homolog A (S. cerevisiae)	29					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			GTGCCGATGAGACAATCATTC	0.413																																					p.V29V													.	.			0			c.C87A												91.0	83.0	86.0					15																	85234840		1885	4124	6009	SO:0001819	synonymous_variant	23478	exon2			CGATGAGACAATC	AF061737	CCDS45340.1, CCDS61742.1, CCDS61743.1, CCDS61744.1, CCDS73776.1	15q25.2	2006-11-07	2006-11-07	2006-11-07		ENSG00000140612			17718	protein-coding gene	gene with protein product			"""SEC11-like 1 (S. cerevisiae)"""	SEC11L1			Standard	NM_001271919		Approved	SPC18, sid2895, SPCS4A	uc031qtg.1	P67812		ENST00000268220.7:c.87C>A	15.37:g.85234840G>T			89	0.0112359551	1		75	0.05	4	NM_001271921	468	0.00	0	B2RAD7|B4DUL4|H0YK72|H0YK83|O75957|P21378|Q53FQ8	Silent	SNP	ENST00000268220.7	37	CCDS45340.1																																																																																					0.413	SEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418777.1		NM_014300	
CACNA1H	8912	mdanderson.org	37	16	1260952	1260952	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:1260952C>T	ENST00000348261.5	+	21	4452	c.4204C>T	c.(4204-4206)Cgg>Tgg	p.R1402W	CACNA1H_ENST00000358590.4_Missense_Mutation_p.R1402W|CACNA1H_ENST00000565831.1_Missense_Mutation_p.R1402W	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1402					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GCGTCTGCTGCGGACCCTGCG	0.687																																					p.R1402W													.	.			0			c.C4204T												80.0	95.0	90.0					16																	1260952		2175	4268	6443	SO:0001583	missense	8912	exon21			CTGCTGCGGACCC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4204C>T	16.37:g.1260952C>T	ENSP00000334198:p.Arg1402Trp		19	0	0		23	0.13	3	NM_021098	35	0.00	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182653	0.57800	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98822	-5.16;-5.16	4.11	-0.907	0.10521	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99504	0.9823	H	0.99794	4.785	0.46298	D	0.998971	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	D	0.98260	1.0498	10	0.87932	D	0	.	13.237	0.59974	0.5169:0.4831:0.0:0.0	.	143;143;143;1402;1402	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	W	1402	ENSP00000334198:R1402W;ENSP00000351401:R1402W	ENSP00000334198:R1402W	R	+	1	2	CACNA1H	1200953	0.993000	0.37304	0.998000	0.56505	0.538000	0.34931	0.541000	0.23207	0.090000	0.17273	0.491000	0.48974	CGG			0.687	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421601.1		NM_001005407	
SRRM2	23524	bcgsc.ca;mdanderson.org	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	SRRM2_ENST00000574593.1_3'UTR|AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S													.	SRRM2	263		0			c.C7875T												141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	16.37:g.2819139C>T			64	0.015625	1		68	0.07	5	NM_016333	719	0.00	3	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																					0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436411.1			
PRSS33	260429	mdanderson.org	37	16	2835120	2835120	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:2835120G>T	ENST00000293851.5	-	5	726	c.567C>A	c.(565-567)gaC>gaA	p.D189E	PRSS33_ENST00000570702.1_Missense_Mutation_p.D189E|PRSS33_ENST00000576886.1_Missense_Mutation_p.L99I	NM_152891.2	NP_690851.2	Q8NF86	PRS33_HUMAN	protease, serine, 33	189	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			prostate(1)	1						AGGTGCGCGAGTCCAGCAGCG	0.701																																					p.D189E	NSCLC(194;489 2153 16702 19171 27758)												.	.			0			c.C567A												5.0	7.0	7.0					16																	2835120		2035	4123	6158	SO:0001583	missense	260429	exon5			GCGCGAGTCCAGC	AF536382	CCDS42110.1	16p13.3	2014-09-04			ENSG00000103355	ENSG00000103355		"""Serine peptidases / Serine peptidases"""	30405	protein-coding gene	gene with protein product		613797				12795636	Standard	NM_152891		Approved	EOS	uc002cro.1	Q8NF86	OTTHUMG00000177360	ENST00000293851.5:c.567C>A	16.37:g.2835120G>T	ENSP00000293851:p.Asp189Glu		27	0	0		18	0.17	3	NM_152891	11	0.00	0	A6NNQ3|Q8N171	Missense_Mutation	SNP	ENST00000293851.5	37	CCDS42110.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765397	0.31228	.	.	ENSG00000103355	ENST00000293851	D	0.82526	-1.62	4.42	-1.14	0.09741	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.224693	0.30850	N	0.008742	D	0.82793	0.5114	L	0.41027	1.25	0.09310	N	0.999998	D	0.64830	0.994	D	0.69479	0.964	T	0.74808	-0.3539	10	0.35671	T	0.21	.	8.7673	0.34711	0.5112:0.0:0.4888:0.0	.	189	Q8NF86	PRS33_HUMAN	E	189	ENSP00000293851:D189E	ENSP00000293851:D189E	D	-	3	2	PRSS33	2775121	0.000000	0.05858	0.006000	0.13384	0.420000	0.31355	0.081000	0.14823	-0.545000	0.06224	0.486000	0.48141	GAC			0.701	PRSS33-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436446.1		NM_152891	
C16orf62	57020	broad.mit.edu	37	16	19612991	19612991	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:19612991C>A	ENST00000251143.5	+	9	742	c.730C>A	c.(730-732)Ctc>Atc	p.L244I	C16orf62_ENST00000448695.1_Splice_Site_p.L94I|C16orf62_ENST00000543152.1_5'UTR|C16orf62_ENST00000542263.1_Missense_Mutation_p.L333I|C16orf62_ENST00000538853.1_3'UTR|C16orf62_ENST00000417362.2_Missense_Mutation_p.L244I|C16orf62_ENST00000438132.3_Missense_Mutation_p.L333I			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	244						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CCCAGGAAAGCTCGTGTACGA	0.488											OREG0023661	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L333I													.	C16orf62	164		0			c.C997A												157.0	124.0	135.0					16																	19612991		2197	4300	6497	SO:0001583	missense	57020	exon9			GGAAAGCTCGTGT		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.730C>A	16.37:g.19612991C>A	ENSP00000251143:p.Leu244Ile		86	0.011627907	1	734	66	0.06	4	NM_020314	65	0.05	3	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	37		.	.	.	.	.	.	.	.	.	.	C	17.02	3.283011	0.59867	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	5.3	1.97	0.26223	.	0.000000	0.64402	D	0.000001	T	0.77665	0.4164	M	0.87547	2.89	0.80722	D	1	D;D;D;D	0.67145	0.984;0.974;0.967;0.996	P;D;P;D	0.67725	0.752;0.953;0.789;0.946	T	0.79077	-0.1951	10	0.66056	D	0.02	-15.1376	10.2431	0.43324	0.0:0.7537:0.0:0.2463	.	244;333;244;333	B3KT69;F5H7K1;Q7Z3J2;E7EWW0	.;.;CP062_HUMAN;.	I	333;333;244;244;94	ENSP00000400815:L333I;ENSP00000442468:L333I;ENSP00000251143:L244I;ENSP00000395973:L244I;ENSP00000398009:L94I	ENSP00000251143:L244I	L	+	1	0	C16orf62	19520492	1.000000	0.71417	0.902000	0.35471	0.635000	0.38103	1.183000	0.32041	0.613000	0.30089	0.462000	0.41574	CTC			0.488	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_020314	
KNOP1	400506	mdanderson.org	37	16	19718523	19718523	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:19718523C>T	ENST00000219837.7	-	5	1164	c.1086G>A	c.(1084-1086)tgG>tgA	p.W362*	KNOP1_ENST00000568230.1_Nonsense_Mutation_p.W41*|AC002550.5_ENST00000565916.1_RNA	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	362	Interaction with ZNF106. {ECO:0000250}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CAGCAGTATCCCACTGGCCAA	0.517																																					p.W362X													.	.			0			c.G1086A												36.0	38.0	37.0					16																	19718523		1928	4129	6057	SO:0001587	stop_gained	400506	exon5			AGTATCCCACTGG	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.1086G>A	16.37:g.19718523C>T	ENSP00000219837:p.Trp362*		40	0	0		40	0.08	3	NM_001012991	110	0.00	0	O43328|Q5FWF3	Nonsense_Mutation	SNP	ENST00000219837.7	37	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	C	37	6.583499	0.97684	.	.	ENSG00000103550	ENST00000219837	.	.	.	4.96	4.96	0.65561	.	0.559743	0.19815	N	0.105449	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.7986	18.4134	0.90559	0.0:1.0:0.0:0.0	.	.	.	.	X	362	.	.	W	-	3	0	C16orf88	19626024	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.066000	0.71185	2.556000	0.86216	0.563000	0.77884	TGG			0.517	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435993.2		NM_001012991	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30723654	30723654	+	Silent	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:30723654G>A	ENST00000262518.4	+	13	2272	c.1887G>A	c.(1885-1887)ctG>ctA	p.L629L	SRCAP_ENST00000395059.2_Silent_p.L629L|SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Silent_p.L629L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	629					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TAGACTGGCTGGTTACCATGT	0.522																																					p.L629L													SRCAP,bladder,carcinoma,+2,1	SRCAP	2	1	0			c.G1887A												102.0	91.0	95.0					16																	30723654		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon13			CTGGCTGGTTACC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1887G>A	16.37:g.30723654G>A			83	0	0		65	0.25	16	NM_006662	37	0.32	12	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																					0.522	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255523.1		NM_006662	
ARMC5	79798	mdanderson.org	37	16	31473510	31473510	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr16:31473510G>T	ENST00000563544.1	+	4	1188	c.642G>T	c.(640-642)caG>caT	p.Q214H	RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000457010.2_Missense_Mutation_p.Q214H|ARMC5_ENST00000538189.1_Missense_Mutation_p.Q246H|ARMC5_ENST00000268314.4_Missense_Mutation_p.Q214H|ARMC5_ENST00000412665.2_Missense_Mutation_p.Q50H|ARMC5_ENST00000408912.3_Missense_Mutation_p.Q309H			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	214										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						AGTGCCTACAGAGCGTGGTGC	0.657																																					p.Q214H													.	.			0			c.G642T												68.0	74.0	72.0					16																	31473510		2162	4263	6425	SO:0001583	missense	79798	exon3			CCTACAGAGCGTG	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.642G>T	16.37:g.31473510G>T	ENSP00000456877:p.Gln214His		32	0	0		27	0.15	4	NM_001105247	47	0.00	0	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	.	.	.	.	.	.	.	.	.	.	g	15.73	2.920608	0.52653	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010;ENST00000412665	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	4.25	3.29	0.37713	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58466	0.2124	L	0.50333	1.59	0.24453	N	0.994474	D;D;D;D;D	0.89917	0.997;0.997;1.0;0.997;0.998	D;D;D;D;D	0.85130	0.993;0.995;0.997;0.993;0.994	T	0.47315	-0.9127	10	0.44086	T	0.13	-6.5611	9.7277	0.40342	0.1027:0.0:0.8973:0.0	.	246;246;309;214;214	B4DH27;F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;.;ARMC5_HUMAN;.	H	309;246;214;214;50	ENSP00000386125:Q309H;ENSP00000443995:Q246H;ENSP00000268314:Q214H;ENSP00000399561:Q214H;ENSP00000400183:Q50H	ENSP00000268314:Q214H	Q	+	3	2	ARMC5	31381011	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.471000	0.45127	1.003000	0.39130	0.556000	0.70494	CAG			0.657	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432847.1		NM_024742	
WDR81	124997	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	1631599	1631599	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr17:1631599G>A	ENST00000409644.1	+	1	3346	c.3346G>A	c.(3346-3348)Gag>Aag	p.E1116K	WDR81_ENST00000446363.1_Intron|WDR81_ENST00000545662.1_5'Flank|WDR81_ENST00000419248.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000309182.5_Missense_Mutation_p.E65K	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1116					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CAGCACCAGCGAGACCTCCCT	0.642																																					p.E1116K													.	WDR81	180		0			c.G3346A												51.0	59.0	57.0					17																	1631599		2202	4297	6499	SO:0001583	missense	124997	exon1			ACCAGCGAGACCT	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3346G>A	17.37:g.1631599G>A	ENSP00000386609:p.Glu1116Lys		63	0.0317460317	2		48	0.33	16	NM_001163809	31	0.23	7	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	37	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602748	0.87157	.	.	ENSG00000167716	ENST00000309182;ENST00000409644	T;T	0.60920	1.95;0.15	5.65	5.65	0.86999	.	0.101360	0.64402	D	0.000003	T	0.48021	0.1477	L	0.29908	0.895	0.80722	D	1	P;P	0.49862	0.929;0.929	B;B	0.38020	0.263;0.175	T	0.56300	-0.8002	10	0.72032	D	0.01	.	19.7221	0.96147	0.0:0.0:1.0:0.0	.	243;65	Q8TEL1;Q562E7	.;WDR81_HUMAN	K	65;1116	ENSP00000312074:E65K;ENSP00000386609:E1116K	ENSP00000312074:E65K	E	+	1	0	WDR81	1578349	1.000000	0.71417	0.789000	0.31954	0.867000	0.49689	9.720000	0.98763	2.679000	0.91253	0.655000	0.94253	GAG			0.642	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000333118.2		NM_152348	
GAS2L2	246176	broad.mit.edu	37	17	34077157	34077157	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr17:34077157T>G	ENST00000254466.6	-	2	593	c.566A>C	c.(565-567)gAc>gCc	p.D189A	GAS2L2_ENST00000587565.1_Intron	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	189					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGGCGAGGGGTCGGGCGGGGG	0.741																																					p.D189A													GAS2L2,right_upper_lobe,carcinoma,0,2	GAS2L2	94	2	0			c.A566C												20.0	26.0	24.0					17																	34077157		2188	4280	6468	SO:0001583	missense	246176	exon2			GAGGGGTCGGGCG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.566A>C	17.37:g.34077157T>G	ENSP00000254466:p.Asp189Ala		60	0.3	18		64	0.52	33	NM_139285	5	0.00	0	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	T	7.826	0.718860	0.15372	.	.	ENSG00000132139	ENST00000254466	T	0.18016	2.24	4.98	2.77	0.32553	.	1.437920	0.04140	N	0.319452	T	0.17152	0.0412	L	0.51422	1.61	0.26149	N	0.980163	P	0.37781	0.608	B	0.30401	0.115	T	0.28902	-1.0029	10	0.49607	T	0.09	0.0179	8.0796	0.30737	0.0:0.1677:0.0:0.8323	.	189	Q8NHY3	GA2L2_HUMAN	A	189	ENSP00000254466:D189A	ENSP00000254466:D189A	D	-	2	0	GAS2L2	31101270	0.986000	0.35501	0.134000	0.22075	0.011000	0.07611	2.112000	0.41892	0.749000	0.32854	0.402000	0.26972	GAC			0.741	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256497.1		NM_139285	
TBC1D3	729873	broad.mit.edu;bcgsc.ca	37	17	36353755	36353755	+	5'UTR	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr17:36353755G>A	ENST00000537432.1	-	0	167				RP11-1407O15.2_ENST00000312412.4_Missense_Mutation_p.T369I|RP11-1407O15.2_ENST00000544906.1_Missense_Mutation_p.T214I			Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCAAAGATGAGTCCACCATTC	0.353																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	0	.			AGATGAGTCCACC		CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000537432.1:c.-322C>T	17.37:g.36353755G>A			122	0	0		85	0.08	7	.	41	0.12	5	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Missense_Mutation	SNP	ENST00000537432.1	37	CCDS45658.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047367	0.55110	.	.	ENSG00000174093	ENST00000544906;ENST00000520237;ENST00000312412;ENST00000518004	T;T;T;T	0.05139	3.49;3.49;3.49;3.49	2.5	2.5	0.30297	.	.	.	.	.	T	0.16854	0.0405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02484	-1.1152	6	0.72032	D	0.01	.	12.9976	0.58657	0.0:0.0:1.0:0.0	.	.	.	.	I	214;369;369;365	ENSP00000444117:T214I;ENSP00000428261:T369I;ENSP00000308540:T369I;ENSP00000428330:T365I	ENSP00000308540:T369I	T	-	2	0	RP11-1407O15.2	33607554	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	9.426000	0.97469	1.389000	0.46526	0.184000	0.17185	ACT			0.353	TBC1D3-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001123391	
EMILIN2	84034	ucsc.edu	37	18	2913106	2913106	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr18:2913106G>T	ENST00000254528.3	+	8	3025	c.2866G>T	c.(2866-2868)Gcc>Tcc	p.A956S	EMILIN2_ENST00000308080.5_3'UTR	NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	956	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		CCTGATCACGGCCACCCTCAC	0.622																																					p.A956S													.	EMILIN2	97		0			c.G2866T												56.0	58.0	57.0					18																	2913106		2203	4300	6503	SO:0001583	missense	84034	exon8			ATCACGGCCACCC	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2866G>T	18.37:g.2913106G>T	ENSP00000254528:p.Ala956Ser		45	0	0		33	0.12	4	NM_032048	31	0.00	0	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113632	0.56398	.	.	ENSG00000132205	ENST00000254528;ENST00000308080	T	0.74947	-0.89	5.38	5.38	0.77491	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.64402	D	0.000001	D	0.85483	0.5707	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82335	-0.0508	10	0.27785	T	0.31	-21.6945	19.4811	0.95009	0.0:0.0:1.0:0.0	.	956	Q9BXX0	EMIL2_HUMAN	S	956;233	ENSP00000254528:A956S	ENSP00000254528:A956S	A	+	1	0	EMILIN2	2903106	1.000000	0.71417	0.961000	0.40146	0.048000	0.14542	9.358000	0.97109	2.669000	0.90835	0.655000	0.94253	GCC			0.622	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250337.2		NM_032048	
OSBPL1A	114876	mdanderson.org	37	18	21747306	21747306	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr18:21747306G>T	ENST00000319481.3	-	25	2728	c.2522C>A	c.(2521-2523)cCa>cAa	p.P841Q	OSBPL1A_ENST00000357041.4_Missense_Mutation_p.P459Q|OSBPL1A_ENST00000399443.3_Missense_Mutation_p.P328Q	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	841				P -> S (in Ref. 1; AAL40662). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					GGCAGAATTTGGAGGCCGTGG	0.552																																					p.P841Q													.	.			0			c.C2522A												71.0	73.0	72.0					18																	21747306		2203	4300	6503	SO:0001583	missense	114876	exon25			GAATTTGGAGGCC	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2522C>A	18.37:g.21747306G>T	ENSP00000320291:p.Pro841Gln		122	0	0		68	0.07	5	NM_080597	57	0.00	0	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497864	0.44455	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.29917	1.55;1.55;1.55	6.02	5.14	0.70334	.	0.146336	0.64402	D	0.000006	T	0.39682	0.1087	M	0.72118	2.19	0.80722	D	1	P	0.42203	0.773	B	0.42827	0.399	T	0.36553	-0.9743	10	0.54805	T	0.06	-16.8454	15.1526	0.72713	0.0677:0.0:0.9323:0.0	.	841	Q9BXW6	OSBL1_HUMAN	Q	841;328;459	ENSP00000320291:P841Q;ENSP00000382372:P328Q;ENSP00000349545:P459Q	ENSP00000320291:P841Q	P	-	2	0	OSBPL1A	20001304	1.000000	0.71417	0.797000	0.32132	0.987000	0.75469	6.069000	0.71209	1.541000	0.49316	0.655000	0.94253	CCA			0.552	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254902.1		NM_080597	
KCTD1	284252	mdanderson.org	37	18	24127791	24127791	+	Intron	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr18:24127791C>T	ENST00000408011.3	-	1	545				KCTD1_ENST00000417602.1_Missense_Mutation_p.R237H|KCTD1_ENST00000579973.1_Intron|KCTD1_ENST00000317932.7_Intron|KCTD1_ENST00000580059.1_5'Flank	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ATTGAGGTAGCGGTTGAGGGA	0.662																																					p.R237H													.	.			0			c.G710A												80.0	87.0	85.0					18																	24127791		692	1591	2283	SO:0001627	intron_variant	284252	exon1			AGGTAGCGGTTGA	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.14+1063G>A	18.37:g.24127791C>T			12	0	0		14	0.14	2	NM_001142730	30	0.00	0	A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	37	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.990697	0.74589	.	.	ENSG00000134504	ENST00000417602	D	0.85556	-2.0	4.53	4.53	0.55603	.	.	.	.	.	D	0.90892	0.7138	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.92418	0.5943	6	0.87932	D	0	.	15.8648	0.79057	0.0:1.0:0.0:0.0	.	.	.	.	H	237	ENSP00000408405:R237H	ENSP00000408405:R237H	R	-	2	0	KCTD1	22381789	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.964000	0.76061	2.073000	0.62155	0.563000	0.77884	CGC			0.662	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000446265.1		XM_209091	
ZNF236	7776	bcgsc.ca	37	18	74637144	74637144	+	Splice_Site	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr18:74637144G>T	ENST00000253159.8	+	22	3853		c.e22-1		ZNF236_ENST00000320610.9_Splice_Site	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCTTTTCACAGGTCAGAAGCT	0.547																																					.													.	ZNF236	325		0			c.3656-1G>T												96.0	96.0	96.0					18																	74637144		2064	4219	6283	SO:0001630	splice_region_variant	7776	exon22			TTCACAGGTCAGA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3656-1G>T	18.37:g.74637144G>T			70	0	0		46	0.09	4	NM_007345	0		0	B2RTX9|Q9UL37	Splice_Site	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076210	0.76415	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9368	0.92589	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF236	72766132	1.000000	0.71417	0.970000	0.41538	0.717000	0.41224	9.424000	0.97464	2.475000	0.83589	0.650000	0.86243	.			0.547	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000445776.1			Intron
OLFM2	93145	mdanderson.org	37	19	9965327	9965327	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr19:9965327C>T	ENST00000264833.4	-	6	1085	c.900G>A	c.(898-900)gtG>gtA	p.V300V	OLFM2_ENST00000590841.1_Silent_p.V222V	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	300	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GGCTCCTCTGCACCAGCACAG	0.617																																					p.V300V													.	.			0			c.G900A												61.0	61.0	61.0					19																	9965327		2203	4300	6503	SO:0001819	synonymous_variant	93145	exon6			CCTCTGCACCAGC	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.900G>A	19.37:g.9965327C>T			56	0	0		42	0.07	3	NM_058164	313	0.00	0	Q6IMJ3|Q96FC2	Silent	SNP	ENST00000264833.4	37	CCDS12221.1																																																																																					0.617	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451119.1			
PRKCSH	5589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11546956	11546956	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr19:11546956G>T	ENST00000589838.1	+	1	18	c.18G>T	c.(16-18)ctG>ctT	p.L6L	PRKCSH_ENST00000412601.1_Silent_p.L6L|PRKCSH_ENST00000591462.1_Silent_p.L6L|PRKCSH_ENST00000587327.1_Silent_p.L6L|CCDC151_ENST00000586836.1_5'Flank|CCDC151_ENST00000591179.1_5'Flank|PRKCSH_ENST00000592741.1_Silent_p.L6L|PRKCSH_ENST00000252455.2_Silent_p.L6L|CCDC151_ENST00000545100.1_5'Flank|CCDC151_ENST00000356392.4_5'Flank			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	6					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						tgccgctgctgctgctgctAC	0.652											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L6L													.	.			0			c.G18T												28.0	25.0	26.0					19																	11546956		2203	4298	6501	SO:0001819	synonymous_variant	5589	exon2			GCTGCTGCTGCTG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.18G>T	19.37:g.11546956G>T			20	0	0	673	25	0.44	11	NM_001001329	785	0.41	318	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																					0.652	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
ZNF333	84449	bcgsc.ca	37	19	14817526	14817526	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr19:14817526G>T	ENST00000292530.6	+	7	543	c.452G>T	c.(451-453)aGg>aTg	p.R151M	ZNF333_ENST00000536363.1_Missense_Mutation_p.R42M|ZNF333_ENST00000601134.1_Missense_Mutation_p.E91D|ZNF333_ENST00000540689.2_Missense_Mutation_p.R151M	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						CAGATTCAGAGGGTGGTGATA	0.602																																					p.R151M	NSCLC(60;75 1281 16985 25154 29885)												.	ZNF333	76		0			c.G452T												100.0	93.0	95.0					19																	14817526		2203	4300	6503	SO:0001583	missense	84449	exon7			TTCAGAGGGTGGT		CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.452G>T	19.37:g.14817526G>T	ENSP00000292530:p.Arg151Met		34	0	0		37	0.11	4	NM_032433	18	0.00	0	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	ENST00000292530.6	37	CCDS12316.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449881	0.43531	.	.	ENSG00000160961	ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.07114	3.22;5.77;3.27	2.29	2.29	0.28610	.	.	.	.	.	T	0.10165	0.0249	N	0.24115	0.695	0.09310	N	1	D	0.63046	0.992	P	0.53912	0.737	T	0.24012	-1.0172	9	0.48119	T	0.1	.	8.1747	0.31275	0.0:0.0:1.0:0.0	.	151	Q96JL9	ZN333_HUMAN	M	42;151;151	ENSP00000439749:R42M;ENSP00000438130:R151M;ENSP00000292530:R151M	ENSP00000292530:R151M	R	+	2	0	ZNF333	14678526	0.760000	0.28428	0.133000	0.22050	0.010000	0.07245	1.702000	0.37836	1.623000	0.50342	0.591000	0.81541	AGG			0.602	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466496.1		NM_032433	
ERCC1	2067	ucsc.edu;bcgsc.ca	37	19	45918201	45918201	+	Missense_Mutation	SNP	C	C	T	rs534974123		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr19:45918201C>T	ENST00000300853.3	-	7	1211	c.620G>A	c.(619-621)cGg>cAg	p.R207Q	ERCC1_ENST00000013807.5_Missense_Mutation_p.R207Q|ERCC1_ENST00000340192.7_Missense_Mutation_p.R207Q|ERCC1_ENST00000423698.2_Missense_Mutation_p.R135Q|ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000589165.1_Missense_Mutation_p.R207Q|ERCC1_ENST00000591636.1_Intron	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	207					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		CTCCAGGTACCGCCCAGCTTC	0.547								Nucleotide excision repair (NER)																													p.R207Q													.	ERCC1	46		0			c.G620A												85.0	74.0	78.0					19																	45918201		2203	4300	6503	SO:0001583	missense	2067	exon7			AGGTACCGCCCAG		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.620G>A	19.37:g.45918201C>T	ENSP00000300853:p.Arg207Gln		57	0	0		30	0.13	4	NM_001983	369	0.00	0	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	ENST00000300853.3	37	CCDS12662.1	.	.	.	.	.	.	.	.	.	.	C	30	5.051042	0.93740	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000423698;ENST00000013807	T;T;T;T	0.51325	0.78;0.71;0.86;0.75	5.21	5.21	0.72293	Restriction endonuclease, type II-like (1);	0.058451	0.64402	D	0.000001	T	0.58018	0.2093	M	0.82433	2.59	0.58432	D	0.999998	D;D;D;D	0.76494	0.997;0.999;0.999;0.999	B;P;P;P	0.46940	0.405;0.532;0.501;0.501	T	0.67650	-0.5616	10	0.87932	D	0	-34.1949	14.6773	0.68989	0.0:1.0:0.0:0.0	.	207;135;207;207	Q7Z7F5;B3KRR0;Q96S40;P07992	.;.;.;ERCC1_HUMAN	Q	207;207;135;207	ENSP00000300853:R207Q;ENSP00000345203:R207Q;ENSP00000394875:R135Q;ENSP00000013807:R207Q	ENSP00000013807:R207Q	R	-	2	0	ERCC1	50610041	1.000000	0.71417	0.437000	0.26809	0.915000	0.54546	5.064000	0.64338	2.617000	0.88574	0.505000	0.49811	CGG			0.547	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459542.1		NM_001983	
LIG1	3978	mdanderson.org	37	19	48636323	48636323	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr19:48636323G>T	ENST00000263274.7	-	18	2060	c.1641C>A	c.(1639-1641)ccC>ccA	p.P547P	LIG1_ENST00000536218.1_Silent_p.P479P|LIG1_ENST00000427526.2_Silent_p.P516P	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	547					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	TGCCCCGGGTGGGATGGGCCA	0.562								Nucleotide excision repair (NER)																													p.P547P													.	.			0			c.C1641A												116.0	114.0	115.0					19																	48636323		2203	4300	6503	SO:0001819	synonymous_variant	3978	exon18			CCGGGTGGGATGG		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1641C>A	19.37:g.48636323G>T			77	0	0		42	0.07	3	NM_000234	111	0.00	0	B2RAI8|Q2TB12|Q32P23	Silent	SNP	ENST00000263274.7	37	CCDS12711.1																																																																																					0.562	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465575.1		NM_000234	
DNMT3A	1788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25505572	25505572	+	Silent	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr2:25505572G>A	ENST00000264709.3	-	4	523	c.186C>T	c.(184-186)agC>agT	p.S62S	DNMT3A_ENST00000321117.5_Silent_p.S62S|DNMT3A_ENST00000406659.3_Silent_p.S62S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	62					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGTGTCACCGCTTTCCACCT	0.517			"""Mis, F, N, S"""		AML																																p.S62S				Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	.			0			c.C186T												47.0	56.0	53.0					2																	25505572		2200	4297	6497	SO:0001819	synonymous_variant	1788	exon4			GTCACCGCTTTCC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.186C>T	2.37:g.25505572G>A			113	0	0		95	0.27	26	NM_175630	48	0.31	15	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	37	CCDS33157.1																																																																																					0.517	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000211587.1		NM_022552	
EMILIN1	11117	mdanderson.org	37	2	27305627	27305627	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr2:27305627C>T	ENST00000380320.4	+	4	1687	c.1188C>T	c.(1186-1188)caC>caT	p.H396H		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	396					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGGAGGCCACCCCCCAGGCT	0.701																																					p.H396H													.	.			0			c.C1188T												5.0	5.0	5.0					2																	27305627		2028	3993	6021	SO:0001819	synonymous_variant	11117	exon4			AGGCCACCCCCCA	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1188C>T	2.37:g.27305627C>T			9	0	0		10	0.20	2	NM_007046	705	0.00	1	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Silent	SNP	ENST00000380320.4	37	CCDS1733.1																																																																																					0.701	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214185.1		NM_007046	
MTA3	57504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	42836614	42836614	+	Silent	SNP	A	A	G	rs201096010		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr2:42836614A>G	ENST00000405094.1	+	4	207	c.207A>G	c.(205-207)gaA>gaG	p.E69E	MTA3_ENST00000407270.3_Silent_p.E69E|MTA3_ENST00000406652.1_Silent_p.E13E|MTA3_ENST00000406911.1_Silent_p.E69E|MTA3_ENST00000405592.1_Silent_p.E13E			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	69	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						TTGAGGAAGAATCTGAAACAA	0.343																																					p.E69E													.	.			0			c.A207G												70.0	68.0	69.0					2																	42836614		1848	4096	5944	SO:0001819	synonymous_variant	57504	exon4			GGAAGAATCTGAA	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.207A>G	2.37:g.42836614A>G			117	0	0		110	0.29	32	NM_020744	95	0.31	29	Q9NSP2|Q9ULF4	Silent	SNP	ENST00000405094.1	37																																																																																						0.343	MTA3-017	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000318159.1		NM_020744	
SPEG	10290	mdanderson.org	37	2	220347856	220347856	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr2:220347856C>T	ENST00000312358.7	+	30	5803	c.5671C>T	c.(5671-5673)Cgc>Tgc	p.R1891C	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1891					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCTGGTGCTGCGCCCCATCCC	0.682																																					p.R1891C													.	.			0			c.C5671T												8.0	10.0	10.0					2																	220347856		1926	4088	6014	SO:0001583	missense	10290	exon30			GTGCTGCGCCCCA	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5671C>T	2.37:g.220347856C>T	ENSP00000311684:p.Arg1891Cys		40	0	0		43	0.07	3	NM_005876	9	0.00	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174276	0.38413	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.39997	1.05	4.89	4.89	0.63831	Protein kinase-like domain (1);	0.000000	0.39407	N	0.001363	T	0.52629	0.1746	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54906	-0.8223	10	0.87932	D	0	.	13.2379	0.59979	0.1588:0.8412:0.0:0.0	.	1891	Q15772	SPEG_HUMAN	C	1891	ENSP00000311684:R1891C	ENSP00000265327:R1891C	R	+	1	0	SPEG	220056100	0.998000	0.40836	1.000000	0.80357	0.823000	0.46562	0.547000	0.23299	2.538000	0.85594	0.557000	0.71058	CGC			0.682	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130252.2		NM_005876	
SNRPB	6628	broad.mit.edu	37	20	2443298	2443298	+	Silent	SNP	A	A	G			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr20:2443298A>G	ENST00000438552.2	-	6	831	c.669T>C	c.(667-669)ccT>ccC	p.P223P	SNRPB_ENST00000381342.2_Silent_p.P223P|SNRPB_ENST00000339610.6_Silent_p.P144P|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	223	Repeat-rich region.				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						TCCCAGGGGGAGGAGGCCGCA	0.582																																					p.P223P													.	SNRPB	29		0			c.T669C												52.0	55.0	54.0					20																	2443298		2195	4287	6482	SO:0001819	synonymous_variant	6628	exon6			AGGGGGAGGAGGC		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.669T>C	20.37:g.2443298A>G			125	0	0		111	0.04	4	NM_003091	592	0.00	1	Q15490|Q6IB35|Q9UIS5	Silent	SNP	ENST00000438552.2	37	CCDS13026.1																																																																																					0.582	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077585.2			
LOC101929413	101929413	broad.mit.edu	37	20	10869748	10869748	+	lincRNA	DEL	T	T	-			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr20:10869748delT	ENST00000448859.1	-	0	1058				RP11-103J8.1_ENST00000605292.1_RNA																							TCtttttttattttttttttt	0.438																																					.													.	.			0			.																																											0	.			TTTTTATTTTTTT																													20.37:g.10869748delT			9	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000448859.1	37																																																																																						0.438	RP4-697P8.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000078011.1			
REM1	28954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30064434	30064434	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr20:30064434C>T	ENST00000201979.2	+	2	479	c.186C>T	c.(184-186)gcC>gcT	p.A62A	DEFB124_ENST00000481595.1_5'UTR	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	62					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CTTCACCTGCCCCAGATGATT	0.602																																					p.A62A													.	.			0			c.C186T												76.0	71.0	73.0					20																	30064434		2203	4300	6503	SO:0001819	synonymous_variant	28954	exon2			ACCTGCCCCAGAT	AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.186C>T	20.37:g.30064434C>T			131	0	0		125	0.19	24	NM_014012	8	0.25	2	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Silent	SNP	ENST00000201979.2	37	CCDS13181.1																																																																																					0.602	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078508.2		NM_014012	
ZNF512B	57473	mdanderson.org	37	20	62595514	62595514	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr20:62595514G>T	ENST00000450537.1	-	8	1450	c.1390C>A	c.(1390-1392)Cca>Aca	p.P464T	ZNF512B_ENST00000217130.3_Missense_Mutation_p.P464T|ZNF512B_ENST00000369888.1_Missense_Mutation_p.P464T			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	464					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCAGGGCCTGGCCCCTCCTGC	0.657																																					p.P464T													.	.			0			c.C1390A												81.0	87.0	85.0					20																	62595514		2203	4300	6503	SO:0001583	missense	57473	exon8			GGCCTGGCCCCTC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1390C>A	20.37:g.62595514G>T	ENSP00000393795:p.Pro464Thr		46	0	0		39	0.08	3	NM_020713	91	0.00	0	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	3.728	-0.056132	0.07362	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.21543	2.0;2.0;2.0	4.59	-4.68	0.03309	.	1.230840	0.06291	N	0.699103	T	0.11281	0.0275	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35748	-0.9776	10	0.15952	T	0.53	-0.9437	0.9303	0.01334	0.1762:0.1872:0.2763:0.3603	.	464	Q96KM6	Z512B_HUMAN	T	464	ENSP00000358904:P464T;ENSP00000393795:P464T;ENSP00000217130:P464T	ENSP00000217130:P464T	P	-	1	0	ZNF512B	62065958	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.096000	0.15147	-0.609000	0.05724	-0.373000	0.07131	CCA			0.657	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080246.1		NM_020713	
MIR3687-2	103504728	broad.mit.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																					.													.	.			0			.																																											0	.			CGCGACTGCGGCG																													21.37:g.9825845_9825847dupGCG			8	0	0		10	0.40	4	.	0		0		RNA	INS	ENST00000577708.1	37																																																																																						0.842	MIR3687-201	KNOWN	basic	miRNA	miRNA					
AC008132.13	0	broad.mit.edu	37	22	18842958	18842958	+	Intron	SNP	G	G	T	rs3875977	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr22:18842958G>T	ENST00000412938.1	+	4	2208																											CCAGGAGGTGGCCTGGGCACC	0.572																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			GAGGTGGCCTGGG																												ENST00000412938.1:c.2209-345G>T	22.37:g.18842958G>T			45	0	0		22	0.14	3	.	0		0		RNA	SNP	ENST00000412938.1	37																																																																																						0.572	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
SMC1B	27127	broad.mit.edu	37	22	45798264	45798264	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr22:45798264T>C	ENST00000357450.4	-	5	802	c.803A>G	c.(802-804)aAg>aGg	p.K268R	SMC1B_ENST00000404354.3_Missense_Mutation_p.K268R	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	268					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCCATGTTCCTTTTTCCTGGC	0.333																																					p.K268R													.	SMC1B	215		0			c.A803G												155.0	131.0	139.0					22																	45798264		1858	4093	5951	SO:0001583	missense	27127	exon5			TGTTCCTTTTTCC	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.803A>G	22.37:g.45798264T>C	ENSP00000350036:p.Lys268Arg		116	0	0		109	0.03	3	NM_148674	1	0.00	0	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.232505	0.39498	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.80738	-1.41;3.31	5.9	4.86	0.63082	RecF/RecN/SMC (1);	0.000000	0.64402	D	0.000005	T	0.78400	0.4277	L	0.61036	1.89	0.47245	D	0.999361	B;P;B	0.36110	0.329;0.537;0.314	B;B;B	0.41135	0.348;0.155;0.142	T	0.73975	-0.3813	10	0.33141	T	0.24	.	8.505	0.33181	0.1299:0.0:0.1363:0.7338	.	268;268;268	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	R	268	ENSP00000350036:K268R;ENSP00000385902:K268R	ENSP00000350036:K268R	K	-	2	0	SMC1B	44176928	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	4.574000	0.60900	1.042000	0.40150	-0.336000	0.08194	AAG			0.333	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322256.2		NM_148674	
TBC1D22A	25771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	47287258	47287258	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr22:47287258A>T	ENST00000337137.4	+	6	971	c.805A>T	c.(805-807)Aac>Tac	p.N269Y	TBC1D22A_ENST00000380995.1_Missense_Mutation_p.N222Y|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.N222Y|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.N210Y|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.N191Y	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	269	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		CGATTCTAGGAACGACGAAGT	0.433																																					p.N269Y													.	.			0			c.A805T												104.0	106.0	105.0					22																	47287258		2203	4300	6503	SO:0001583	missense	25771	exon6			TCTAGGAACGACG	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.805A>T	22.37:g.47287258A>T	ENSP00000336724:p.Asn269Tyr		187	0	0		155	0.19	29	NM_014346	61	0.26	16	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	37	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.338751	0.24253	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76	4.36	4.36	0.52297	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.10294	0.0252	L	0.42245	1.32	0.47065	D	0.999303	B;B;B;B	0.31769	0.022;0.081;0.339;0.022	B;B;B;B	0.34301	0.038;0.039;0.179;0.038	T	0.17077	-1.0381	10	0.15952	T	0.53	.	11.5589	0.50766	1.0:0.0:0.0:0.0	.	269;191;210;269	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	Y	269;222;210;191;222	ENSP00000336724:N269Y;ENSP00000370383:N222Y;ENSP00000384036:N210Y;ENSP00000347932:N191Y;ENSP00000385634:N222Y	ENSP00000336724:N269Y	N	+	1	0	TBC1D22A	45665922	1.000000	0.71417	0.746000	0.31095	0.150000	0.21749	5.974000	0.70465	1.823000	0.53134	0.455000	0.32223	AAC			0.433	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317600.3		NM_014346	
CAND2	23066	mdanderson.org	37	3	12851759	12851759	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:12851759G>T	ENST00000456430.2	+	5	734	c.693G>T	c.(691-693)ccG>ccT	p.P231P	CAND2_ENST00000295989.5_Silent_p.P138P	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	231					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCACCAGCCCGACTGCCATCC	0.741																																					p.P231P	GBM(43;676 868 1633 6395 37496)												.	.			0			c.G693T												2.0	3.0	2.0					3																	12851759		1465	3343	4808	SO:0001819	synonymous_variant	23066	exon5			CAGCCCGACTGCC		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.693G>T	3.37:g.12851759G>T			17	0	0		20	0.10	2	NM_001162499	6	0.17	1	B9EGM9|E9KL24	Silent	SNP	ENST00000456430.2	37	CCDS54554.1																																																																																					0.741	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339856.4		XM_371617	
VILL	50853	mdanderson.org	37	3	38035877	38035877	+	Silent	SNP	G	G	T	rs370182077		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:38035877G>T	ENST00000283713.6	+	4	527	c.261G>T	c.(259-261)ctG>ctT	p.L87L	VILL_ENST00000465644.1_Intron|VILL_ENST00000383759.2_Silent_p.L87L			O15195	VILL_HUMAN	villin-like	87					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AGGACGAGCTGGGGGGCCAGA	0.711																																					p.L87L													.	.			0			c.G261T							G		1,4331		0,1,2165	17.0	22.0	20.0		261	2.0	0.0	3		20	0,8542		0,0,4271	no	coding-synonymous	VILL	NM_015873.3		0,1,6436	TT,TG,GG		0.0,0.0231,0.0078		87/857	38035877	1,12873	2166	4271	6437	SO:0001819	synonymous_variant	50853	exon3			CGAGCTGGGGGGC		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.261G>T	3.37:g.38035877G>T			65	0	0		48	0.06	3	NM_015873	9	0.00	0	A8MZP1|Q9BT80|Q9BWH7	Silent	SNP	ENST00000283713.6	37	CCDS2670.2																																																																																					0.711	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253360.3		NM_015873	
ARIH2	10425	bcgsc.ca;mdanderson.org	37	3	48999100	48999100	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:48999100A>T	ENST00000356401.4	+	4	650	c.311A>T	c.(310-312)gAg>gTg	p.E104V	ARIH2_ENST00000449376.1_Missense_Mutation_p.E104V|ARIH2_ENST00000490095.1_3'UTR	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	104					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		CAAGTTTCAGAGATATTGGAC	0.368																																					p.E104V													.	ARIH2	32		0			c.A311T												75.0	76.0	76.0					3																	48999100		2203	4300	6503	SO:0001583	missense	10425	exon4			TTTCAGAGATATT	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.311A>T	3.37:g.48999100A>T	ENSP00000348769:p.Glu104Val		82	0	0		77	0.06	5	NM_006321	59	0.00	0	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	37	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935511	0.52866	.	.	ENSG00000177479	ENST00000452882;ENST00000430423;ENST00000356401;ENST00000449376;ENST00000420814;ENST00000444790	T;T;D;D;T	0.82803	1.27;1.37;-1.65;-1.65;1.27	5.26	5.26	0.73747	.	0.152710	0.64402	D	0.000014	T	0.79221	0.4409	L	0.40543	1.245	0.58432	D	0.999993	B;B;B	0.31318	0.031;0.319;0.001	B;B;B	0.34991	0.009;0.193;0.005	T	0.78730	-0.2090	10	0.49607	T	0.09	.	15.4683	0.75419	1.0:0.0:0.0:0.0	.	111;104;104	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	V	104;104;104;104;104;103	ENSP00000395560:E104V;ENSP00000399788:E104V;ENSP00000348769:E104V;ENSP00000403222:E104V;ENSP00000397225:E104V	ENSP00000348769:E104V	E	+	2	0	ARIH2	48974104	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.801000	0.75170	2.120000	0.65058	0.260000	0.18958	GAG			0.368	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257525.1		NM_006321	
CACNA2D2	9254	mdanderson.org	37	3	50431589	50431589	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:50431589T>C	ENST00000479441.1	-	4	415	c.416A>G	c.(415-417)gAt>gGt	p.D139G	CACNA2D2_ENST00000395083.1_Missense_Mutation_p.D139G|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.D139G|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.D139G|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.D139G|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.D139G|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.D70G|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.D139G			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	139					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CTCTGCAGCATCAGCCAGTCT	0.607																																					p.D139G													.	.			0			c.A416G												149.0	128.0	135.0					3																	50431589		2203	4300	6503	SO:0001583	missense	9254	exon4			GCAGCATCAGCCA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.416A>G	3.37:g.50431589T>C	ENSP00000418081:p.Asp139Gly		46	0	0		49	0.06	3	NM_006030	47	0.00	0	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	37	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.249692	0.39797	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.06068	3.35;3.35;3.35;3.35;3.35;3.35;3.35;3.35	4.32	4.32	0.51571	.	0.226618	0.36167	N	0.002749	T	0.06096	0.0158	L	0.29908	0.895	0.28559	N	0.911218	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.12785	-1.0534	10	0.46703	T	0.11	-14.317	12.8424	0.57811	0.0:0.0:0.0:1.0	.	139;139	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	G	139;139;139;70;139;139;139;139	ENSP00000407393:D139G;ENSP00000404631:D139G;ENSP00000266039:D139G;ENSP00000354228:D70G;ENSP00000390526:D139G;ENSP00000378519:D139G;ENSP00000390329:D139G;ENSP00000418081:D139G	ENSP00000266039:D139G	D	-	2	0	CACNA2D2	50406593	0.547000	0.26465	0.972000	0.41901	0.979000	0.70002	2.025000	0.41059	1.813000	0.52934	0.402000	0.26972	GAT			0.607	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000346457.1		NM_006030	
DOCK3	1795	broad.mit.edu;mdanderson.org	37	3	51251594	51251594	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:51251594C>T	ENST00000266037.9	+	14	1191	c.1168C>T	c.(1168-1170)Cag>Tag	p.Q390*		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	390					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AGACATGGAACAGATTCGGAG	0.383																																					p.Q390X													.	DOCK3	397		0			c.C1168T												93.0	89.0	91.0					3																	51251594		1872	4122	5994	SO:0001587	stop_gained	1795	exon14			ATGGAACAGATTC	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1168C>T	3.37:g.51251594C>T	ENSP00000266037:p.Gln390*		118	0	0		117	0.05	6	NM_004947	21	0.00	0	O15017	Nonsense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	C	36	5.899889	0.97081	.	.	ENSG00000088538	ENST00000266037	.	.	.	5.35	5.35	0.76521	.	0.050647	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.4352	0.94788	0.0:1.0:0.0:0.0	.	.	.	.	X	390	.	ENSP00000266037:Q390X	Q	+	1	0	DOCK3	51226634	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.447000	0.66606	2.668000	0.90789	0.655000	0.94253	CAG			0.383	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346478.5		NM_004947	
GLYCTK	132158	mdanderson.org	37	3	52326663	52326663	+	Missense_Mutation	SNP	G	G	T	rs200573074		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr3:52326663G>T	ENST00000436784.2	+	5	1153	c.1093G>T	c.(1093-1095)Ggg>Tgg	p.G365W	GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000461183.1_Intron|GLYCTK_ENST00000477382.1_3'UTR|MIR135A1_ENST00000385191.1_RNA|GLYCTK_ENST00000473032.1_Intron|GLYCTK_ENST00000305690.8_Intron|GLYCTK_ENST00000471180.1_Intron|GLYCTK_ENST00000354773.4_3'UTR			Q8IVS8	GLCTK_HUMAN	glycerate kinase	365					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		ATCCATGGCTGGGGCTTCTGT	0.597																																					p.G365W													.	.			0			c.G1093T												34.0	38.0	36.0					3																	52326663		2203	4300	6503	SO:0001583	missense	132158	exon5			ATGGCTGGGGCTT		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.1093G>T	3.37:g.52326663G>T	ENSP00000389175:p.Gly365Trp		42	0	0		43	0.07	3	NM_145262	18	0.00	0	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	37	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	G	8.099	0.776150	0.16051	.	.	ENSG00000168237	ENST00000436784;ENST00000411757	T	0.46063	0.88	5.74	3.94	0.45596	.	0.372998	0.33005	N	0.005392	T	0.29684	0.0741	L	0.40543	1.245	0.23376	N	0.997801	B	0.06786	0.001	B	0.10450	0.005	T	0.18085	-1.0348	9	.	.	.	-6.7348	6.2519	0.20850	0.1863:0.0:0.6672:0.1465	.	365	Q8IVS8	GLCTK_HUMAN	W	365;299	ENSP00000389175:G365W	.	G	+	1	0	GLYCTK	52301703	0.039000	0.19947	0.007000	0.13788	0.633000	0.38033	0.686000	0.25392	0.770000	0.33336	0.655000	0.94253	GGG			0.597	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350835.1		NM_145262	
LPHN3	23284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	62679544	62679544	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr4:62679544C>T	ENST00000514591.1	+	8	1542	c.1213C>T	c.(1213-1215)Caa>Taa	p.Q405*	LPHN3_ENST00000514996.1_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000508946.1_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000504896.1_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000507625.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000506720.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000512091.2_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000511324.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000506746.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000514157.1_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000507164.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000508693.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000506700.1_Nonsense_Mutation_p.Q405*|LPHN3_ENST00000509896.1_Nonsense_Mutation_p.Q473*|LPHN3_ENST00000545650.1_Nonsense_Mutation_p.Q405*			Q9HAR2	LPHN3_HUMAN	latrophilin 3	405					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						acatcatggacaagtttcata	0.358																																					p.Q405X													.	.			0			c.C1213T												117.0	112.0	114.0					4																	62679544		1933	4148	6081	SO:0001587	stop_gained	23284	exon6			CATGGACAAGTTT	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1213C>T	4.37:g.62679544C>T	ENSP00000422533:p.Gln405*		78	0	0		89	0.34	30	NM_015236	20	0.05	1	E9PE04|O94867|Q9NWK5	Nonsense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	C	37	6.106046	0.97286	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.	.	.	3.67	3.67	0.42095	.	0.232564	0.37530	N	0.002048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	11.1945	0.48704	0.0:1.0:0.0:0.0	.	.	.	.	X	405;405;473;473;405;405;405;405;405;473;473;473;405;405;405;473;473;405	.	ENSP00000280009:Q405X	Q	+	1	0	LPHN3	62362139	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.846000	0.48262	2.343000	0.79666	0.563000	0.77884	CAA			0.358	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000361765.1			
PRLR	5618	mdanderson.org	37	5	35068387	35068387	+	Splice_Site	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr5:35068387G>T	ENST00000382002.5	-	9	1212	c.786C>A	c.(784-786)agC>agA	p.S262R	PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Splice_Site_p.S262R|PRLR_ENST00000511486.1_Splice_Site_p.S161R|PRLR_ENST00000342362.5_Splice_Site_p.S161R|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000513753.1_Splice_Site_p.S262R|PRLR_ENST00000231423.3_Splice_Site_p.S262R|PRLR_ENST00000542609.1_Splice_Site_p.S262R|PRLR_ENST00000348262.3_Intron	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	262					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AGGTCACCATGCTATAAAATA	0.378																																					p.S262R													.	.			0			c.C786A												121.0	113.0	116.0					5																	35068387		2203	4300	6503	SO:0001630	splice_region_variant	5618	exon8			CACCATGCTATAA		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.786-1C>A	5.37:g.35068387G>T			70	0	0		33	0.09	3	NM_001204316	3	0.00	0	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.280920	0.23392	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;D;T;D;T	0.86562	-0.81;-0.8;-0.81;-2.14;-1.23;-2.14;-0.79	5.45	3.62	0.41486	.	0.115126	0.85682	N	0.000000	T	0.74298	0.3698	N	0.20685	0.6	0.48040	D	0.999571	B;B;B;B	0.32893	0.389;0.284;0.074;0.185	B;B;B;B	0.34722	0.085;0.188;0.059;0.099	T	0.63998	-0.6510	10	0.18276	T	0.48	.	5.7561	0.18174	0.1474:0.0:0.5587:0.2939	.	262;161;262;262	P16471;P16471-2;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	R	262;262;262;161;262;161;262	ENSP00000231423:S262R;ENSP00000424841:S262R;ENSP00000441813:S262R;ENSP00000339213:S161R;ENSP00000371432:S262R;ENSP00000422556:S161R;ENSP00000309008:S262R	ENSP00000231423:S262R	S	-	3	2	PRLR	35104144	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	1.141000	0.31528	0.753000	0.32945	0.591000	0.81541	AGC			0.378	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207575.2			Missense_Mutation
DIAPH1	1729	ucsc.edu	37	5	140953699	140953699	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr5:140953699G>T	ENST00000398557.4	-	16	1858	c.1718C>A	c.(1717-1719)cCt>cAt	p.P573H	DIAPH1_ENST00000253811.6_Missense_Mutation_p.P573H|DIAPH1_ENST00000389057.5_Missense_Mutation_p.P564H|DIAPH1_ENST00000398566.3_Missense_Mutation_p.P564H|DIAPH1_ENST00000398562.2_Missense_Mutation_p.P564H|DIAPH1_ENST00000518047.1_Missense_Mutation_p.P564H|DIAPH1_ENST00000520569.1_Missense_Mutation_p.P519H|DIAPH1_ENST00000389054.3_Missense_Mutation_p.P573H	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	573					actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACAGAAGGAGGTACAGTAAT	0.507																																					p.P573H													.	DIAPH1	64		0			c.C1718A												72.0	77.0	75.0					5																	140953699		2062	4190	6252	SO:0001583	missense	1729	exon16			GAAGGAGGTACAG	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1718C>A	5.37:g.140953699G>T	ENSP00000381565:p.Pro573His		66	0	0		41	0.10	4	NM_005219	32	0.00	0	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	37	CCDS43374.1	.	.	.	.	.	.	.	.	.	.	G	6.498	0.460167	0.12342	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000546094	T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;1.42;-1.1;-1.1;-1.1;-1.1;-1.1	2.8	-1.44	0.08856	.	1.135460	0.06786	U	0.786116	T	0.67988	0.2952	L	0.49126	1.545	0.09310	N	1	B;B;B	0.31519	0.118;0.327;0.327	B;B;B	0.24394	0.053;0.053;0.053	T	0.54483	-0.8287	10	0.59425	D	0.04	.	6.6374	0.22891	0.6493:0.0:0.3507:0.0	.	519;564;573	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	H	573;519;564;564;564;573;573;564;12	ENSP00000373706:P573H;ENSP00000429282:P519H;ENSP00000381570:P564H;ENSP00000373709:P564H;ENSP00000381572:P564H;ENSP00000381565:P573H;ENSP00000253811:P573H;ENSP00000428268:P564H	ENSP00000253811:P573H	P	-	2	0	DIAPH1	140933883	0.235000	0.23794	0.002000	0.10522	0.017000	0.09413	2.262000	0.43285	-0.562000	0.06086	0.579000	0.79373	CCT			0.507	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_005219	
CCNJL	79616	mdanderson.org	37	5	159707575	159707575	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr5:159707575G>T	ENST00000393977.3	-	3	522	c.237C>A	c.(235-237)tcC>tcA	p.S79S	CCNJL_ENST00000541762.1_Silent_p.S78S|CCNJL_ENST00000377503.2_5'UTR|CCNJL_ENST00000505287.2_Silent_p.S124S|CCNJL_ENST00000257536.7_Silent_p.S79S|CCNJL_ENST00000519673.1_Silent_p.S79S	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	79	Cyclin N-terminal.					nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGAGCTGCTTGGAGGTGGTGA	0.627																																					p.S79S													.	.			0			c.C237A												94.0	96.0	95.0					5																	159707575		2166	4246	6412	SO:0001819	synonymous_variant	79616	exon3			CTGCTTGGAGGTG	BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.237C>A	5.37:g.159707575G>T			58	0	0		21	0.10	2	NM_024565	10	0.00	0	Q6ZN43|Q9H7W8	Silent	SNP	ENST00000393977.3	37	CCDS4350.2																																																																																					0.627	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252674.1		NM_024565	
HLA-F	3134	bcgsc.ca	37	6	29694891	29694891	+	IGR	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:29694891G>T	ENST00000376861.1	+	0	1544				HLA-F_ENST00000440587.2_Intron|HLA-F_ENST00000259951.7_Missense_Mutation_p.S423I|HLA-F_ENST00000475996.1_Intron			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						AGGGGCAGGAGCTTCCTTCTT	0.443																																					p.S423I													.	HLA-F	41		0			c.G1268T												198.0	217.0	211.0					6																	29694891		1315	2586	3901	SO:0001628	intergenic_variant	3134	exon7			GCAGGAGCTTCCT	AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29694891G>T			45	0	0		52	0.10	5	NM_001098479	10	0.00	0	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Missense_Mutation	SNP	ENST00000376861.1	37	CCDS43438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.69|10.69	1.422166|1.422166	0.25639|0.25639	.|.	.|.	ENSG00000204642|ENSG00000204642	ENST00000444621|ENST00000449921;ENST00000259951	.|T	.|0.00832	.|5.64	0.62|0.62	0.62|0.62	0.17637|0.17637	.|.	.|.	.|.	.|.	.|.	T|T	0.00580|0.00580	0.0019|0.0019	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|D	.|0.58268	.|0.982	.|P	.|0.49665	.|0.618	T|T	0.75107|0.75107	-0.3434|-0.3434	4|8	.|0.87932	.|D	.|0	.|.	.|.	.|.	.|.	.|.	.|423	.|P30511-3	.|.	S|I	105|400;423	.|ENSP00000259951:S423I	.|ENSP00000259951:S423I	A|S	+|+	1|2	0|0	HLA-F|HLA-F	29802870|29802870	0.909000|0.909000	0.30893|0.30893	0.791000|0.791000	0.31998|0.31998	0.448000|0.448000	0.32197|0.32197	-0.065000|-0.065000	0.11617|0.11617	0.580000|0.580000	0.29522|0.29522	0.436000|0.436000	0.28706|0.28706	GCT|AGC			0.443	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195083.1		NM_018950	
UBR2	23304	broad.mit.edu;bcgsc.ca	37	6	42582883	42582894	+	In_Frame_Del	DEL	AGACTGATGCTT	AGACTGATGCTT	-			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	AGACTGATGCTT	AGACTGATGCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:42582883_42582894delAGACTGATGCTT	ENST00000372899.1	+	9	1318_1329	c.1060_1071delAGACTGATGCTT	c.(1060-1071)agactgatgcttdel	p.RLML354del	UBR2_ENST00000372901.1_In_Frame_Del_p.RLML354del|UBR2_ENST00000372903.2_In_Frame_Del_p.RLML354del|UBR2_ENST00000372883.3_5'Flank	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	354					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TCTAGTGGACAGACTGATGCTTAGTGATTCCA	0.377																																					p.354_357del													.	UBR2	134		0			c.1060_1071del																																									SO:0001651	inframe_deletion	23304	exon9			GTGGACAGACTGA	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1060_1071delAGACTGATGCTT	6.37:g.42582883_42582894delAGACTGATGCTT	ENSP00000361990:p.Arg354_Leu357del		82	0	0		67	0.10	7	NM_001184801	10	0.00	0	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	In_Frame_Del	DEL	ENST00000372899.1	37	CCDS4870.1																																																																																					0.377	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040558.2		NM_015255	
KLHDC3	116138	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	42985044	42985044	+	Nonsense_Mutation	SNP	T	T	G			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:42985044T>G	ENST00000326974.4	+	2	309	c.114T>G	c.(112-114)taT>taG	p.Y38*	KLHDC3_ENST00000244670.8_De_novo_Start_InFrame|KLHDC3_ENST00000332245.8_Nonsense_Mutation_p.Y38*	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	38					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GTGAAGACTATGAGACACTGC	0.592																																					p.Y38X													.	KLHDC3	23		0			c.T114G												125.0	128.0	127.0					6																	42985044		2203	4300	6503	SO:0001587	stop_gained	116138	exon2			AGACTATGAGACA	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.114T>G	6.37:g.42985044T>G	ENSP00000313995:p.Tyr38*		53	0.0188679245	1		48	0.27	13	NM_057161	249	0.16	40	A8K2W9	Nonsense_Mutation	SNP	ENST00000326974.4	37	CCDS4880.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880406	0.91740	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000394096;ENST00000332245	.	.	.	5.05	-0.712	0.11226	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6899	0.40123	0.0:0.4512:0.0:0.5488	.	.	.	.	X	38	.	ENSP00000313995:Y38X	Y	+	3	2	KLHDC3	43093022	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	0.633000	0.24598	-0.049000	0.13379	0.533000	0.62120	TAT			0.592	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040570.1		NM_057161	
GSTA4	2941	mdanderson.org	37	6	52859034	52859034	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:52859034G>A	ENST00000370959.1	-	2	125	c.8C>T	c.(7-9)gCa>gTa	p.A3V	RN7SK_ENST00000365328.1_RNA|GSTA4_ENST00000370960.1_5'UTR|GSTA4_ENST00000541324.1_5'UTR			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	3	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	CTTGGGCCTTGCTGCCATGAT	0.537																																					p.A3V													.	.			0			c.C8T												67.0	67.0	67.0					6																	52859034		2203	4300	6503	SO:0001583	missense	2941	exon2			GGCCTTGCTGCCA	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.8C>T	6.37:g.52859034G>A	ENSP00000359998:p.Ala3Val		44	0	0		34	0.09	3	NM_001512	206	0.00	0	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Missense_Mutation	SNP	ENST00000370959.1	37	CCDS4948.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395773	0.42512	.	.	ENSG00000170899	ENST00000370963;ENST00000370959	T;T	0.01613	4.73;4.73	5.7	-3.43	0.04810	Glutathione S-transferase, N-terminal (1);Thioredoxin-like fold (1);	0.871460	0.10422	N	0.676637	T	0.01029	0.0034	M	0.69823	2.125	0.19300	N	0.99998	B	0.02656	0.0	B	0.04013	0.001	T	0.40289	-0.9571	10	0.54805	T	0.06	-0.4118	12.5371	0.56147	0.0:0.1248:0.258:0.6172	.	3	O15217	GSTA4_HUMAN	V	3	ENSP00000360002:A3V;ENSP00000359998:A3V	ENSP00000359998:A3V	A	-	2	0	GSTA4	52966993	0.000000	0.05858	0.012000	0.15200	0.826000	0.46750	-0.460000	0.06720	-0.251000	0.09542	-1.014000	0.02459	GCA			0.537	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040946.1		NM_001512	
TBX18	9096	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	85473885	85473885	+	Silent	SNP	T	T	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:85473885T>A	ENST00000369663.5	-	1	352	c.15A>T	c.(13-15)cgA>cgT	p.R5R	TBX18_ENST00000606784.1_5'Flank|TBX18_ENST00000606521.1_5'Flank	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	5					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GCGAGCCCCTTCGCTTCTCGG	0.667																																					p.R5R													.	TBX18	131		0			c.A15T												5.0	5.0	5.0					6																	85473885		1917	3864	5781	SO:0001819	synonymous_variant	9096	exon1			GCCCCTTCGCTTC	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.15A>T	6.37:g.85473885T>A			19	0	0		21	0.19	4	NM_001080508	2	0.50	1	A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	ENST00000369663.5	37	CCDS34495.1																																																																																					0.667	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041378.2		NM_001080508	
RARS2	57038	broad.mit.edu	37	6	88251684	88251684	+	Frame_Shift_Del	DEL	A	A	-			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:88251684delA	ENST00000369536.5	-	8	609	c.564delT	c.(562-564)tttfs	p.F188fs		NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	188					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CCTCATAGCCAAACAGCTGGA	0.373																																					p.F188fs													.	RARS2	61		0			c.564delT												84.0	82.0	83.0					6																	88251684		2203	4300	6503	SO:0001589	frameshift_variant	57038	exon8			ATAGCCAAACAGC	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.564delT	6.37:g.88251684delA	ENSP00000358549:p.Phe188fs		28	0	0		37	0.22	8	NM_020320	51	0.00	0	B2RDT7|Q96FU5|Q9H8K8	Frame_Shift_Del	DEL	ENST00000369536.5	37	CCDS5011.1																																																																																					0.373	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041448.1		NM_020320	
EYA4	2070	broad.mit.edu	37	6	133804227	133804227	+	Missense_Mutation	SNP	G	G	T	rs563208631		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:133804227G>T	ENST00000367895.5	+	13	1629	c.1165G>T	c.(1165-1167)Ggg>Tgg	p.G389W	EYA4_ENST00000431403.2_Missense_Mutation_p.G389W|EYA4_ENST00000430974.2_Missense_Mutation_p.G341W|EYA4_ENST00000355167.3_Missense_Mutation_p.G389W|EYA4_ENST00000452339.2_Missense_Mutation_p.G335W|EYA4_ENST00000525849.1_Missense_Mutation_p.G366W|EYA4_ENST00000355286.6_Missense_Mutation_p.G366W|EYA4_ENST00000531901.1_Missense_Mutation_p.G395W	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	389					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		ACTGCTCACCGGGTCTTATGC	0.338																																					p.G389W	Melanoma(57;398 1237 3528 4702 7415)												.	EYA4	196		0			c.G1165T												106.0	102.0	103.0					6																	133804227		2203	4300	6503	SO:0001583	missense	2070	exon13			CTCACCGGGTCTT	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1165G>T	6.37:g.133804227G>T	ENSP00000356870:p.Gly389Trp		150	0	0		160	0.03	4	NM_172105	34	0.00	0	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.719802	0.89205	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.43	5.43	0.79202	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.100632	0.64402	D	0.000002	D	0.91178	0.7221	M	0.83312	2.635	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	D	0.92029	0.5632	10	0.87932	D	0	-10.7352	19.2272	0.93822	0.0:0.0:1.0:0.0	.	395;341;335;366;389;389	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	W	335;341;389;389;366;395;366;389	ENSP00000395916:G335W;ENSP00000388670:G341W;ENSP00000356870:G389W;ENSP00000347294:G389W;ENSP00000347434:G366W;ENSP00000432770:G395W;ENSP00000433219:G366W;ENSP00000404558:G389W	ENSP00000347294:G389W	G	+	1	0	EYA4	133845920	1.000000	0.71417	0.989000	0.46669	0.961000	0.63080	9.869000	0.99810	2.535000	0.85469	0.557000	0.71058	GGG			0.338	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000042282.2		NM_004100	
FRMD1	79981	broad.mit.edu	37	6	168461656	168461656	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr6:168461656A>C	ENST00000283309.6	-	9	1191	c.1127T>G	c.(1126-1128)gTc>gGc	p.V376G	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.V308G|FRMD1_ENST00000537786.1_Missense_Mutation_p.V147G	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	376						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTGGCTGCTGACCCCACTGCC	0.642																																					p.V376G	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												.	FRMD1	52		0			c.T1127G												32.0	32.0	32.0					6																	168461656		2202	4300	6502	SO:0001583	missense	79981	exon9			CTGCTGACCCCAC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.1127T>G	6.37:g.168461656A>C	ENSP00000283309:p.Val376Gly		84	0.2261904762	19		77	0.31	24	NM_024919	0		0	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	A	8.721	0.914257	0.17907	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	T;T;T	0.47177	0.85;0.85;0.85	2.48	-0.976	0.10286	.	0.902956	0.09085	N	0.850778	T	0.10252	0.0251	N	0.14661	0.345	0.44261	D	0.99711	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.33369	-0.9871	10	0.24483	T	0.36	.	4.6562	0.12618	0.167:0.636:0.0:0.197	.	311;376;308;271	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	G	376;308;147	ENSP00000283309:V376G;ENSP00000414115:V308G;ENSP00000440078:V147G	ENSP00000283309:V376G	V	-	2	0	FRMD1	168204505	0.998000	0.40836	0.000000	0.03702	0.121000	0.20230	0.710000	0.25748	-0.410000	0.07542	-0.940000	0.02684	GTC			0.642	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362513.2		NM_024919	
SP8	221833	mdanderson.org	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S													.	.			0			c.G466A																																									SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	7.37:g.20824970C>T	ENSP00000354482:p.Gly138Ser		33	0	0		37	0.08	3	NM_182700	2	0.00	0	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC			0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326904.2			
EGFR	1956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	55273210	55273210	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:55273210C>T	ENST00000275493.2	+	28	3710	c.3533C>T	c.(3532-3534)cCc>cTc	p.P1178L	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Missense_Mutation_p.P1125L	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1178					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GACTTCTTTCCCAAGGAAGCC	0.517		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.P1178L			yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.			0			c.C3533T												73.0	64.0	67.0					7																	55273210		2203	4300	6503	SO:0001583	missense	1956	exon28	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	TCTTTCCCAAGGA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3533C>T	7.37:g.55273210C>T	ENSP00000275493:p.Pro1178Leu		137	0	0		162	0.23	38	NM_005228	19	0.21	4	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824831	0.90955	.	.	ENSG00000146648	ENST00000395504;ENST00000275493;ENST00000454757	T;T	0.76316	-1.01;-1.0	5.34	5.34	0.76211	.	0.047903	0.85682	D	0.000000	D	0.86543	0.5958	M	0.80183	2.485	0.80722	D	1	D	0.61697	0.99	P	0.56343	0.796	D	0.88394	0.3010	10	0.87932	D	0	.	18.0405	0.89317	0.0:1.0:0.0:0.0	.	1178	P00533	EGFR_HUMAN	L	1048;1178;1125	ENSP00000275493:P1178L;ENSP00000395243:P1125L	ENSP00000275493:P1178L	P	+	2	0	EGFR	55240704	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.100000	0.76989	2.663000	0.90544	0.558000	0.71614	CCC			0.517	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251456.2		NM_005228	
LRRD1	401387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91793802	91793802	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:91793802G>C	ENST00000458448.1	-	2	915	c.715C>G	c.(715-717)Ctc>Gtc	p.L239V	LRRD1_ENST00000454089.2_5'UTR|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000430130.2_Missense_Mutation_p.L239V|CTB-161K23.1_ENST00000453068.1_RNA			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	239					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						TAAAAAAAGAGTTGTCTGATA	0.269																																					p.L239V													.	.			0			c.C715G												23.0	19.0	20.0					7																	91793802		692	1580	2272	SO:0001583	missense	401387	exon1			AAAAGAGTTGTCT	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.715C>G	7.37:g.91793802G>C	ENSP00000405987:p.Leu239Val		189	0	0		152	0.18	27	NM_001161528	0		0	B7ZMM9|Q49AT9	Missense_Mutation	SNP	ENST00000458448.1	37	CCDS55124.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368212	0.61513	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	T;T	0.60424	0.19;0.19	5.73	5.73	0.89815	.	.	.	.	.	T	0.77003	0.4067	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77222	-0.2667	9	0.59425	D	0.04	.	19.8994	0.96980	0.0:0.0:1.0:0.0	.	239	A4D1F6	LRRD1_HUMAN	V	239	ENSP00000405987:L239V;ENSP00000411568:L239V	ENSP00000411568:L239V	L	-	1	0	LRRD1	91631738	1.000000	0.71417	0.991000	0.47740	0.819000	0.46315	6.824000	0.75288	2.703000	0.92315	0.650000	0.86243	CTC			0.269	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342027.2		NM_001045475	
SYPL1	6856	mdanderson.org	37	7	105752945	105752945	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:105752945G>A	ENST00000011473.2	-	1	77	c.31C>T	c.(31-33)Cgg>Tgg	p.R11W	SYPL1_ENST00000470347.1_5'Flank|SYPL1_ENST00000455385.2_5'Flank	NM_006754.3	NP_006745.1	Q16563	SYPL1_HUMAN	synaptophysin-like 1	11					synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|integral component of synaptic vesicle membrane (GO:0030285)|secretory granule (GO:0030141)	transporter activity (GO:0005215)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	7						cgactgatccgctGGCGAACC	0.721																																					p.R11W													.	.			0			c.C31T												17.0	14.0	15.0					7																	105752945		2183	4270	6453	SO:0001583	missense	6856	exon1			TGATCCGCTGGCG		CCDS5736.1, CCDS47685.1	7q22.2	2005-05-24	2005-05-24	2005-05-24	ENSG00000008282	ENSG00000008282			11507	protein-coding gene	gene with protein product			"""synaptophysin-like protein"""	SYPL			Standard	NM_006754		Approved		uc003vdp.4	Q16563	OTTHUMG00000157587	ENST00000011473.2:c.31C>T	7.37:g.105752945G>A	ENSP00000011473:p.Arg11Trp		33	0	0		21	0.10	2	NM_006754	4	0.00	0	A4D0R2|Q96AR8	Missense_Mutation	SNP	ENST00000011473.2	37	CCDS5736.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615160	0.28712	.	.	ENSG00000008282	ENST00000011473	T	0.37235	1.21	3.26	1.38	0.22167	.	0.918405	0.09264	N	0.826126	T	0.25827	0.0629	L	0.36672	1.1	0.80722	D	1	B	0.18310	0.027	B	0.06405	0.002	T	0.19321	-1.0309	10	0.87932	D	0	8.6574	3.753	0.08573	0.1315:0.0:0.6276:0.2408	.	11	Q16563	SYPL1_HUMAN	W	11	ENSP00000011473:R11W	ENSP00000011473:R11W	R	-	1	2	SYPL1	105540181	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	0.748000	0.26305	0.355000	0.24131	-0.500000	0.04577	CGG			0.721	SYPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349221.1			
RP11-274B21.1	0	broad.mit.edu	37	7	128210684	128210685	+	RNA	INS	-	-	T	rs386717721|rs200185648|rs201622560|rs201660766		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:128210684_128210685insT	ENST00000605862.1	+	0	189																											GCCACCATGACCATCCTCCTTA	0.525																																					.													.	.			0			.																																											0	.			CCATGACCATCCT																													7.37:g.128210684_128210685insT			11	0	0		12	0.42	5	.	2	0.00	0		RNA	INS	ENST00000605862.1	37																																																																																						0.525	RP11-274B21.1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000468355.1			
RP11-274B21.1	0	broad.mit.edu	37	7	128210686	128210687	+	RNA	DEL	AT	AT	-	rs386717721|rs200185648|rs55946993|rs56180919		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:128210686_128210687delAT	ENST00000605862.1	+	0	189																											CACCATGACCATCCTCCTTAAA	0.525																																					.													.	.			0			.																																											0	.			ATGACCATCCTCC																													7.37:g.128210686_128210687delAT			10	0	0		11	0.45	5	.	2	0.00	0		RNA	DEL	ENST00000605862.1	37																																																																																						0.525	RP11-274B21.1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000468355.1			
EPHB6	2051	mdanderson.org	37	7	142566831	142566831	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:142566831G>T	ENST00000392957.2	+	16	3175	c.2388G>T	c.(2386-2388)ctG>ctT	p.L796L	EPHB6_ENST00000442129.1_Silent_p.L796L|EPHB6_ENST00000411471.2_Silent_p.L519L	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	796	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ATCGCTCGCTGTCTGCCCACA	0.637																																					p.L796L													.	.			0			c.G2388T												74.0	63.0	67.0					7																	142566831		2203	4300	6503	SO:0001819	synonymous_variant	2051	exon16			CTCGCTGTCTGCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2388G>T	7.37:g.142566831G>T			52	0	0		40	0.08	3	NM_004445	82	0.00	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																					0.637	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341329.1			
KEL	3792	mdanderson.org	37	7	142639975	142639975	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr7:142639975G>T	ENST00000355265.2	-	17	2402	c.1928C>A	c.(1927-1929)gCc>gAc	p.A643D		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	643					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CAGCGCGATGGCTAGCCCCCC	0.498																																					p.A643D													.	.			0			c.C1928A												104.0	94.0	97.0					7																	142639975		2203	4300	6503	SO:0001583	missense	3792	exon17			GCGATGGCTAGCC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1928C>A	7.37:g.142639975G>T	ENSP00000347409:p.Ala643Asp		58	0	0		45	0.07	3	NM_000420	2	0.00	0	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	6.955	0.546063	0.13312	.	.	ENSG00000197993	ENST00000355265	D	0.81821	-1.54	4.61	1.57	0.23409	Peptidase M13, neprilysin, C-terminal (2);	0.556995	0.16035	N	0.232700	T	0.74504	0.3725	M	0.71581	2.175	0.09310	N	0.999999	P	0.43231	0.801	B	0.37650	0.255	T	0.67496	-0.5656	10	0.87932	D	0	-11.0619	5.8463	0.18667	0.3464:0.0:0.6536:0.0	.	643	P23276	KELL_HUMAN	D	643	ENSP00000347409:A643D	ENSP00000347409:A643D	A	-	2	0	KEL	142350097	0.550000	0.26489	0.221000	0.23827	0.005000	0.04900	1.684000	0.37649	0.560000	0.29169	0.655000	0.94253	GCC			0.498	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347671.2		NM_000420	
MFHAS1	9258	broad.mit.edu;mdanderson.org	37	8	8749747	8749747	+	Silent	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr8:8749747C>T	ENST00000276282.6	-	1	1408	c.822G>A	c.(820-822)cgG>cgA	p.R274R		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	274										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCATTTTGAGCCGCTGCAGGC	0.637																																					p.R274R	Melanoma(103;1201 2045 17515 28966)												.	MFHAS1	58		0			c.G822A												31.0	35.0	34.0					8																	8749747		2201	4298	6499	SO:0001819	synonymous_variant	9258	exon1			TTTGAGCCGCTGC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.822G>A	8.37:g.8749747C>T			30	0	0		20	0.15	3	NM_004225	21	0.00	0	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																					0.637	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
NPBWR1	2831	mdanderson.org	37	8	53852980	53852980	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr8:53852980G>T	ENST00000331251.3	+	1	1990	c.513G>T	c.(511-513)ctG>ctT	p.L171L		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	171					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				TCGTCGTGCTGCCCTTCGCAG	0.731																																					p.L171L													.	.			0			c.G513T												12.0	13.0	13.0					8																	53852980		2183	4263	6446	SO:0001819	synonymous_variant	2831	exon1			CGTGCTGCCCTTC	BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.513G>T	8.37:g.53852980G>T			21	0	0		12	0.17	2	NM_005285	0		0	Q6NTC7	Silent	SNP	ENST00000331251.3	37	CCDS6151.1																																																																																					0.731	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378047.1		NM_005285	
PREX2	80243	mdanderson.org	37	8	69002939	69002939	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr8:69002939C>T	ENST00000288368.4	+	20	2516	c.2239C>T	c.(2239-2241)Cgg>Tgg	p.R747W	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	747	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GAAGTACAGGCGGCCAACGAA	0.478																																					p.R747W													.	.			0			c.C2239T												86.0	73.0	77.0					8																	69002939		2203	4300	6503	SO:0001583	missense	80243	exon20			TACAGGCGGCCAA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2239C>T	8.37:g.69002939C>T	ENSP00000288368:p.Arg747Trp		27	0	0		41	0.07	3	NM_025170	12	0.00	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211004	0.79240	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.36340	1.26	5.89	3.96	0.45880	PDZ/DHR/GLGF (2);	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	N	0.22421	0.69	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.998;0.999	D;P;D	0.74023	0.982;0.889;0.949	T	0.49670	-0.8915	10	0.87932	D	0	.	15.5396	0.76031	0.3148:0.6852:0.0:0.0	.	747;747;747	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	W	747	ENSP00000288368:R747W	ENSP00000288368:R747W	R	+	1	2	PREX2	69165493	1.000000	0.71417	0.983000	0.44433	0.970000	0.65996	2.598000	0.46223	0.688000	0.31529	0.585000	0.79938	CGG			0.478	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378620.1		NM_025170	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72987612	72987612	+	Silent	SNP	A	A	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr8:72987612A>T	ENST00000262209.4	-	1	240	c.33T>A	c.(31-33)ccT>ccA	p.P11P		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	11					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TCTTTTCTCCAGGGCGCCACA	0.642																																					p.P11P													.	.			0			c.T33A												86.0	89.0	88.0					8																	72987612		2203	4300	6503	SO:0001819	synonymous_variant	8989	exon1			TTCTCCAGGGCGC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.33T>A	8.37:g.72987612A>T			32	0	0		32	0.19	6	NM_007332	4	1.00	4	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																					0.642	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379079.2		NM_007332	
CNBD1	168975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	88363932	88363932	+	Silent	SNP	T	T	C			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr8:88363932T>C	ENST00000518476.1	+	9	1113	c.1062T>C	c.(1060-1062)aaT>aaC	p.N354N		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	354										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AAAGTGGAAATATAATTTCTT	0.269																																					p.N354N													.	.			0			c.T1062C												73.0	73.0	73.0					8																	88363932		1790	4039	5829	SO:0001819	synonymous_variant	168975	exon9			TGGAAATATAATT	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1062T>C	8.37:g.88363932T>C			50	0	0		71	0.15	11	NM_173538	0		0		Silent	SNP	ENST00000518476.1	37	CCDS55259.1	.	.	.	.	.	.	.	.	.	.	T	0.025	-1.378390	0.01204	.	.	ENSG00000176571	ENST00000523299	.	.	.	5.36	-4.87	0.03123	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29640	-1.0005	4	.	.	.	-5.1407	0.3407	0.00333	0.2559:0.2506:0.2624:0.2311	.	.	.	.	T	46	.	.	I	+	2	0	CNBD1	88433048	0.844000	0.29557	0.030000	0.17652	0.047000	0.14425	-0.358000	0.07641	-0.236000	0.09753	0.528000	0.53228	ATA			0.269	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375113.2		NM_173538	
JKAMPP1	100049717	bcgsc.ca	37	9	12288078	12288078	+	IGR	SNP	A	A	G	rs10960566	byFrequency	TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:12288078A>G								RP11-74C3.1 (128931 upstream) : RNU2-47P (12187 downstream)																							TGGTTACTTCATGCCCGTAGA	0.388													A|||	1632	0.325879	0.2844	0.3905	5008	,	,		15966	0.4087		0.2525	False		,,,				2504	0.3262				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TACTTCATGCCCG																													9.37:g.12288078A>G			18	0	0		10	0.60	6	.	0		0		RNA	SNP		37																																																																																					0	0.388										
FAM219A	203259	mdanderson.org	37	9	34405956	34405956	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:34405956C>T	ENST00000445726.1	-	2	373	c.67G>A	c.(67-69)Gcc>Acc	p.A23T	FAM219A_ENST00000379089.1_Missense_Mutation_p.A22T|FAM219A_ENST00000379081.1_Missense_Mutation_p.A11T|FAM219A_ENST00000379087.1_Missense_Mutation_p.A22T|FAM219A_ENST00000297620.4_Missense_Mutation_p.A23T|FAM219A_ENST00000379078.1_Missense_Mutation_p.A22T|FAM219A_ENST00000379080.1_Missense_Mutation_p.A11T|FAM219A_ENST00000379084.1_Missense_Mutation_p.A22T	NM_001184940.1|NM_001184941.1	NP_001171869.1|NP_001171870.1	Q8IW50	F219A_HUMAN	family with sequence similarity 219, member A	23																	GAGGCGGCGGCTGGGTCCTGT	0.587																																					p.A23T													.	.			0			c.G67A												63.0	65.0	64.0					9																	34405956		2203	4300	6503	SO:0001583	missense	203259	exon2			CGGCGGCTGGGTC	AK096350	CCDS6556.1, CCDS55304.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164970	ENSG00000164970			19920	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 25"""	C9orf25		9110174, 8619474	Standard	NM_147202		Approved	bA573M23.5, FLJ39031	uc011lok.2	Q8IW50	OTTHUMG00000019822	ENST00000445726.1:c.67G>A	9.37:g.34405956C>T	ENSP00000392452:p.Ala23Thr		29	0	0		44	0.07	3	NM_147202	38	0.00	0	A2A364|B4DFE1|B4DSR8|Q5T590|Q5T591|Q5T592|Q5T594|Q5T595|Q8TAZ8	Missense_Mutation	SNP	ENST00000445726.1	37	CCDS55304.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495875	0.26774	.	.	ENSG00000164970	ENST00000379089;ENST00000379087;ENST00000379084;ENST00000379081;ENST00000379080;ENST00000445726;ENST00000297620;ENST00000422409;ENST00000379078	.	.	.	5.2	3.34	0.38264	.	0.171345	0.51477	N	0.000090	T	0.65059	0.2655	L	0.47716	1.5	0.40867	D	0.983881	B;B;D;D;B	0.67145	0.006;0.001;0.996;0.996;0.002	B;B;D;D;B	0.79784	0.015;0.003;0.993;0.993;0.003	T	0.58482	-0.7629	9	0.20519	T	0.43	-5.1795	10.8436	0.46730	0.0:0.8287:0.0:0.1713	.	12;23;12;12;23	Q8IW50-4;Q8IW50;Q8IW50-3;Q8IW50-2;Q8IW50-6	.;CI025_HUMAN;.;.;.	T	22;22;22;11;11;23;23;22;22	.	ENSP00000297620:A23T	A	-	1	0	C9orf25	34395956	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	1.727000	0.38095	0.219000	0.20840	-1.134000	0.01955	GCC			0.587	FAM219A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001184940	
FAM205A	259308	mdanderson.org	37	9	34726543	34726543	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:34726543G>T	ENST00000378788.3	-	4	733	c.694C>A	c.(694-696)Ctg>Atg	p.L232M		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	232						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						TCCTGGTTCAGTGGAGCCCTT	0.562																																					p.L232M													.	.			0			c.C694A												41.0	37.0	38.0					9																	34726543		692	1591	2283	SO:0001583	missense	259308	exon4			GGTTCAGTGGAGC		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.694C>A	9.37:g.34726543G>T	ENSP00000417711:p.Leu232Met		41	0	0		47	0.06	3	NM_001141917	0		0	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	G	9.271	1.045588	0.19748	.	.	ENSG00000205108	ENST00000378788	T	0.23348	1.91	4.04	2.12	0.27331	.	34.031200	0.00166	U	0.000000	T	0.11239	0.0274	N	0.01705	-0.755	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.18713	-1.0328	10	0.27082	T	0.32	.	4.953	0.14025	0.0:0.6374:0.2345:0.1281	.	232	Q6ZU69	F205A_HUMAN	M	232	ENSP00000417711:L232M	ENSP00000417711:L232M	L	-	1	2	RP11-195F19.10	34716543	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	0.172000	0.16704	0.434000	0.26340	-0.321000	0.08615	CTG			0.562	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001150.2		NM_001141917	
KIAA1958	158405	mdanderson.org	37	9	115336895	115336895	+	Missense_Mutation	SNP	C	C	A	rs186262765		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:115336895C>A	ENST00000337530.6	+	2	831	c.535C>A	c.(535-537)Cca>Aca	p.P179T	KIAA1958_ENST00000536272.1_Missense_Mutation_p.P179T|KIAA1958_ENST00000374244.3_Missense_Mutation_p.P179T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	179										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						TGGGGTAGTCCCATCTTCCCT	0.448																																					p.P179T													.	.			0			c.C535A												93.0	94.0	94.0					9																	115336895		2203	4300	6503	SO:0001583	missense	158405	exon2			GTAGTCCCATCTT	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.535C>A	9.37:g.115336895C>A	ENSP00000336940:p.Pro179Thr		70	0	0		41	0.07	3	NM_133465	9	0.00	0	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	C	9.430	1.085241	0.20390	.	.	ENSG00000165185	ENST00000337530;ENST00000374244;ENST00000536272	T;T;T	0.40756	1.02;1.02;1.02	6.07	5.12	0.69794	.	0.163862	0.42682	D	0.000672	T	0.19525	0.0469	N	0.08118	0	0.19575	N	0.999964	P;B	0.38922	0.651;0.421	B;B	0.29598	0.104;0.05	T	0.18967	-1.0320	10	0.66056	D	0.02	-19.7128	9.7918	0.40710	0.0:0.781:0.1433:0.0757	.	179;179	B7ZKW6;Q8N8K9	.;K1958_HUMAN	T	179	ENSP00000336940:P179T;ENSP00000363362:P179T;ENSP00000440504:P179T	ENSP00000336940:P179T	P	+	1	0	KIAA1958	114376716	0.097000	0.21791	0.487000	0.27428	0.848000	0.48234	1.834000	0.39171	2.884000	0.98904	0.655000	0.94253	CCA			0.448	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053690.1		NM_133465	
C5	727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123794397	123794397	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:123794397C>T	ENST00000223642.1	-	6	690	c.661G>A	c.(661-663)Gaa>Aaa	p.E221K		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	221					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTACCATATTCTTTAACTTCA	0.358																																					p.E221K													.	.			0			c.G661A												81.0	86.0	84.0					9																	123794397		2202	4300	6502	SO:0001583	missense	727	exon6			CATATTCTTTAAC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.661G>A	9.37:g.123794397C>T	ENSP00000223642:p.Glu221Lys		59	0	0		34	0.44	15	NM_001735	0		0	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629643	0.87660	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.38240	1.15	6.06	5.17	0.71159	.	0.113437	0.64402	D	0.000004	T	0.52322	0.1727	L	0.56340	1.77	0.43632	D	0.996029	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.45731	-0.9241	10	0.21014	T	0.42	.	13.864	0.63576	0.0:0.9269:0.0:0.0731	.	292;221	Q59GS8;P01031	.;CO5_HUMAN	K	221;292	ENSP00000223642:E221K	ENSP00000223642:E221K	E	-	1	0	C5	122834218	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.759000	0.62227	1.578000	0.49821	0.650000	0.86243	GAA			0.358	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053844.1		NM_001735	
NTMT1	28989	mdanderson.org	37	9	132395063	132395063	+	Silent	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:132395063G>T	ENST00000372486.1	+	2	430	c.81G>T	c.(79-81)gtG>gtT	p.V27V	NTMT1_ENST00000482347.1_Intron|NTMT1_ENST00000486391.2_3'UTR|NTMT1_ENST00000459968.2_Silent_p.V27V|NTMT1_ENST00000372481.3_Silent_p.V27V|NTMT1_ENST00000372480.1_Silent_p.V27V|NTMT1_ENST00000372483.4_Silent_p.V27V			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	27					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)										CACCCACGGTGGACGGCATGC	0.552																																					p.V27V													.	.			0			c.G81T												170.0	139.0	149.0					9																	132395063		2203	4300	6503	SO:0001819	synonymous_variant	28989	exon2			CACGGTGGACGGC	AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.81G>T	9.37:g.132395063G>T			71	0	0		45	0.07	3	NM_014064	73	0.00	0	A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Silent	SNP	ENST00000372486.1	37	CCDS35160.1																																																																																					0.552	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054589.1		NM_014064	
LAMC3	10319	bcgsc.ca	37	9	133914313	133914313	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:133914313G>T	ENST00000361069.4	+	5	1172	c.1039G>T	c.(1039-1041)Ggc>Tgc	p.G347C	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	347	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCGCAGCACAGGCCACGGCGG	0.627																																					p.G347C													.	LAMC3	167		0			c.G1039T												58.0	60.0	59.0					9																	133914313		2203	4299	6502	SO:0001583	missense	10319	exon5			AGCACAGGCCACG	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1039G>T	9.37:g.133914313G>T	ENSP00000354360:p.Gly347Cys		64	0	0		43	0.09	4	NM_006059	35	0.00	0	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993228	0.93167	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.67523	-0.27	4.85	4.85	0.62838	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.85613	0.5737	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89223	0.3572	10	0.87932	D	0	.	17.3158	0.87224	0.0:0.0:1.0:0.0	.	347	Q9Y6N6	LAMC3_HUMAN	C	347	ENSP00000354360:G347C	ENSP00000325873:G347C	G	+	1	0	LAMC3	132904134	1.000000	0.71417	0.974000	0.42286	0.992000	0.81027	6.414000	0.73318	2.376000	0.81061	0.650000	0.86243	GGC			0.627	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054717.3		NM_006059	
CEL	1056	mdanderson.org	37	9	135939866	135939866	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:135939866G>T	ENST00000372080.4	+	2	167	c.151G>T	c.(151-153)Gac>Tac	p.D51Y	CEL_ENST00000351304.7_Missense_Mutation_p.D48Y	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	48	Heparin-binding.				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TGACTCTGTGGACATCTTCAA	0.627																																					p.D51Y													.	.			0			c.G151T												85.0	98.0	94.0					9																	135939866		2069	4198	6267	SO:0001583	missense	1056	exon2			TCTGTGGACATCT	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.151G>T	9.37:g.135939866G>T	ENSP00000361151:p.Asp51Tyr		59	0	0		41	0.07	3	NM_001807	83	0.00	0	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	37	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938186	0.73557	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.66995	-0.24;-0.24	5.27	4.36	0.52297	Carboxylesterase, type B (1);	0.044283	0.85682	D	0.000000	T	0.72510	0.3469	L	0.28400	0.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75766	-0.3202	10	0.87932	D	0	.	13.8913	0.63740	0.0:0.0:0.8462:0.1538	.	48	P19835	CEL_HUMAN	Y	51;48;51	ENSP00000361151:D51Y;ENSP00000342217:D48Y	ENSP00000304021:D51Y	D	+	1	0	CEL	134929687	1.000000	0.71417	0.525000	0.27900	0.943000	0.58893	8.990000	0.93510	1.193000	0.43086	0.561000	0.74099	GAC			0.627	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054823.1			
PNPLA7	375775	mdanderson.org	37	9	140374861	140374861	+	Missense_Mutation	SNP	A	A	T	rs1891630		TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chr9:140374861A>T	ENST00000277531.4	-	22	2594	c.2408T>A	c.(2407-2409)gTa>gAa	p.V803E	PNPLA7_ENST00000492278.1_5'Flank|PNPLA7_ENST00000371457.1_Missense_Mutation_p.V409E|PNPLA7_ENST00000406427.1_Missense_Mutation_p.V828E	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	803			V -> A (in dbSNP:rs1891630). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		CGTGCCATCTACCTGGTAGAG	0.652																																					p.V828E													.	.			0			c.T2483A												74.0	55.0	61.0					9																	140374861		2203	4300	6503	SO:0001583	missense	375775	exon23			CCATCTACCTGGT	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2408T>A	9.37:g.140374861A>T	ENSP00000277531:p.Val803Glu		73	0	0		45	0.04	2	NM_001098537	2	0.00	0	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890385	0.33348	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	4.92	4.02	0.46733	.	0.232742	0.44902	D	0.000415	T	0.17874	0.0429	N	0.24115	0.695	0.25807	N	0.984444	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.16689	-1.0394	10	0.72032	D	0.01	-4.4993	10.7163	0.46015	0.1563:0.0:0.8437:0.0	.	211;828;803	E2QRF8;Q6ZV29-5;Q6ZV29	.;.;PLPL7_HUMAN	E	409;211;803;828;803;794	ENSP00000360512:V409E;ENSP00000360501:V211E;ENSP00000277531:V803E;ENSP00000384610:V828E;ENSP00000400582:V794E	ENSP00000277531:V803E	V	-	2	0	PNPLA7	139494682	1.000000	0.71417	0.912000	0.35992	0.026000	0.11368	6.399000	0.73248	0.507000	0.28148	-0.642000	0.03964	GTA			0.652	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000254787.1		NM_152286	
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53579361	53579361	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANI-01A-11D-A435-10	TCGA-XE-AANI-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	be4df9d3-88c9-42ae-9752-179602eb36db	168dc95b-9014-4cb0-9d44-1e0e2d747959	g.chrX:53579361G>T	ENST00000342160.3	-	62	9249	c.8792C>A	c.(8791-8793)tCt>tAt	p.S2931Y	HUWE1_ENST00000262854.6_Missense_Mutation_p.S2931Y			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2931					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGCCACGGCAGAATCTCTGGT	0.502																																					p.S2931Y													.	.			0			c.C8792A												57.0	51.0	53.0					X																	53579361		2203	4300	6503	SO:0001583	missense	10075	exon63			ACGGCAGAATCTC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8792C>A	X.37:g.53579361G>T	ENSP00000340648:p.Ser2931Tyr		101	0	0		149	0.38	57	NM_031407	189	0.42	79	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.60|14.60	2.583564|2.583564	0.46006|0.46006	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.37915	.|1.17;1.17	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.188650	.|0.47852	.|D	.|0.000220	T|T	0.34978|0.34978	0.0916|0.0916	N|N	0.19112|0.19112	0.55|0.55	0.32670|0.32670	N|N	0.516952|0.516952	.|P;D	.|0.54207	.|0.94;0.965	.|P;P	.|0.51135	.|0.459;0.66	T|T	0.47598|0.47598	-0.9105|-0.9105	5|10	.|0.56958	.|D	.|0.05	.|.	13.6738|13.6738	0.62440|0.62440	0.0:0.1509:0.8491:0.0|0.0:0.1509:0.8491:0.0	.|.	.|2931;2931	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	L|Y	1964|2931	.|ENSP00000340648:S2931Y;ENSP00000262854:S2931Y	.|ENSP00000262854:S2931Y	F|S	-|-	3|2	2|0	HUWE1|HUWE1	53596086|53596086	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	4.546000|4.546000	0.60705|0.60705	2.528000|2.528000	0.85240|0.85240	0.529000|0.529000	0.55759|0.55759	TTC|TCT			0.502	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056766.1		XM_497119	
