#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MIB2	142678	ucsc.edu;bcgsc.ca	37	1	1564101	1564101	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:1564101G>T	ENST00000357210.4	+	16	2591	c.2375G>T	c.(2374-2376)aGg>aTg	p.R792M	MIB2_ENST00000378710.3_Splice_Site_p.R756M|MIB2_ENST00000520777.1_Splice_Site_p.R845M|MIB2_ENST00000360522.4_Splice_Site_p.R757M|MIB2_ENST00000504599.1_Splice_Site_p.R748M|MIB2_ENST00000355826.5_Splice_Site_p.R835M|MIB2_ENST00000505820.2_Splice_Site_p.R849M|MIB2_ENST00000378712.1_Splice_Site_p.R669M|MIB2_ENST00000378708.1_Splice_Site_p.R698M|MIB2_ENST00000518681.1_Splice_Site_p.R784M	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	792					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CTGCTGTCCAGGGTGAGGAAG	0.706																																					p.R849M													.	MIB2	62		0			c.G2546T												8.0	12.0	11.0					1																	1564101		1956	4004	5960	SO:0001630	splice_region_variant	142678	exon16			TGTCCAGGGTGAG	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.2376+1G>T	1.37:g.1564101G>T			35	0	0		37	0.11	4	NM_080875	40	0.00	0	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	ENST00000357210.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.73|14.73	2.622726|2.622726	0.46840|0.46840	.|.	.|.	ENSG00000197530|ENSG00000197530	ENST00000514234|ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000355826;ENST00000518681;ENST00000505820;ENST00000378712;ENST00000504599;ENST00000378708	.|T;T;T;T;T;T;T;T;T;T	.|0.66815	.|1.27;1.29;1.29;1.29;1.28;1.27;1.27;-0.23;1.28;1.29	4.03|4.03	4.03|4.03	0.46877|0.46877	.|Ankyrin repeat-containing domain (1);	.|0.267927	.|0.29668	.|U	.|0.011506	T|T	0.71187|0.71187	0.3310|0.3310	L|L	0.43152|0.43152	1.355|1.355	0.36402|0.36402	D|D	0.863208|0.863208	.|P;D;D;D;D;D;P	.|0.71674	.|0.591;0.984;0.993;0.963;0.997;0.998;0.939	.|B;P;P;P;P;D;P	.|0.64595	.|0.312;0.847;0.825;0.719;0.907;0.927;0.465	T|T	0.76705|0.76705	-0.2861|-0.2861	5|10	.|0.56958	.|D	.|0.05	-3.4578|-3.4578	9.4515|9.4515	0.38729|0.38729	0.1164:0.0:0.8836:0.0|0.1164:0.0:0.8836:0.0	.|.	.|757;698;669;784;845;778;792	.|Q96AX9-5;F2Z2L2;B3KXY1;E9PHQ1;E9PGU1;Q96AX9-2;Q96AX9	.|.;.;.;.;.;.;MIB2_HUMAN	H|M	607|845;792;757;756;835;784;849;669;748;698	.|ENSP00000428660:R845M;ENSP00000349741:R792M;ENSP00000353713:R757M;ENSP00000367982:R756M;ENSP00000348081:R835M;ENSP00000428264:R784M;ENSP00000426103:R849M;ENSP00000367984:R669M;ENSP00000426128:R748M;ENSP00000367980:R698M	.|ENSP00000348081:R835M	Q|R	+|+	3|2	2|0	MIB2|MIB2	1553964|1553964	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.736000|0.736000	0.42039|0.42039	2.926000|2.926000	0.48892|0.48892	1.966000|1.966000	0.57179|0.57179	0.491000|0.491000	0.48974|0.48974	CAG|AGG			0.706	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_080875	Missense_Mutation
PRDM2	7799	hgsc.bcm.edu	37	1	14105122	14105124	+	In_Frame_Del	DEL	GAA	GAA	-	rs556843220|rs375577840	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	GAA	GAA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:14105122_14105124delGAA	ENST00000235372.7	+	8	1688_1690	c.832_834delGAA	c.(832-834)gaadel	p.E282del	PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000413440.1_In_Frame_Del_p.E81del|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_In_Frame_Del_p.E81del|PRDM2_ENST00000311066.5_In_Frame_Del_p.E282del	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	282	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		ggaggaggatgaagaagaagaag	0.498																																					p.277_278del													PRDM2,colon,carcinoma,0,1	PRDM2	147		0			c.831_833del																																									SO:0001651	inframe_deletion	7799	exon8			GAGGATGAAGAAG	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.832_834delGAA	1.37:g.14105131_14105133delGAA	ENSP00000235372:p.Glu282del		150	0	0		149	0.07	10	NM_015866	1	0.00	0	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	In_Frame_Del	DEL	ENST00000235372.7	37	CCDS150.1																																																																																					0.498	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000021792.2		NM_012231	
COL11A1	1301	broad.mit.edu	37	1	103491776	103491776	+	Missense_Mutation	SNP	G	G	C	rs398123652		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:103491776G>C	ENST00000370096.3	-	6	1205	c.893C>G	c.(892-894)aCg>aGg	p.T298R	COL11A1_ENST00000353414.4_Intron|COL11A1_ENST00000512756.1_Missense_Mutation_p.T298R|COL11A1_ENST00000358392.2_Intron	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	298	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTACCTCCGTCTGTGCTAT	0.433																																					p.T298R													COL11A1_ENST00000370096,NS,carcinoma,+1,2	COL11A1	972	2	0			c.C893G												271.0	224.0	240.0					1																	103491776		2203	4300	6503	SO:0001583	missense	1301	exon6			ACCTCCGTCTGTG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.893C>G	1.37:g.103491776G>C	ENSP00000359114:p.Thr298Arg		248	0	0		215	0.03	6	NM_080630	7	0.00	0	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790392	0.50102	.	.	ENSG00000060718	ENST00000370096;ENST00000512756	D;D	0.88586	-2.33;-2.4	5.39	5.39	0.77823	.	.	.	.	.	D	0.90916	0.7145	L	0.56769	1.78	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.74348	0.983;0.983	D	0.87413	0.2377	9	0.13853	T	0.58	.	19.1559	0.93510	0.0:0.0:1.0:0.0	.	298;298	E9PCU0;P12107	.;COBA1_HUMAN	R	298	ENSP00000359114:T298R;ENSP00000426533:T298R	ENSP00000359114:T298R	T	-	2	0	COL11A1	103264364	1.000000	0.71417	0.970000	0.41538	0.992000	0.81027	7.064000	0.76721	2.529000	0.85273	0.643000	0.83706	ACG			0.433	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000029997.1		NM_080630	
NBPF10	100132406	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	145326040	145326040	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:145326040G>C	ENST00000342960.5	+	30	3948	c.3913G>C	c.(3913-3915)Gaa>Caa	p.E1305Q	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	648						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGTTGTCTTGAACTGACTGA	0.483																																					p.E1305Q													.	.			0			c.G3913C																																									SO:0001583	missense	100132406	exon30			TGTCTTGAACTGA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3913G>C	1.37:g.145326040G>C	ENSP00000345684:p.Glu1305Gln		73	0	0		70	0.24	17	NM_001039703	0		0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	8.049	0.765592	0.15914	.	.	ENSG00000163386	ENST00000342960	T	0.08634	3.07	0.557	-1.11	0.09840	.	.	.	.	.	T	0.07007	0.0178	M	0.85542	2.76	0.09310	N	1	.	.	.	.	.	.	T	0.20806	-1.0264	6	0.39692	T	0.17	.	.	.	.	.	.	.	.	Q	1305	ENSP00000345684:E1305Q	ENSP00000345684:E1305Q	E	+	1	0	NBPF10	144037397	0.006000	0.16342	0.001000	0.08648	0.012000	0.07955	0.107000	0.15375	-0.392000	0.07751	0.152000	0.16155	GAA			0.483	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001039703	
ILDR2	387597	mdanderson.org	37	1	166890612	166890612	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:166890612G>A	ENST00000271417.3	-	9	1271	c.1216C>T	c.(1216-1218)Ccg>Tcg	p.P406S	ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.P347S|ILDR2_ENST00000529071.1_Missense_Mutation_p.P387S|ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000525740.1_Missense_Mutation_p.P279S|ILDR2_ENST00000526687.1_Missense_Mutation_p.P298S	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	406					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						TTGGAGCGCGGCTGGCTGCGG	0.687																																					p.P406S													.	.			0			c.C1216T												14.0	17.0	16.0					1																	166890612		2160	4237	6397	SO:0001583	missense	387597	exon9			AGCGCGGCTGGCT	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1216C>T	1.37:g.166890612G>A	ENSP00000271417:p.Pro406Ser		29	0	0		21	0.10	2	NM_199351	0		0		Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	9.946	1.218884	0.22373	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.77620	0.51;-1.09;0.5;-1.11;-0.1	4.73	4.73	0.59995	.	0.392121	0.27906	N	0.017365	T	0.51873	0.1700	L	0.36672	1.1	0.32869	D	0.508985	B	0.24258	0.1	B	0.21708	0.036	T	0.48317	-0.9046	10	0.07990	T	0.79	.	17.7848	0.88534	0.0:0.0:1.0:0.0	.	406	Q71H61	ILDR2_HUMAN	S	406;279;387;298;347	ENSP00000271417:P406S;ENSP00000436120:P279S;ENSP00000436882:P387S;ENSP00000434273:P298S;ENSP00000432750:P347S	ENSP00000271417:P406S	P	-	1	0	ILDR2	165157236	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	5.355000	0.66046	2.172000	0.68678	0.558000	0.71614	CCG			0.687	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082880.2		NM_199351	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186056429	186056429	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:186056429G>A	ENST00000271588.4	+	59	9356	c.9127G>A	c.(9127-9129)Gaa>Aaa	p.E3043K	HMCN1_ENST00000367492.2_Missense_Mutation_p.E3043K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3043	Ig-like C2-type 28.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.E3043K(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCAAGCTGGCGAAAGCAAGAA	0.353																																					p.E3043K													HMCN1,NS,carcinoma,0,2	HMCN1	0	2	1	Substitution - Missense(1)	pancreas(1)	c.G9127A												145.0	140.0	142.0					1																	186056429		2203	4300	6503	SO:0001583	missense	83872	exon59			GCTGGCGAAAGCA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9127G>A	1.37:g.186056429G>A	ENSP00000271588:p.Glu3043Lys		221	0	0		175	0.17	30	NM_031935	1	0.00	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814527	0.90790	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66280	-0.2;-0.2	5.84	4.93	0.64822	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.042858	0.85682	N	0.000000	T	0.70090	0.3184	L	0.39245	1.2	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.66460	-0.5918	10	0.23891	T	0.37	.	14.8696	0.70448	0.0687:0.0:0.9313:0.0	.	3043	Q96RW7	HMCN1_HUMAN	K	3043	ENSP00000271588:E3043K;ENSP00000356462:E3043K	ENSP00000271588:E3043K	E	+	1	0	HMCN1	184323052	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	6.962000	0.76048	1.464000	0.47987	0.655000	0.94253	GAA			0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131848.1		NM_031935	
PTGS2	5743	broad.mit.edu	37	1	186645692	186645692	+	Silent	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr1:186645692G>T	ENST00000367468.5	-	7	1013	c.877C>A	c.(877-879)Cgg>Agg	p.R293R	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	293					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TTGTGTTCCCGCAGCCAGATT	0.507																																					p.R293R													PTGS2_ENST00000367468,NS,carcinoma,0,4	PTGS2	144	4	0			c.C877A												142.0	131.0	135.0					1																	186645692		2203	4300	6503	SO:0001819	synonymous_variant	5743	exon7			GTTCCCGCAGCCA	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.877C>A	1.37:g.186645692G>T			112	0	0		101	0.04	4	NM_000963	2	0.00	0	A8K802|Q16876	Silent	SNP	ENST00000367468.5	37	CCDS1371.1																																																																																					0.507	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086157.2		NM_000963	
KCNMA1	3778	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	79163700	79163700	+	Missense_Mutation	SNP	C	C	T	rs142858967		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr10:79163700C>T	ENST00000286628.8	-	2	459	c.460G>A	c.(460-462)Gcc>Acc	p.A154T	KCNMA1_ENST00000286627.5_Missense_Mutation_p.A154T|KCNMA1_ENST00000406533.3_Missense_Mutation_p.A154T|KCNMA1_ENST00000404857.1_Missense_Mutation_p.A154T|KCNMA1_ENST00000372440.1_Missense_Mutation_p.A154T|KCNMA1_ENST00000354353.5_Missense_Mutation_p.A154T|KCNMA1_ENST00000372443.1_Missense_Mutation_p.A154T|KCNMA1_ENST00000404771.3_Missense_Mutation_p.A154T	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	154					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CCGACCTCGGCGGCCACTGCC	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		15015	0.0		0.001	False		,,,				2504	0.0				p.A154T													KCNMA1_ENST00000406533,colon,adenoma,0,4	KCNMA1	370	4	0			c.G460A												62.0	61.0	61.0					10																	79163700		2203	4300	6503	SO:0001583	missense	3778	exon2			CCTCGGCGGCCAC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.460G>A	10.37:g.79163700C>T	ENSP00000286628:p.Ala154Thr		81	0	0		50	0.10	5	NM_002247	2	0.00	0	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.63|16.63	3.176359|3.176359	0.57692|0.57692	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857|ENST00000372421	T;T;T;T;T;T;T;T;T;T|.	0.44881|.	1.01;1.01;1.01;1.01;1.01;1.01;0.91;1.01;1.01;1.01|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.183688|.	0.48767|.	D|.	0.000170|.	T|T	0.61173|0.61173	0.2326|0.2326	L|L	0.38175|0.38175	1.15|1.15	0.42198|0.42198	D|D	0.991756|0.991756	B;B;B;B;B|.	0.31290|.	0.024;0.041;0.182;0.082;0.318|.	B;B;B;B;B|.	0.26969|.	0.007;0.016;0.075;0.01;0.048|.	T|T	0.56353|0.56353	-0.7993|-0.7993	10|5	0.28530|.	T|.	0.3|.	-7.9872|-7.9872	19.0922|19.0922	0.93231|0.93231	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	154;154;154;154;154|.	B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7|.	.;.;KCMA1_HUMAN;.;.|.	T|H	154;91;89;128;91;154;154;128;154;154;154|142	ENSP00000361517:A154T;ENSP00000361485:A91T;ENSP00000361514:A89T;ENSP00000396608:A128T;ENSP00000361520:A154T;ENSP00000286627:A154T;ENSP00000286628:A128T;ENSP00000385552:A154T;ENSP00000346321:A154T;ENSP00000385806:A154T|.	ENSP00000286627:A154T|.	A|R	-|-	1|2	0|0	KCNMA1|KCNMA1	78833706|78833706	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.972000|0.972000	0.66771|0.66771	5.585000|5.585000	0.67497|0.67497	2.690000|2.690000	0.91761|0.91761	0.650000|0.650000	0.86243|0.86243	GCC|CGC			0.582	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000048885.3		NM_002247	
FRA10AC1	118924	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	95458121	95458121	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr10:95458121G>T	ENST00000359204.4	-	3	307	c.110C>A	c.(109-111)cCa>cAa	p.P37Q	FRA10AC1_ENST00000371430.2_Missense_Mutation_p.P37Q|FRA10AC1_ENST00000394100.2_Missense_Mutation_p.P37Q|FRA10AC1_ENST00000536233.1_Missense_Mutation_p.P37Q	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1	37						nucleus (GO:0005634)				NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						TTTCTGAAATGGTTTTTGGAG	0.318																																					p.P37Q													.	FRA10AC1	68		0			c.C110A												131.0	124.0	126.0					10																	95458121		2203	4300	6503	SO:0001583	missense	118924	exon3			TGAAATGGTTTTT	AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.110C>A	10.37:g.95458121G>T	ENSP00000360488:p.Pro37Gln		123	0.0081300813	1		89	0.06	5	NM_145246	20	0.00	0	C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Missense_Mutation	SNP	ENST00000359204.4	37	CCDS7430.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449203	0.84101	.	.	ENSG00000148690	ENST00000359204;ENST00000536233;ENST00000371426;ENST00000371430;ENST00000394100	T;T;T;T	0.25085	1.84;1.87;1.82;1.85	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	M	0.76328	2.33	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.982;0.98	T	0.56733	-0.7930	10	0.87932	D	0	-8.507	19.5479	0.95307	0.0:0.0:1.0:0.0	.	37;37;37	F8WCS9;Q70Z53-2;Q70Z53	.;.;F10C1_HUMAN	Q	37	ENSP00000360488:P37Q;ENSP00000438405:P37Q;ENSP00000360484:P37Q;ENSP00000377660:P37Q	ENSP00000360488:P37Q	P	-	2	0	FRA10AC1	95448111	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.118000	0.89577	2.633000	0.89246	0.655000	0.94253	CCA			0.318	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049439.1		NM_145246	
ARHGAP19	84986	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	99023294	99023294	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr10:99023294A>C	ENST00000358531.4	-	4	524	c.496T>G	c.(496-498)Ttg>Gtg	p.L166V	ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.L166V|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.L166V|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.L157V|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.L157V|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.L166V	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	166	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		CCTGATTCCAAGTCAATGTCA	0.438																																					p.L166V													.	.			0			c.T496G												145.0	133.0	137.0					10																	99023294		2203	4300	6503	SO:0001583	missense	84986	exon4			ATTCCAAGTCAAT	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.496T>G	10.37:g.99023294A>C	ENSP00000351333:p.Leu166Val		145	0	0		137	0.06	8	NM_001204300	3	0.00	0	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	37	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	A	15.59	2.879493	0.51801	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000358308	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	5.87	2.31	0.28768	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.184969	0.36628	U	0.002491	T	0.16428	0.0395	L	0.52364	1.645	0.37595	D	0.920359	P;B;P	0.41313	0.514;0.426;0.745	B;B;B	0.38880	0.133;0.284;0.27	T	0.07635	-1.0762	10	0.41790	T	0.15	-5.2747	5.1844	0.15176	0.525:0.15:0.325:0.0	.	166;166;157	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	V	166;166;157;166;157;166	ENSP00000414774:L166V;ENSP00000324468:L166V;ENSP00000347526:L157V;ENSP00000351333:L166V;ENSP00000360066:L157V;ENSP00000351058:L166V	ENSP00000324468:L166V	L	-	1	2	ARHGAP19	99013284	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.893000	0.48633	0.476000	0.27440	-0.250000	0.11733	TTG			0.438	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049647.2		NM_032900	
PIDD1	55367	broad.mit.edu	37	11	802595	802595	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:802595C>T	ENST00000347755.5	-	5	1063	c.922G>A	c.(922-924)Gca>Aca	p.A308T	PIDD_ENST00000411829.2_Missense_Mutation_p.A308T|PIDD_ENST00000534649.1_5'Flank	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					ATGAGGGCTGCCACTGTGCAG	0.582																																					p.A308T													.	PIDD	76		0			c.G922A												59.0	50.0	53.0					11																	802595		2203	4297	6500	SO:0001583	missense	55367	exon5			GGGCTGCCACTGT																												ENST00000347755.5:c.922G>A	11.37:g.802595C>T	ENSP00000337797:p.Ala308Thr		223	0	0		184	0.03	5	NM_145887	29	0.00	0		Missense_Mutation	SNP	ENST00000347755.5	37	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	C	7.382	0.629077	0.14257	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.41065	1.1;1.01	4.01	-4.0	0.04057	.	1.948520	0.02464	N	0.086865	T	0.20088	0.0483	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.16660	-1.0395	10	0.11182	T	0.66	.	7.1982	0.25866	0.0:0.5517:0.1705:0.2779	.	308;162;308	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	T	308	ENSP00000416801:A308T;ENSP00000337797:A308T	ENSP00000337797:A308T	A	-	1	0	PIDD	792595	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.701000	0.05075	-0.667000	0.05303	-0.378000	0.06908	GCA			0.582	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257103.1			
PACSIN3	29763	mdanderson.org	37	11	47202014	47202014	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:47202014G>T	ENST00000539589.1	-	5	781	c.439C>A	c.(439-441)Ctg>Atg	p.L147M	PACSIN3_ENST00000298838.6_Missense_Mutation_p.L147M	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	147	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						ACCTCCTTCAGCCTCTTCAGC	0.677																																					p.L147M													.	.			0			c.C439A												33.0	34.0	34.0					11																	47202014		2200	4296	6496	SO:0001583	missense	29763	exon5			CCTTCAGCCTCTT	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.439C>A	11.37:g.47202014G>T	ENSP00000440945:p.Leu147Met		38	0	0		49	0.06	3	NM_001184975	42	0.00	0	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	37	CCDS31481.1	.	.	.	.	.	.	.	.	.	.	G	8.307	0.821255	0.16678	.	.	ENSG00000165912	ENST00000298838;ENST00000415232;ENST00000539589;ENST00000528462;ENST00000531226	T;T;T;T	0.46819	2.42;2.42;2.42;0.86	5.23	3.35	0.38373	.	0.064265	0.64402	D	0.000006	T	0.31827	0.0809	L	0.43152	1.355	0.53005	D	0.999961	B	0.28713	0.22	B	0.18871	0.023	T	0.11591	-1.0581	10	0.30854	T	0.27	-19.2125	4.8373	0.13471	0.238:0.0:0.5978:0.1642	.	147	Q9UKS6	PACN3_HUMAN	M	147	ENSP00000298838:L147M;ENSP00000440945:L147M;ENSP00000437252:L147M;ENSP00000434699:L147M	ENSP00000298838:L147M	L	-	1	2	PACSIN3	47158590	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	5.624000	0.67764	1.220000	0.43490	0.561000	0.74099	CTG			0.677	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391632.1		NM_016223	
NDUFV1	4723	mdanderson.org	37	11	67377004	67377004	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:67377004C>A	ENST00000322776.6	+	4	561	c.408C>A	c.(406-408)caC>caA	p.H136Q	NDUFV1_ENST00000415352.2_Missense_Mutation_p.H129Q|NDUFV1_ENST00000529927.1_Missense_Mutation_p.H127Q|NDUFV1_ENST00000532303.1_Missense_Mutation_p.H35Q|RP11-655M14.12_ENST00000533876.1_RNA|C11orf72_ENST00000333139.3_5'Flank|NDUFV1_ENST00000526169.1_3'UTR	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	136					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						ATGATCCTCACAAGCTGCTGG	0.637																																					p.H136Q													NDUFV1,NS,carcinoma,0,1	NDUFV1	0	1	0			c.C408A												74.0	96.0	88.0					11																	67377004		2200	4294	6494	SO:0001583	missense	4723	exon4			TCCTCACAAGCTG	AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.408C>A	11.37:g.67377004C>A	ENSP00000322450:p.His136Gln		36	0	0		40	0.08	3	NM_007103	314	0.00	0	O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Missense_Mutation	SNP	ENST00000322776.6	37	CCDS8173.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902410	0.72754	.	.	ENSG00000167792	ENST00000322776;ENST00000532303;ENST00000532244;ENST00000529927;ENST00000532343;ENST00000415352;ENST00000533075;ENST00000529867;ENST00000530638;ENST00000528314	D;D;D;D;D;D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9	4.17	4.17	0.49024	NADH:ubiquinone oxidoreductase, 51kDa subunit (1);	0.054070	0.64402	D	0.000001	D	0.96457	0.8844	M	0.93106	3.38	0.54753	D	0.999984	P;P;P;P	0.50272	0.783;0.91;0.533;0.933	P;P;P;P	0.61592	0.633;0.559;0.577;0.891	D	0.97283	0.9919	10	0.62326	D	0.03	-15.3296	15.3019	0.73958	0.0:1.0:0.0:0.0	.	35;129;127;136	B4DE93;G3V0I5;P49821-2;P49821	.;.;.;NDUV1_HUMAN	Q	136;35;35;127;35;129;129;124;97;35	ENSP00000322450:H136Q;ENSP00000432015:H35Q;ENSP00000435202:H35Q;ENSP00000436766:H127Q;ENSP00000431751:H35Q;ENSP00000395368:H129Q;ENSP00000437267:H129Q;ENSP00000434438:H124Q;ENSP00000436936:H97Q;ENSP00000434581:H35Q	ENSP00000322450:H136Q	H	+	3	2	NDUFV1	67133580	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.069000	0.50026	2.174000	0.68829	0.555000	0.69702	CAC			0.637	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000388406.1		NM_007103	
MYEOV	26579	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	69063822	69063822	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:69063822T>A	ENST00000308946.3	+	3	1355	c.905T>A	c.(904-906)cTc>cAc	p.L302H	MYEOV_ENST00000441339.2_Missense_Mutation_p.L302H|MYEOV_ENST00000535407.1_Missense_Mutation_p.L244H	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	302										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		ctccaccacctcctcctcctc	0.577																																					p.L302H													.	MYEOV	42		0			c.T905A												39.0	35.0	36.0					11																	69063822		2198	4289	6487	SO:0001583	missense	26579	exon3			ACCACCTCCTCCT	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.905T>A	11.37:g.69063822T>A	ENSP00000308330:p.Leu302His		107	0.0093457944	1		82	0.06	5	NM_138768	5	0.00	0	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.704894	0.00719	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.27402	1.68;1.68;1.67	1.23	-2.46	0.06461	.	.	.	.	.	T	0.10508	0.0257	N	0.08118	0	0.09310	N	1	P	0.43352	0.804	B	0.34489	0.184	T	0.15263	-1.0443	9	0.87932	D	0	.	0.7984	0.01070	0.1638:0.2594:0.1641:0.4128	.	302	Q96EZ4	MYEOV_HUMAN	H	302;302;244	ENSP00000412482:L302H;ENSP00000308330:L302H;ENSP00000438100:L244H	ENSP00000308330:L302H	L	+	2	0	MYEOV	68820398	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.679000	0.05203	-3.385000	0.00174	-2.750000	0.00124	CTC			0.577	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000396548.1			
TECTA	7007	mdanderson.org	37	11	121061449	121061449	+	Silent	SNP	G	G	T	rs141203939	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:121061449G>T	ENST00000392793.1	+	24	6673	c.6402G>T	c.(6400-6402)acG>acT	p.T2134T	TECTA_ENST00000264037.2_Silent_p.T2134T			O75443	TECTA_HUMAN	tectorin alpha	2134					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AAGTCTGGACGCTTCTTCTCA	0.388													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15399	0.0		0.0	False		,,,				2504	0.0				p.T2134T													.	.			0			c.G6402T												104.0	94.0	98.0					11																	121061449		2203	4299	6502	SO:0001819	synonymous_variant	7007	exon23			CTGGACGCTTCTT	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6402G>T	11.37:g.121061449G>T			88	0	0		47	0.06	3	NM_005422	1	0.00	0		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																			0		0.388	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313850.1		NM_005422	
UBASH3B	84959	mdanderson.org	37	11	122526901	122526901	+	Silent	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr11:122526901G>A	ENST00000284273.5	+	1	519	c.144G>A	c.(142-144)ggG>ggA	p.G48G	UBASH3B_ENST00000525711.1_3'UTR	NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	48	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TCTCCATGGGGTTCCCCAGAG	0.726																																					p.G48G													.	.			0			c.G144A												13.0	12.0	13.0					11																	122526901		2134	4218	6352	SO:0001819	synonymous_variant	84959	exon1			CATGGGGTTCCCC	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.144G>A	11.37:g.122526901G>A			69	0	0		46	0.07	3	NM_032873	12	0.00	0	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Silent	SNP	ENST00000284273.5	37	CCDS31694.1																																																																																					0.726	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387499.1		NM_032873	
GRIN2B	2904	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	13724765	13724765	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr12:13724765T>A	ENST00000609686.1	-	10	2353	c.2144A>T	c.(2143-2145)gAt>gTt	p.D715V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	715					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CAATGCATCATCTACACCCCT	0.448																																					p.D715V													.	.			0			c.A2144T												266.0	228.0	241.0					12																	13724765		2203	4300	6503	SO:0001583	missense	2904	exon10			GCATCATCTACAC		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2144A>T	12.37:g.13724765T>A	ENSP00000477455:p.Asp715Val		153	0	0		238	0.09	21	NM_000834	0		0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.228265	0.58777	.	.	ENSG00000150086	ENST00000279593	T	0.28895	1.59	5.73	5.73	0.89815	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.049067	0.85682	D	0.000000	T	0.31389	0.0795	L	0.47716	1.5	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.03933	-1.0991	10	0.51188	T	0.08	.	16.3123	0.82883	0.0:0.0:0.0:1.0	.	715	Q13224	NMDE2_HUMAN	V	715	ENSP00000279593:D715V	ENSP00000279593:D715V	D	-	2	0	GRIN2B	13616032	0.995000	0.38212	0.995000	0.50966	0.998000	0.95712	5.006000	0.63978	2.308000	0.77769	0.533000	0.62120	GAT			0.448	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268014.2			
CERS5	91012	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	50529846	50529846	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr12:50529846delG	ENST00000317551.6	-	7	767	c.643delC	c.(643-645)ctgfs	p.L215fs	CERS5_ENST00000422340.2_Frame_Shift_Del_p.L157fs	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	215	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AACATGATCAGGAAGTCCTAG	0.448																																					p.L215fs													.	.			0			c.644delT												110.0	107.0	108.0					12																	50529846		2203	4300	6503	SO:0001589	frameshift_variant	91012	exon7			TGATCAGGAAGTC		CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.643delC	12.37:g.50529846delG	ENSP00000325485:p.Leu215fs		62	0	0		83	0.17	14	NM_147190	56	0.00	0	B4DV54	Frame_Shift_Del	DEL	ENST00000317551.6	37	CCDS8801.1																																																																																					0.448	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000406069.3		NM_147190	
ZIC2	7546	mdanderson.org	37	13	100635045	100635045	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr13:100635045T>C	ENST00000376335.3	+	1	1020	c.727T>C	c.(727-729)Ttt>Ctt	p.F243L		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	243	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.				brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ccCCGGTGCCTTTTTCCGCTA	0.562																																					p.F243L	Pancreas(97;119 1522 31925 44771 48764)												.	.			0			c.T727C												52.0	58.0	56.0					13																	100635045		2203	4300	6503	SO:0001583	missense	7546	exon1			GGTGCCTTTTTCC	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.727T>C	13.37:g.100635045T>C	ENSP00000365514:p.Phe243Leu		31	0	0		24	0.13	3	NM_007129	2	0.00	0	Q5VYA9|Q9H309	Missense_Mutation	SNP	ENST00000376335.3	37	CCDS9495.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.633149	0.87660	.	.	ENSG00000043355	ENST00000376335	T	0.43688	0.94	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	M	0.77103	2.36	0.80722	D	1	P	0.35612	0.512	B	0.37198	0.243	T	0.57412	-0.7816	10	0.87932	D	0	.	14.0708	0.64858	0.0:0.0:0.0:1.0	.	243	O95409	ZIC2_HUMAN	L	243	ENSP00000365514:F243L	ENSP00000365514:F243L	F	+	1	0	ZIC2	99433046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.482000	0.81143	2.064000	0.61679	0.459000	0.35465	TTT			0.562	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045618.2		NM_007129	
NKX2-8	26257	mdanderson.org	37	14	37050384	37050384	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr14:37050384G>A	ENST00000258829.5	-	2	660	c.443C>T	c.(442-444)gCg>gTg	p.A148V		NM_014360.2	NP_055175.2	O15522	NKX28_HUMAN	NK2 homeobox 8	148					axonogenesis (GO:0007409)|liver development (GO:0001889)|lung development (GO:0030324)|negative regulation of epithelial cell proliferation (GO:0050680)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			upper_aerodigestive_tract(1)	1	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		AGGCGACTCCGCCGCCCCTGG	0.701																																					p.A148V													.	.			0			c.C443T												9.0	10.0	9.0					14																	37050384		2186	4273	6459	SO:0001583	missense	26257	exon2			GACTCCGCCGCCC		CCDS9660.1	14q13.3	2012-03-09	2007-07-09	2002-10-04	ENSG00000136327	ENSG00000136327		"""Homeoboxes / ANTP class : NKL subclass"""	16364	protein-coding gene	gene with protein product		603245	"""NK-2 homolog H (Drosophila)"", ""NK2 transcription factor related, locus 8 (Drosophila)"""	NKX2H		9446603	Standard	NM_014360		Approved	NKX2.8, Nkx2-9	uc001wtx.3	O15522	OTTHUMG00000028772	ENST00000258829.5:c.443C>T	14.37:g.37050384G>A	ENSP00000258829:p.Ala148Val		12	0	0		17	0.12	2	NM_014360	0		0	Q8IUT7	Missense_Mutation	SNP	ENST00000258829.5	37	CCDS9660.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343691	0.24339	.	.	ENSG00000136327	ENST00000258829	D	0.91295	-2.82	4.22	3.32	0.38043	.	0.532616	0.19005	N	0.125232	D	0.84924	0.5580	L	0.44542	1.39	0.09310	N	1	B	0.18863	0.031	B	0.08055	0.003	T	0.69910	-0.5017	10	0.21014	T	0.42	.	11.2755	0.49163	0.0898:0.0:0.9102:0.0	.	148	O15522	NKX28_HUMAN	V	148	ENSP00000258829:A148V	ENSP00000258829:A148V	A	-	2	0	NKX2-8	36120135	0.373000	0.25073	0.002000	0.10522	0.074000	0.17049	0.731000	0.26058	0.974000	0.38366	0.561000	0.74099	GCG			0.701	NKX2-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071844.6			
POLG	5428	mdanderson.org	37	15	89876841	89876841	+	Missense_Mutation	SNP	G	G	T	rs200132079		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr15:89876841G>T	ENST00000268124.5	-	2	478	c.145C>A	c.(145-147)Cag>Aag	p.Q49K	POLG_ENST00000442287.2_Missense_Mutation_p.Q49K|RP11-217B1.2_ENST00000562356.1_RNA|RP11-217B1.2_ENST00000569473.1_RNA|POLG_ENST00000525806.1_5'Flank	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	49	Poly-Gln.				aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			tgctgctgctgctgctgctgc	0.706								DNA polymerases (catalytic subunits)																													p.Q49K	Colon(73;648 1203 11348 18386 27782)												.	.			0			c.C145A												9.0	10.0	10.0					15																	89876841		2128	4169	6297	SO:0001583	missense	5428	exon2			GCTGCTGCTGCTG	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.145C>A	15.37:g.89876841G>T	ENSP00000268124:p.Gln49Lys		17	0	0		18	0.11	2	NM_001126131	7	0.00	0	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	g	0.029	-1.349012	0.01266	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.95980	-3.87;-3.87	0.355	0.355	0.16069	.	7.913470	0.02615	U	0.102578	D	0.86944	0.6055	N	0.08118	0	0.09310	N	1	B	0.26041	0.14	B	0.22880	0.042	T	0.81908	-0.0717	9	0.05959	T	0.93	.	.	.	.	.	49	P54098	DPOG1_HUMAN	K	49	ENSP00000268124:Q49K;ENSP00000399851:Q49K	ENSP00000268124:Q49K	Q	-	1	0	POLG	87677845	0.007000	0.16637	0.009000	0.14445	0.010000	0.07245	0.089000	0.15002	0.458000	0.26988	0.089000	0.15464	CAG			0.706	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000312854.2		NM_002693	
RGMA	56963	broad.mit.edu	37	15	93588747	93588747	+	Silent	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr15:93588747G>T	ENST00000329082.7	-	4	1105	c.834C>A	c.(832-834)ggC>ggA	p.G278G	RGMA_ENST00000425933.2_Silent_p.G262G|RGMA_ENST00000556658.1_Silent_p.G169G|RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000538818.1_Silent_p.G169G|RGMA_ENST00000543599.1_Silent_p.G262G|RGMA_ENST00000542321.2_Silent_p.G262G|RGMA_ENST00000557301.1_Silent_p.G286G	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	278					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.G278G(2)|p.G286G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			CGATGGTGGTGCCGATGTACT	0.612																																					p.G286G													RGMA,NS,carcinoma,0,2	RGMA	49	2	3	Substitution - coding silent(3)	endometrium(2)|prostate(1)	c.C858A																																									SO:0001819	synonymous_variant	56963	exon4			GGTGGTGCCGATG	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.834C>A	15.37:g.93588747G>T			88	0.0227272727	2		99	0.06	6	NM_001166283	19	0.16	3	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Silent	SNP	ENST00000329082.7	37	CCDS45357.1																																																																																					0.612	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000415091.1		NM_020211	
MSLN	10232	mdanderson.org	37	16	815169	815169	+	Silent	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr16:815169C>T	ENST00000382862.3	+	8	665	c.570C>T	c.(568-570)tgC>tgT	p.C190C	MSLN_ENST00000563941.1_Silent_p.C190C|MSLN_ENST00000545450.2_Silent_p.C190C|MSLN_ENST00000566549.1_Silent_p.C190C	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	190					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				GCCTGGCTTGCGACCTGCCTG	0.692																																					p.C190C													MSLN_ENST00000446427,NS,carcinoma,0,2	MSLN_ENST00000446427	0	2	0			c.C570T												20.0	18.0	18.0					16																	815169		2162	4272	6434	SO:0001819	synonymous_variant	10232	exon9			GGCTTGCGACCTG	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.570C>T	16.37:g.815169C>T			23	0	0		24	0.08	2	NM_005823	1	0.00	0	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	ENST00000382862.3	37	CCDS32356.1																																																																																					0.692	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000109253.2			
ARMC5	79798	mdanderson.org	37	16	31476521	31476521	+	Intron	SNP	G	G	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr16:31476521G>C	ENST00000563544.1	+	5	2410				ARMC5_ENST00000268314.4_Intron|ARMC5_ENST00000412665.2_Intron|ARMC5_ENST00000538189.1_Intron|ARMC5_ENST00000457010.2_Nonstop_Mutation_p.*726S|ARMC5_ENST00000408912.3_Intron			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5											central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GCACTGTCCTGACTGCTCCCC	0.627																																					p.X726S													.	.			0			c.G2177C												36.0	40.0	39.0					16																	31476521		2178	4284	6462	SO:0001627	intron_variant	79798	exon4			TGTCCTGACTGCT	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1864+313G>C	16.37:g.31476521G>C			60	0	0		60	0.05	3	NM_024742	1	0.00	0	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	.	.	.	.	.	.	.	.	.	.	G	1.732	-0.493862	0.04322	.	.	ENSG00000140691	ENST00000457010	.	.	.	3.48	0.326	0.15908	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5218	0.11962	0.2097:0.0:0.6026:0.1876	.	.	.	.	S	726	.	.	X	+	2	2	ARMC5	31384022	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.322000	0.19576	0.108000	0.17862	-0.350000	0.07774	TGA			0.627	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432847.1		NM_024742	
HEATR3	55027	mdanderson.org	37	16	50112858	50112858	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr16:50112858G>T	ENST00000299192.7	+	7	1161	c.970G>T	c.(970-972)Gat>Tat	p.D324Y	HEATR3_ENST00000285767.4_Missense_Mutation_p.D238Y	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	324										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TTTGATTGAAGATGATGAAAT	0.368																																					p.D324Y													.	.			0			c.G970T												81.0	86.0	84.0					16																	50112858		2198	4300	6498	SO:0001583	missense	55027	exon7			ATTGAAGATGATG	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.970G>T	16.37:g.50112858G>T	ENSP00000299192:p.Asp324Tyr		42	0	0		37	0.08	3	NM_182922	16	0.00	0	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	37	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919835	0.73098	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.30714	1.52;1.52	5.54	4.59	0.56863	Armadillo-type fold (1);	0.248172	0.45606	D	0.000358	T	0.48537	0.1505	M	0.67953	2.075	0.48452	D	0.99965	D;D	0.69078	0.994;0.997	P;P	0.58172	0.834;0.819	T	0.53732	-0.8397	10	0.72032	D	0.01	.	14.4479	0.67364	0.0707:0.0:0.9293:0.0	.	238;324	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	Y	238;324	ENSP00000285767:D238Y;ENSP00000299192:D324Y	ENSP00000285767:D238Y	D	+	1	0	HEATR3	48670359	1.000000	0.71417	0.698000	0.30274	0.988000	0.76386	5.735000	0.68587	1.477000	0.48234	0.551000	0.68910	GAT			0.368	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256880.2		NM_182922	
PRDM7	11105	broad.mit.edu	37	16	90160793	90160793	+	5'Flank	SNP	G	G	C	rs185366455	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr16:90160793G>C	ENST00000569206.1	-	0	0				TUBB8P7_ENST00000567960.1_RNA|TUBB8P7_ENST00000564451.1_RNA			Q9NQW5	PRDM7_HUMAN	PR domain containing 7						regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		GACTCCGCTGGCACCTACCAC	0.706													.|||	1018	0.203275	0.0113	0.2608	5008	,	,		7926	0.5923		0.0944	False		,,,				2504	0.1329				.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			CCGCTGGCACCTA	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990		16.37:g.90160793G>C	Exception_encountered		9	0.1111111111	1		8	0.50	4	.	1	0.00	0	A4Q9G8|Q08EM4|Q9NQW4	RNA	SNP	ENST00000569206.1	37																																																																																						0.706	PRDM7-009	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000420855.1			
PHF23	79142	broad.mit.edu;bcgsc.ca	37	17	7139505	7139506	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr17:7139505_7139506delAG	ENST00000320316.3	-	4	966_967	c.740_741delCT	c.(739-741)tctfs	p.S247fs	DVL2_ENST00000575458.1_5'Flank|PHF23_ENST00000570753.1_5'Flank|DVL2_ENST00000005340.5_5'Flank|PHF23_ENST00000576955.1_Frame_Shift_Del_p.S117fs|PHF23_ENST00000454255.2_Frame_Shift_Del_p.S243fs|PHF23_ENST00000571362.1_Frame_Shift_Del_p.S180fs	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	247							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						cctcctcttcAGAGTCTGTATC	0.569																																					p.247_247del													.	PHF23	38		0			c.740_741del																																									SO:0001589	frameshift_variant	79142	exon4			CTCTTCAGAGTCT	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.740_741delCT	17.37:g.7139507_7139508delAG	ENSP00000322579:p.Ser247fs		52	0	0		48	0.19	9	NM_024297	134	0.01	1	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Frame_Shift_Del	DEL	ENST00000320316.3	37	CCDS42250.1																																																																																					0.569	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440047.1		NM_024297	
KDM6B	23135	mdanderson.org	37	17	7756632	7756632	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr17:7756632G>T	ENST00000448097.2	+	22	5173	c.4842G>T	c.(4840-4842)caG>caT	p.Q1614H	TMEM88_ENST00000574668.1_5'Flank|KDM6B_ENST00000254846.5_Missense_Mutation_p.Q1614H|TMEM88_ENST00000301599.6_5'Flank			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1614					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CAGGCCTGCAGGGCGTGGTGG	0.672																																					p.Q1614H													.	.			0			c.G4842T												20.0	22.0	21.0					17																	7756632		2198	4294	6492	SO:0001583	missense	23135	exon22			CCTGCAGGGCGTG	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4842G>T	17.37:g.7756632G>T	ENSP00000412513:p.Gln1614His		39	0	0		24	0.08	2	NM_001080424	18	0.00	0	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	11.72	1.721555	0.30503	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.32515	1.45;1.45	4.17	4.17	0.49024	.	0.737125	0.12862	N	0.433069	T	0.26882	0.0658	L	0.34521	1.04	0.35294	D	0.782443	B;B	0.20052	0.016;0.041	B;B	0.23419	0.046;0.026	T	0.28554	-1.0040	10	0.56958	D	0.05	-6.4157	12.6829	0.56932	0.0:0.1683:0.8317:0.0	.	1614;1614	O15054;O15054-1	KDM6B_HUMAN;.	H	1614	ENSP00000254846:Q1614H;ENSP00000412513:Q1614H	ENSP00000254846:Q1614H	Q	+	3	2	KDM6B	7697357	0.416000	0.25424	1.000000	0.80357	0.935000	0.57460	0.258000	0.18387	2.248000	0.74166	0.462000	0.41574	CAG			0.672	KDM6B-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000440248.1		XM_043272	
MYH10	4628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8439201	8439201	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr17:8439201G>A	ENST00000269243.4	-	14	1762	c.1624C>T	c.(1624-1626)Cct>Tct	p.P542S	MYH10_ENST00000379980.4_Missense_Mutation_p.P558S|MYH10_ENST00000396239.1_Missense_Mutation_p.P542S|MYH10_ENST00000360416.3_Missense_Mutation_p.P552S	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	542	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GTGGCTTTAGGGAACCAGCAT	0.413																																					p.P552S													.	.			0			c.C1654T												82.0	80.0	81.0					17																	8439201		2203	4300	6503	SO:0001583	missense	4628	exon15			CTTTAGGGAACCA	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.1624C>T	17.37:g.8439201G>A	ENSP00000269243:p.Pro542Ser		143	0	0		125	0.14	17	NM_001256012	6	0.33	2	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138767	0.94560	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;D;T	0.96073	-0.87;-0.87;-3.9;-0.87	5.42	5.42	0.78866	Myosin head, motor domain (2);	0.115170	0.64402	D	0.000010	D	0.98286	0.9432	M	0.91090	3.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98874	1.0767	10	0.87932	D	0	.	19.4084	0.94658	0.0:0.0:1.0:0.0	.	551;552;542	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	S	542;552;542;558	ENSP00000269243:P542S;ENSP00000353590:P552S;ENSP00000379539:P542S;ENSP00000369315:P558S	ENSP00000269243:P542S	P	-	1	0	MYH10	8379926	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.657000	0.98554	2.820000	0.97059	0.650000	0.86243	CCT			0.413	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000227001.2			
ABHD15	116236	mdanderson.org	37	17	27893542	27893542	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr17:27893542C>T	ENST00000307201.4	-	1	613	c.443G>A	c.(442-444)cGc>cAc	p.R148H	RP11-68I3.2_ENST00000581474.1_RNA|TP53I13_ENST00000584522.1_3'UTR|TP53I13_ENST00000301057.7_5'Flank	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	148						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						GGTGATCCGGCGGCCCCGAAC	0.692																																					p.R148H													.	.			0			c.G443A												24.0	22.0	23.0					17																	27893542		2201	4294	6495	SO:0001583	missense	116236	exon1			ATCCGGCGGCCCC	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.443G>A	17.37:g.27893542C>T	ENSP00000302657:p.Arg148His		45	0	0		57	0.05	3	NM_198147	9	0.00	0	Q96EC5	Missense_Mutation	SNP	ENST00000307201.4	37	CCDS32602.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458359	0.26248	.	.	ENSG00000168792	ENST00000307201	T	0.18810	2.19	4.34	2.22	0.28083	.	0.066930	0.56097	D	0.000038	T	0.11665	0.0284	L	0.29908	0.895	0.19945	N	0.999948	D	0.55385	0.971	B	0.42062	0.374	T	0.14364	-1.0475	10	0.22706	T	0.39	-21.6941	4.5164	0.11937	0.1442:0.6019:0.1577:0.0962	.	148	Q6UXT9	ABH15_HUMAN	H	148	ENSP00000302657:R148H	ENSP00000302657:R148H	R	-	2	0	ABHD15	24917668	0.005000	0.15991	0.644000	0.29465	0.133000	0.20885	0.783000	0.26802	1.047000	0.40274	0.563000	0.77884	CGC			0.692	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447796.2		NM_198147	
ONECUT2	9480	mdanderson.org	37	18	55103650	55103650	+	Silent	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr18:55103650C>T	ENST00000491143.2	+	1	734	c.702C>T	c.(700-702)aaC>aaT	p.N234N	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	234					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		CGCTGGGCAACGGGCTAGGCG	0.672																																					p.N234N													.	.			0			c.C702T												20.0	25.0	23.0					18																	55103650		2107	4203	6310	SO:0001819	synonymous_variant	9480	exon1			GGGCAACGGGCTA	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.702C>T	18.37:g.55103650C>T			38	0	0		43	0.07	3	NM_004852	0		0		Silent	SNP	ENST00000491143.2	37	CCDS42440.1																																																																																					0.672	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357264.3			
VAV1	7409	mdanderson.org	37	19	6826646	6826646	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:6826646G>A	ENST00000602142.1	+	9	933	c.851G>A	c.(850-852)tGc>tAc	p.C284Y	VAV1_ENST00000596764.1_Missense_Mutation_p.C252Y|VAV1_ENST00000539284.1_Missense_Mutation_p.C187Y|VAV1_ENST00000304076.2_Missense_Mutation_p.C284Y|VAV1_ENST00000599806.1_Missense_Mutation_p.C229Y	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	284	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GGCCGCTACTGCAGCCAGGTG	0.652																																					p.C284Y													.	.			0			c.G851A												61.0	47.0	52.0					19																	6826646		2167	4261	6428	SO:0001583	missense	7409	exon9			GCTACTGCAGCCA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.851G>A	19.37:g.6826646G>A	ENSP00000472929:p.Cys284Tyr		38	0	0		32	0.09	3	NM_001258206	43	0.00	0	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479596	0.84747	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.67345	-0.26;-0.26	5.26	5.26	0.73747	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.87573	0.6211	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91442	0.5174	10	0.87932	D	0	.	16.3535	0.83227	0.0:0.0:1.0:0.0	.	187;284;229;284	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	Y	284;187	ENSP00000302269:C284Y;ENSP00000443242:C187Y	ENSP00000302269:C284Y	C	+	2	0	VAV1	6777646	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.045000	0.93812	2.465000	0.83290	0.561000	0.74099	TGC			0.652	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458475.1			
ZNF317	57693	mdanderson.org	37	19	9268706	9268706	+	Nonsense_Mutation	SNP	G	G	T	rs200289169		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:9268706G>T	ENST00000247956.6	+	5	645	c.340G>T	c.(340-342)Gag>Tag	p.E114*	ZNF317_ENST00000360385.3_Intron	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	114	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						GCAGGAGGAGGAGCCGAGGAC	0.597																																					p.E114X													.	.			0			c.G340T												42.0	34.0	37.0					19																	9268706		1825	3363	5188	SO:0001587	stop_gained	57693	exon5			GAGGAGGAGCCGA	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.340G>T	19.37:g.9268706G>T	ENSP00000247956:p.Glu114*		39	0	0		40	0.08	3	NM_020933	11	0.00	0	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Nonsense_Mutation	SNP	ENST00000247956.6	37	CCDS12210.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618789	0.87460	.	.	ENSG00000130803	ENST00000247956	.	.	.	3.48	3.48	0.39840	.	0.409423	0.17984	N	0.155431	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-28.684	10.6705	0.45755	0.0:0.0:1.0:0.0	.	.	.	.	X	114	.	ENSP00000247956:E114X	E	+	1	0	ZNF317	9129706	0.530000	0.26330	0.901000	0.35422	0.363000	0.29612	1.861000	0.39438	1.977000	0.57605	0.591000	0.81541	GAG			0.597	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000448995.1		NM_020933	
COLGALT1	79709	mdanderson.org	37	19	17683358	17683358	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:17683358G>A	ENST00000252599.4	+	6	1016	c.896G>A	c.(895-897)aGc>aAc	p.S299N		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	299					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CGCGCCCACAGCACCCTCCAG	0.582																																					p.S299N													.	.			0			c.G896A												157.0	122.0	134.0					19																	17683358		2203	4300	6503	SO:0001583	missense	79709	exon6			CCCACAGCACCCT	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.896G>A	19.37:g.17683358G>A	ENSP00000252599:p.Ser299Asn		45	0	0		36	0.08	3	NM_024656	134	0.00	0	Q8NC64	Missense_Mutation	SNP	ENST00000252599.4	37	CCDS12363.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556382	0.27827	.	.	ENSG00000130309	ENST00000252599	T	0.24350	1.86	5.35	5.35	0.76521	.	0.244563	0.46758	D	0.000277	T	0.20618	0.0496	N	0.25890	0.77	0.44890	D	0.997903	B	0.06786	0.001	B	0.10450	0.005	T	0.03112	-1.1071	10	0.29301	T	0.29	-26.8539	16.5483	0.84457	0.0:0.0:1.0:0.0	.	299	Q8NBJ5	GT251_HUMAN	N	299	ENSP00000252599:S299N	ENSP00000252599:S299N	S	+	2	0	GLT25D1	17544358	1.000000	0.71417	0.998000	0.56505	0.340000	0.28889	2.558000	0.45879	2.494000	0.84150	0.655000	0.94253	AGC			0.582	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464216.1		NM_024656	
MAST3	23031	mdanderson.org	37	19	18241320	18241320	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:18241320C>T	ENST00000262811.6	+	13	1153	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W		NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CTACCTGGTGCGGCACCGTGA	0.587																																					p.R385W													.	.			0			c.C1153T												42.0	40.0	41.0					19																	18241320		2200	4299	6499	SO:0001583	missense	23031	exon13			CTGGTGCGGCACC	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.1153C>T	19.37:g.18241320C>T	ENSP00000262811:p.Arg385Trp		50	0	0		51	0.06	3	NM_015016	7	0.00	0	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877406	0.51801	.	.	ENSG00000099308	ENST00000262811	T	0.26957	1.7	4.87	3.8	0.43715	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.70108	2.13	0.58432	D	0.999991	D	0.89917	1.0	D	0.81914	0.995	T	0.50180	-0.8858	10	0.87932	D	0	-26.7665	11.6836	0.51472	0.2494:0.7506:0.0:0.0	.	385	O60307	MAST3_HUMAN	W	385	ENSP00000262811:R385W	ENSP00000262811:R385W	R	+	1	2	MAST3	18102320	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	1.685000	0.37659	2.244000	0.73946	0.561000	0.74099	CGG			0.587	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466526.2		XM_038150	
MEGF8	1954	mdanderson.org	37	19	42873740	42873740	+	Silent	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:42873740G>T	ENST00000251268.6	+	38	6699	c.6699G>T	c.(6697-6699)gtG>gtT	p.V2233V	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Silent_p.V2166V	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2233					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GCTCATGTGTGGAGCCCGACC	0.672																																					p.V2233V													.	.			0			c.G6699T												43.0	42.0	42.0					19																	42873740		2203	4299	6502	SO:0001819	synonymous_variant	1954	exon38			ATGTGTGGAGCCC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6699G>T	19.37:g.42873740G>T			43	0	0		34	0.09	3	NM_001271938	10	0.00	0	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																						0.672	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
PPP2R1A	5518	mdanderson.org	37	19	52716240	52716240	+	Nonsense_Mutation	SNP	C	C	A	rs201531933	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr19:52716240C>A	ENST00000322088.6	+	6	742	c.684C>A	c.(682-684)tgC>tgA	p.C228*	PPP2R1A_ENST00000444322.2_Nonsense_Mutation_p.C173*|PPP2R1A_ENST00000462990.1_Nonsense_Mutation_p.C49*	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	228	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TGGAGGCGTGCGTGAACATCG	0.642			Mis		clear cell ovarian carcinoma																																p.C228X				Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.			0			c.C684A												36.0	36.0	36.0					19																	52716240		2203	4300	6503	SO:0001587	stop_gained	5518	exon6			GGCGTGCGTGAAC		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.684C>A	19.37:g.52716240C>A	ENSP00000324804:p.Cys228*		37	0	0		33	0.09	3	NM_014225	321	0.00	0	Q13773|Q6ICQ3|Q96DH3	Nonsense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796232	0.90453	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	.	.	.	4.59	-9.19	0.00685	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7042	20.7588	0.99720	0.0:0.1632:0.0:0.8368	.	.	.	.	X	218;148;228;173	.	ENSP00000324804:C228X	C	+	3	2	PPP2R1A	57408052	0.007000	0.16637	0.004000	0.12327	0.934000	0.57294	-1.429000	0.02437	-3.353000	0.00180	-0.136000	0.14681	TGC			0.642	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000267967.2		NM_014225	
MIR217HG	104355290	broad.mit.edu	37	2	56210465	56210465	+	lincRNA	DEL	G	G	-	rs11303332|rs71416150|rs111857538	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr2:56210465delG	ENST00000606639.1	+	0	82				MIR217_ENST00000384817.1_RNA|AC011306.2_ENST00000446139.1_lincRNA																							TTTAAAAATAGCTTTTTAAAA	0.328																																					.													.	.			0			.																																											0	.			AAAATAGCTTTTT																													2.37:g.56210465delG			7	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000606639.1	37																																																																																						0.328	RP11-481J13.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000470754.1			
TET3	200424	mdanderson.org	37	2	74307690	74307690	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr2:74307690G>T	ENST00000409262.3	+	3	2246	c.2246G>T	c.(2245-2247)aGc>aTc	p.S749I		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	749					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAGGGAAAGAGCTCCCGCGGT	0.587																																					p.S749I													.	.			0			c.G2246T												48.0	52.0	51.0					2																	74307690		1988	4152	6140	SO:0001583	missense	200424	exon3			GAAAGAGCTCCCG		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2246G>T	2.37:g.74307690G>T	ENSP00000386869:p.Ser749Ile		52	0	0		52	0.06	3	NM_144993	0		0	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	G	31	5.091764	0.94149	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.38401	1.14	5.28	5.28	0.74379	TET cysteine-rich domain (1);	0.042316	0.85682	D	0.000000	T	0.63153	0.2487	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66472	-0.5915	10	0.87932	D	0	.	17.8379	0.88706	0.0:0.0:1.0:0.0	.	749	O43151	TET3_HUMAN	I	749	ENSP00000386869:S749I	ENSP00000233310:S749I	S	+	2	0	TET3	74161198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.745000	0.94114	0.655000	0.94253	AGC			0.587	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328141.4			
NR4A2	4929	broad.mit.edu	37	2	157182338	157182338	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr2:157182338C>T	ENST00000339562.4	-	8	2077	c.1715G>A	c.(1714-1716)cGc>cAc	p.R572H	NR4A2_ENST00000409108.2_Silent_p.A537A|NR4A2_ENST00000409572.1_Missense_Mutation_p.R572H|NR4A2_ENST00000426264.1_Missense_Mutation_p.R509H|NR4A2_ENST00000539077.1_Missense_Mutation_p.R583H|NR4A2_ENST00000429376.1_Silent_p.A474A	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	572					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						GTAGAAAATGCGCTGTAGCCC	0.483																																					p.R572H													NR4A2,NS,carcinoma,-1,1	NR4A2	82	1	0			c.G1715A												108.0	111.0	110.0					2																	157182338		2203	4300	6503	SO:0001583	missense	0	exon8			AAAATGCGCTGTA	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1715G>A	2.37:g.157182338C>T	ENSP00000344479:p.Arg572His		185	0	0		185	0.02	4	NM_006186	10	0.00	0	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038732	0.75617	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077	D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04	6.07	6.07	0.98685	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95703	0.8751	10	0.19590	T	0.45	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	572	P43354	NR4A2_HUMAN	H	572;509;572;583	ENSP00000344479:R572H;ENSP00000389986:R509H;ENSP00000386747:R572H;ENSP00000444925:R583H	ENSP00000344479:R572H	R	-	2	0	NR4A2	156890584	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CGC			0.483	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254909.2			
FARSB	10056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223507631	223507631	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr2:223507631T>C	ENST00000281828.6	-	3	471	c.208A>G	c.(208-210)Aat>Gat	p.N70D	FARSB_ENST00000536361.1_5'UTR	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	70					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	TCATATCTATTGGCAGGGACG	0.393																																					p.N70D													.	.			0			c.A208G												95.0	90.0	91.0					2																	223507631		2203	4300	6503	SO:0001583	missense	10056	exon3			ATCTATTGGCAGG	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.208A>G	2.37:g.223507631T>C	ENSP00000281828:p.Asn70Asp		142	0	0		115	0.15	17	NM_005687	39	0.36	14	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.948840	0.92660	.	.	ENSG00000116120	ENST00000281828	.	.	.	5.62	5.62	0.85841	DNA binding domain, putative (1);	0.000000	0.85682	D	0.000000	D	0.83737	0.5319	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.85180	0.1003	9	0.44086	T	0.13	-28.2635	15.837	0.78805	0.0:0.0:0.0:1.0	.	70;70	A8K666;Q9NSD9	.;SYFB_HUMAN	D	70	.	ENSP00000281828:N70D	N	-	1	0	FARSB	223215875	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.694000	0.84235	2.140000	0.66376	0.460000	0.39030	AAT			0.393	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256855.2		NM_005687	
SOX12	6666	broad.mit.edu	37	20	305267	305267	+	5'Flank	DEL	A	A	-			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr20:305267delA	ENST00000342665.2	+	0	0				RP5-1103G7.4_ENST00000442637.1_RNA|RP5-1103G7.4_ENST00000414676.1_RNA|SOX12_ENST00000544632.1_5'Flank	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12						cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CGACGCGCCCAAGTCGGGCAC	0.721																																					.													.	SOX12	8		0			.																																									SO:0001631	upstream_gene_variant	0	.			GCGCCCAAGTCGG	U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623		20.37:g.305267delA	Exception_encountered		4	0	0		6	0.33	2	.	0		0	Q5D038|Q9NUD4	RNA	DEL	ENST00000342665.2	37	CCDS12995.1																																																																																					0.721	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077435.2		NM_006943	
DNMT3B	1789	mdanderson.org	37	20	31386384	31386384	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr20:31386384C>T	ENST00000328111.2	+	15	1930	c.1609C>T	c.(1609-1611)Cgg>Tgg	p.R537W	DNMT3B_ENST00000443239.3_Missense_Mutation_p.R475W|DNMT3B_ENST00000353855.2_Missense_Mutation_p.R517W|DNMT3B_ENST00000344505.4_Missense_Mutation_p.R517W|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000201963.3_Missense_Mutation_p.R529W|DNMT3B_ENST00000348286.2_Missense_Mutation_p.R517W|DNMT3B_ENST00000456297.2_Missense_Mutation_p.R441W	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	537	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGCGTCCTGCGGCGCCGGAA	0.637																																					p.R537W													DNMT3B_ENST00000201963,NS,carcinoma,0,4	DNMT3B_ENST00000201963	0	4	0			c.C1609T												42.0	47.0	45.0					20																	31386384		2203	4300	6503	SO:0001583	missense	1789	exon15			GTCCTGCGGCGCC		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1609C>T	20.37:g.31386384C>T	ENSP00000328547:p.Arg537Trp		66	0	0		53	0.06	3	NM_006892	430	0.00	0	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977312	0.53720	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.76	4.8	0.61643	Zinc finger, FYVE/PHD-type (1);	0.234553	0.43260	N	0.000583	T	0.68403	0.2997	L	0.42245	1.32	0.80722	D	1	B;B;B;B;B;B;B	0.16166	0.009;0.009;0.009;0.016;0.016;0.016;0.005	B;B;B;B;B;B;B	0.15484	0.001;0.0;0.0;0.013;0.001;0.001;0.0	T	0.66650	-0.5870	10	0.87932	D	0	-11.4462	7.4437	0.27198	0.1634:0.7485:0.0:0.088	.	441;475;236;529;517;517;537	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	W	537;517;517;475;441;517;529	ENSP00000328547:R537W;ENSP00000313397:R517W;ENSP00000337764:R517W;ENSP00000403169:R475W;ENSP00000412305:R441W;ENSP00000345105:R517W;ENSP00000201963:R529W	ENSP00000201963:R529W	R	+	1	2	DNMT3B	30850045	0.997000	0.39634	0.998000	0.56505	0.694000	0.40290	1.733000	0.38156	1.485000	0.48380	0.650000	0.86243	CGG			0.637	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078643.2		NM_006892	
OGFR	11054	broad.mit.edu	37	20	61443978	61443978	+	Silent	SNP	T	T	G			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr20:61443978T>G	ENST00000290291.6	+	7	1036	c.1011T>G	c.(1009-1011)ggT>ggG	p.G337G	OGFR_ENST00000370461.1_Silent_p.G285G	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	337					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					ATAGCAAGGGTGGGGGCAGGG	0.726																																					p.G337G													.	OGFR	63		0			c.T1011G																																									SO:0001819	synonymous_variant	11054	exon7			CAAGGGTGGGGGC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1011T>G	20.37:g.61443978T>G			53	0.0943396226	5		53	0.15	8	NM_007346	91	0.04	4	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																					0.726	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080067.1			
TRPM2	7226	mdanderson.org	37	21	45825863	45825863	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr21:45825863G>T	ENST00000397928.1	+	18	3178	c.2733G>T	c.(2731-2733)atG>atT	p.M911I	TRPM2_ENST00000300481.9_Missense_Mutation_p.M891I|TRPM2_ENST00000397932.2_Missense_Mutation_p.M911I|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Missense_Mutation_p.M911I	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	911					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TCCGGCTCATGCACATTTTTA	0.632																																					p.M911I													TRPM2,right_upper_lobe,carcinoma,+1,1	TRPM2	1	1	0			c.G2733T												109.0	115.0	113.0					21																	45825863		2203	4299	6502	SO:0001583	missense	7226	exon18			GCTCATGCACATT	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2733G>T	21.37:g.45825863G>T	ENSP00000381023:p.Met911Ile		24	0	0		43	0.07	3	NM_003307	13	0.00	0	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	g	10.20	1.283613	0.23392	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	D;D;D;D	0.98280	-4.84;-4.84;-4.84;-4.84	4.3	4.3	0.51218	Ion transport (1);	0.051320	0.85682	D	0.000000	D	0.96500	0.8858	L	0.41415	1.275	0.52099	D	0.99994	P;P;P	0.43024	0.798;0.689;0.689	P;P;P	0.47626	0.447;0.552;0.447	D	0.95834	0.8860	10	0.06494	T	0.89	-33.4867	16.8112	0.85720	0.0:0.0:1.0:0.0	.	911;697;911	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	I	911;911;891;911	ENSP00000300482:M911I;ENSP00000381023:M911I;ENSP00000300481:M891I;ENSP00000381026:M911I	ENSP00000300481:M891I	M	+	3	0	TRPM2	44650291	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	4.262000	0.58847	2.131000	0.65755	0.536000	0.68110	ATG			0.632	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098086.1		NM_003307	
TRPM2	7226	mdanderson.org	37	21	45861630	45861630	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr21:45861630G>T	ENST00000397928.1	+	32	4887	c.4442G>T	c.(4441-4443)cGc>cTc	p.R1481L	TRPM2_ENST00000300481.9_Missense_Mutation_p.R1427L|TRPM2_ENST00000397932.2_Missense_Mutation_p.R1531L|TRPM2_ENST00000498430.1_3'UTR|snoZ6_ENST00000583496.1_RNA|TRPM2_ENST00000300482.5_Missense_Mutation_p.R1481L	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1481	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GTGGACAGGCGCATCCCACTC	0.657																																					p.R1481L													.	.			0			c.G4442T												103.0	73.0	83.0					21																	45861630		2203	4300	6503	SO:0001583	missense	7226	exon32			ACAGGCGCATCCC	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.4442G>T	21.37:g.45861630G>T	ENSP00000381023:p.Arg1481Leu		35	0	0		49	0.06	3	NM_003307	77	0.00	0	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315958	0.23908	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932;ENST00000540347	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	4.2	3.31	0.37934	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.621124	0.15079	N	0.281799	T	0.09686	0.0238	N	0.16862	0.45	0.09310	N	0.999999	P;P;B;B	0.43352	0.804;0.62;0.402;0.402	B;B;B;B	0.41466	0.358;0.196;0.095;0.095	T	0.14090	-1.0485	10	0.66056	D	0.02	-15.3063	9.2104	0.37316	0.104:0.0:0.896:0.0	.	162;1531;1267;1481	B4DVI8;E9PGK7;Q5KTC1;O94759	.;.;.;TRPM2_HUMAN	L	1481;1481;1427;1531;225	ENSP00000300482:R1481L;ENSP00000381023:R1481L;ENSP00000300481:R1427L;ENSP00000381026:R1531L	ENSP00000300481:R1427L	R	+	2	0	TRPM2	44686058	0.998000	0.40836	0.117000	0.21633	0.187000	0.23431	4.883000	0.63128	1.126000	0.42016	0.591000	0.81541	CGC			0.657	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098086.1		NM_003307	
CBX6	23466	mdanderson.org	37	22	39262865	39262865	+	Silent	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr22:39262865C>T	ENST00000407418.3	-	5	711	c.588G>A	c.(586-588)gcG>gcA	p.A196A	CBX6_ENST00000216083.6_Silent_p.A178A			O95503	CBX6_HUMAN	chromobox homolog 6	196					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					ggcgggccagcgccccggccc	0.667																																					p.A196A													.	.			0			c.G588A												19.0	20.0	20.0					22																	39262865		2202	4292	6494	SO:0001819	synonymous_variant	23466	exon5			GGCCAGCGCCCCG		CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.588G>A	22.37:g.39262865C>T			51	0	0		50	0.06	3	NM_014292	3	0.00	0	A8KAH0|Q96EM5	Silent	SNP	ENST00000407418.3	37	CCDS13980.1																																																																																					0.667	CBX6-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000318190.1		NM_014292	
SLIT2	9353	mdanderson.org	37	4	20570610	20570610	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr4:20570610G>T	ENST00000504154.1	+	29	3323	c.3071G>T	c.(3070-3072)tGc>tTc	p.C1024F	SLIT2_ENST00000273739.5_Missense_Mutation_p.C1028F|SLIT2_ENST00000503823.1_Missense_Mutation_p.C1016F|SLIT2_ENST00000503837.1_Missense_Mutation_p.C1020F	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1024	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACATGCCTTTGCCCACCTGAG	0.333																																					p.C1024F													.	.			0			c.G3071T												124.0	114.0	117.0					4																	20570610		2203	4300	6503	SO:0001583	missense	9353	exon29			GCCTTTGCCCACC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3071G>T	4.37:g.20570610G>T	ENSP00000422591:p.Cys1024Phe		73	0	0		46	0.07	3	NM_004787	1	0.00	0	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.276495|4.276495	0.80580|0.80580	.|.	.|.	ENSG00000145147|ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837|ENST00000509941	D;D;D;D|D	0.99992|0.95588	-12.4;-12.4;-12.4;-12.4|-3.75	5.61|5.61	5.61|5.61	0.85477|0.85477	EGF (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.99039|0.99039	0.9671|0.9671	H|H	0.99609|0.99609	4.655|4.655	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.98802|0.98802	1.0740|1.0740	10|6	0.87932|.	D|.	0|.	.|.	20.0018|20.0018	0.97417|0.97417	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1016;1024|.	O94813-3;O94813|.	.;SLIT2_HUMAN|.	F|F	1016;1024;1028;1020;1020|154	ENSP00000427548:C1016F;ENSP00000422591:C1024F;ENSP00000273739:C1028F;ENSP00000422261:C1020F|ENSP00000425609:L154F	ENSP00000273739:C1028F|.	C|L	+|+	2|3	0|2	SLIT2|SLIT2	20179708|20179708	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.420000|9.420000	0.97426|0.97426	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	TGC|TTG			0.333	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250396.2			
CCDC149	91050	broad.mit.edu	37	4	24875311	24875311	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr4:24875311T>C	ENST00000389609.4	-	4	399	c.256A>G	c.(256-258)Agg>Ggg	p.R86G	CCDC149_ENST00000504487.1_Missense_Mutation_p.R86G|CCDC149_ENST00000502801.1_Missense_Mutation_p.R86G|CCDC149_ENST00000428116.2_Missense_Mutation_p.R31G	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	31										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				ACCTGTTTCCTTTTTTCAGGA	0.343																																					p.R86G													.	CCDC149	41		0			c.A256G												76.0	80.0	79.0					4																	24875311		2203	4300	6503	SO:0001583	missense	91050	exon4			GTTTCCTTTTTTC		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.256A>G	4.37:g.24875311T>C	ENSP00000374260:p.Arg86Gly		92	0	0		79	0.05	4	NM_173463	4	0.00	0	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Missense_Mutation	SNP	ENST00000389609.4	37	CCDS33967.2	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561491	0.45590	.	.	ENSG00000181982	ENST00000504487;ENST00000428116;ENST00000389609;ENST00000502801;ENST00000382116;ENST00000503881	T	0.22743	1.94	5.4	4.2	0.49525	.	0.144833	0.35646	U	0.003075	T	0.39759	0.1090	L	0.60455	1.87	0.38359	D	0.944567	D;D;D	0.76494	0.984;0.997;0.999	P;D;D	0.80764	0.874;0.994;0.964	T	0.25745	-1.0123	10	0.36615	T	0.2	-4.6108	12.1154	0.53861	0.0:0.0:0.1436:0.8564	.	31;86;86	Q6ZUS6;D6RIA9;G5EA04	CC149_HUMAN;.;.	G	86;31;86;86;10;31	ENSP00000427529:R86G	ENSP00000371550:R10G	R	-	1	2	CCDC149	24484409	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.474000	0.45154	0.965000	0.38133	0.519000	0.50382	AGG			0.343	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000360157.1		NM_173463	
TRIM61	391712	broad.mit.edu	37	4	165890992	165890992	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr4:165890992A>G	ENST00000329314.5	-	3	775	c.163T>C	c.(163-165)Ttt>Ctt	p.F55L		NM_001012414.2	NP_001012414.1	Q5EBN2	TRI61_HUMAN	tripartite motif containing 61	55						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|liver(1)|skin(1)|upper_aerodigestive_tract(1)	5	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)		AAGTGGCAAAAGGGGCAGGGG	0.448																																					p.F55L													.	TRIM61	11		0			c.T163C												104.0	84.0	91.0					4																	165890992		2201	4298	6499	SO:0001583	missense	391712	exon3			GGCAAAAGGGGCA		CCDS34093.1	4q32.3	2013-01-09	2011-01-25			ENSG00000183439		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24339	protein-coding gene	gene with protein product			"""ring finger protein 35"", ""tripartite motif-containing 61"""	RNF35			Standard	NM_001012414		Approved		uc003iqw.3	Q5EBN2		ENST00000329314.5:c.163T>C	4.37:g.165890992A>G	ENSP00000332288:p.Phe55Leu		907	0.0011025358	1		672	0.01	6	NM_001012414	6	0.00	0		Missense_Mutation	SNP	ENST00000329314.5	37	CCDS34093.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460500	0.43736	.	.	ENSG00000183439	ENST00000329314	T	0.14893	2.47	3.09	-4.89	0.03103	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.02727	0.0082	N	0.00377	-1.585	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42616	-0.9441	9	0.16420	T	0.52	.	2.6621	0.05029	0.2276:0.4939:0.1161:0.1623	.	55	Q5EBN2	TRI61_HUMAN	L	55	ENSP00000332288:F55L	ENSP00000332288:F55L	F	-	1	0	TRIM61	166110442	0.000000	0.05858	0.000000	0.03702	0.412000	0.31113	-3.434000	0.00472	-0.434000	0.07275	0.473000	0.43528	TTT			0.448	TRIM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364331.1		XM_373038	
SAP30	8819	broad.mit.edu	37	4	174295154	174295154	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr4:174295154C>A	ENST00000296504.3	+	3	746	c.506C>A	c.(505-507)aCc>aAc	p.T169N		NM_003864.3	NP_003855.1			Sin3A-associated protein, 30kDa											large_intestine(1)|lung(2)|ovary(1)	4		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.15e-17)|Epithelial(43;4.33e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.62e-09)|STAD - Stomach adenocarcinoma(60;0.00278)|GBM - Glioblastoma multiforme(59;0.00659)|LUSC - Lung squamous cell carcinoma(193;0.0919)		AAGCTACCAACCAGACCAGGA	0.318																																					p.T169N													.	SAP30	9		0			c.C506A												108.0	112.0	111.0					4																	174295154		2203	4298	6501	SO:0001583	missense	8819	exon3			TACCAACCAGACC	AF055993	CCDS3817.1	4q34.1	2008-02-05	2006-02-02		ENSG00000164105	ENSG00000164105			10532	protein-coding gene	gene with protein product		603378	"""sin3A-associated protein, 30kDa"""			9651585	Standard	NM_003864		Approved		uc003itd.3	O75446	OTTHUMG00000160798	ENST00000296504.3:c.506C>A	4.37:g.174295154C>A	ENSP00000296504:p.Thr169Asn		391	0	0		349	0.02	6	NM_003864	56	0.00	0		Missense_Mutation	SNP	ENST00000296504.3	37	CCDS3817.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226483	0.58668	.	.	ENSG00000164105	ENST00000296504	.	.	.	4.79	4.79	0.61399	.	0.349373	0.27327	N	0.019878	T	0.77850	0.4192	M	0.82323	2.585	0.58432	D	0.999991	D	0.56746	0.977	P	0.56434	0.798	T	0.82426	-0.0463	9	0.72032	D	0.01	-0.7914	18.1975	0.89828	0.0:1.0:0.0:0.0	.	169	O75446	SAP30_HUMAN	N	169	.	ENSP00000296504:T169N	T	+	2	0	SAP30	174531729	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.321000	0.79088	2.372000	0.80975	0.467000	0.42956	ACC			0.318	SAP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362360.1		NM_003864	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139819758	139819758	+	Silent	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr5:139819758G>A	ENST00000360839.2	+	4	826	c.672G>A	c.(670-672)ttG>ttA	p.L224L	ANKHD1_ENST00000297183.6_Silent_p.L224L|ANKHD1_ENST00000394723.3_Silent_p.L224L|ANKHD1_ENST00000394722.3_Silent_p.L213L|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.L224L	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	224						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGTAAATTGCTAGATGAAG	0.408																																					p.L224L													.	.			0			c.G672A												160.0	157.0	158.0					5																	139819758		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon4			TAAATTGCTAGAT	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.672G>A	5.37:g.139819758G>A			98	0	0		59	0.17	10	NM_024668	38	0.18	7	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1																																																																																					0.408	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000251672.1		NM_017747	
PCDHB13	56123	broad.mit.edu	37	5	140594283	140594283	+	Silent	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr5:140594283G>A	ENST00000341948.4	+	1	775	c.588G>A	c.(586-588)gtG>gtA	p.V196V		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	196	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGAGCTGGTGCTGGACAAAG	0.527																																					p.V196V													.	PCDHB13	142		0			c.G588A												40.0	45.0	43.0					5																	140594283		2202	4280	6482	SO:0001819	synonymous_variant	0	exon1			GCTGGTGCTGGAC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.588G>A	5.37:g.140594283G>A			409	0	0		308	0.04	11	NM_018933	1	0.00	0	A8K9V6	Silent	SNP	ENST00000341948.4	37	CCDS4255.1																																																																																					0.527	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251810.1		NM_018933	
HK3	3101	mdanderson.org	37	5	176308175	176308175	+	Missense_Mutation	SNP	G	G	T	rs200044768		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr5:176308175G>T	ENST00000292432.5	-	19	2762	c.2671C>A	c.(2671-2673)Cgc>Agc	p.R891S		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	891	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCACACAGCGAGGGGCCAGC	0.677																																					p.R891S													HK3_ENST00000292432,NS,carcinoma,+1,3	HK3_ENST00000292432	1	3	0			c.C2671A												50.0	49.0	49.0					5																	176308175		2203	4300	6503	SO:0001583	missense	3101	exon19			CACAGCGAGGGGC		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2671C>A	5.37:g.176308175G>T	ENSP00000292432:p.Arg891Ser		69	0	0		43	0.07	3	NM_002115	133	0.00	0	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	6.129	0.392089	0.11581	.	.	ENSG00000160883	ENST00000292432	D	0.97976	-4.64	5.22	2.51	0.30379	Hexokinase, C-terminal (1);	0.633028	0.14191	N	0.335344	D	0.92371	0.7579	N	0.10782	0.045	0.09310	N	1	B	0.30634	0.288	B	0.39503	0.301	D	0.85721	0.1325	10	0.15499	T	0.54	-3.7085	3.9852	0.09513	0.3268:0.0:0.5184:0.1547	.	891	P52790	HXK3_HUMAN	S	891	ENSP00000292432:R891S	ENSP00000292432:R891S	R	-	1	0	HK3	176240781	0.000000	0.05858	0.228000	0.23943	0.821000	0.46438	0.218000	0.17622	0.367000	0.24454	0.561000	0.74099	CGC			0.677	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253428.1			
BTN2A3P	54718	hgsc.bcm.edu;broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			121	0.0082644628	1		108	0.05	5	.	4	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
BTN2A3P	54718	hgsc.bcm.edu	37	6	26422469	26422469	+	RNA	SNP	T	T	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr6:26422469T>A	ENST00000466808.2	+	0	79							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											TCAGAAAGGATCATCAACCCT	0.498																																					.													.	.			0			.												85.0	69.0	75.0					6																	26422469		2203	4300	6503			54718	.			AAAGGATCATCAA	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422469T>A			58	0	0		60	0.08	5	.	3	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.498	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
EPB41L2	2037	mdanderson.org	37	6	131222222	131222222	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr6:131222222G>T	ENST00000337057.3	-	7	1209	c.1028C>A	c.(1027-1029)gCt>gAt	p.A343D	EPB41L2_ENST00000530481.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000392427.3_Missense_Mutation_p.A343D|EPB41L2_ENST00000368128.2_Missense_Mutation_p.A343D|EPB41L2_ENST00000527659.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000530148.1_5'UTR|EPB41L2_ENST00000445890.2_Missense_Mutation_p.A343D|EPB41L2_ENST00000525193.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000525271.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000529208.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000528282.1_Missense_Mutation_p.A343D|EPB41L2_ENST00000527411.1_Missense_Mutation_p.A343D	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	343	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		ACCAAGTTCAGCCTGCAGGGT	0.542																																					p.A343D													.	.			0			c.C1028A												160.0	148.0	152.0					6																	131222222		2203	4300	6503	SO:0001583	missense	2037	exon7			AGTTCAGCCTGCA	AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1028C>A	6.37:g.131222222G>T	ENSP00000338481:p.Ala343Asp		126	0	0		116	0.04	5	NM_001252660	59	0.00	0	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	G	32	5.181868	0.94885	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	T;T;T;T;T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34	5.33	5.33	0.75918	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.91815	0.7410	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	D	0.93148	0.6547	10	0.87932	D	0	.	19.3931	0.94592	0.0:0.0:1.0:0.0	.	343;343;343;343;343	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	D	343	ENSP00000434308:A343D;ENSP00000434576:A343D;ENSP00000402041:A343D;ENSP00000338481:A343D;ENSP00000376222:A343D;ENSP00000357110:A343D;ENSP00000436348:A343D;ENSP00000432803:A343D;ENSP00000431988:A343D;ENSP00000431647:A343D;ENSP00000436641:A343D	ENSP00000338481:A343D	A	-	2	0	EPB41L2	131263915	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.054000	0.57434	2.669000	0.90835	0.655000	0.94253	GCT			0.542	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042204.3			
HIVEP2	3097	mdanderson.org	37	6	143092507	143092507	+	Silent	SNP	C	C	T	rs372386907	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr6:143092507C>T	ENST00000367604.1	-	4	4008	c.3369G>A	c.(3367-3369)ccG>ccA	p.P1123P	HIVEP2_ENST00000367603.2_Silent_p.P1123P|HIVEP2_ENST00000012134.2_Silent_p.P1123P			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCACAGCAGGCGGGCCATGGT	0.667													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17673	0.0		0.0	False		,,,				2504	0.0				p.P1123P	Esophageal Squamous(107;843 1510 13293 16805 42198)												.	.			0			c.G3369A							C		3,4131		0,3,2064	31.0	37.0	35.0		3369	-6.6	0.0	6		35	2,8410		0,2,4204	no	coding-synonymous	HIVEP2	NM_006734.3		0,5,6268	TT,TC,CC		0.0238,0.0726,0.0399		1123/2447	143092507	5,12541	2067	4206	6273	SO:0001819	synonymous_variant	3097	exon5			AGCAGGCGGGCCA	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3369G>A	6.37:g.143092507C>T			34	0	0		43	0.07	3	NM_006734	2	0.00	0	Q02646|Q5THT5|Q9NS05	Silent	SNP	ENST00000367604.1	37	CCDS43510.1																																																																																					0.667	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042495.1			
NPC1L1	29881	broad.mit.edu	37	7	44575925	44575925	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:44575925G>A	ENST00000289547.4	-	4	1839	c.1784C>T	c.(1783-1785)gCc>gTc	p.A595V	NPC1L1_ENST00000423141.1_Missense_Mutation_p.A595V|NPC1L1_ENST00000546276.1_Missense_Mutation_p.A595V|NPC1L1_ENST00000381160.3_Missense_Mutation_p.A595V	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	595					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CTCTAAGAAGGCCTCCTCCCA	0.612																																					p.A595V													.	NPC1L1	141		0			c.C1784T												75.0	76.0	76.0					7																	44575925		2203	4300	6503	SO:0001583	missense	29881	exon4			AAGAAGGCCTCCT		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1784C>T	7.37:g.44575925G>A	ENSP00000289547:p.Ala595Val		84	0	0		72	0.06	4	NM_001101648	0		0	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	g	7.229	0.598860	0.13939	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.94046	-3.26;-3.26;-3.34;-2.05	4.11	1.05	0.20165	.	0.582024	0.17409	N	0.175248	D	0.87692	0.6241	L	0.41632	1.29	0.09310	N	0.999999	B;P;B;P	0.40578	0.017;0.664;0.007;0.722	B;B;B;B	0.38500	0.03;0.275;0.018;0.261	T	0.77552	-0.2545	10	0.30854	T	0.27	-4.2614	8.5746	0.33590	0.0:0.5968:0.2856:0.1176	.	595;595;595;595	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	V	595	ENSP00000289547:A595V;ENSP00000370552:A595V;ENSP00000438033:A595V;ENSP00000404670:A595V	ENSP00000289547:A595V	A	-	2	0	NPC1L1	44542450	0.712000	0.27916	0.011000	0.14972	0.147000	0.21601	0.470000	0.22084	0.075000	0.16796	0.298000	0.19748	GCC			0.612	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251256.1		NM_013389	
DTX2	113878	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	76112033	76112033	+	Silent	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:76112033C>T	ENST00000324432.5	+	5	987	c.477C>T	c.(475-477)caC>caT	p.H159H	DTX2_ENST00000430490.2_Silent_p.H159H|DTX2_ENST00000413936.2_Silent_p.H159H|DTX2_ENST00000307569.8_Silent_p.H159H|DTX2_ENST00000446820.2_Silent_p.H159H|DTX2_ENST00000446600.1_Silent_p.H68H	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	159	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						ACACCACCCACACGCAGACCA	0.642																																					p.H159H													.	.			0			c.C477T												58.0	47.0	51.0					7																	76112033		2203	4300	6503	SO:0001819	synonymous_variant	113878	exon2			CACCCACACGCAG		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.477C>T	7.37:g.76112033C>T			315	0	0		298	0.18	55	NM_001102596	34	0.09	3	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																					0.642	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000253104.2			
PEX1	5189	mdanderson.org	37	7	92138651	92138651	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:92138651G>T	ENST00000248633.4	-	9	1757	c.1662C>A	c.(1660-1662)agC>agA	p.S554R	PEX1_ENST00000428214.1_Missense_Mutation_p.S554R|PEX1_ENST00000541751.1_Intron|PEX1_ENST00000438045.1_Missense_Mutation_p.S232R	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	554					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ACCCCAAAGAGCTCAGCTTTA	0.328																																					p.S554R													.	.			0			c.C1662A												66.0	67.0	67.0					7																	92138651		2203	4299	6502	SO:0001583	missense	5189	exon9			CAAAGAGCTCAGC	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.1662C>A	7.37:g.92138651G>T	ENSP00000248633:p.Ser554Arg		61	0	0		72	0.06	4	NM_000466	8	0.00	0	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.515548	0.27123	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214;ENST00000545192	D;D;D	0.94931	-3.41;-3.46;-3.56	5.95	4.06	0.47325	.	0.479940	0.26753	N	0.022674	D	0.88596	0.6479	L	0.34521	1.04	0.80722	D	1	B;B;B	0.24426	0.103;0.009;0.004	B;B;B	0.16289	0.015;0.004;0.006	D	0.83986	0.0335	10	0.33940	T	0.23	-9.7904	7.767	0.28986	0.2728:0.0:0.7272:0.0	.	232;346;554	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	R	232;554;554;554	ENSP00000410438:S232R;ENSP00000248633:S554R;ENSP00000394413:S554R	ENSP00000248633:S554R	S	-	3	2	PEX1	91976587	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	0.594000	0.24014	1.438000	0.47492	0.491000	0.48974	AGC			0.328	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254066.3		NM_000466	
GRM8	2918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	126249528	126249528	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:126249528A>G	ENST00000339582.2	-	8	2190	c.1382T>C	c.(1381-1383)tTt>tCt	p.F461S	GRM8_ENST00000405249.1_Silent_p.L485L|GRM8_ENST00000444921.2_Missense_Mutation_p.F461S|GRM8_ENST00000480995.1_Intron|GRM8_ENST00000358373.3_Missense_Mutation_p.F461S			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	461					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTTTTCATTAAAAGTGACAGG	0.378										HNSCC(24;0.065)																											p.F461S													.	.			0			c.T1382C												116.0	100.0	106.0					7																	126249528		2203	4300	6503	SO:0001583	missense	2918	exon7			TCATTAAAAGTGA		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1382T>C	7.37:g.126249528A>G	ENSP00000344173:p.Phe461Ser		98	0	0		95	0.13	12	NM_000845	0		0	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.809079	0.90707	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.91068	-2.78;-2.78;-2.78	5.45	5.45	0.79879	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.96827	0.8964	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.97110	0.852;1.0	D	0.98029	1.0375	10	0.87932	D	0	.	14.7111	0.69232	1.0:0.0:0.0:0.0	.	461;461	O00222-2;O00222	.;GRM8_HUMAN	S	461	ENSP00000344173:F461S;ENSP00000409790:F461S;ENSP00000351142:F461S	ENSP00000344173:F461S	F	-	2	0	GRM8	126036764	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.307000	0.96226	2.051000	0.60960	0.460000	0.39030	TTT			0.378	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000059209.4			
KIAA1549	57670	bcgsc.ca;mdanderson.org	37	7	138593755	138593755	+	Silent	SNP	C	C	T	rs551289013	byFrequency	TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:138593755C>T	ENST00000422774.1	-	5	3306	c.3258G>A	c.(3256-3258)acG>acA	p.T1086T	KIAA1549_ENST00000242365.4_Silent_p.T1036T|KIAA1549_ENST00000440172.1_Silent_p.T1086T			Q9HCM3	K1549_HUMAN	KIAA1549	1086						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TGAGGTTATACGTTCCCTGGT	0.473			O	BRAF	pilocytic astrocytoma																																p.T1086T	NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314		0			c.G3258A												103.0	101.0	101.0					7																	138593755		1932	4146	6078	SO:0001819	synonymous_variant	57670	exon5			GTTATACGTTCCC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3258G>A	7.37:g.138593755C>T			103	0	0		90	0.06	5	NM_020910	7	0.00	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																					0.473	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000348092.1			
HTR5A	3361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	154876031	154876031	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr7:154876031T>C	ENST00000287907.2	+	2	1484	c.908T>C	c.(907-909)cTc>cCc	p.L303P	HTR5A_ENST00000486819.1_3'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	303					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CCCTTCTTTCTCACCGAGCTC	0.597																																					p.L303P													.	.			0			c.T908C												235.0	193.0	207.0					7																	154876031		2203	4300	6503	SO:0001583	missense	3361	exon2			TCTTTCTCACCGA		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.908T>C	7.37:g.154876031T>C	ENSP00000287907:p.Leu303Pro		207	0	0		157	0.17	27	NM_024012	0		0	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.941077	0.73557	.	.	ENSG00000157219	ENST00000287907	T	0.74002	-0.8	4.93	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.312451	0.33591	N	0.004749	D	0.83308	0.5226	M	0.92833	3.35	0.58432	D	0.999999	P	0.37441	0.595	P	0.47941	0.562	D	0.83377	0.0010	10	0.87932	D	0	.	7.6383	0.28280	0.0:0.1079:0.0:0.8921	.	303	P47898	5HT5A_HUMAN	P	303	ENSP00000287907:L303P	ENSP00000287907:L303P	L	+	2	0	HTR5A	154506964	1.000000	0.71417	0.803000	0.32268	0.868000	0.49771	3.983000	0.56916	0.822000	0.34565	0.533000	0.62120	CTC			0.597	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322240.1		NM_024012	
CSMD1	64478	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	2944635	2944635	+	Silent	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr8:2944635G>A	ENST00000520002.1	-	50	8016	c.7461C>T	c.(7459-7461)ctC>ctT	p.L2487L	CSMD1_ENST00000537824.1_Silent_p.L2486L|CSMD1_ENST00000602723.1_Silent_p.L2487L|CSMD1_ENST00000400186.3_Silent_p.L2487L|CSMD1_ENST00000542608.1_Silent_p.L2486L|CSMD1_ENST00000602557.1_Silent_p.L2487L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2487	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGAGTGGCGTGAGGGAGTCCC	0.468																																					p.L2486L													.	CSMD1	1469		0			c.C7458T												90.0	92.0	91.0					8																	2944635		2033	4184	6217	SO:0001819	synonymous_variant	64478	exon49			TGGCGTGAGGGAG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7461C>T	8.37:g.2944635G>A			104	0	0		87	0.06	5	NM_033225	0		0	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	0.033	-1.320203	0.01320	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.81	-6.02	0.02192	.	.	.	.	.	T	0.29850	0.0746	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33803	-0.9854	4	.	.	.	.	9.6229	0.39732	0.5717:0.2967:0.1316:0.0	.	.	.	.	Y	1904	.	.	H	-	1	0	CSMD1	2932042	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.804000	0.04535	-1.515000	0.01784	0.561000	0.74099	CAC			0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000374500.2		NM_033225	
CYP7A1	1581	broad.mit.edu	37	8	59409377	59409377	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr8:59409377G>A	ENST00000301645.3	-	3	831	c.694C>T	c.(694-696)Cac>Tac	p.H232Y		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	232					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CGGGCATTGTGCGCAGTCCTG	0.488									Neonatal Giant Cell Hepatitis																												p.H232Y													.	CYP7A1	76		0			c.C694T												158.0	158.0	158.0					8																	59409377		2203	4300	6503	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	CATTGTGCGCAGT	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.694C>T	8.37:g.59409377G>A	ENSP00000301645:p.His232Tyr		157	0	0		143	0.03	4	NM_000780	0		0	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	37	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	3.367	-0.129149	0.06753	.	.	ENSG00000167910	ENST00000301645	T	0.69040	-0.37	5.74	3.94	0.45596	.	0.099897	0.64402	D	0.000001	T	0.41766	0.1173	N	0.16130	0.375	0.42311	D	0.992215	B	0.12013	0.005	B	0.09377	0.004	T	0.31110	-0.9955	10	0.05721	T	0.95	-18.1068	9.4597	0.38776	0.2125:0.0:0.7875:0.0	.	232	P22680	CP7A1_HUMAN	Y	232	ENSP00000301645:H232Y	ENSP00000301645:H232Y	H	-	1	0	CYP7A1	59571931	0.637000	0.27216	0.033000	0.17914	0.003000	0.03518	2.216000	0.42871	1.576000	0.49790	0.563000	0.77884	CAC			0.488	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378190.1		NM_000780	
KRT8P11	347265	bcgsc.ca;mdanderson.org	37	9	102068358	102068358	+	IGR	SNP	A	A	G			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr9:102068358A>G								RN7SKP225 (21703 upstream) : NAMA (49333 downstream)																							ACAAAGACTGAGATCTCCGAG	0.602																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	347265	.			AGACTGAGATCTC																													9.37:g.102068358A>G			65	0	0		54	0.11	6	.	4	0.00	0		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	A	14.50	2.552489	0.45487	.	.	ENSG00000222039	ENST00000409686	D	0.93133	-3.17	0.694	0.694	0.18062	.	.	.	.	.	D	0.92912	0.7745	.	.	.	0.53688	D	0.999975	.	.	.	.	.	.	D	0.90458	0.4444	6	0.87932	D	0	.	5.6466	0.17592	1.0:0.0:0.0:0.0	.	.	.	.	G	322	ENSP00000404011:E322G	ENSP00000404011:E322G	E	+	2	0	KRT8P11	101108179	1.000000	0.71417	0.214000	0.23707	0.045000	0.14185	3.185000	0.50934	0.563000	0.29222	0.254000	0.18369	GAG		0	0.602										
PRRC2B	84726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134343013	134343013	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr9:134343013C>A	ENST00000357304.4	+	12	1839	c.1784C>A	c.(1783-1785)tCc>tAc	p.S595Y	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.S595Y|PRRC2B_ENST00000405995.1_Missense_Mutation_p.S595Y	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	595							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CCCACAGTGTCCCCAGCAGTG	0.567																																					p.S595Y													.	.			0			c.C1784A												42.0	47.0	45.0					9																	134343013		1969	4163	6132	SO:0001583	missense	84726	exon12			CAGTGTCCCCAGC	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1784C>A	9.37:g.134343013C>A	ENSP00000349856:p.Ser595Tyr		75	0	0		63	0.16	10	NM_013318	27	0.04	1	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396945	0.62177	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550;ENST00000422467	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	5.76	5.76	0.90799	.	0.260034	0.19874	U	0.104136	T	0.11965	0.0291	N	0.22421	0.69	0.80722	D	1	P	0.39624	0.681	B	0.40782	0.34	T	0.04946	-1.0916	10	0.59425	D	0.04	-8.3578	18.8872	0.92383	0.0:1.0:0.0:0.0	.	595	Q5JSZ5	PRC2B_HUMAN	Y	595;595;595;135	ENSP00000384606:S595Y;ENSP00000349856:S595Y;ENSP00000398853:S595Y;ENSP00000391063:S135Y	ENSP00000349856:S595Y	S	+	2	0	PRRC2B	133332834	0.248000	0.23930	0.050000	0.19076	0.004000	0.04260	3.983000	0.56916	2.882000	0.98803	0.655000	0.94253	TCC			0.567	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
SNAPC4	6621	mdanderson.org	37	9	139272498	139272498	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr9:139272498G>T	ENST00000298532.2	-	21	4149	c.3781C>A	c.(3781-3783)Cag>Aag	p.Q1261K		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GGCCCAGGCTGGGGTAGGGGC	0.741																																					p.Q1261K													.	.			0			c.C3781A												4.0	5.0	4.0					9																	139272498		1715	3514	5229	SO:0001583	missense	6621	exon21			CAGGCTGGGGTAG	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3781C>A	9.37:g.139272498G>T	ENSP00000298532:p.Gln1261Lys		53	0	0		38	0.08	3	NM_003086	17	0.00	0		Missense_Mutation	SNP	ENST00000298532.2	37	CCDS6998.1	.	.	.	.	.	.	.	.	.	.	g	0.088	-1.171865	0.01646	.	.	ENSG00000165684	ENST00000298532	T	0.21734	1.99	3.42	-1.61	0.08399	.	3.491040	0.00604	N	0.000395	T	0.14874	0.0359	L	0.43152	1.355	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.11665	-1.0578	10	0.08381	T	0.77	-1.4729	2.9495	0.05856	0.1025:0.1176:0.3895:0.3903	.	1261	Q5SXM2	SNPC4_HUMAN	K	1261	ENSP00000298532:Q1261K	ENSP00000298532:Q1261K	Q	-	1	0	SNAPC4	138392319	0.659000	0.27411	0.001000	0.08648	0.111000	0.19643	1.268000	0.33062	0.000000	0.14550	0.556000	0.70494	CAG			0.741	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055071.1		NM_003086	
PORCN	64840	hgsc.bcm.edu	37	X	48374126	48374126	+	Missense_Mutation	SNP	G	G	T	rs373433770		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chrX:48374126G>T	ENST00000326194.6	+	10	1011	c.968G>T	c.(967-969)cGc>cTc	p.R323L	PORCN_ENST00000361988.3_Missense_Mutation_p.R312L|PORCN_ENST00000367574.4_Missense_Mutation_p.R241L|PORCN_ENST00000359882.4_Missense_Mutation_p.R317L|PORCN_ENST00000537758.1_Missense_Mutation_p.R323L|PORCN_ENST00000355961.4_Missense_Mutation_p.R318L|PORCN_ENST00000355092.3_Missense_Mutation_p.R317L	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	323					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AATGCTCTCCGCCTGGGGACC	0.592																																					p.R323L													.	.			0			c.G968T												55.0	52.0	53.0					X																	48374126		2203	4300	6503	SO:0001583	missense	64840	exon10			CTCTCCGCCTGGG	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.968G>T	X.37:g.48374126G>T	ENSP00000322304:p.Arg323Leu		143	0	0		140	0.04	6	NM_203475	21	0.00	0	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	ENST00000326194.6	37	CCDS14299.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142037	0.37825	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	4.94	3.12	0.35913	.	0.214221	0.45606	D	0.000359	T	0.66548	0.2800	L	0.59436	1.845	0.37300	D	0.908663	B;B;B;B;B	0.28055	0.199;0.1;0.058;0.06;0.199	B;B;B;B;B	0.36719	0.052;0.231;0.049;0.033;0.085	T	0.64411	-0.6414	10	0.49607	T	0.09	-7.7233	6.6305	0.22853	0.3222:0.0:0.6778:0.0	.	317;323;241;312;318	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	L	317;323;241;318;312;323;317	ENSP00000352946:R317L;ENSP00000446401:R323L;ENSP00000356546:R241L;ENSP00000348233:R318L;ENSP00000354978:R312L;ENSP00000322304:R323L;ENSP00000347207:R317L	ENSP00000322304:R323L	R	+	2	0	PORCN	48259070	0.594000	0.26849	1.000000	0.80357	0.944000	0.59088	0.656000	0.24948	0.406000	0.25560	0.529000	0.55759	CGC			0.592	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000356990.1		NM_022825	
POF1B	79983	mdanderson.org	37	X	84634406	84634406	+	Silent	SNP	C	C	T			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chrX:84634406C>T	ENST00000262753.4	-	2	199	c.54G>A	c.(52-54)caG>caA	p.Q18Q	POF1B_ENST00000373145.3_Silent_p.Q18Q	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	18						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						CCTCTGGGAGCTGCTGGGTTC	0.552																																					p.Q18Q													.	.			0			c.G54A												49.0	42.0	44.0					X																	84634406		2203	4300	6503	SO:0001819	synonymous_variant	79983	exon2			TGGGAGCTGCTGG	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.54G>A	X.37:g.84634406C>T			63	0	0		53	0.06	3	NM_024921	1	0.00	0	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Silent	SNP	ENST00000262753.4	37	CCDS14452.1																																																																																					0.552	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000057391.2		NM_024921	
CTBP2P1	352905	bcgsc.ca	37	Y	59001500	59001500	+	IGR	SNP	C	C	A	rs141869091		TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chrY:59001500C>A								None (None upstream) : SPRY3 (98979 downstream)																							GGACTTCCTGCGTCCATGGAA	0.542																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	352905	.			TTCCTGCGTCCAT																													Y.37:g.59001500C>A			35	0	0		25	0.16	4	.	0		0		RNA	SNP		37																																																																																					0	0.542										
BAHCC1	57597	mdanderson.org	37	17	79414838	79414838	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOB-01A-11D-A435-10	TCGA-XE-AAOB-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	ee51c341-2389-4d94-bcec-3032c60427d6	9cbd9079-ffd1-4fcd-a8bb-c0e2c4d1a594	g.chr17:79414838G>A	ENST00000307745.7	+	15	3940	c.3940G>A	c.(3940-3942)Gca>Aca	p.A1314T																								GGCTGACCTGGCAATCCAGCG	0.677																																					.													.	.			0			.												12.0	13.0	12.0					17																	79414838		1967	4135	6102	SO:0001583	missense	57597	.			GACCTGGCAATCC																												ENST00000307745.7:c.3940G>A	17.37:g.79414838G>A	ENSP00000303486:p.Ala1314Thr		53	0	0		50	0.08	4	.	5	0.00	0		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	g	15.27	2.783491	0.49891	.	.	ENSG00000171282	ENST00000307745	T	0.24538	1.85	4.07	4.07	0.47477	.	0.471941	0.16627	N	0.206204	T	0.22205	0.0535	L	0.29908	0.895	0.28602	N	0.909122	B;B	0.29037	0.089;0.231	B;B	0.29942	0.05;0.109	T	0.18147	-1.0346	10	0.59425	D	0.04	.	15.1818	0.72965	0.0:0.0:1.0:0.0	.	1314;1314	Q9P281;F8WBW8	BAHC1_HUMAN;.	T	1314	ENSP00000303486:A1314T	ENSP00000303486:A1314T	A	+	1	0	AC110285.1	77029433	1.000000	0.71417	0.966000	0.40874	0.083000	0.17756	8.259000	0.89855	2.079000	0.62486	0.457000	0.33378	GCA			0.677	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					
