#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	broad.mit.edu	37	1	17185383	17185384	+	lincRNA	INS	-	-	C	rs112074527		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:17185383_17185384insC	ENST00000414128.1	+	0	646				MIR3675_ENST00000583661.1_RNA																							ACTAAATTTTTAGTGCAATAAT	0.465																																					.													.	.			0			.																																											0	.			AATTTTTAGTGCA																													1.37:g.17185383_17185384insC			11	0.0909090909	1		8	0.38	3	.	0		0		RNA	INS	ENST00000414128.1	37																																																																																						0.465	RP11-108M9.2-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA		OTTHUMT00000006253.1			
PTGFRN	5738	mdanderson.org	37	1	117487540	117487540	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:117487540G>A	ENST00000393203.2	+	3	805	c.658G>A	c.(658-660)Gtg>Atg	p.V220M		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	220	Ig-like C2-type 2.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CAGTGGGGACGTGCGCCTCGA	0.706																																					p.V220M													.	.			0			c.G658A												32.0	30.0	30.0					1																	117487540		2203	4299	6502	SO:0001583	missense	5738	exon3			GGGGACGTGCGCC	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.658G>A	1.37:g.117487540G>A	ENSP00000376899:p.Val220Met		26	0	0		43	0.07	3	NM_020440	10	0.00	0	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427843	0.62733	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.02763	4.17	5.47	4.47	0.54385	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.177832	0.49305	D	0.000146	T	0.02767	0.0083	L	0.59436	1.845	0.31632	N	0.648862	P	0.45396	0.857	P	0.44422	0.449	T	0.15350	-1.0440	10	0.66056	D	0.02	-23.2349	14.5503	0.68061	0.0:0.0:0.8436:0.1564	.	220	Q9P2B2	FPRP_HUMAN	M	220;79	ENSP00000376899:V220M	ENSP00000376899:V220M	V	+	1	0	PTGFRN	117289063	0.545000	0.26449	0.999000	0.59377	0.942000	0.58702	0.657000	0.24963	2.573000	0.86826	0.561000	0.74099	GTG			0.706	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033271.1		NM_020440	
TTF2	8458	broad.mit.edu;bcgsc.ca	37	1	117644003	117644006	+	Splice_Site	DEL	TTTG	TTTG	-			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	TTTG	TTTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:117644003_117644006delTTTG	ENST00000369466.4	+	23	3390_3393	c.3346_3349delTTTG	c.(3346-3351)tttgtt>tt	p.FV1116fs	TTF2_ENST00000480701.1_3'UTR	NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	1116	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GTTTTTTAGATTTGTTTGTGAGGG	0.309																																					p.1116_1117del													.	TTF2	92		0			c.3346_3349del																																									SO:0001630	splice_region_variant	8458	exon23			TTTAGATTTGTTT	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.3345-1TTTG>-	1.37:g.117644007_117644010delTTTG			42	0	0		47	0.21	10	NM_003594	28	0.00	0	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Splice_Site	DEL	ENST00000369466.4	37	CCDS892.1																																																																																					0.309	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033277.3			Frame_Shift_Del
TUFT1	7286	broad.mit.edu	37	1	151546805	151546805	+	Silent	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:151546805G>A	ENST00000368849.3	+	8	716	c.654G>A	c.(652-654)gaG>gaA	p.E218E	TUFT1_ENST00000392712.3_Silent_p.E163E|TUFT1_ENST00000368848.2_Silent_p.E193E|TUFT1_ENST00000353024.3_Silent_p.E159E|TUFT1_ENST00000538902.1_Silent_p.E237E	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	218					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCAGAGAGAGGAGGACAGAG	0.527											OREG0003906	type=REGULATORY REGION|Gene=TUFT1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.E218E													.	TUFT1	32		0			c.G654A												111.0	102.0	105.0					1																	151546805		2203	4300	6503	SO:0001819	synonymous_variant	7286	exon8			GAGAGAGGAGGAC	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.654G>A	1.37:g.151546805G>A			238	0	0	1741	313	0.02	7	NM_020127	29	0.00	0	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Silent	SNP	ENST00000368849.3	37	CCDS1000.1																																																																																					0.527	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000035022.1		NM_020127	
KDM5B	10765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	202710494	202710494	+	Splice_Site	SNP	C	C	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:202710494C>A	ENST00000367265.3	-	19	4110		c.e19+1		KDM5B_ENST00000367264.2_Splice_Site	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B						histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						TGCTTTTTCACCTGGCCTTGA	0.512																																					.													.	.			0			c.2945+1G>T												33.0	35.0	34.0					1																	202710494		2199	4299	6498	SO:0001630	splice_region_variant	10765	exon20			TTTTCACCTGGCC	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2945+1G>T	1.37:g.202710494C>A			44	0	0		75	0.23	17	NM_006618	1	0.00	0	O95811|Q15752|Q9Y3Q5	Splice_Site	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864479	0.91511	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KDM5B	200977117	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	7.814000	0.86154	2.826000	0.97356	0.563000	0.77884	.			0.512	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000099184.2		NM_006618	Intron
EIF2D	1939	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	206781611	206781612	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:206781611_206781612delCA	ENST00000271764.2	-	4	607_608	c.399_400delTG	c.(397-402)tgtgccfs	p.A134fs	EIF2D_ENST00000367114.3_Frame_Shift_Del_p.A134fs	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	134	PUA. {ECO:0000255|PROSITE- ProRule:PRU00161}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						AAAGAAATGGCACAGAGGTCGC	0.48											OREG0014175	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.134_134del													.	EIF2D	42		0			c.400_401del																																									SO:0001589	frameshift_variant	1939	exon4			AAATGGCACAGAG	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.399_400delTG	1.37:g.206781613_206781614delCA	ENSP00000271764:p.Ala134fs		595	0	0	2162	819	0.22	184	NM_006893	51	0.00	0	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Frame_Shift_Del	DEL	ENST00000271764.2	37	CCDS1465.1																																																																																					0.480	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088475.1		NM_006893	
CDC42BPA	8476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	227335123	227335123	+	Silent	SNP	G	G	A	rs139987030	byFrequency	TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr1:227335123G>A	ENST00000366769.3	-	7	2122	c.831C>T	c.(829-831)taC>taT	p.Y277Y	CDC42BPA_ENST00000366765.3_Silent_p.Y277Y|CDC42BPA_ENST00000366766.2_Silent_p.Y277Y|CDC42BPA_ENST00000366767.3_Silent_p.Y277Y|CDC42BPA_ENST00000366764.2_Silent_p.Y277Y|CDC42BPA_ENST00000535525.1_Silent_p.Y277Y|CDC42BPA_ENST00000334218.5_Silent_p.Y277Y	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GTGTTTCTCCGTAAAGCATTT	0.398																																					p.Y277Y													.	.			0			c.C831T							G	,	2,4404	4.2+/-10.8	0,2,2201	126.0	115.0	119.0		831,831	1.8	1.0	1	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CDC42BPA	NM_003607.3,NM_014826.4	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	277/1720,277/1639	227335123	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8476	exon7			TTCTCCGTAAAGC	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.831C>T	1.37:g.227335123G>A			132	0	0		270	0.26	70	NM_003607	21	0.14	3		Silent	SNP	ENST00000366769.3	37	CCDS1558.1																																																																																			0		0.398	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091696.1		NM_014826	
GPR158	57512	mdanderson.org	37	10	25883231	25883231	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr10:25883231G>T	ENST00000376351.3	+	9	2262	c.1903G>T	c.(1903-1905)Gcc>Tcc	p.A635S	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	635					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ATTTGTTCTTGCCTCAAGACT	0.358																																					p.A635S													.	.			0			c.G1903T												175.0	158.0	164.0					10																	25883231		2203	4300	6503	SO:0001583	missense	57512	exon9			GTTCTTGCCTCAA	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1903G>T	10.37:g.25883231G>T	ENSP00000365529:p.Ala635Ser		51	0.0196078431	1		48	0.06	3	NM_020752	0		0	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.776226	0.49786	.	.	ENSG00000151025	ENST00000376351	D	0.87334	-2.24	5.62	5.62	0.85841	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.86736	0.6004	L	0.51422	1.61	0.40549	D	0.981101	B	0.24092	0.097	B	0.38327	0.271	T	0.82118	-0.0615	10	0.21014	T	0.42	.	15.9703	0.80008	0.0:0.0:0.8648:0.1352	.	635	Q5T848	GP158_HUMAN	S	635	ENSP00000365529:A635S	ENSP00000365529:A635S	A	+	1	0	GPR158	25923237	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	5.752000	0.68728	2.628000	0.89032	0.650000	0.86243	GCC			0.358	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047248.2		XM_166110	
TNKS2	80351	mdanderson.org	37	10	93617191	93617191	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr10:93617191G>T	ENST00000371627.4	+	24	3377	c.2998G>T	c.(2998-3000)Gtt>Ttt	p.V1000F		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	1000	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GATTCAGAAGGTTTGTAACAA	0.333																																					p.V1000F													.	.			0			c.G2998T												74.0	77.0	76.0					10																	93617191		2202	4300	6502	SO:0001583	missense	80351	exon24			CAGAAGGTTTGTA	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2998G>T	10.37:g.93617191G>T	ENSP00000360689:p.Val1000Phe		79	0	0		51	0.06	3	NM_025235	44	0.00	0	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021352	0.93462	.	.	ENSG00000107854	ENST00000371627	T	0.21191	2.02	5.38	5.38	0.77491	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.48286	D	0.000188	T	0.59142	0.2172	M	0.93638	3.44	0.80722	D	1	D	0.71674	0.998	D	0.70716	0.97	T	0.70506	-0.4853	10	0.87932	D	0	.	19.4945	0.95067	0.0:0.0:1.0:0.0	.	1000	Q9H2K2	TNKS2_HUMAN	F	1000	ENSP00000360689:V1000F	ENSP00000360689:V1000F	V	+	1	0	TNKS2	93607171	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.694000	0.91930	0.557000	0.71058	GTT			0.333	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049374.1		NM_025235	
B4GALNT4	338707	mdanderson.org	37	11	375478	375478	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:375478C>T	ENST00000329962.6	+	9	801	c.801C>T	c.(799-801)ccC>ccT	p.P267P		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	267					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.P267P(1)		endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTTCCTGCCCGGCCTGAAGT	0.672																																					p.P267P													B4GALNT4,NS,carcinoma,0,1	B4GALNT4	0	1	1	Substitution - coding silent(1)	kidney(1)	c.C801T												94.0	99.0	97.0					11																	375478		2203	4296	6499	SO:0001819	synonymous_variant	338707	exon9			CCTGCCCGGCCTG	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.801C>T	11.37:g.375478C>T			49	0	0		43	0.07	3	NM_178537	203	0.00	1	Q96LV2	Silent	SNP	ENST00000329962.6	37	CCDS7694.1																																																																																					0.672	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239289.2		NM_178537	
MUC2	4583	mdanderson.org	37	11	1092920	1092920	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:1092920C>A	ENST00000441003.2	+	30	4766	c.4739C>A	c.(4738-4740)aCc>aAc	p.T1580N	MUC2_ENST00000359061.5_Missense_Mutation_p.T1581N|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ggcacacagaccccaacatcg	0.632																																					p.T1580N													.	.			0			c.C4739A												74.0	113.0	100.0					11																	1092920		1924	3573	5497	SO:0001583	missense	4583	exon30			CACAGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4739C>A	11.37:g.1092920C>A	ENSP00000415183:p.Thr1580Asn		40	0.025	1		22	0.14	3	NM_002457	39	0.05	2	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228278	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.38;2.53	1.75	-3.51	0.04696	.	7739.210000	0.00597	U	0.000365	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.28026	0.198	B	0.17098	0.017	T	0.10776	-1.0615	9	0.27082	T	0.32	.	2.0197	0.03506	0.1703:0.3607:0.3305:0.1386	.	1580	E7EUV1	.	N	1580;1581	ENSP00000415183:T1580N;ENSP00000351956:T1581N	ENSP00000351956:T1581N	T	+	2	0	MUC2	1082920	0.001000	0.12720	0.000000	0.03702	0.071000	0.16799	1.304000	0.33482	-1.223000	0.02584	0.121000	0.15741	ACC			0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
TTC17	55761	mdanderson.org	37	11	43469622	43469622	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:43469622G>T	ENST00000039989.4	+	19	2750	c.2736G>T	c.(2734-2736)gaG>gaT	p.E912D		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	912					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GCTGGGTAGAGCTGACTGCCA	0.488																																					p.E912D													.	.			0			c.G2736T												90.0	77.0	81.0					11																	43469622		2203	4300	6503	SO:0001583	missense	55761	exon19			GGTAGAGCTGACT	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2736G>T	11.37:g.43469622G>T	ENSP00000039989:p.Glu912Asp		62	0	0		45	0.07	3	NM_018259	74	0.00	0	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757662	0.31137	.	.	ENSG00000052841	ENST00000039989	T	0.31247	1.5	5.91	4.82	0.62117	.	0.050116	0.85682	D	0.000000	T	0.18718	0.0449	N	0.12746	0.255	0.36679	D	0.878923	B	0.06786	0.001	B	0.04013	0.001	T	0.10086	-1.0645	10	0.21540	T	0.41	-20.6752	15.9715	0.80025	0.0747:0.0:0.9253:0.0	.	912	Q96AE7	TTC17_HUMAN	D	912	ENSP00000039989:E912D	ENSP00000039989:E912D	E	+	3	2	TTC17	43426198	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.909000	0.48758	2.804000	0.96469	0.650000	0.86243	GAG			0.488	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389577.2		NM_018259	
LRP4	4038	mdanderson.org	37	11	46918500	46918500	+	Missense_Mutation	SNP	C	C	T	rs146670859		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:46918500C>T	ENST00000378623.1	-	8	1084	c.842G>A	c.(841-843)cGc>cAc	p.R281H		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	281	LDL-receptor class A 7. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GCGGACACAGCGGCCTGAGTG	0.572																																					p.R281H													.	.			0			c.G842A							C	HIS/ARG	0,4402		0,0,2201	132.0	115.0	121.0		842	5.8	1.0	11	dbSNP_134	121	1,8597	1.2+/-3.3	0,1,4298	no	missense	LRP4	NM_002334.3	29	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	281/1906	46918500	1,12999	2201	4299	6500	SO:0001583	missense	4038	exon8			ACACAGCGGCCTG	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.842G>A	11.37:g.46918500C>T	ENSP00000367888:p.Arg281His		60	0	0		39	0.08	3	NM_002334	4	0.00	0	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	32	5.120577	0.94385	0.0	1.16E-4	ENSG00000134569	ENST00000378623	T	0.42131	0.98	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	L	0.38692	1.165	0.80722	D	1	D	0.58268	0.982	P	0.49387	0.609	T	0.41448	-0.9508	10	0.59425	D	0.04	.	20.0313	0.97540	0.0:1.0:0.0:0.0	.	281	O75096	LRP4_HUMAN	H	281	ENSP00000367888:R281H	ENSP00000367888:R281H	R	-	2	0	LRP4	46875076	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	7.818000	0.86416	2.746000	0.94184	0.655000	0.94253	CGC	0		0.572	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391133.1		NM_002334	
TCIRG1	10312	mdanderson.org	37	11	67817183	67817183	+	Silent	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:67817183G>A	ENST00000265686.3	+	16	2049	c.1941G>A	c.(1939-1941)ctG>ctA	p.L647L	RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000532635.1_Silent_p.L431L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	647					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						TGCCCATCCTGCTGCTTGGCA	0.716																																					p.L647L													.	.			0			c.G1941A												20.0	18.0	18.0					11																	67817183		2192	4288	6480	SO:0001819	synonymous_variant	10312	exon16			CATCCTGCTGCTT	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.1941G>A	11.37:g.67817183G>A			28	0	0		14	0.14	2	NM_006019	103	0.00	0	O75877|Q8WVC5	Silent	SNP	ENST00000265686.3	37	CCDS8177.1																																																																																					0.716	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394305.1		NM_006019	
AQP11	282679	mdanderson.org	37	11	77320415	77320415	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr11:77320415A>G	ENST00000313578.3	+	3	1167	c.809A>G	c.(808-810)aAg>aGg	p.K270R	AQP11_ENST00000528638.1_3'UTR|CLNS1A_ENST00000533957.1_5'Flank	NM_173039.2	NP_766627.1	Q8NBQ7	AQP11_HUMAN	aquaporin 11	270					endosomal lumen acidification (GO:0048388)|protein homooligomerization (GO:0051260)|proximal tubule development (GO:0072014)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			kidney(2)|large_intestine(1)|lung(5)	8	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			ATTAATAAAAAGGAATAACTG	0.353																																					p.K270R													.	.			0			c.A809G												101.0	97.0	98.0					11																	77320415		2199	4292	6491	SO:0001583	missense	282679	exon3			ATAAAAAGGAATA	AB028147	CCDS8251.1	11q13.5	2008-02-05			ENSG00000178301	ENSG00000178301		"""Ion channels / Aquaporins"""	19940	protein-coding gene	gene with protein product		609914				16107722	Standard	NM_173039		Approved		uc001oyj.3	Q8NBQ7	OTTHUMG00000165194	ENST00000313578.3:c.809A>G	11.37:g.77320415A>G	ENSP00000318770:p.Lys270Arg		54	0	0		38	0.08	3	NM_173039	19	0.00	0		Missense_Mutation	SNP	ENST00000313578.3	37	CCDS8251.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.043213	0.36085	.	.	ENSG00000178301	ENST00000313578	T	0.47528	0.84	5.09	1.53	0.23141	Aquaporin-like (1);	0.769687	0.12378	N	0.474171	T	0.24431	0.0592	N	0.08118	0	0.24027	N	0.996121	B	0.02656	0.0	B	0.06405	0.002	T	0.17745	-1.0359	10	0.33141	T	0.24	.	6.6853	0.23142	0.7265:0.0:0.2735:0.0	.	270	Q8NBQ7	AQP11_HUMAN	R	270	ENSP00000318770:K270R	ENSP00000318770:K270R	K	+	2	0	AQP11	76998063	1.000000	0.71417	0.938000	0.37757	0.963000	0.63663	0.649000	0.24843	0.103000	0.17682	0.477000	0.44152	AAG			0.353	AQP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382582.1		NM_173039	
KDM5A	5927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	432911	432911	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr12:432911C>T	ENST00000399788.2	-	15	2367	c.2005G>A	c.(2005-2007)Gtt>Att	p.V669I	KDM5A_ENST00000382815.4_Missense_Mutation_p.V669I	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	669					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TCATCAGGAACAAGTTCAAAC	0.398			T	NUP98	AML																																p.V669I				Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	.			0			c.G2005A												127.0	126.0	126.0					12																	432911		1934	4156	6090	SO:0001583	missense	5927	exon15			CAGGAACAAGTTC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2005G>A	12.37:g.432911C>T	ENSP00000382688:p.Val669Ile		177	0	0		316	0.20	62	NM_001042603	43	0.09	4	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157848	0.57368	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	D;D;D	0.84944	-1.92;-1.73;-1.53	6.03	6.03	0.97812	.	0.130106	0.52532	D	0.000068	T	0.75925	0.3916	N	0.04508	-0.205	0.45194	D	0.998204	B;B;B;P	0.35700	0.243;0.018;0.012;0.516	B;B;B;B	0.38755	0.097;0.022;0.004;0.281	T	0.76844	-0.2809	10	0.45353	T	0.12	-19.2821	20.5568	0.99304	0.0:1.0:0.0:0.0	.	288;669;669;669	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	I	288;628;669;669;288	ENSP00000382688:V669I;ENSP00000372265:V669I;ENSP00000440622:V288I	ENSP00000261253:V288I	V	-	1	0	KDM5A	303172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.438000	0.44837	2.861000	0.98227	0.655000	0.94253	GTT			0.398	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397812.1		NM_005056	
AEBP2	121536	mdanderson.org	37	12	19593200	19593200	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr12:19593200C>T	ENST00000398864.3	+	1	593	c.567C>T	c.(565-567)taC>taT	p.Y189Y	AEBP2_ENST00000266508.9_Silent_p.Y189Y|AEBP2_ENST00000541908.1_Intron|AEBP2_ENST00000360995.4_5'Flank	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	189	Gly-rich.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					acgagggctacgggactgggg	0.746																																					p.Y189Y													.	.			0			c.C567T												2.0	6.0	5.0					12																	19593200		522	1364	1886	SO:0001819	synonymous_variant	121536	exon1			GGGCTACGGGACT		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.567C>T	12.37:g.19593200C>T			9	0	0		16	0.13	2	NM_001114176	15	0.00	0	Q59FS5|Q6ZN62|Q96BG3	Silent	SNP	ENST00000398864.3	37	CCDS44841.1																																																																																					0.746	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000401575.1		NM_153207	
RP11-415I12.3	0	broad.mit.edu	37	12	64081924	64081925	+	RNA	INS	-	-	A	rs367961484|rs35652992|rs574398488	byFrequency	TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr12:64081924_64081925insA	ENST00000509615.2	-	0	238				RP11-415I12.2_ENST00000541353.1_RNA																							ttctttcACTTAAAAAAAAAAC	0.436													|||unknown(HR)	1313	0.262181	0.2587	0.3357	5008	,	,		21069	0.256		0.2803	False		,,,				2504	0.2025				.													.	.			0			.																																											0	.			TTCACTTAAAAAA																													12.37:g.64081934_64081934dupA			5	0	0		12	0.33	4	.	0		0		RNA	INS	ENST00000509615.2	37																																																																																						0.436	RP11-415I12.3-001	KNOWN	basic	antisense	antisense		OTTHUMT00000400798.1			
HSP90B1	7184	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	104333319	104333319	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr12:104333319G>A	ENST00000299767.5	+	8	1190	c.1008G>A	c.(1006-1008)atG>atA	p.M336I		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	336					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	GGGAACTTATGAATGATATCA	0.333																																					p.M336I													.	HSP90B1	72		0			c.G1008A												110.0	115.0	114.0					12																	104333319		2203	4300	6503	SO:0001583	missense	7184	exon8			ACTTATGAATGAT	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.1008G>A	12.37:g.104333319G>A	ENSP00000299767:p.Met336Ile		238	0.0042016807	1		242	0.10	23	NM_003299	1078	0.18	191	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589086	0.46110	.	.	ENSG00000166598	ENST00000299767;ENST00000421266	T	0.08984	3.03	5.5	5.5	0.81552	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.04679	0.0127	N	0.01705	-0.755	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.51702	-0.8672	10	0.32370	T	0.25	.	19.4074	0.94653	0.0:0.0:1.0:0.0	.	336	P14625	ENPL_HUMAN	I	336;86	ENSP00000299767:M336I	ENSP00000299767:M336I	M	+	3	0	HSP90B1	102857449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.568000	0.86640	0.650000	0.86243	ATG			0.333	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407349.1		NM_003299	
PDS5B	23047	mdanderson.org	37	13	33222915	33222915	+	Silent	SNP	T	T	C	rs534207351		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr13:33222915T>C	ENST00000315596.10	+	2	192	c.6T>C	c.(4-6)gcT>gcC	p.A2A		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	2					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CTGTCATGGCTCATTCAAAGA	0.333																																					p.A2A													.	.			0			c.T6C												99.0	99.0	99.0					13																	33222915		1824	4066	5890	SO:0001819	synonymous_variant	23047	exon2			CATGGCTCATTCA	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.6T>C	13.37:g.33222915T>C			41	0	0		37	0.08	3	NM_015032	5	0.00	0	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Silent	SNP	ENST00000315596.10	37	CCDS41878.1																																																																																					0.333	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044428.3		NM_015032	
CTSG	1511	mdanderson.org	37	14	25043631	25043631	+	Silent	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr14:25043631G>T	ENST00000216336.2	-	4	450	c.414C>A	c.(412-414)ccC>ccA	p.P138P		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	138	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		ACAGCGTCCCGGGTCTCAGTC	0.607																																					p.P138P													.	.			0			c.C414A												107.0	102.0	104.0					14																	25043631		2203	4300	6503	SO:0001819	synonymous_variant	1511	exon4			CGTCCCGGGTCTC	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.414C>A	14.37:g.25043631G>T			37	0	0		43	0.07	3	NM_001911	5	0.00	0	Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	37	CCDS9631.1																																																																																					0.607	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276536.2		NM_001911	
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81227824	81227824	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr14:81227824G>A	ENST00000555265.1	-	17	2885	c.2510C>T	c.(2509-2511)gCa>gTa	p.A837V	CEP128_ENST00000281129.3_Missense_Mutation_p.A837V			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	837						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TTTACAAGCTGCATCAATTTC	0.368																																					p.A837V													.	.			0			c.C2510T												106.0	103.0	104.0					14																	81227824		2203	4300	6503	SO:0001583	missense	145508	exon16			CAAGCTGCATCAA	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2510C>T	14.37:g.81227824G>A	ENSP00000451162:p.Ala837Val		138	0	0		144	0.10	14	NM_152446	12	0.00	0	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.060188	0.36373	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000554728	T;T	0.35789	1.29;1.29	5.67	3.78	0.43462	.	0.299354	0.25380	N	0.031081	T	0.24005	0.0581	N	0.22421	0.69	0.80722	D	1	B	0.31548	0.328	B	0.34242	0.178	T	0.05451	-1.0884	10	0.27785	T	0.31	.	9.1932	0.37211	0.0744:0.0:0.7785:0.1471	.	837	Q6ZU80	CE128_HUMAN	V	837;837;837;38	ENSP00000281129:A837V;ENSP00000451162:A837V	ENSP00000281129:A837V	A	-	2	0	CEP128	80297577	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.875000	0.48491	1.346000	0.45694	0.655000	0.94253	GCA			0.368	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413415.1		NM_152446	
ATXN3	4287	hgsc.bcm.edu	37	14	92537354	92537355	+	In_Frame_Ins	INS	-	-	CTG	rs12895357	byFrequency	TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr14:92537354_92537355insCTG	ENST00000532032.1	-	10	924_925	c.915_916insCAG	c.(913-918)cagggg>cagCAGggg	p.305_306insQ	ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000429774.2_In_Frame_Ins_p.298_299insQ|ATXN3_ENST00000545170.1_In_Frame_Ins_p.314_315insQ|ATXN3_ENST00000393287.5_In_Frame_Ins_p.305_306insQ|ATXN3_ENST00000340660.6_In_Frame_Ins_p.250_251insQ|ATXN3_ENST00000502250.1_In_Frame_Ins_p.126_127insQ|ATXN3_ENST00000503767.1_In_Frame_Ins_p.290_291insQ			P54252	ATX3_HUMAN	ataxin 3	305	Poly-Gln.		G -> QQQQQQQQQQQQR. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7874163, ECO:0000269|PubMed:9274833}.		actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G306R(1)		endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		GATAGGTCCCCctgctgctgct	0.446																																					p.G306delinsQG	Esophageal Squamous(190;752 2094 29897 44875 49530)												ATXN3,NS,carcinoma,0,7	ATXN3	46		1	Substitution - Missense(1)	lung(1)	c.916_917insCAG																																									SO:0001652	inframe_insertion	4287	exon10			GGTCCCCCTGCTG	U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.913_915dupCAG	14.37:g.92537361_92537363dupCTG	ENSP00000437157:p.Gln305_Gln305dup		55	0	0		81	0.36	29	NM_004993	23	0.00	0	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	In_Frame_Ins	INS	ENST00000532032.1	37																																																																																						0.446	ATXN3-015	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000388065.1		NM_004993	
XRCC3	7517	mdanderson.org	37	14	104169621	104169621	+	Silent	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr14:104169621G>T	ENST00000553264.1	-	5	1246	c.450C>A	c.(448-450)cgC>cgA	p.R150R	XRCC3_ENST00000555055.1_Silent_p.R150R|XRCC3_ENST00000555832.1_5'Flank|XRCC3_ENST00000554974.1_Intron|XRCC3_ENST00000554913.1_Silent_p.R150R|XRCC3_ENST00000352127.7_Silent_p.R150R|XRCC3_ENST00000445556.1_Silent_p.R150R			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	150					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		GCTGCTGCAGGCGCTTGTGCG	0.632								Direct reversal of damage;Homologous recombination																													p.R150R													.	.			0			c.C450A												39.0	31.0	34.0					14																	104169621		2182	4279	6461	SO:0001819	synonymous_variant	7517	exon7			CTGCAGGCGCTTG	AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.450C>A	14.37:g.104169621G>T			26	0	0		35	0.09	3	NM_001100119	19	0.00	0	O43568|Q9BU18	Silent	SNP	ENST00000553264.1	37	CCDS9984.1																																																																																					0.632	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414631.1		NM_005432	
TYRO3	7301	mdanderson.org	37	15	41859673	41859673	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr15:41859673G>T	ENST00000263798.3	+	7	1123	c.899G>T	c.(898-900)tGt>tTt	p.C300F	TYRO3_ENST00000559066.1_Missense_Mutation_p.C255F	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	300	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AGGGTGCGCTGTGCCAATGCC	0.637																																					p.C300F													.	.			0			c.G899T												99.0	99.0	99.0					15																	41859673		2203	4300	6503	SO:0001583	missense	7301	exon7			TGCGCTGTGCCAA	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.899G>T	15.37:g.41859673G>T	ENSP00000263798:p.Cys300Phe		57	0	0		46	0.07	3	NM_006293	32	0.00	0	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153323	0.78114	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.56611	0.45	4.64	4.64	0.57946	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000302	T	0.71517	0.3349	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75519	-0.3289	10	0.87932	D	0	-10.2483	14.5246	0.67878	0.0:0.0:1.0:0.0	.	300	Q06418	TYRO3_HUMAN	F	232;300	ENSP00000263798:C300F	ENSP00000263798:C300F	C	+	2	0	TYRO3	39646965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.321000	0.79088	2.417000	0.82017	0.655000	0.94253	TGT			0.637	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252693.2			
IL4R	3566	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	27353570	27353570	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr16:27353570C>T	ENST00000395762.2	+	4	458	c.199C>T	c.(199-201)Ctg>Ttg	p.L67L	IL4R_ENST00000543915.2_Silent_p.L67L|IL4R_ENST00000449195.1_Silent_p.L67L|IL4R_ENST00000380922.3_Silent_p.L52L|IL4R_ENST00000170630.2_Silent_p.L67L	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	67					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GCTGGTTTTTCTGCTCTCCGA	0.577																																					p.L67L													.	.			0			c.C199T												132.0	116.0	122.0					16																	27353570		2197	4300	6497	SO:0001819	synonymous_variant	3566	exon4			GTTTTTCTGCTCT	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.199C>T	16.37:g.27353570C>T			113	0	0		151	0.05	8	NM_000418	22	0.00	0	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	ENST00000395762.2	37	CCDS10629.1																																																																																					0.577	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214104.4			
RANBP10	57610	broad.mit.edu;bcgsc.ca	37	16	67762301	67762301	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr16:67762301G>T	ENST00000317506.3	-	11	1581	c.1466C>A	c.(1465-1467)tCc>tAc	p.S489Y	RANBP10_ENST00000536251.1_Missense_Mutation_p.S260Y|RANBP10_ENST00000602677.1_Missense_Mutation_p.S519Y|RANBP10_ENST00000448631.2_Missense_Mutation_p.S463Y|RANBP10_ENST00000411657.2_Missense_Mutation_p.S402Y	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	489					microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		ACCCATGCTGGACTCATCCGT	0.592																																					p.S489Y													.	RANBP10	56		0			c.C1466A												162.0	114.0	130.0					16																	67762301		2198	4300	6498	SO:0001583	missense	57610	exon11			ATGCTGGACTCAT	AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.1466C>A	16.37:g.67762301G>T	ENSP00000316589:p.Ser489Tyr		49	0.0204081633	1		65	0.32	21	NM_020850	32	0.13	4	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643878	0.67244	.	.	ENSG00000141084	ENST00000317506;ENST00000448631;ENST00000536251;ENST00000411657	.	.	.	5.87	5.87	0.94306	.	0.232996	0.45361	D	0.000380	T	0.71533	0.3351	L	0.55481	1.735	0.80722	D	1	P;D;P	0.56287	0.938;0.975;0.645	P;P;P	0.55055	0.69;0.767;0.611	T	0.70673	-0.4807	9	0.52906	T	0.07	-13.0563	18.3552	0.90355	0.0:0.0:1.0:0.0	.	402;463;489	B4DID0;B4DQH9;Q6VN20	.;.;RBP10_HUMAN	Y	489;463;260;402	.	ENSP00000316589:S489Y	S	-	2	0	RANBP10	66319802	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.997000	0.49457	2.941000	0.99782	0.655000	0.94253	TCC			0.592	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467896.1		NM_020850	
CRK	1398	mdanderson.org	37	17	1359235	1359235	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr17:1359235G>T	ENST00000300574.2	-	1	317	c.177C>A	c.(175-177)caC>caA	p.H59Q	CRK_ENST00000398970.5_Missense_Mutation_p.H59Q|CRK_ENST00000574295.1_Missense_Mutation_p.H59Q|CRK_ENST00000572145.1_Intron	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog	59	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		TGATGATGTAGTGGGAGACGC	0.731																																					p.H59Q													.	.			0			c.C177A												24.0	28.0	27.0					17																	1359235		2200	4296	6496	SO:0001583	missense	1398	exon1			GATGTAGTGGGAG	D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.177C>A	17.37:g.1359235G>T	ENSP00000300574:p.His59Gln		51	0	0		47	0.06	3	NM_005206	30	0.00	0	A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	Missense_Mutation	SNP	ENST00000300574.2	37	CCDS11002.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528177	0.85706	.	.	ENSG00000167193	ENST00000300574;ENST00000398970	T;T	0.38401	1.14;1.14	4.72	4.72	0.59763	Src homology-3 domain (1);SH2 motif (5);	0.097704	0.64402	D	0.000001	T	0.67562	0.2906	M	0.92219	3.285	0.80722	D	1	B;P	0.51147	0.054;0.942	B;D	0.65874	0.182;0.939	T	0.76260	-0.3024	10	0.66056	D	0.02	-15.8667	15.5538	0.76173	0.0:0.0:1.0:0.0	.	59;59	P46108-2;P46108	.;CRK_HUMAN	Q	59	ENSP00000300574:H59Q;ENSP00000381942:H59Q	ENSP00000300574:H59Q	H	-	3	2	CRK	1305985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.648000	0.61425	2.334000	0.79466	0.655000	0.94253	CAC			0.731	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206679.1		NM_016823	
SMCR2	140768	broad.mit.edu	37	17	17579770	17579771	+	lincRNA	DEL	TG	TG	-	rs377428889|rs111841324		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr17:17579770_17579771delTG	ENST00000456090.2	-	0	114									Smith-Magenis syndrome chromosome region, candidate 2 (non-protein coding)																		AACCCAAGGCtgtgtgtgtgtg	0.495																																					.													.	.			0			.																																											0	.			CAAGGCTGTGTGT	AI821758		17p11.2	2012-10-16	2011-06-10		ENSG00000223979	ENSG00000223979		"""Long non-coding RNAs"""	17914	non-coding RNA	RNA, long non-coding			"""Smith-Magenis syndrome chromosome region, candidate 2"""			11997338	Standard			Approved				OTTHUMG00000059291		17.37:g.17579780_17579781delTG			11	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000456090.2	37																																																																																						0.495	SMCR2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000131667.2			
SLFN12	55106	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	33749877	33749877	+	Silent	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr17:33749877T>C	ENST00000394562.1	-	4	694	c.171A>G	c.(169-171)ggA>ggG	p.G57G	SLFN12_ENST00000452764.3_Silent_p.G57G|SLFN12_ENST00000304905.5_Silent_p.G57G|SLFN12_ENST00000460530.1_5'Flank			Q8IYM2	SLN12_HUMAN	schlafen family member 12	57							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTTGATCACTCCCCCTCCAG	0.358																																					p.G57G													.	SLFN12	56		0			c.A171G												125.0	115.0	118.0					17																	33749877		2203	4300	6503	SO:0001819	synonymous_variant	55106	exon2			GATCACTCCCCCT	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.171A>G	17.37:g.33749877T>C			118	0	0		159	0.04	6	NM_018042	2	0.00	0	A8K711|Q9NP47	Silent	SNP	ENST00000394562.1	37	CCDS11295.1																																																																																					0.358	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256491.1		NM_018042	
NUP85	79902	mdanderson.org	37	17	73208158	73208158	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr17:73208158G>T	ENST00000245544.4	+	4	432		c.e4+1		NUP85_ENST00000579298.1_Splice_Site|NUP85_ENST00000541827.1_Splice_Site|NUP85_ENST00000447371.2_Splice_Site|NUP85_ENST00000449421.2_Splice_Site|NUP85_ENST00000579324.1_Splice_Site	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CAGGTTGCAAGTAAGGACtgt	0.413																																					.													.	.			0			c.361+1G>T												129.0	99.0	109.0					17																	73208158		2203	4300	6503	SO:0001630	splice_region_variant	79902	exon4			TTGCAAGTAAGGA	AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.361+1G>T	17.37:g.73208158G>T			31	0	0		51	0.06	3	NM_024844	0		0	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Splice_Site	SNP	ENST00000245544.4	37	CCDS32730.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587688	0.86851	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000449421	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1591	0.93524	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP85	70719753	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.664000	0.83830	2.619000	0.88677	0.591000	0.81541	.			0.413	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446619.1		NM_024844	Intron
ESCO1	114799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	19153599	19153600	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr18:19153599_19153600delCA	ENST00000269214.5	-	4	2142_2143	c.1205_1206delTG	c.(1204-1206)gtgfs	p.V402fs		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	402					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TATTGTGCTGCACAGAGTTAAA	0.366																																					p.402_403del													.	ESCO1	89		0			c.1206_1207del																																									SO:0001589	frameshift_variant	114799	exon4			GTGCTGCACAGAG	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1205_1206delTG	18.37:g.19153601_19153602delCA	ENSP00000269214:p.Val402fs		139	0	0		131	0.13	17	NM_052911	13	0.00	0	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Frame_Shift_Del	DEL	ENST00000269214.5	37	CCDS32800.1																																																																																					0.366	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443942.1		NM_052911	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	50278479	50278479	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr18:50278479C>T	ENST00000442544.2	+	2	763	c.147C>T	c.(145-147)gcC>gcT	p.A49A	DCC_ENST00000412726.1_5'Flank	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	49	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTTCTGATGCCGTCACAATGC	0.483																																					p.A49A													.	.			0			c.C147T												60.0	60.0	60.0					18																	50278479		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon2			TGATGCCGTCACA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.147C>T	18.37:g.50278479C>T			94	0	0		63	0.19	12	NM_005215	6	0.33	2		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																					0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255996.3		NM_005215	
PALM3	342979	mdanderson.org	37	19	14168210	14168210	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr19:14168210C>T	ENST00000340790.4	-	2	78	c.79G>A	c.(79-81)Gcg>Acg	p.A27T		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	27					negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						TCCCGGCGCGCGGCGCGGATC	0.741																																					p.A27T													.	.			0			c.G79A												5.0	9.0	7.0					19																	14168210		661	1546	2207	SO:0001583	missense	342979	exon2			GGCGCGCGGCGCG		CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.79G>A	19.37:g.14168210C>T	ENSP00000344996:p.Ala27Thr		36	0	0		43	0.07	3	NM_001145028	4	0.00	0		Missense_Mutation	SNP	ENST00000340790.4	37	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	c	18.84	3.708842	0.68615	.	.	ENSG00000187867	ENST00000340790	T	0.35421	1.31	4.08	1.89	0.25635	.	.	.	.	.	T	0.32556	0.0833	L	0.43152	1.355	0.25430	N	0.988197	D	0.61080	0.989	P	0.50860	0.652	T	0.11767	-1.0574	9	0.22706	T	0.39	.	4.002	0.09584	0.0:0.5756:0.1995:0.2249	.	27	A6NDB9	PALM3_HUMAN	T	27	ENSP00000344996:A27T	ENSP00000344996:A27T	A	-	1	0	PALM3	14029210	0.950000	0.32346	0.964000	0.40570	0.969000	0.65631	1.986000	0.40677	0.821000	0.34540	0.561000	0.74099	GCG			0.741	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458540.1		NM_001145028	
RPLP0P6	220717	broad.mit.edu	37	2	38709868	38709868	+	lincRNA	SNP	T	T	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:38709868T>A	ENST00000417039.1	-	0	696																											ctgctgctgctgcagcCCCAG	0.532																																					.													.	.			0			.																																											0	.			TGCTGCTGCAGCC																													2.37:g.38709868T>A			186	0	0		212	0.02	5	.	3343	0.00	0		RNA	SNP	ENST00000417039.1	37																																																																																						0.532	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000331173.1			
CLASP1	23332	mdanderson.org	37	2	122176293	122176293	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:122176293C>T	ENST00000263710.4	-	23	2614	c.2225G>A	c.(2224-2226)cGt>cAt	p.R742H	CLASP1_ENST00000397587.3_Intron|CLASP1_ENST00000541859.1_Intron|CLASP1_ENST00000409078.3_Intron|CLASP1_ENST00000541377.1_Intron|CLASP1_ENST00000455322.2_Intron|CLASP1_ENST00000545861.1_Intron	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	742	Interaction with microtubules, MAPRE1 and MAPRE3.|Ser-rich.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					TCGAGGGATACGGCTGCTCCG	0.527																																					p.R742H													CLASP1,NS,carcinoma,0,2	CLASP1	0	2	0			c.G2225A												59.0	67.0	64.0					2																	122176293		2077	4210	6287	SO:0001583	missense	23332	exon23			GGGATACGGCTGC	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.2225G>A	2.37:g.122176293C>T	ENSP00000263710:p.Arg742His		32	0	0		44	0.07	3	NM_015282	0		0	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	C	31	5.059284	0.93846	.	.	ENSG00000074054	ENST00000263710	T	0.21734	1.99	5.88	5.88	0.94601	Armadillo-type fold (1);	0.095421	0.64402	D	0.000001	T	0.42653	0.1212	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	T	0.08249	-1.0731	10	0.62326	D	0.03	-17.7943	20.2314	0.98350	0.0:1.0:0.0:0.0	.	742	Q7Z460	CLAP1_HUMAN	H	742	ENSP00000263710:R742H	ENSP00000263710:R742H	R	-	2	0	CLASP1	121892763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.938000	0.63519	2.789000	0.95967	0.591000	0.81541	CGT			0.527	CLASP1-201	KNOWN	basic	protein_coding	protein_coding				NM_015282	
SP5	389058	broad.mit.edu;mdanderson.org	37	2	171573375	171573375	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:171573375C>T	ENST00000375281.3	+	2	820	c.658C>T	c.(658-660)Ccc>Tcc	p.P220S	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	220					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCCCCACGCGCCCCGCTTCCc	0.776																																					p.P220S													.	SP5	14		0			c.C658T												1.0	1.0	1.0					2																	171573375		295	672	967	SO:0001583	missense	389058	exon2			CACGCGCCCCGCT		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.658C>T	2.37:g.171573375C>T	ENSP00000364430:p.Pro220Ser		30	0	0		56	0.07	4	NM_001003845	7	0.00	0		Missense_Mutation	SNP	ENST00000375281.3	37	CCDS33322.1	.	.	.	.	.	.	.	.	.	.	C	9.540	1.113211	0.20795	.	.	ENSG00000204335	ENST00000375281	T	0.11277	2.79	3.76	3.76	0.43208	.	0.062472	0.64402	U	0.000007	T	0.05318	0.0141	N	0.08118	0	0.44323	D	0.997201	P	0.43750	0.816	B	0.38264	0.269	T	0.49781	-0.8903	10	0.12103	T	0.63	.	14.6851	0.69044	0.0:1.0:0.0:0.0	.	220	Q6BEB4	SP5_HUMAN	S	220	ENSP00000364430:P220S	ENSP00000364430:P220S	P	+	1	0	SP5	171281621	0.001000	0.12720	0.425000	0.26659	0.150000	0.21749	0.496000	0.22499	2.092000	0.63282	0.555000	0.69702	CCC			0.776	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333670.1		XM_371581	
HOXD13	3239	mdanderson.org	37	2	176957866	176957866	+	Missense_Mutation	SNP	C	C	T	rs369711414		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:176957866C>T	ENST00000392539.3	+	1	248	c.248C>T	c.(247-249)aCg>aTg	p.T83M		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	83					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		TCTGAGCGCACGGGCTCTTCC	0.766			T	NUP98	AML*																																p.T83M				Dom	yes		2	2q31-q32	3239	homeo box D13		L	.	.			0			c.C248T							C	MET/THR	0,4020		0,0,2010	11.0	13.0	12.0		248	3.5	1.0	2		12	1,7873		0,1,3936	no	missense	HOXD13	NM_000523.3	81	0,1,5946	TT,TC,CC		0.0127,0.0,0.0084	benign	83/344	176957866	1,11893	2010	3937	5947	SO:0001583	missense	3239	exon1			AGCGCACGGGCTC	AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.248C>T	2.37:g.176957866C>T	ENSP00000376322:p.Thr83Met		25	0	0		38	0.08	3	NM_000523	0		0		Missense_Mutation	SNP	ENST00000392539.3	37	CCDS2264.2	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502255	0.44455	0.0	1.27E-4	ENSG00000128714	ENST00000392539	D	0.95001	-3.58	3.53	3.53	0.40419	.	1.143430	0.06736	N	0.777454	D	0.88164	0.6363	N	0.08118	0	0.27214	N	0.959837	P	0.34977	0.478	B	0.35655	0.207	T	0.81424	-0.0939	10	0.42905	T	0.14	.	10.2851	0.43562	0.0:0.7977:0.2023:0.0	.	83	P35453	HXD13_HUMAN	M	83	ENSP00000376322:T83M	ENSP00000376322:T83M	T	+	2	0	HOXD13	176666112	0.510000	0.26171	0.972000	0.41901	0.864000	0.49448	1.542000	0.36137	1.801000	0.52704	0.467000	0.42956	ACG			0.766	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000359256.1			
HOXD10	3236	mdanderson.org	37	2	176982179	176982179	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:176982179C>T	ENST00000249501.4	+	1	873	c.618C>T	c.(616-618)agC>agT	p.S206S	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	206					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AGCCCGTGAGCGGCCAGGAGC	0.652																																					p.S206S													.	.			0			c.C618T												23.0	29.0	27.0					2																	176982179		2190	4274	6464	SO:0001819	synonymous_variant	3236	exon1			CGTGAGCGGCCAG		CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.618C>T	2.37:g.176982179C>T			75	0	0		79	0.05	4	NM_002148	5	0.00	0	Q6NT10	Silent	SNP	ENST00000249501.4	37	CCDS2266.1																																																																																					0.652	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255692.2			
PLCL1	5334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198949565	198949565	+	Missense_Mutation	SNP	G	G	A	rs201197388		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:198949565G>A	ENST00000428675.1	+	2	1722	c.1324G>A	c.(1324-1326)Gtt>Att	p.V442I	PLCL1_ENST00000437704.2_Missense_Mutation_p.V344I	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	442	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CTGTCGAAGCGTTGAACTCGA	0.408																																					p.V442I													PLCL1_ENST00000428675,right_upper_lobe,carcinoma,0,2	PLCL1_ENST00000428675	0	2	0			c.G1324A							G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	62.0	59.0	60.0		1324	1.0	1.0	2		60	0,8600		0,0,4300	no	missense	PLCL1	NM_006226.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	442/1096	198949565	1,13005	2203	4300	6503	SO:0001583	missense	5334	exon2			CGAAGCGTTGAAC	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1324G>A	2.37:g.198949565G>A	ENSP00000402861:p.Val442Ile		133	0	0		122	0.32	39	NM_006226	5	0.40	2	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	g	2.384	-0.341507	0.05243	2.27E-4	0.0	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.55413	0.52;0.52	5.94	1.05	0.20165	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.279290	0.31031	N	0.008399	T	0.30696	0.0773	N	0.13235	0.315	0.22940	N	0.998531	B;B	0.21147	0.052;0.021	B;B	0.24006	0.05;0.05	T	0.18871	-1.0323	9	.	.	.	.	9.6222	0.39727	0.7455:0.0:0.2545:0.0	.	442;368	Q15111;B4DYZ4	PLCL1_HUMAN;.	I	442;344	ENSP00000402861:V442I;ENSP00000414138:V344I	.	V	+	1	0	PLCL1	198657810	1.000000	0.71417	0.998000	0.56505	0.621000	0.37620	2.516000	0.45520	0.161000	0.19458	-0.405000	0.06341	GTT	0.001		0.408	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340210.1		NM_006226	
ARPC2	10109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219103519	219103519	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:219103519A>C	ENST00000295685.10	+	5	662	c.401A>C	c.(400-402)gAg>gCg	p.E134A	ARPC2_ENST00000477992.1_3'UTR|ARPC2_ENST00000315717.5_Missense_Mutation_p.E134A	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	134					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		TTCCAAGAAGAGGGCAAGGAA	0.443																																					p.E134A													.	.			0			c.A401C												98.0	95.0	96.0					2																	219103519		2203	4300	6503	SO:0001583	missense	10109	exon5			AAGAAGAGGGCAA	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.401A>C	2.37:g.219103519A>C	ENSP00000295685:p.Glu134Ala		233	0	0		306	0.29	89	NM_005731	809	0.33	268	Q92801|Q9P1D4	Missense_Mutation	SNP	ENST00000295685.10	37	CCDS2410.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.272205	0.59649	.	.	ENSG00000163466	ENST00000315717;ENST00000295685	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	N	0.04746	-0.17	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.18618	-1.0331	9	0.31617	T	0.26	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	134	O15144	ARPC2_HUMAN	A	134	.	ENSP00000295685:E134A	E	+	2	0	ARPC2	218811764	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.139000	0.94554	2.371000	0.80710	0.533000	0.62120	GAG			0.443	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256777.2		NM_005731	
TTLL4	9654	broad.mit.edu	37	2	219617499	219617499	+	Missense_Mutation	SNP	C	C	T	rs557920337		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:219617499C>T	ENST00000392102.1	+	17	3330	c.2990C>T	c.(2989-2991)tCt>tTt	p.S997F	TTLL4_ENST00000442769.1_Missense_Mutation_p.S933F|TTLL4_ENST00000457313.1_Missense_Mutation_p.S832F|TTLL4_ENST00000258398.4_Missense_Mutation_p.S997F	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	997					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TTCTATGCATCTGTGCTGGAT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20861	0.0		0.0	False		,,,				2504	0.001				p.S997F	GBM(172;1818 2053 15407 20943 49753)												.	TTLL4	96		0			c.C2990T												182.0	167.0	172.0					2																	219617499		2203	4300	6503	SO:0001583	missense	9654	exon17			ATGCATCTGTGCT		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2990C>T	2.37:g.219617499C>T	ENSP00000375951:p.Ser997Phe		121	0	0		135	0.03	4	NM_014640	65	0.02	1	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941961	0.92526	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.04758	3.73;3.98;3.56;3.98	5.38	5.38	0.77491	.	0.977927	0.08412	N	0.949716	T	0.24122	0.0584	M	0.70595	2.14	0.51482	D	0.999924	P;D;D;D	0.76494	0.823;0.999;0.999;0.994	P;D;D;P	0.67103	0.535;0.909;0.949;0.885	T	0.00221	-1.1905	10	0.87932	D	0	.	18.3102	0.90197	0.0:1.0:0.0:0.0	.	200;832;933;997	B4DJF5;E9PH58;E7EX20;Q14679	.;.;.;TTLL4_HUMAN	F	832;997;933;997	ENSP00000393332:S832F;ENSP00000375951:S997F;ENSP00000396555:S933F;ENSP00000258398:S997F	ENSP00000258398:S997F	S	+	2	0	TTLL4	219325743	0.970000	0.33590	0.990000	0.47175	0.992000	0.81027	4.272000	0.58908	2.793000	0.96121	0.655000	0.94253	TCT			0.493	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256726.1		NM_014640	
SPEG	10290	mdanderson.org	37	2	220343903	220343903	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:220343903C>T	ENST00000312358.7	+	23	5197	c.5065C>T	c.(5065-5067)Ccc>Tcc	p.P1689S	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1689	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCCAGGAAACCCACCGTGTG	0.617																																					p.P1689S													.	.			0			c.C5065T												62.0	72.0	68.0					2																	220343903		2094	4222	6316	SO:0001583	missense	10290	exon23			AGGAAACCCACCG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5065C>T	2.37:g.220343903C>T	ENSP00000311684:p.Pro1689Ser		32	0	0		39	0.08	3	NM_005876	15	0.00	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194964	0.38806	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.38560	1.13	4.42	2.59	0.31030	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39834	N	0.001260	T	0.25938	0.0632	N	0.25332	0.735	0.80722	D	1	B	0.20988	0.05	B	0.31290	0.127	T	0.05801	-1.0863	10	0.06494	T	0.89	.	7.8754	0.29590	0.1602:0.7531:0.0:0.0867	.	1689	Q15772	SPEG_HUMAN	S	1689	ENSP00000311684:P1689S	ENSP00000265327:P1689S	P	+	1	0	SPEG	220052147	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	1.014000	0.29950	0.481000	0.27557	0.561000	0.74099	CCC			0.617	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130252.2		NM_005876	
PTMA	5757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	232576664	232576664	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:232576664A>G	ENST00000341369.7	+	3	376	c.185A>G	c.(184-186)gAg>gGg	p.E62G	PTMA_ENST00000409683.1_Missense_Mutation_p.E61G|PTMA_ENST00000410064.1_Missense_Mutation_p.E87G|PTMA_ENST00000409321.1_Missense_Mutation_p.E82G|PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409115.3_Missense_Mutation_p.E61G	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	62	Asp/Glu-rich (acidic).				transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		gaaggtggggaggaagaggag	0.502																																					p.E62G													.	.			0			c.A185G												51.0	53.0	52.0					2																	232576664		2034	4195	6229	SO:0001583	missense	5757	exon3			GTGGGGAGGAAGA		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.185A>G	2.37:g.232576664A>G	ENSP00000344547:p.Glu62Gly		53	0	0		82	0.22	18	NM_001099285	2865	0.23	654	Q15249|Q15592	Missense_Mutation	SNP	ENST00000341369.7	37	CCDS42833.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.29|13.29	2.192066|2.192066	0.38707|0.38707	.|.	.|.	ENSG00000187514|ENSG00000187514	ENST00000409321;ENST00000409115;ENST00000341369;ENST00000409683;ENST00000410064;ENST00000358839|ENST00000412128	.|.	.|.	.|.	3.58|3.58	3.58|3.58	0.41010|0.41010	.|.	0.117593|.	0.34777|.	U|.	0.003698|.	T|T	0.52757|0.52757	0.1754|0.1754	L|L	0.34521|0.34521	1.04|1.04	0.37866|0.37866	D|D	0.929878|0.929878	D;D|.	0.56287|.	0.975;0.975|.	D;D|.	0.63283|.	0.913;0.913|.	T|T	0.54695|0.54695	-0.8255|-0.8255	9|5	0.35671|.	T|.	0.21|.	.|.	11.9888|11.9888	0.53163|0.53163	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	62;61|.	P06454;Q53S24|.	PTMA_HUMAN;.|.	G|G	82;61;62;61;87;86|99	.|.	ENSP00000344547:E62G|.	E|R	+|+	2|1	0|2	PTMA|PTMA	232284908|232284908	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	3.904000|3.904000	0.56325|0.56325	1.865000|1.865000	0.54081|0.54081	0.448000|0.448000	0.29417|0.29417	GAG|AGG			0.502	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000332553.1			
UGT1A4	54657	mdanderson.org	37	2	234628241	234628241	+	Missense_Mutation	SNP	G	G	C	rs200363835		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr2:234628241G>C	ENST00000373409.3	+	1	818	c.775G>C	c.(775-777)Ggg>Cgg	p.G259R	UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000608381.1_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	259					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	GCTGTTCCGAGGGGACTTTGT	0.517																																					p.G259R	Melanoma(99;1011 1962 13201 26492)												.	.			0			c.G775C												201.0	201.0	201.0					2																	234628241		2203	4300	6503	SO:0001583	missense	54657	exon1			TTCCGAGGGGACT	M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.775G>C	2.37:g.234628241G>C	ENSP00000362508:p.Gly259Arg		139	0.0071942446	1		166	0.04	7	NM_007120	0		0	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	CCDS33405.1	7	0.003205128205128205	0	0.0	1	0.0027624309392265192	4	0.006993006993006993	2	0.002638522427440633	g	0.015	-1.547026	0.00926	.	.	ENSG00000244474	ENST00000373409	T	0.61510	0.1	4.49	-5.65	0.02459	.	.	.	.	.	T	0.34395	0.0896	L	0.51914	1.62	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.17433	0.006;0.018	T	0.39461	-0.9613	9	0.49607	T	0.09	.	3.3767	0.07239	0.1848:0.0788:0.2436:0.4928	.	259;259	B8K288;P22310	.;UD14_HUMAN	R	259	ENSP00000362508:G259R	ENSP00000362508:G259R	G	+	1	0	UGT1A4	234292980	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.669000	0.01958	-0.911000	0.03843	-4.554000	0.00004	GGG	0.003		0.517	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding		OTTHUMT00000130984.1		NM_007120	
SIGLEC1	6614	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3673381	3673381	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:3673381C>T	ENST00000344754.4	-	15	3816	c.3817G>A	c.(3817-3819)Gaa>Aaa	p.E1273K	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.E1273K	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1273	Ig-like C2-type 13.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGGGCACCTTCAGGCACGGCA	0.657																																					p.E1273K													.	SIGLEC1	210		0			c.G3817A												42.0	42.0	42.0					20																	3673381		2203	4300	6503	SO:0001583	missense	6614	exon15			CACCTTCAGGCAC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3817G>A	20.37:g.3673381C>T	ENSP00000341141:p.Glu1273Lys		37	0	0		36	0.14	5	NM_023068	7	0.00	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409273	0.62399	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.14766	2.48;2.48	5.74	5.74	0.90152	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37483	N	0.002062	T	0.33673	0.0871	M	0.71920	2.185	0.39617	D	0.96997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.08848	-1.0702	10	0.10902	T	0.67	.	15.4078	0.74893	0.0:1.0:0.0:0.0	.	1273;1273	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	K	1273	ENSP00000341141:E1273K;ENSP00000202578:E1273K	ENSP00000202578:E1273K	E	-	1	0	SIGLEC1	3621381	0.987000	0.35691	0.995000	0.50966	0.022000	0.10575	2.933000	0.48948	2.712000	0.92718	0.561000	0.74099	GAA			0.657	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077761.2		NM_023068	
KIF16B	55614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	16385486	16385486	+	Silent	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:16385486G>A	ENST00000354981.2	-	17	1913	c.1756C>T	c.(1756-1758)Ctg>Ttg	p.L586L	KIF16B_ENST00000355755.3_Silent_p.L586L|KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000408042.1_Silent_p.L586L	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	586					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						ACTGCAGACAGGTTCTCACGG	0.507																																					p.L586L													.	.			0			c.C1756T												109.0	90.0	97.0					20																	16385486		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon17			CAGACAGGTTCTC	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1756C>T	20.37:g.16385486G>A			59	0	0		74	0.16	12	NM_001199865	17	0.06	1	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																					0.507	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078104.2		NM_017683	
FRG1B	284802	bcgsc.ca	37	20	29623182	29623182	+	5'UTR	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:29623182G>A	ENST00000278882.3	+	0	374				FRG1B_ENST00000439954.2_5'UTR|FRG1B_ENST00000358464.4_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CATAGCCATTGAAATGGATGA	0.378																																					.													.	FRG1B	181		0			.																																									SO:0001623	5_prime_UTR_variant	284802	.			GCCATTGAAATGG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-7G>A	20.37:g.29623182G>A			358	0.0418994413	15		354	0.05	19	.	205	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37																																																																																						0.378	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29623214	29623214	+	Missense_Mutation	SNP	C	C	T	rs367590609		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:29623214C>T	ENST00000278882.3	+	3	406	c.26C>T	c.(25-27)tCg>tTg	p.S9L	FRG1B_ENST00000439954.2_Silent_p.L10L|FRG1B_ENST00000358464.4_Missense_Mutation_p.S9L			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	9										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TACATGCACTCGACAATGGTC	0.393																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			TGCACTCGACAAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.26C>T	20.37:g.29623214C>T	ENSP00000278882:p.Ser9Leu		386	0.0336787565	13		381	0.06	24	.	177	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	6.225	0.409655	0.11812	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.93	-0.799	0.10901	.	0.226615	0.39020	N	0.001481	T	0.26268	0.0641	.	.	.	0.21064	N	0.999793	.	.	.	.	.	.	T	0.21827	-1.0234	6	0.72032	D	0.01	.	0.1722	0.00114	0.2331:0.1666:0.2366:0.3637	.	.	.	.	L	9	.	ENSP00000278882:S9L	S	+	2	0	FRG1B	28236875	0.975000	0.34042	0.996000	0.52242	0.067000	0.16453	-0.074000	0.11450	-0.180000	0.10637	-0.465000	0.05216	TCG			0.393	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
NCOA6	23054	hgsc.bcm.edu	37	20	33345756	33345756	+	Silent	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:33345756T>C	ENST00000374796.2	-	8	3365	c.795A>G	c.(793-795)caA>caG	p.Q265Q	NCOA6_ENST00000359003.2_Silent_p.Q265Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	265	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q265Q(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gttgttgttgttgctgctgct	0.537																																					p.Q265Q													NCOA6,bladder,carcinoma,0,2	NCOA6	0	2	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A795G												62.0	52.0	55.0					20																	33345756		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			TTGTTGTTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.795A>G	20.37:g.33345756T>C			76	0.0131578947	1		76	0.05	4	NM_014071	26	0.00	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																					0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078811.2		NM_014071	
PCK1	5105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	56137903	56137903	+	Silent	SNP	T	T	C	rs201469307		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr20:56137903T>C	ENST00000319441.4	+	4	722	c.558T>C	c.(556-558)gaT>gaC	p.D186D	PCK1_ENST00000535860.1_Silent_p.D54D|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	186					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CAGTGGGCGATGGGGAGTTTG	0.502													T|||	1	0.000199681	0.0	0.0	5008	,	,		19406	0.0		0.001	False		,,,				2504	0.0				p.D186D													.	.			0			c.T558C												62.0	60.0	61.0					20																	56137903		2203	4300	6503	SO:0001819	synonymous_variant	5105	exon4			GGGCGATGGGGAG		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.558T>C	20.37:g.56137903T>C			149	0	0		133	0.25	33	NM_002591	0		0	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	37	CCDS13460.1																																																																																			0		0.502	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079851.2			
LRRC3	81543	mdanderson.org	37	21	45876537	45876537	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr21:45876537G>A	ENST00000291592.4	+	2	327	c.10G>A	c.(10-12)Gtg>Atg	p.V4M	LRRC3-AS1_ENST00000426578.1_RNA	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	4						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		GATGGGCACCGTGCGCCCACC	0.677																																					p.V4M													.	.			0			c.G10A												36.0	41.0	39.0					21																	45876537		2203	4299	6502	SO:0001583	missense	81543	exon2			GGCACCGTGCGCC	AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.10G>A	21.37:g.45876537G>A	ENSP00000291592:p.Val4Met		15	0	0		26	0.08	2	NM_030891	8	0.00	0	Q0VDJ2	Missense_Mutation	SNP	ENST00000291592.4	37	CCDS13711.1	.	.	.	.	.	.	.	.	.	.	G	7.205	0.594244	0.13875	.	.	ENSG00000160233	ENST00000291592;ENST00000471776	T	0.59083	0.29	2.96	-5.92	0.02261	.	3.138150	0.00913	N	0.002489	T	0.31734	0.0806	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.11717	-1.0576	10	0.39692	T	0.17	-0.0371	3.1025	0.06330	0.1717:0.4044:0.3123:0.1115	.	4	Q9BY71	LRRC3_HUMAN	M	4	ENSP00000291592:V4M	ENSP00000291592:V4M	V	+	1	0	LRRC3	44700965	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.505000	0.02273	-1.835000	0.01191	-0.448000	0.05591	GTG			0.677	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098095.3			
PRR14L	253143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32111642	32111642	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr22:32111642G>A	ENST00000327423.6	-	4	2372	c.2183C>T	c.(2182-2184)tCa>tTa	p.S728L	PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000434485.1_Missense_Mutation_p.S728L|PRR14L_ENST00000397493.2_Missense_Mutation_p.S728L	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	728										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GGGACAGTTTGAAGAGGCACC	0.428																																					p.S728L													.	.			0			c.C2183T												138.0	109.0	118.0					22																	32111642		692	1591	2283	SO:0001583	missense	253143	exon4			CAGTTTGAAGAGG	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.2183C>T	22.37:g.32111642G>A	ENSP00000331845:p.Ser728Leu		149	0	0		113	0.42	47	NM_173566	7	0.71	5	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	37	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254244	0.59212	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.18657	2.2;2.24;2.2	5.6	4.59	0.56863	.	0.376195	0.19885	N	0.103868	T	0.22936	0.0554	L	0.59436	1.845	0.33446	D	0.58306	B;B;B	0.32203	0.36;0.36;0.36	B;B;B	0.34385	0.181;0.181;0.181	T	0.27706	-1.0066	9	.	.	.	-6.8852	11.5146	0.50513	0.0836:0.0:0.9164:0.0	.	728;728;728	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	L	728	ENSP00000380630:S728L;ENSP00000331845:S728L;ENSP00000388314:S728L	.	S	-	2	0	PRR14L	30441642	0.884000	0.30299	0.996000	0.52242	0.694000	0.40290	2.165000	0.42396	1.373000	0.46208	-0.136000	0.14681	TCA			0.428	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000074993.2		NM_173566	
FAM19A5	25817	mdanderson.org	37	22	49042516	49042516	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr22:49042516C>T	ENST00000402357.1	+	2	353	c.220C>T	c.(220-222)Cag>Tag	p.Q74*	FAM19A5_ENST00000358295.5_Nonsense_Mutation_p.Q67*|FAM19A5_ENST00000473898.1_Intron	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5	74						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TAGAAAGGGGCAGATCGCCGG	0.706																																					p.Q74X													.	.			0			c.C220T												17.0	22.0	20.0					22																	49042516		2023	4162	6185	SO:0001587	stop_gained	25817	exon2			AAGGGGCAGATCG	AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.220C>T	22.37:g.49042516C>T	ENSP00000383933:p.Gln74*		24	0	0		22	0.14	3	NM_001082967	47	0.00	0	A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	Nonsense_Mutation	SNP	ENST00000402357.1	37	CCDS46728.1	.	.	.	.	.	.	.	.	.	.	C	38	7.135300	0.98088	.	.	ENSG00000219438	ENST00000402357;ENST00000336769;ENST00000358295	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.3357	0.87280	0.0:1.0:0.0:0.0	.	.	.	.	X	74;74;67	.	ENSP00000336812:Q74X	Q	+	1	0	FAM19A5	47428952	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	6.991000	0.76232	2.417000	0.82017	0.655000	0.94253	CAG			0.706	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000317504.1		NM_015381	
NFKBIZ	64332	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	101572306	101572306	+	Silent	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr3:101572306T>C	ENST00000326172.5	+	5	1051	c.936T>C	c.(934-936)ccT>ccC	p.P312P	NFKBIZ_ENST00000326151.5_Intron|NFKBIZ_ENST00000394054.2_Silent_p.P212P	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	312					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						AATACAGTCCTTTTCCCATAC	0.483																																					p.P312P													.	NFKBIZ	55		0			c.T936C												145.0	136.0	139.0					3																	101572306		2203	4300	6503	SO:0001819	synonymous_variant	64332	exon5			CAGTCCTTTTCCC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.936T>C	3.37:g.101572306T>C			108	0	0		138	0.04	5	NM_031419	7	0.00	0	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Silent	SNP	ENST00000326172.5	37	CCDS2946.1																																																																																					0.483	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000353793.1		NM_031419	
EPHB1	2047	mdanderson.org	37	3	134968244	134968244	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr3:134968244G>T	ENST00000398015.3	+	15	3127	c.2757G>T	c.(2755-2757)tgG>tgT	p.W919C	EPHB1_ENST00000493838.1_Missense_Mutation_p.W480C	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	919	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.W919*(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TGGATGACTGGCTCAGCGCCA	0.577																																					p.W919C													EPHB1_ENST00000398015,face,malignant_melanoma,0,2	EPHB1_ENST00000398015	0	2	2	Substitution - Nonsense(2)	skin(2)	c.G2757T												96.0	97.0	97.0					3																	134968244		2101	4232	6333	SO:0001583	missense	2047	exon15			TGACTGGCTCAGC	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2757G>T	3.37:g.134968244G>T	ENSP00000381097:p.Trp919Cys		53	0	0		48	0.06	3	NM_004441	159	0.00	0	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717962	0.89205	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.72282	-0.64;-0.64	5.43	5.43	0.79202	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.90721	0.7088	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93594	0.6924	10	0.87932	D	0	.	19.4372	0.94801	0.0:0.0:1.0:0.0	.	919	P54762	EPHB1_HUMAN	C	919;480	ENSP00000381097:W919C;ENSP00000419574:W480C	ENSP00000381097:W919C	W	+	3	0	EPHB1	136450934	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.827000	0.97445	0.650000	0.86243	TGG			0.577	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357671.1		NM_004441	
NELFA	7469	mdanderson.org	37	4	1985675	1985675	+	Missense_Mutation	SNP	G	G	A	rs139794494		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr4:1985675G>A	ENST00000411638.2	-	9	1217	c.1202C>T	c.(1201-1203)cCg>cTg	p.P401L	NELFA_ENST00000382882.3_Missense_Mutation_p.P412L|NELFA_ENST00000542778.1_Missense_Mutation_p.P266L|MIR943_ENST00000401286.1_RNA	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	401					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										GGCGACAGCCGGAGGTGTGGT	0.687																																					p.P412L													.	.			0			c.C1235T							G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	40.0	44.0	42.0		1235	4.1	0.0	4	dbSNP_134	42	1,8597	1.2+/-3.3	0,1,4298	no	missense	WHSC2	NM_005663.4	98	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	benign	412/540	1985675	2,13002	2203	4299	6502	SO:0001583	missense	7469	exon9			ACAGCCGGAGGTG	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.1202C>T	4.37:g.1985675G>A	ENSP00000399165:p.Pro401Leu		28	0	0		35	0.09	3	NM_005663	114	0.00	0	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		.	.	.	.	.	.	.	.	.	.	G	12.06	1.825813	0.32237	2.27E-4	1.16E-4	ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000542778;ENST00000411638	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	4.94	4.09	0.47781	.	0.167170	0.53938	D	0.000045	T	0.40909	0.1136	L	0.48642	1.525	0.80722	D	1	B	0.29270	0.24	B	0.21151	0.033	T	0.33163	-0.9879	10	0.49607	T	0.09	-13.9787	7.5264	0.27658	0.0844:0.0:0.7521:0.1635	.	401	Q9H3P2	NELFA_HUMAN	L	412;405;266;401	ENSP00000372335:P412L;ENSP00000387647:P405L;ENSP00000445757:P266L;ENSP00000399165:P401L	ENSP00000372335:P412L	P	-	2	0	WHSC2	1955473	1.000000	0.71417	0.046000	0.18839	0.175000	0.22909	6.079000	0.71291	1.089000	0.41292	0.462000	0.41574	CCG	0		0.687	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000473007.1		NM_005663	
RGS12	6002	mdanderson.org	37	4	3422429	3422429	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr4:3422429C>T	ENST00000344733.5	+	10	3726	c.2822C>T	c.(2821-2823)gCg>gTg	p.A941V	RGS12_ENST00000336727.3_Missense_Mutation_p.A941V|RGS12_ENST00000306648.7_Missense_Mutation_p.A339V|RGS12_ENST00000382788.3_Missense_Mutation_p.A941V|RGS12_ENST00000338806.4_Missense_Mutation_p.A293V|RGS12_ENST00000538395.1_Missense_Mutation_p.A283V|RGS12_ENST00000508158.1_3'UTR	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	941				A -> V (in Ref. 7; AAI18595). {ECO:0000305}.	positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTGTCCTCTGCGGGGAGCCTG	0.612																																					p.A941V													.	.			0			c.C2822T												77.0	68.0	71.0					4																	3422429		2202	4300	6502	SO:0001583	missense	6002	exon10			CCTCTGCGGGGAG	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2822C>T	4.37:g.3422429C>T	ENSP00000339381:p.Ala941Val		39	0	0		48	0.06	3	NM_002926	55	0.00	0	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643523	0.47258	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.35236	1.63;1.63;1.63;1.32;1.32;1.33	4.79	4.79	0.61399	.	0.207171	0.41294	D	0.000903	T	0.34337	0.0894	L	0.51422	1.61	0.09310	N	1	P;P;P;P;B;P;B;P	0.45986	0.576;0.87;0.87;0.701;0.26;0.708;0.348;0.48	B;B;B;B;B;B;B;B	0.39465	0.124;0.184;0.184;0.3;0.103;0.124;0.148;0.284	T	0.29971	-0.9994	10	0.36615	T	0.2	-10.8183	16.8327	0.85949	0.0:1.0:0.0:0.0	.	283;140;140;283;293;339;941;941	B7Z764;B3KVS7;A8K440;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;.;RGS12_HUMAN;.	V	941;941;941;339;293;283	ENSP00000339381:A941V;ENSP00000338509:A941V;ENSP00000372238:A941V;ENSP00000304459:A339V;ENSP00000342133:A293V;ENSP00000438888:A283V	ENSP00000304459:A339V	A	+	2	0	RGS12	3392227	0.527000	0.26306	0.030000	0.17652	0.886000	0.51366	4.313000	0.59160	2.205000	0.71048	0.655000	0.94253	GCG			0.612	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206602.1		NM_002926	
GNRHR	2798	mdanderson.org	37	4	68619536	68619536	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr4:68619536G>T	ENST00000226413.4	-	1	542	c.518C>A	c.(517-519)cCa>cAa	p.P173Q	UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000502758.1_RNA|GNRHR_ENST00000420975.2_Missense_Mutation_p.P173Q	NM_000406.2	NP_000397.1	P30968	GNRHR_HUMAN	gonadotropin-releasing hormone receptor	173					cellular response to gonadotropin-releasing hormone (GO:0097211)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gonadotropin-releasing hormone receptor activity (GO:0004968)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	13					Abarelix(DB00106)|Buserelin(DB06719)|Cetrorelix(DB00050)|Danazol(DB01406)|Degarelix(DB06699)|Gonadorelin(DB00644)|Goserelin(DB00014)|Leuprolide(DB00007)|Nafarelin(DB00666)	GCTTACCTGTGGTCCTGCAAA	0.433																																					p.P173Q													.	.			0			c.C518A												49.0	45.0	46.0					4																	68619536		2203	4300	6503	SO:0001583	missense	2798	exon1			ACCTGTGGTCCTG		CCDS3517.1, CCDS47064.1	4q21.2	2012-08-08			ENSG00000109163	ENSG00000109163		"""GPCR / Class A : Gonadotropin-releasing hormone receptors"""	4421	protein-coding gene	gene with protein product		138850		GRHR		8386108	Standard	NM_000406		Approved	LHRHR	uc003hdn.3	P30968	OTTHUMG00000129302	ENST00000226413.4:c.518C>A	4.37:g.68619536G>T	ENSP00000226413:p.Pro173Gln		63	0	0		51	0.06	3	NM_001012763	0		0	O75793|Q14D13|Q92644	Missense_Mutation	SNP	ENST00000226413.4	37	CCDS3517.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486052	0.63962	.	.	ENSG00000109163	ENST00000226413;ENST00000420975	T;T	0.51325	0.71;0.71	6.02	6.02	0.97574	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	T	0.77219	0.4098	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81803	-0.0765	10	0.87932	D	0	-14.7706	18.0345	0.89296	0.0:0.0:1.0:0.0	.	173;173	P30968;P30968-2	GNRHR_HUMAN;.	Q	173	ENSP00000226413:P173Q;ENSP00000397561:P173Q	ENSP00000226413:P173Q	P	-	2	0	GNRHR	68302131	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	9.142000	0.94618	2.865000	0.98341	0.655000	0.94253	CCA			0.433	GNRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251432.2			
Unknown	0	bcgsc.ca	37	5	23305133	23305133	+	IGR	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr5:23305133T>C								Y_RNA (5762 upstream) : PRDM9 (202590 downstream)																							AAGTGTGAAGTCTCCAGGGTT	0.443																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTGAAGTCTCCAG																													5.37:g.23305133T>C			49	0	0		45	0.11	5	.	0		0		RNA	SNP		37																																																																																					0	0.443										
ARSB	411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78251240	78251240	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr5:78251240T>C	ENST00000264914.4	-	4	1312	c.776A>G	c.(775-777)cAa>cGa	p.Q259R	ARSB_ENST00000565165.1_Missense_Mutation_p.Q259R|ARSB_ENST00000396151.3_Missense_Mutation_p.Q259R	NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	259					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		GTTCTTGTCTTGGATAAAGTC	0.463																																					p.Q259R	Melanoma(169;563 1968 25780 26156 52266)												.	.			0			c.A776G												159.0	144.0	149.0					5																	78251240		2203	4300	6503	SO:0001583	missense	411	exon5			TTGTCTTGGATAA	M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.776A>G	5.37:g.78251240T>C	ENSP00000264914:p.Gln259Arg		146	0	0		98	0.40	39	NM_198709	25	0.40	10	B2RC20|Q8N322|Q9UDI9	Missense_Mutation	SNP	ENST00000264914.4	37	CCDS4043.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740534	0.30865	.	.	ENSG00000113273	ENST00000264914;ENST00000396151	D;D	0.98666	-5.06;-5.06	5.55	4.4	0.53042	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.487590	0.24705	N	0.036277	D	0.95843	0.8647	L	0.35854	1.095	0.35893	D	0.829804	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	D	0.94235	0.7480	10	0.16420	T	0.52	.	11.1767	0.48603	0.0:0.072:0.0:0.928	.	259;259	Q8N322;P15848	.;ARSB_HUMAN	R	259	ENSP00000264914:Q259R;ENSP00000379455:Q259R	ENSP00000264914:Q259R	Q	-	2	0	ARSB	78286996	0.999000	0.42202	0.970000	0.41538	0.987000	0.75469	3.076000	0.50081	0.951000	0.37770	0.482000	0.46254	CAA			0.463	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226932.2		NM_000046	
POU4F3	5459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145719235	145719235	+	Missense_Mutation	SNP	C	C	A	rs145218099		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr5:145719235C>A	ENST00000230732.4	+	2	334	c.245C>A	c.(244-246)aCc>aAc	p.T82N	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	82					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCTACCATACCATGAGCAGC	0.647																																					p.T82N													.	.			0			c.C245A												140.0	127.0	131.0					5																	145719235		2203	4300	6503	SO:0001583	missense	5459	exon2			ACCATACCATGAG	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.245C>A	5.37:g.145719235C>A	ENSP00000230732:p.Thr82Asn		94	0	0		68	0.46	31	NM_002700	0		0	O60557|Q2M3F8	Missense_Mutation	SNP	ENST00000230732.4	37	CCDS4281.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807729	0.31961	.	.	ENSG00000091010	ENST00000230732	T	0.28069	1.63	4.63	4.63	0.57726	.	0.187571	0.45361	D	0.000362	T	0.31702	0.0805	M	0.73962	2.25	0.80722	D	1	P	0.38922	0.651	B	0.30251	0.113	T	0.23691	-1.0181	10	0.27785	T	0.31	.	16.4058	0.83669	0.0:1.0:0.0:0.0	.	82	Q15319	PO4F3_HUMAN	N	82	ENSP00000230732:T82N	ENSP00000230732:T82N	T	+	2	0	POU4F3	145699428	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.531000	0.81973	2.391000	0.81399	0.462000	0.41574	ACC			0.647	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251887.2		NM_002700	
SLIT3	6586	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	168678411	168678411	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr5:168678411G>T	ENST00000519560.1	-	2	669	c.250C>A	c.(250-252)Ctc>Atc	p.L84I	SLIT3_ENST00000521130.1_5'UTR|SLIT3_ENST00000332966.8_Missense_Mutation_p.L84I|SLIT3_ENST00000404867.3_Missense_Mutation_p.L84I	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	84					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTTCTTGAGCCCAGCGAAG	0.433																																					p.L84I	Ovarian(29;311 847 10864 17279 24903)												.	SLIT3	224		0			c.C250A												173.0	160.0	164.0					5																	168678411		2203	4300	6503	SO:0001583	missense	6586	exon2			TCTTGAGCCCAGC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.250C>A	5.37:g.168678411G>T	ENSP00000430333:p.Leu84Ile		67	0	0		44	0.09	4	NM_001271946	1	0.00	0	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244367	0.59103	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.35789	1.29;1.29;1.29	4.95	4.07	0.47477	.	0.000000	0.53938	D	0.000049	T	0.60843	0.2300	M	0.86178	2.8	0.39262	D	0.964238	D;D	0.89917	0.974;1.0	D;D	0.91635	0.953;0.999	T	0.66818	-0.5827	10	0.72032	D	0.01	.	9.667	0.39990	0.0984:0.0:0.9016:0.0	.	84;84	O75094-2;O75094	.;SLIT3_HUMAN	I	84	ENSP00000430333:L84I;ENSP00000332164:L84I;ENSP00000384890:L84I	ENSP00000332164:L84I	L	-	1	0	SLIT3	168610989	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	4.046000	0.57376	1.053000	0.40415	0.655000	0.94253	CTC			0.433	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252792.4		NM_003062	
HIST1H3G	8355	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26271526	26271526	+	Silent	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr6:26271526G>A	ENST00000305910.3	-	1	86	c.87C>T	c.(85-87)agC>agT	p.S29S	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	29					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						TGGCCGGCGCGCTTTTCCGAG	0.647																																					p.S29S													.	HIST1H3G	20		0			c.C87T												28.0	34.0	32.0					6																	26271526		2194	4290	6484	SO:0001819	synonymous_variant	8355	exon1			CGGCGCGCTTTTC	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.87C>T	6.37:g.26271526G>A			75	0.0133333333	1		86	0.56	48	NM_003534	4	0.75	3	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000305910.3	37	CCDS4602.1																																																																																					0.647	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040099.2		NM_003534	
TRERF1	55809	mdanderson.org	37	6	42227154	42227154	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr6:42227154C>T	ENST00000372922.4	-	9	2754	c.2192G>A	c.(2191-2193)gGc>gAc	p.G731D	TRERF1_ENST00000541110.1_Missense_Mutation_p.G751D|TRERF1_ENST00000354325.2_Missense_Mutation_p.G648D|TRERF1_ENST00000340840.2_Missense_Mutation_p.G648D|TRERF1_ENST00000372917.4_Missense_Mutation_p.G648D	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	731	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AGGGCCGTGGCCGGAGATGAG	0.701																																					p.G731D													.	.			0			c.G2192A												8.0	11.0	10.0					6																	42227154		2176	4217	6393	SO:0001583	missense	55809	exon9			CCGTGGCCGGAGA	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2192G>A	6.37:g.42227154C>T	ENSP00000362013:p.Gly731Asp		11	0	0		13	0.15	2	NM_033502	6	0.00	0	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.617604	0.66787	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.11385	2.95;2.78;2.93;2.78;2.78	5.36	4.47	0.54385	.	0.394097	0.21423	N	0.074797	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	P;P;P;P;D	0.54047	0.589;0.454;0.454;0.589;0.964	B;B;B;B;P	0.48598	0.229;0.115;0.115;0.229;0.583	T	0.39272	-0.9622	10	0.30854	T	0.27	-18.0152	8.0	0.30291	0.131:0.5745:0.2945:0.0	.	648;751;731;487;487	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	D	751;648;731;648;648	ENSP00000439689:G751D;ENSP00000362008:G648D;ENSP00000362013:G731D;ENSP00000339438:G648D;ENSP00000346285:G648D	ENSP00000339438:G648D	G	-	2	0	TRERF1	42335132	0.647000	0.27304	0.985000	0.45067	0.986000	0.74619	1.878000	0.39608	2.505000	0.84491	0.655000	0.94253	GGC			0.701	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040551.2		NM_033502	
MED23	9439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	131931259	131931259	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr6:131931259G>A	ENST00000368068.3	-	11	1183	c.1004C>T	c.(1003-1005)tCa>tTa	p.S335L	MED23_ENST00000368060.3_Missense_Mutation_p.S335L|MED23_ENST00000368053.4_Missense_Mutation_p.S341L|MED23_ENST00000354577.4_Missense_Mutation_p.S341L|MED23_ENST00000540546.1_Missense_Mutation_p.S341L|MED23_ENST00000545957.1_Missense_Mutation_p.S24L|MED23_ENST00000539158.1_Missense_Mutation_p.S335L|MED23_ENST00000368058.1_Missense_Mutation_p.S341L|MED23_ENST00000403834.3_Missense_Mutation_p.S341L	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	335					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GAGCTGACTTGAGAGATGCTG	0.458																																					p.S341L													.	.			0			c.C1022T												125.0	123.0	124.0					6																	131931259		2203	4300	6503	SO:0001583	missense	9439	exon12			TGACTTGAGAGAT	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1004C>T	6.37:g.131931259G>A	ENSP00000357047:p.Ser335Leu		106	0	0		108	0.68	73	NM_015979	14	0.64	9	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147793	0.78001	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957;ENST00000368053;ENST00000540546;ENST00000539158	T;T;T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.76	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.83617	0.5293	L	0.58810	1.83	0.80722	D	1	D;D;D;D	0.89917	0.999;0.981;1.0;0.999	D;D;D;D	0.85130	0.997;0.943;0.986;0.977	D	0.84692	0.0723	10	0.72032	D	0.01	0.0503	16.24	0.82402	0.0:0.0:0.8668:0.1332	.	24;341;335;341	B4E3G4;Q9ULK4-2;Q9ULK4;Q9ULK4-3	.;.;MED23_HUMAN;.	L	341;335;341;335;341;24;341;341;335	ENSP00000346588:S341L;ENSP00000357047:S335L;ENSP00000384536:S341L;ENSP00000357039:S335L;ENSP00000357037:S341L;ENSP00000439977:S24L;ENSP00000357032:S341L;ENSP00000437818:S341L;ENSP00000445072:S335L	ENSP00000346588:S341L	S	-	2	0	MED23	131972952	1.000000	0.71417	0.982000	0.44146	0.981000	0.71138	8.001000	0.88508	2.730000	0.93505	0.591000	0.81541	TCA			0.458	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000042215.1			
BAZ1B	9031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	72861685	72861685	+	Silent	SNP	A	A	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:72861685A>G	ENST00000339594.4	-	16	4091	c.3753T>C	c.(3751-3753)tcT>tcC	p.S1251S	BAZ1B_ENST00000404251.1_Silent_p.S1251S	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1251					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				CACTGTCCTCAGAAGCAGACT	0.453																																					p.S1251S	Esophageal Squamous(112;1167 1561 21085 43672 48228)												.	.			0			c.T3753C												128.0	116.0	120.0					7																	72861685		2203	4300	6503	SO:0001819	synonymous_variant	9031	exon16			GTCCTCAGAAGCA	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.3753T>C	7.37:g.72861685A>G			87	0	0		58	0.43	25	NM_032408	72	0.38	27	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	ENST00000339594.4	37	CCDS5549.1																																																																																					0.453	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252123.4		NM_032408	
PCLO	27445	mdanderson.org	37	7	82583012	82583012	+	Silent	SNP	T	T	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:82583012T>G	ENST00000333891.9	-	5	7594	c.7257A>C	c.(7255-7257)ccA>ccC	p.P2419P	PCLO_ENST00000423517.2_Silent_p.P2419P|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						gagggggtggtggtggaggag	0.507																																					p.P2419P													.	.			0			c.A7257C																																									SO:0001819	synonymous_variant	27445	exon5			GGGTGGTGGTGGA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7257A>C	7.37:g.82583012T>G			18	0.3333333333	6		12	0.25	3	NM_014510	0		0		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																					0.507	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337368.5		NM_014510	
NAPEPLD	222236	bcgsc.ca	37	7	102760577	102760577	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:102760577G>T	ENST00000417955.1	-	3	542	c.388C>A	c.(388-390)Ctg>Atg	p.L130M	NAPEPLD_ENST00000455523.2_Missense_Mutation_p.L203M|NAPEPLD_ENST00000427257.1_Missense_Mutation_p.L130M|NAPEPLD_ENST00000341533.4_Missense_Mutation_p.L130M|NAPEPLD_ENST00000465647.1_Missense_Mutation_p.L130M			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	130					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCATGTCCCAGCCATGTGACT	0.473																																					p.L130M													.	NAPEPLD	49		0			c.C388A												139.0	116.0	124.0					7																	102760577		2203	4300	6503	SO:0001583	missense	222236	exon3			GTCCCAGCCATGT	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.388C>A	7.37:g.102760577G>T	ENSP00000407112:p.Leu130Met		76	0	0		50	0.08	4	NM_001122838	12	0.00	0	Q5CZ87|Q769K1	Missense_Mutation	SNP	ENST00000417955.1	37	CCDS5729.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216562	0.79352	.	.	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523	D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.94621	0.8266	L	0.61218	1.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.985	D	0.93635	0.6959	10	0.48119	T	0.1	-34.7372	11.7782	0.51997	0.1349:0.0:0.8651:0.0	.	203;130	B4E3B0;Q6IQ20	.;NAPEP_HUMAN	M	130;130;130;130;203	ENSP00000340093:L130M;ENSP00000407112:L130M;ENSP00000419188:L130M;ENSP00000392775:L130M;ENSP00000414364:L203M	ENSP00000340093:L130M	L	-	1	2	NAPEPLD	102547813	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.846000	0.48262	2.865000	0.98341	0.655000	0.94253	CTG			0.473	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347904.1		NM_198990	
NAMPT	10135	broad.mit.edu	37	7	105893479	105893479	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:105893479A>G	ENST00000222553.3	-	10	1656	c.1349T>C	c.(1348-1350)cTt>cCt	p.L450P		NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	450					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						ATATTCCTCAAGGTCTCCTTT	0.398																																					p.L450P													.	NAMPT	37		0			c.T1349C												96.0	93.0	94.0					7																	105893479		2203	4300	6503	SO:0001583	missense	10135	exon10			TCCTCAAGGTCTC	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.1349T>C	7.37:g.105893479A>G	ENSP00000222553:p.Leu450Pro		246	0	0		186	0.03	5	NM_005746	68	0.00	0	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Missense_Mutation	SNP	ENST00000222553.3	37	CCDS5737.1	.	.	.	.	.	.	.	.	.	.	A	13.49	2.253644	0.39797	.	.	ENSG00000105835	ENST00000222553	.	.	.	5.36	5.36	0.76844	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.061211	0.64402	D	0.000002	T	0.28928	0.0718	N	0.02296	-0.605	0.80722	D	1	B	0.23185	0.081	B	0.20955	0.032	T	0.14062	-1.0486	9	0.26408	T	0.33	-3.0974	15.638	0.76970	1.0:0.0:0.0:0.0	.	450	P43490	NAMPT_HUMAN	P	450	.	ENSP00000222553:L450P	L	-	2	0	NAMPT	105680715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.423000	0.90264	2.158000	0.67659	0.533000	0.62120	CTT			0.398	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000277146.1		NM_182790	
OR2A25	392138	bcgsc.ca;mdanderson.org	37	7	143771911	143771911	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:143771911C>T	ENST00000408898.2	+	1	637	c.599C>T	c.(598-600)gCa>gTa	p.A200V		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					ATGGTTTTGGCAGGGGCAGTG	0.443																																					p.A200V													.	OR2A25	66		0			c.C599T												136.0	141.0	139.0					7																	143771911		2035	4219	6254	SO:0001583	missense	392138	exon1			TTTTGGCAGGGGC		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.599C>T	7.37:g.143771911C>T	ENSP00000386167:p.Ala200Val		127	0	0		105	0.05	5	NM_001004488	0		0	B2RNC9	Missense_Mutation	SNP	ENST00000408898.2	37	CCDS43669.1	.	.	.	.	.	.	.	.	.	.	C	0.184	-1.059463	0.01950	.	.	ENSG00000221933	ENST00000408898	T	0.00031	8.89	4.84	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.04880	-0.145	0.09310	N	1	B	0.17667	0.023	B	0.26693	0.072	T	0.15492	-1.0435	9	0.02654	T	1	-0.8758	5.336	0.15957	0.0:0.6776:0.0:0.3224	.	200	A4D2G3	O2A25_HUMAN	V	200	ENSP00000386167:A200V	ENSP00000386167:A200V	A	+	2	0	OR2A25	143402844	0.000000	0.05858	0.767000	0.31495	0.009000	0.06853	-0.035000	0.12205	1.262000	0.44165	0.563000	0.77884	GCA			0.443	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350000.1			
ESYT2	57488	bcgsc.ca	37	7	158552222	158552222	+	Silent	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr7:158552222G>T	ENST00000251527.5	-	13	1583	c.1518C>A	c.(1516-1518)tcC>tcA	p.S506S		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	534					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						GCAATGCAGAGGAAAGACCAT	0.468																																					p.S506S													ESYT2,colon,carcinoma,-2,1	ESYT2	70	1	0			c.C1518A												170.0	147.0	154.0					7																	158552222		2203	4300	6503	SO:0001819	synonymous_variant	57488	exon13			TGCAGAGGAAAGA	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1518C>A	7.37:g.158552222G>T			69	0	0		48	0.08	4	NM_020728	44	0.00	0	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	ENST00000251527.5	37	CCDS34791.1																																																																																					0.468	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322647.1		NM_020728	
LYPLA1	10434	mdanderson.org	37	8	54965242	54965242	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr8:54965242C>T	ENST00000316963.3	-	7	628	c.435G>A	c.(433-435)tgG>tgA	p.W145*	LYPLA1_ENST00000522007.1_Intron|LYPLA1_ENST00000519926.1_5'Flank|LYPLA1_ENST00000343231.6_Nonsense_Mutation_p.W129*	NM_001279360.1|NM_006330.2	NP_001266289.1|NP_006321.1	O75608	LYPA1_HUMAN	lysophospholipase I	145					fatty acid metabolic process (GO:0006631)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|nitric oxide metabolic process (GO:0046209)|protein depalmitoylation (GO:0002084)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	lysophospholipase activity (GO:0004622)|palmitoyl-(protein) hydrolase activity (GO:0008474)	p.W145C(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)	6		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			GAAGTGGAAGCCAGCAACTGA	0.448																																					p.W145X													LYPLA1,colon,carcinoma,0,2	LYPLA1	0	2	1	Substitution - Missense(1)	central_nervous_system(1)	c.G435A												71.0	64.0	67.0					8																	54965242		2203	4300	6503	SO:0001587	stop_gained	10434	exon7			TGGAAGCCAGCAA	AF081281	CCDS6157.1, CCDS64899.1, CCDS75738.1, CCDS75739.1	8q11.23-q12.1	2008-05-15			ENSG00000120992	ENSG00000120992	3.1.1.5		6737	protein-coding gene	gene with protein product		605599				10064899	Standard	NM_006330		Approved	LPL1	uc003xry.3	O75608	OTTHUMG00000164313	ENST00000316963.3:c.435G>A	8.37:g.54965242C>T	ENSP00000320043:p.Trp145*		60	0	0		46	0.07	3	NM_006330	53	0.00	0	O43202|Q9UQF9	Nonsense_Mutation	SNP	ENST00000316963.3	37	CCDS6157.1	.	.	.	.	.	.	.	.	.	.	C	36	5.737925	0.96865	.	.	ENSG00000120992	ENST00000316963;ENST00000343231;ENST00000521171;ENST00000518546;ENST00000521352	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9796	18.0108	0.89222	0.0:1.0:0.0:0.0	.	.	.	.	X	145;129;54;129;81	.	ENSP00000320043:W145X	W	-	3	0	LYPLA1	55127795	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.510000	0.81708	2.414000	0.81942	0.650000	0.86243	TGG			0.448	LYPLA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378238.1			
GSDMD	79792	mdanderson.org	37	8	144644277	144644277	+	Silent	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr8:144644277G>T	ENST00000526406.1	+	11	1855	c.972G>T	c.(970-972)ctG>ctT	p.L324L	GSDMD_ENST00000533063.1_Silent_p.L372L|GSDMD_ENST00000262580.4_Silent_p.L324L	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	324					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						GGGACCAGCTGGCCCTGCGAG	0.687																																					p.L324L													.	.			0			c.G972T												29.0	32.0	31.0					8																	144644277		2200	4300	6500	SO:0001819	synonymous_variant	79792	exon11			CCAGCTGGCCCTG	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.972G>T	8.37:g.144644277G>T			15	0	0		18	0.11	2	NM_001166237	31	0.00	0	D3DWJ9|Q96Q98	Silent	SNP	ENST00000526406.1	37	CCDS34956.1	.	.	.	.	.	.	.	.	.	.	G	3.510	-0.100032	0.07010	.	.	ENSG00000104518	ENST00000525208	.	.	.	4.39	-3.56	0.04626	.	.	.	.	.	T	0.17619	0.0423	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24584	-1.0156	4	.	.	.	-12.5715	1.164	0.01811	0.3596:0.2755:0.2325:0.1324	.	.	.	.	C	20	.	.	G	+	1	0	GSDMD	144715420	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.337000	0.07852	-0.763000	0.04658	-0.390000	0.06520	GGC			0.687	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382046.3		NM_024736	
KIFC2	90990	mdanderson.org	37	8	145692490	145692490	+	Silent	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr8:145692490C>T	ENST00000301332.2	+	3	704	c.327C>T	c.(325-327)ggC>ggT	p.G109G	CYHR1_ENST00000403000.2_5'Flank|CYHR1_ENST00000424149.2_5'Flank|CYHR1_ENST00000438911.2_5'Flank|CYHR1_ENST00000306145.5_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|KIFC2_ENST00000301331.5_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	109					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CGGACCTGGGCCAGGTGAGCG	0.711											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G109G													.	.			0			c.C327T												9.0	12.0	11.0					8																	145692490		2147	4227	6374	SO:0001819	synonymous_variant	90990	exon3			CCTGGGCCAGGTG	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.327C>T	8.37:g.145692490C>T			57	0	0	1696	31	0.10	3	NM_145754	25	0.00	0	E9PHB2|Q96NN6	Silent	SNP	ENST00000301332.2	37	CCDS6427.1																																																																																					0.711	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382052.2		NM_145754	
PPP1R16A	84988	mdanderson.org	37	8	145722649	145722649	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr8:145722649G>T	ENST00000292539.4	+	2	989	c.72G>T	c.(70-72)aaG>aaT	p.K24N	PPP1R16A_ENST00000435887.1_Missense_Mutation_p.K24N|PPP1R16A_ENST00000529009.1_3'UTR|CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	24						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AGCGGCTGAAGCATGCCCAGA	0.682																																					p.K24N													.	.			0			c.G72T												28.0	26.0	27.0					8																	145722649		2196	4296	6492	SO:0001583	missense	84988	exon1			GCTGAAGCATGCC		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.72G>T	8.37:g.145722649G>T	ENSP00000292539:p.Lys24Asn		35	0	0		36	0.08	3	NM_032902	109	0.00	0	D3DWM5	Missense_Mutation	SNP	ENST00000292539.4	37	CCDS6429.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102087	0.76983	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.72051	-0.62;-0.62	4.81	1.52	0.23074	.	0.000000	0.85682	D	0.000000	T	0.62258	0.2413	M	0.66506	2.035	0.52501	D	0.999957	P	0.42483	0.781	B	0.41466	0.358	T	0.55939	-0.8061	10	0.14252	T	0.57	.	6.8242	0.23874	0.3956:0.0:0.6044:0.0	.	24	Q96I34	PP16A_HUMAN	N	24	ENSP00000292539:K24N;ENSP00000391126:K24N	ENSP00000292539:K24N	K	+	3	2	PPP1R16A	145693457	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.494000	0.35616	0.465000	0.27167	0.462000	0.41574	AAG			0.682	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382459.1		NM_032902	
TAF1L	138474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32632961	32632961	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:32632961G>A	ENST00000242310.4	-	1	2706	c.2617C>T	c.(2617-2619)Cgc>Tgc	p.R873C	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	873					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCCCTGTGCGTTTGAAGTCA	0.483																																					p.R873C													TAF1L,rectum,carcinoma,0,2	TAF1L	0	2	0			c.C2617T												147.0	147.0	147.0					9																	32632961		2203	4300	6503	SO:0001583	missense	138474	exon1			CTGTGCGTTTGAA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2617C>T	9.37:g.32632961G>A	ENSP00000418379:p.Arg873Cys		332	0	0		372	0.31	115	NM_153809	1	0.00	0	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548593	0.45383	.	.	ENSG00000122728	ENST00000242310	T	0.20332	2.08	1.19	1.19	0.21007	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55231	-0.8173	10	0.87932	D	0	.	7.8312	0.29344	0.0:0.0:1.0:0.0	.	873	Q8IZX4	TAF1L_HUMAN	C	873	ENSP00000418379:R873C	ENSP00000418379:R873C	R	-	1	0	TAF1L	32622961	1.000000	0.71417	0.996000	0.52242	0.703000	0.40648	6.138000	0.71717	0.632000	0.30432	0.195000	0.17529	CGC			0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052012.2			
Unknown	0	bcgsc.ca	37	9	45363836	45363836	+	IGR	SNP	G	G	A	rs112572669		TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:45363836G>A								RP11-449H15.2 (151335 upstream) : RP11-187C18.5 (30008 downstream)																							GAGACAGAGCGGAACGCCCAC	0.577																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100289027	.			CAGAGCGGAACGC																													9.37:g.45363836G>A			30	0	0		17	0.24	4	.	5	0.00	0		RNA	SNP		37																																																																																					0	0.577										
NIPSNAP3A	25934	bcgsc.ca	37	9	107510105	107510105	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:107510105C>T	ENST00000374767.4	+	1	137	c.32C>T	c.(31-33)gCg>gTg	p.A11V		NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)	11						cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CTGACTCGGGCGCTGGCCTCA	0.682																																					p.A11V													.	NIPSNAP3A	18		0			c.C32T												11.0	13.0	12.0					9																	107510105		2195	4281	6476	SO:0001583	missense	25934	exon1			CTCGGGCGCTGGC	BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.32C>T	9.37:g.107510105C>T	ENSP00000363899:p.Ala11Val		37	0	0		30	0.13	4	NM_015469	54	0.00	0	A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	Missense_Mutation	SNP	ENST00000374767.4	37	CCDS6760.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504959	0.64410	.	.	ENSG00000136783	ENST00000374767	T	0.56611	0.45	3.67	-1.46	0.08800	.	0.688763	0.13796	N	0.362143	T	0.42108	0.1188	L	0.53249	1.67	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.34527	-0.9825	10	0.48119	T	0.1	.	7.3163	0.26503	0.0:0.4292:0.0:0.5708	.	11;11	B4DW81;Q9UFN0	.;NPS3A_HUMAN	V	11	ENSP00000363899:A11V	ENSP00000363899:A11V	A	+	2	0	NIPSNAP3A	106549926	0.000000	0.05858	0.001000	0.08648	0.107000	0.19398	-0.194000	0.09559	-0.305000	0.08831	0.563000	0.77884	GCG			0.682	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053484.1		NM_015469	
PIP5KL1	138429	mdanderson.org	37	9	130687406	130687406	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:130687406G>T	ENST00000388747.4	-	9	941	c.897C>A	c.(895-897)agC>agA	p.S299R	PIP5KL1_ENST00000300432.3_Missense_Mutation_p.S96R|PIP5KL1_ENST00000490773.1_5'Flank	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	299	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						GGAAGATGAGGCTGCTGCCCG	0.602																																					p.S299R													.	.			0			c.C897A												77.0	81.0	80.0					9																	130687406		2203	4300	6503	SO:0001583	missense	138429	exon9			GATGAGGCTGCTG	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.897C>A	9.37:g.130687406G>T	ENSP00000373399:p.Ser299Arg		68	0	0		46	0.07	3	NM_001135219	7	0.00	0	Q8IVS3	Missense_Mutation	SNP	ENST00000388747.4	37	CCDS48030.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632750	0.29068	.	.	ENSG00000167103	ENST00000388747;ENST00000300432	T;T	0.36340	1.26;1.26	4.83	0.799	0.18667	Phosphatidylinositol-4-phosphate 5-kinase, core (2);	1.101760	0.06748	N	0.779531	T	0.32675	0.0837	L	0.46885	1.475	0.09310	N	1	B	0.25206	0.12	B	0.31016	0.123	T	0.37291	-0.9712	10	0.17832	T	0.49	-3.7642	9.502	0.39024	0.3155:0.0:0.6845:0.0	.	299	Q5T9C9	PI5L1_HUMAN	R	299;96	ENSP00000373399:S299R;ENSP00000300432:S96R	ENSP00000300432:S96R	S	-	3	2	PIP5KL1	129727227	0.011000	0.17503	0.002000	0.10522	0.185000	0.23345	1.132000	0.31418	0.186000	0.20125	0.491000	0.48974	AGC			0.602	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054289.2		NM_173492	
PIP5KL1	138429	mdanderson.org	37	9	130692148	130692148	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:130692148G>T	ENST00000388747.4	-	2	91	c.47C>A	c.(46-48)cCt>cAt	p.P16H	PIP5KL1_ENST00000300432.3_5'Flank|PIP5KL1_ENST00000490773.1_5'Flank	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	16						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						TCCAGCCTCAGGGGAGGGGGC	0.637																																					p.P16H													.	.			0			c.C47A												6.0	8.0	7.0					9																	130692148		1461	3345	4806	SO:0001583	missense	138429	exon2			GCCTCAGGGGAGG	BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.47C>A	9.37:g.130692148G>T	ENSP00000373399:p.Pro16His		26	0	0		24	0.08	2	NM_001135219	0		0	Q8IVS3	Missense_Mutation	SNP	ENST00000388747.4	37	CCDS48030.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345142	0.24426	.	.	ENSG00000167103	ENST00000388747	T	0.43294	0.95	4.99	4.06	0.47325	.	0.320500	0.25854	N	0.027861	T	0.33904	0.0879	N	0.24115	0.695	0.80722	D	1	D	0.56746	0.977	P	0.49708	0.62	T	0.03249	-1.1056	10	0.19147	T	0.46	-4.1217	10.7221	0.46046	0.0:0.0:0.8092:0.1908	.	16	Q5T9C9	PI5L1_HUMAN	H	16	ENSP00000373399:P16H	ENSP00000373399:P16H	P	-	2	0	PIP5KL1	129731969	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	2.536000	0.45693	1.146000	0.42352	0.561000	0.74099	CCT			0.637	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054289.2		NM_173492	
NELFB	25920	mdanderson.org	37	9	140150062	140150062	+	Splice_Site	SNP	A	A	G			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr9:140150062A>G	ENST00000343053.4	+	1	438	c.101A>G	c.(100-102)cAg>cGg	p.Q34R		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	34					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GAGCAGTTCCAGGTggggcgg	0.716																																					p.Q34R													.	.			0			c.A101G												10.0	9.0	10.0					9																	140150062		1981	3901	5882	SO:0001630	splice_region_variant	25920	exon1			AGTTCCAGGTGGG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.102+1A>G	9.37:g.140150062A>G			60	0.0166666667	1		43	0.07	3	NM_015456	99	0.00	0	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.991260	0.93106	.	.	ENSG00000188986	ENST00000343053	.	.	.	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.74981	0.3788	M	0.73217	2.22	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.76804	-0.2824	9	0.59425	D	0.04	-45.9688	10.4726	0.44646	1.0:0.0:0.0:0.0	.	34	Q8WX92	NELFB_HUMAN	R	34	.	ENSP00000339495:Q34R	Q	+	2	0	COBRA1	139269883	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.190000	0.72057	1.752000	0.51891	0.459000	0.35465	CAG			0.716	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254710.1		NM_015456	Missense_Mutation
MT-CO3	4514	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	9637	9637	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chrM:9637T>C	ENST00000362079.2	+	1	431	c.431T>C	c.(430-432)aTc>aCc	p.I144T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	144					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AGGAGTATCAATCACCTGAGC	0.453																																					p.I144T													.	.			0			c.T431C																																									SO:0001583	missense	5742	exon1			TATCAATCACCTG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.431T>C	M.37:g.9637T>C	ENSP00000354982:p.Ile144Thr		38	0	0		24	0.46	11	ENST00000362079	0		0	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	37																																																																																						0.453	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024032	
CYP4F8	11283	hgsc.bcm.edu	37	19	15733939	15733939	+	RNA	SNP	G	G	T			TCGA-XE-AAOC-01A-11D-A435-10	TCGA-XE-AAOC-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	a95086d9-5cf6-47ea-b486-7459507723c9	aaba5832-4495-4245-a564-32b35dff3387	g.chr19:15733939G>T	ENST00000441682.2	+	0	733							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						ATATTACTGCGATCATGGAGC	0.537																																					.													.	.			0			.												44.0	48.0	46.0					19																	15733939		2200	4299	6499			11283	.			TACTGCGATCATG	AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15733939G>T			83	0	0		85	0.05	4	.	0		0		Silent	SNP	ENST00000441682.2	37																																																																																						0.537	CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript				NM_007253	
