#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CEP104	9731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	3740039	3740039	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:3740039C>T	ENST00000378230.3	-	19	2776	c.2452G>A	c.(2452-2454)Gct>Act	p.A818T		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	818						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						TTGAAAACAGCCTCACTGCAA	0.532																																					p.A818T													CEP104,NS,carcinoma,+1,1	CEP104	1	1	0			c.G2452A												192.0	166.0	174.0					1																	3740039		2203	4300	6503	SO:0001583	missense	9731	exon19			AAACAGCCTCACT	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2452G>A	1.37:g.3740039C>T	ENSP00000367476:p.Ala818Thr		126	0.0079365079	1		100	0.12	12	NM_014704	21	0.19	4	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	C	36	5.788094	0.96945	.	.	ENSG00000116198	ENST00000378230	T	0.43688	0.94	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73751	-0.3884	10	0.52906	T	0.07	.	18.7848	0.91949	0.0:1.0:0.0:0.0	.	818	O60308	CE104_HUMAN	T	818	ENSP00000367476:A818T	ENSP00000367476:A818T	A	-	1	0	CEP104	3729899	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.045000	0.76585	2.670000	0.90874	0.655000	0.94253	GCT			0.532	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009747.3		NM_014704	
CROCC	9696	broad.mit.edu;mdanderson.org	37	1	17250898	17250898	+	Missense_Mutation	SNP	G	G	T	rs146983726		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:17250898G>T	ENST00000375541.5	+	3	344	c.275G>T	c.(274-276)cGc>cTc	p.R92L	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGCTGTCCCGCGTGGAGGAC	0.662																																					p.R92L													CROCC,NS,carcinoma,+1,1	CROCC	185	1	0			c.G275T												42.0	34.0	37.0					1																	17250898		2203	4300	6503	SO:0001583	missense	9696	exon3			TGTCCCGCGTGGA	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.275G>T	1.37:g.17250898G>T	ENSP00000364691:p.Arg92Leu		60	0	0		74	0.05	4	NM_014675	5	0.00	0		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171469	0.78452	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.26223	1.75	4.88	4.88	0.63580	.	.	.	.	.	T	0.50463	0.1617	M	0.72118	2.19	0.45378	D	0.998367	D	0.89917	1.0	D	0.87578	0.998	T	0.53844	-0.8381	9	0.87932	D	0	.	15.1328	0.72539	0.0:0.0:1.0:0.0	.	92	Q5TZA2	CROCC_HUMAN	L	92;63	ENSP00000364691:R92L	ENSP00000364691:R92L	R	+	2	0	CROCC	17123485	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	8.681000	0.91228	2.423000	0.82170	0.591000	0.81541	CGC			0.662	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006249.2		NM_014675	
C1QC	714	mdanderson.org	37	1	22973860	22973860	+	Missense_Mutation	SNP	C	C	T	rs139780188		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:22973860C>T	ENST00000374639.3	+	3	440	c.322C>T	c.(322-324)Cca>Tca	p.P108S	C1QC_ENST00000374640.4_Missense_Mutation_p.P108S|C1QC_ENST00000374637.1_Missense_Mutation_p.P108S	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	108	Collagen-like.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCCTGGAGAGCCAGGTGAGGA	0.622																																					p.P108S	Ovarian(26;671 750 8290 29071 43278)												.	.			0			c.C322T							C	SER/PRO,SER/PRO	1,4405	2.1+/-5.4	0,1,2202	58.0	62.0	60.0		322,322	4.9	1.0	1	dbSNP_134	60	0,8600		0,0,4300	no	missense,missense	C1QC	NM_001114101.1,NM_172369.3	74,74	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	108/246,108/246	22973860	1,13005	2203	4300	6503	SO:0001583	missense	714	exon3			GGAGAGCCAGGTG	AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.322C>T	1.37:g.22973860C>T	ENSP00000363770:p.Pro108Ser		77	0	0		40	0.08	3	NM_001114101	740	0.00	0	Q7Z502|Q96DL2|Q96H05	Missense_Mutation	SNP	ENST00000374639.3	37	CCDS227.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.161745	0.38119	2.27E-4	0.0	ENSG00000159189	ENST00000374640;ENST00000374639;ENST00000374637	D;D;D	0.96802	-4.13;-4.13;-4.13	4.94	4.94	0.65067	.	0.329446	0.31834	N	0.006988	D	0.96062	0.8717	M	0.73598	2.24	0.09310	N	1	D	0.55172	0.97	P	0.48425	0.577	D	0.91866	0.5503	10	0.42905	T	0.14	.	12.7121	0.57096	0.1653:0.8347:0.0:0.0	.	108	P02747	C1QC_HUMAN	S	108	ENSP00000363771:P108S;ENSP00000363770:P108S;ENSP00000363768:P108S	ENSP00000363768:P108S	P	+	1	0	C1QC	22846447	0.195000	0.23338	0.994000	0.49952	0.757000	0.42996	1.938000	0.40203	2.280000	0.76307	0.561000	0.74099	CCA	0		0.622	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008083.1		NM_172369	
BAI2	576	broad.mit.edu	37	1	32221746	32221746	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:32221746G>C	ENST00000373658.3	-	4	1033	c.692C>G	c.(691-693)gCc>gGc	p.A231G	MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398542.1_Missense_Mutation_p.A219G|BAI2_ENST00000373655.2_Missense_Mutation_p.A231G|BAI2_ENST00000257070.4_Missense_Mutation_p.A231G|BAI2_ENST00000398538.1_Missense_Mutation_p.A219G|BAI2_ENST00000398547.1_Missense_Mutation_p.A219G|BAI2_ENST00000398556.3_Missense_Mutation_p.A234G|BAI2_ENST00000527361.1_Missense_Mutation_p.A231G	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	231					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A231G(2)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGTGGAGCCGGCCCCCGCCTC	0.711																																					p.A231G													BAI2,NS,carcinoma,0,1	BAI2	128	1	2	Substitution - Missense(2)	lung(2)	c.C692G												25.0	33.0	30.0					1																	32221746		2201	4297	6498	SO:0001583	missense	576	exon4			GAGCCGGCCCCCG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.692C>G	1.37:g.32221746G>C	ENSP00000362762:p.Ala231Gly		49	0.3469387755	17		54	0.28	15	NM_001703	0		0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	2.541	-0.306384	0.05458	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.45276	1.59;1.79;0.95;0.95;1.96;0.9;0.9;0.98;1.58;1.43	5.08	4.17	0.49024	.	0.353687	0.20794	N	0.085578	T	0.20901	0.0503	N	0.08118	0	0.43122	D	0.994846	B;B;B;B;B;B	0.30281	0.0;0.275;0.054;0.001;0.026;0.015	B;B;B;B;B;B	0.26614	0.0;0.071;0.047;0.001;0.034;0.015	T	0.07443	-1.0772	10	0.25751	T	0.34	.	9.8209	0.40883	0.0967:0.0:0.9033:0.0	.	219;231;219;219;231;231	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	G	234;219;231;231;219;231;231;219;224;265	ENSP00000381564:A234G;ENSP00000381555:A219G;ENSP00000362762:A231G;ENSP00000362759:A231G;ENSP00000381550:A219G;ENSP00000257070:A231G;ENSP00000435397:A231G;ENSP00000381548:A219G;ENSP00000410921:A224G;ENSP00000437219:A265G	ENSP00000257070:A231G	A	-	2	0	BAI2	31994333	0.014000	0.17966	0.066000	0.19879	0.322000	0.28314	1.196000	0.32198	1.283000	0.44513	0.462000	0.41574	GCC			0.711	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000381838.1		NM_001703	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39818746	39818746	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:39818746C>T	ENST00000372915.3	+	43	11369	c.11282C>T	c.(11281-11283)tCa>tTa	p.S3761L	MACF1_ENST00000567887.1_Missense_Mutation_p.S3793L|MACF1_ENST00000564288.1_Missense_Mutation_p.S3756L|MACF1_ENST00000539005.1_Missense_Mutation_p.S1694L|MACF1_ENST00000317713.7_Missense_Mutation_p.S1694L|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.S1694L|MACF1_ENST00000361689.2_Missense_Mutation_p.S1694L|MACF1_ENST00000289893.4_Missense_Mutation_p.S2196L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3761					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGGGTAACTTCAGTAGGATCA	0.517																																					p.S1694L													.	.			0			c.C5081T												101.0	89.0	93.0					1																	39818746		2203	4300	6503	SO:0001583	missense	23499	exon40			TAACTTCAGTAGG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11282C>T	1.37:g.39818746C>T	ENSP00000362006:p.Ser3761Leu		98	0	0		84	0.11	9	NM_012090	6	0.17	1	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	13.03	2.115332	0.37339	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000530262;ENST00000289893	T;T;T;T;T;D;T	0.87571	-0.01;0.01;-0.01;-0.04;0.16;-2.27;1.11	5.53	4.61	0.57282	.	0.577168	0.15708	N	0.248548	D	0.85274	0.5659	L	0.57536	1.79	0.58432	D	0.999998	B;B;B;B	0.11235	0.0;0.001;0.004;0.003	B;B;B;B	0.14578	0.004;0.007;0.011;0.005	T	0.80460	-0.1373	10	0.37606	T	0.19	.	14.8722	0.70465	0.0:0.7279:0.2721:0.0	.	3761;1694;1694;1659	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	MACF1_HUMAN;.;.;.	L	1694;3761;1694;1694;1694;1843;2196	ENSP00000439537:S1694L;ENSP00000362006:S3761L;ENSP00000354573:S1694L;ENSP00000313438:S1694L;ENSP00000444364:S1694L;ENSP00000437059:S1843L;ENSP00000289893:S2196L	ENSP00000289893:S2196L	S	+	2	0	MACF1	39591333	0.973000	0.33851	0.934000	0.37439	0.605000	0.37080	2.477000	0.45180	1.313000	0.45069	0.555000	0.69702	TCA			0.517	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000392096.1		NM_033044	
ZMPSTE24	10269	mdanderson.org	37	1	40747141	40747141	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:40747141G>T	ENST00000372759.3	+	7	1061	c.896G>T	c.(895-897)gGc>gTc	p.G299V		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	299					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GAGGATTCTGGCATGGAACCC	0.358																																					p.G299V													.	.			0			c.G896T												82.0	84.0	84.0					1																	40747141		2203	4300	6503	SO:0001583	missense	10269	exon7			ATTCTGGCATGGA	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.896G>T	1.37:g.40747141G>T	ENSP00000361845:p.Gly299Val		133	0	0		119	0.04	5	NM_005857	26	0.00	0	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	ENST00000372759.3	37	CCDS449.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234768	0.39498	.	.	ENSG00000084073	ENST00000372759	D	0.82526	-1.62	5.65	4.69	0.59074	.	0.272209	0.29822	N	0.011108	T	0.74906	0.3778	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.69881	-0.5025	10	0.38643	T	0.18	-16.7316	15.4572	0.75325	0.0:0.1514:0.8486:0.0	.	299	O75844	FACE1_HUMAN	V	299	ENSP00000361845:G299V	ENSP00000361845:G299V	G	+	2	0	ZMPSTE24	40519728	0.944000	0.32072	1.000000	0.80357	0.980000	0.70556	1.672000	0.37523	2.655000	0.90218	0.655000	0.94253	GGC			0.358	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000015766.1			
CYP2J2	1573	mdanderson.org	37	1	60370571	60370571	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:60370571G>T	ENST00000371204.3	-	7	1206	c.1163C>A	c.(1162-1164)aCc>aAc	p.T388N	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	388					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)			NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	AGCCAAAGTGGTATCAACTGT	0.498																																					p.T388N													.	.			0			c.C1163A												132.0	103.0	112.0					1																	60370571		2203	4300	6503	SO:0001583	missense	1573	exon7			AAAGTGGTATCAA	BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.1163C>A	1.37:g.60370571G>T	ENSP00000360247:p.Thr388Asn		61	0	0		38	0.08	3	NM_000775	3	0.00	0	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425985	0.43020	.	.	ENSG00000134716	ENST00000371204	T	0.70164	-0.46	5.95	4.08	0.47627	.	0.209202	0.49916	D	0.000127	D	0.87346	0.6154	H	0.98901	4.365	0.36380	D	0.861861	P	0.36125	0.538	P	0.59171	0.853	D	0.89781	0.3961	10	0.87932	D	0	.	7.0954	0.25307	0.1443:0.1492:0.7065:0.0	.	388	P51589	CP2J2_HUMAN	N	388	ENSP00000360247:T388N	ENSP00000360247:T388N	T	-	2	0	CYP2J2	60143159	1.000000	0.71417	0.587000	0.28692	0.034000	0.12701	3.569000	0.53827	1.528000	0.49103	-0.150000	0.13652	ACC			0.498	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000024940.1		NM_000775	
BCL2L15	440603	hgsc.bcm.edu	37	1	114423856	114423856	+	Intron	SNP	T	T	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:114423856T>C	ENST00000393316.3	-	4	646				BCL2L15_ENST00000393320.3_Intron|BCL2L15_ENST00000471267.1_Intron|AP4B1-AS1_ENST00000419536.1_RNA|BCL2L15_ENST00000488450.1_Intron	NM_001010922.2	NP_001010922.1	Q5TBC7	B2L15_HUMAN	BCL2-like 15						apoptotic process (GO:0006915)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)	9	Lung SC(450;0.184)	all_cancers(81;3.95e-08)|all_epithelial(167;9.95e-08)|all_lung(203;1.31e-05)|Lung NSC(69;2.46e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCCAGGAAATGTAGCTCTTA	0.398																																					.													.	.			0			.																																									SO:0001627	intron_variant	100287722	.			AGGAAATGTAGCT		CCDS30809.1	1p13.2	2014-03-07			ENSG00000188761	ENSG00000188761			33624	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 178"""	C1orf178		12700646, 15961081, 16690252, 17412810	Standard	NM_001010922		Approved	Bfk, FLJ22588	uc001edw.3	Q5TBC7	OTTHUMG00000011940	ENST00000393316.3:c.475-94A>G	1.37:g.114423856T>C			93	0	0		93	0.16	15	.	0		0	A0PJY6|A8K074|I6LA82	RNA	SNP	ENST00000393316.3	37	CCDS30809.1																																																																																					0.398	BCL2L15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033026.2		NM_001010922	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,0,2068	NRAS	0	2068	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A												180.0	156.0	164.0					1																	115256530		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CTTCTTGTCCAGC	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys		85	0	0		102	0.17	17	NM_002524	18	0.22	4	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA			0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
LOC645166	645166	ucsc.edu	37	1	148933289	148933289	+	lincRNA	SNP	A	A	G	rs9729175	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:148933289A>G	ENST00000539543.1	+	0	176					NR_027355.2																						TGCTGCCCGCAGGATATTGTG	0.562													.|||	630	0.125799	0.112	0.1282	5008	,	,		27649	0.1796		0.0656	False		,,,				2504	0.1493				.													.	.			0			c.236-2A>G																																											645166	exon3			GCCCGCAGGATAT																													1.37:g.148933289A>G			75	0.0666666667	5		66	0.18	12	NR_027355	1	0.00	0		Splice_Site	SNP	ENST00000539543.1	37																																																																																						0.562	RP11-14N7.2-201	KNOWN	basic	lincRNA	lincRNA					
TCHH	7062	broad.mit.edu	37	1	152082220	152082220	+	Missense_Mutation	SNP	G	G	T	rs113946258	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:152082220G>T	ENST00000368804.1	-	2	3472	c.3473C>A	c.(3472-3474)cCg>cAg	p.P1158Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1158	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTCTTCTCCGGTTCCTCTCT	0.592																																					p.P1158Q													.	TCHH	275		0			c.C3473A												71.0	70.0	70.0					1																	152082220		1986	4171	6157	SO:0001583	missense	7062	exon3			TTCTCCGGTTCCT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3473C>A	1.37:g.152082220G>T	ENSP00000357794:p.Pro1158Gln		80	0	0		92	0.03	3	NM_007113	1	0.00	0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	2.075	-0.412056	0.04799	.	.	ENSG00000159450	ENST00000368804	T	0.05025	3.51	1.86	-3.72	0.04411	.	.	.	.	.	T	0.00608	0.0020	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.47674	-0.9099	9	0.13470	T	0.59	.	1.558	0.02589	0.2814:0.2588:0.3346:0.1252	.	1158	Q07283	TRHY_HUMAN	Q	1158	ENSP00000357794:P1158Q	ENSP00000357794:P1158Q	P	-	2	0	TCHH	150348844	0.000000	0.05858	0.024000	0.17045	0.006000	0.05464	-6.257000	0.00073	-1.230000	0.02561	-1.439000	0.01073	CCG			0.592	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036671.2		NM_007113	
FLG	2312	mdanderson.org	37	1	152276368	152276368	+	Missense_Mutation	SNP	C	C	G	rs201216189		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:152276368C>G	ENST00000368799.1	-	3	11029	c.10994G>C	c.(10993-10995)aGt>aCt	p.S3665T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3665	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCACTGTCACTGGCCTGACT	0.587									Ichthyosis																												p.S3665T													FLG,NS,carcinoma,0,1	FLG	0	1	0			c.G10994C												34.0	36.0	36.0					1																	152276368		2201	4268	6469	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTGTCACTGGCCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10994G>C	1.37:g.152276368C>G	ENSP00000357789:p.Ser3665Thr		92	0	0		119	0.03	4	NM_002016	7	0.00	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369374	0.24771	.	.	ENSG00000143631	ENST00000368799	T	0.08008	3.14	4.62	1.67	0.24075	.	.	.	.	.	T	0.04724	0.0128	M	0.69823	2.125	0.09310	N	1	B	0.31383	0.321	B	0.42112	0.376	T	0.45731	-0.9241	9	0.15499	T	0.54	.	6.3601	0.21422	0.0:0.5359:0.3655:0.0986	.	3665	P20930	FILA_HUMAN	T	3665	ENSP00000357789:S3665T	ENSP00000357789:S3665T	S	-	2	0	FLG	150542992	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.297000	0.08276	0.647000	0.30713	0.552000	0.68991	AGT			0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
FLG	2312	mdanderson.org	37	1	152276386	152276386	+	Missense_Mutation	SNP	G	G	T	rs199655799		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:152276386G>T	ENST00000368799.1	-	3	11011	c.10976C>A	c.(10975-10977)tCc>tAc	p.S3659Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3659	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTACCACTGGACCCTCGGTG	0.587									Ichthyosis																												p.S3659Y													FLG,NS,carcinoma,-1,1	FLG	-1	1	0			c.C10976A												34.0	37.0	36.0					1																	152276386		2198	4265	6463	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCACTGGACCCTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10976C>A	1.37:g.152276386G>T	ENSP00000357789:p.Ser3659Tyr		85	0	0		106	0.04	4	NM_002016	11	0.00	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490828	0.26774	.	.	ENSG00000143631	ENST00000368799	T	0.09073	3.02	4.47	2.48	0.30137	.	.	.	.	.	T	0.02455	0.0075	M	0.64997	1.995	0.09310	N	1	B	0.27416	0.178	B	0.35039	0.194	T	0.48703	-0.9012	9	0.02654	T	1	.	5.7821	0.18312	0.1012:0.0:0.7095:0.1893	.	3659	P20930	FILA_HUMAN	Y	3659	ENSP00000357789:S3659Y	ENSP00000357789:S3659Y	S	-	2	0	FLG	150543010	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.583000	0.23849	0.561000	0.29186	0.552000	0.68991	TCC			0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033742.1		NM_002016	
CR1	1378	mdanderson.org	37	1	207782931	207782931	+	Missense_Mutation	SNP	A	A	T	rs6691117	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:207782931A>T	ENST00000367049.4	+	37	6193	c.6193A>T	c.(6193-6195)Atc>Ttc	p.I2065F	CR1_ENST00000367051.1_Missense_Mutation_p.I1615F|CR1_ENST00000367052.1_Missense_Mutation_p.I1615F|CR1_ENST00000367053.1_Missense_Mutation_p.I1615F|CR1_ENST00000400960.2_Missense_Mutation_p.I1615F	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1615					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CACTGAGATCATCAGATTTAG	0.498																																					p.I2065F													.	.			0			c.A6193T												36.0	37.0	37.0					1																	207782931		1925	4129	6054	SO:0001583	missense	1378	exon37			GAGATCATCAGAT	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6193A>T	1.37:g.207782931A>T	ENSP00000356016:p.Ile2065Phe		103	0	0		112	0.03	3	NM_000651	8	0.00	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574787	0.28092	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	2.54	2.54	0.30619	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.68595	0.3018	M	0.73217	2.22	0.80722	P	0.0	B;B;P	0.46277	0.003;0.025;0.875	B;B;P	0.49387	0.01;0.022;0.609	T	0.73433	-0.3984	8	0.87932	D	0	.	5.5311	0.16985	0.1589:0.0:0.8411:0.0	.	1615;1615;2065	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	F	1615;1615;1615;1615;2065	ENSP00000356019:I1615F;ENSP00000356018:I1615F;ENSP00000356020:I1615F;ENSP00000383744:I1615F;ENSP00000356016:I2065F	ENSP00000356016:I2065F	I	+	1	0	CR1	205849554	0.801000	0.28930	0.004000	0.12327	0.078000	0.17371	2.671000	0.46842	0.637000	0.30526	-0.355000	0.07637	ATC			0.498	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382527.1		NM_000573	
LBR	3930	broad.mit.edu	37	1	225592129	225592129	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr1:225592129G>T	ENST00000338179.2	-	13	1789	c.1664C>A	c.(1663-1665)gCc>gAc	p.A555D	LBR_ENST00000272163.4_Missense_Mutation_p.A555D	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	555					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		CCACGCCAAGGCCATGATGAG	0.468																																					p.A555D													.	LBR	54		0			c.C1664A												75.0	75.0	75.0					1																	225592129		2203	4300	6503	SO:0001583	missense	3930	exon13			GCCAAGGCCATGA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1664C>A	1.37:g.225592129G>T	ENSP00000339883:p.Ala555Asp		136	0	0		170	0.04	6	NM_194442	59	0.00	0	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.455039|4.455039	0.84209|0.84209	.|.	.|.	ENSG00000143815|ENSG00000143815	ENST00000272163;ENST00000338179|ENST00000441022	D;D|.	0.98249|.	-4.82;-4.82|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.048502|.	0.85682|.	D|.	0.000000|.	D|D	0.87454|0.87454	0.6181|0.6181	H|H	0.96547|0.96547	3.84|3.84	0.53005|0.53005	D|D	0.999969|0.999969	D|.	0.76494|.	0.999|.	D|.	0.76071|.	0.987|.	D|D	0.90681|0.90681	0.4605|0.4605	10|5	0.87932|.	D|.	0|.	-21.6836|-21.6836	15.5803|15.5803	0.76428|0.76428	0.0:0.1372:0.8628:0.0|0.0:0.1372:0.8628:0.0	.|.	555|.	Q14739|.	LBR_HUMAN|.	D|T	555|47	ENSP00000272163:A555D;ENSP00000339883:A555D|.	ENSP00000272163:A555D|.	A|P	-|-	2|1	0|0	LBR|LBR	223658752|223658752	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.954000|0.954000	0.61252|0.61252	6.557000|6.557000	0.73937|0.73937	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GCC|CCT			0.468	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091398.1		NM_002296	
WAPAL	23063	mdanderson.org	37	10	88206160	88206160	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr10:88206160G>T	ENST00000298767.5	-	16	3633	c.3161C>A	c.(3160-3162)aCa>aAa	p.T1054K	WAPAL_ENST00000263070.7_Missense_Mutation_p.T266K|WAPAL_ENST00000372075.1_Missense_Mutation_p.T266K|WAPAL_ENST00000484070.1_5'Flank	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1054	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CAACTCATCTGTTTTACTTTC	0.408																																					p.T1054K													.	.			0			c.C3161A												125.0	114.0	118.0					10																	88206160		2203	4300	6503	SO:0001583	missense	23063	exon16			TCATCTGTTTTAC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3161C>A	10.37:g.88206160G>T	ENSP00000298767:p.Thr1054Lys		69	0	0		71	0.06	4	NM_015045	42	0.00	0	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159980	0.78226	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T	0.52057	0.68	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	M	0.69358	2.11	0.50813	D	0.999896	D;P;D;D	0.89917	0.999;0.74;0.999;1.0	D;B;D;D	0.85130	0.994;0.364;0.994;0.997	T	0.61342	-0.7082	10	0.27082	T	0.32	.	20.0203	0.97492	0.0:0.0:1.0:0.0	.	1048;1092;1054;1091	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	K	1139;1054;1139;266;266	ENSP00000298767:T1054K	ENSP00000263070:T266K	T	-	2	0	WAPAL	88196140	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.860000	0.99555	2.730000	0.93505	0.655000	0.94253	ACA			0.408	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049151.2		NM_015045	
MINPP1	9562	mdanderson.org	37	10	89265232	89265232	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr10:89265232G>T	ENST00000371996.4	+	1	601	c.560G>T	c.(559-561)tGc>tTc	p.C187F	MINPP1_ENST00000371994.4_Missense_Mutation_p.C187F|MINPP1_ENST00000536010.1_5'Flank	NM_004897.4	NP_004888.2	Q9UNW1	MINP1_HUMAN	multiple inositol-polyphosphate phosphatase 1	187					bone mineralization (GO:0030282)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|ossification (GO:0001503)|polyphosphate metabolic process (GO:0006797)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|bisphosphoglycerate 3-phosphatase activity (GO:0034417)|inositol hexakisphosphate 2-phosphatase activity (GO:0052826)|phosphohistidine phosphatase activity (GO:0008969)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|urinary_tract(2)	5		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		AAGCACCGCTGCATGGATAGC	0.692											OREG0020348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C187F													.	.			0			c.G560T												19.0	22.0	21.0					10																	89265232		2200	4298	6498	SO:0001583	missense	9562	exon1			ACCGCTGCATGGA	AF046915	CCDS7384.1, CCDS53551.1, CCDS53552.1	10q23	2010-05-04	2010-05-04		ENSG00000107789	ENSG00000107789	3.1.3.62		7102	protein-coding gene	gene with protein product		605391	"""multiple inositol polyphosphate histidine phosphatase, 1"""			10087200	Standard	NM_004897		Approved	MIPP	uc001keu.3	Q9UNW1	OTTHUMG00000018678	ENST00000371996.4:c.560G>T	10.37:g.89265232G>T	ENSP00000361064:p.Cys187Phe		53	0	0	1266	38	0.08	3	NM_001178117	8	0.00	0	F5H683|O95172|O95286|Q59EJ2|Q9UGA3	Missense_Mutation	SNP	ENST00000371996.4	37	CCDS7384.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822129	0.90873	.	.	ENSG00000107789	ENST00000371996;ENST00000371994;ENST00000546140	T;T	0.78126	-1.15;-1.15	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.87822	0.6274	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.967;0.981	D	0.89471	0.3743	10	0.87932	D	0	-18.0154	16.9734	0.86306	0.0:0.0:1.0:0.0	.	187;187	Q9UNW1-2;Q9UNW1	.;MINP1_HUMAN	F	187;187;46	ENSP00000361064:C187F;ENSP00000361062:C187F	ENSP00000361062:C187F	C	+	2	0	MINPP1	89255212	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.023000	0.88764	2.541000	0.85698	0.563000	0.77884	TGC			0.692	MINPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049221.1			
WBP1L	54838	mdanderson.org	37	10	104572753	104572753	+	Missense_Mutation	SNP	G	G	A	rs201591380		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr10:104572753G>A	ENST00000369889.4	+	4	836	c.694G>A	c.(694-696)Gca>Aca	p.A232T	WBP1L_ENST00000448841.1_Missense_Mutation_p.A253T	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	232						integral component of membrane (GO:0016021)											TGAACACGGCGCACCCGACAG	0.602													g|||	1	0.000199681	0.0	0.0	5008	,	,		18671	0.001		0.0	False		,,,				2504	0.0				p.A253T													C10orf26,NS,carcinoma,0,1	C10orf26	0	1	0			c.G757A												54.0	50.0	51.0					10																	104572753		2203	4300	6503	SO:0001583	missense	54838	exon4			CACGGCGCACCCG	AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.694G>A	10.37:g.104572753G>A	ENSP00000358905:p.Ala232Thr		46	0	0		35	0.09	3	NM_001083913	14	0.00	0	B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Missense_Mutation	SNP	ENST00000369889.4	37	CCDS7540.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	4.369	0.067966	0.08436	.	.	ENSG00000166272	ENST00000448841;ENST00000369889	T;T	0.30981	1.51;1.51	6.05	-5.34	0.02705	.	0.790379	0.12508	N	0.462665	T	0.13157	0.0319	N	0.08118	0	0.20074	N	0.999932	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32771	-0.9894	10	0.14252	T	0.57	-0.4169	14.86	0.70372	0.4162:0.0:0.5838:0.0	.	253;232	Q9NX94-2;Q9NX94	.;OPA1L_HUMAN	T	253;232	ENSP00000414721:A253T;ENSP00000358905:A232T	ENSP00000358905:A232T	A	+	1	0	C10orf26	104562743	0.006000	0.16342	0.010000	0.14722	0.003000	0.03518	-0.395000	0.07287	-0.883000	0.03982	-0.997000	0.02515	GCA	0		0.602	WBP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000050100.1		NM_017787	
MICALCL	84953	mdanderson.org	37	11	12316251	12316251	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:12316251G>T	ENST00000256186.2	+	3	1564	c.1273G>T	c.(1273-1275)Ggc>Tgc	p.G425C		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	425					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GGACCTCTTTGGCAGCCCCAA	0.517																																					p.G425C													.	.			0			c.G1273T												83.0	86.0	85.0					11																	12316251		1915	4115	6030	SO:0001583	missense	84953	exon3			CTCTTTGGCAGCC	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1273G>T	11.37:g.12316251G>T	ENSP00000256186:p.Gly425Cys		51	0	0		34	0.09	3	NM_032867	0		0	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	.	.	.	.	.	.	.	.	.	.	G	8.857	0.946069	0.18356	.	.	ENSG00000133808	ENST00000256186	T	0.11495	2.77	5.17	-0.0996	0.13624	.	0.656021	0.13809	N	0.361264	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	P	0.52463	0.953	B	0.43754	0.43	T	0.35599	-0.9782	10	0.56958	D	0.05	.	7.5397	0.27731	0.5896:0.0:0.4104:0.0	.	425	Q6ZW33	MICLK_HUMAN	C	425	ENSP00000256186:G425C	ENSP00000256186:G425C	G	+	1	0	MICALCL	12272827	0.000000	0.05858	0.001000	0.08648	0.118000	0.20060	0.408000	0.21065	-0.118000	0.11851	-0.691000	0.03719	GGC			0.517	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386164.1		NM_032867	
SLC39A13	91252	mdanderson.org	37	11	47436633	47436633	+	Silent	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:47436633G>T	ENST00000362021.4	+	9	1005	c.963G>T	c.(961-963)ctG>ctT	p.L321L	SLC39A13_ENST00000354884.4_Silent_p.L314L|SLC39A13_ENST00000524928.1_3'UTR|SLC39A13_ENST00000533076.1_Missense_Mutation_p.C313F	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	321					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CCTGGGTCCTGCCCTTCACCT	0.622																																					p.L321L													.	.			0			c.G963T												51.0	50.0	50.0					11																	47436633		2201	4297	6498	SO:0001819	synonymous_variant	91252	exon9			GGTCCTGCCCTTC		CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.963G>T	11.37:g.47436633G>T			50	0	0		48	0.06	3	NM_001128225	26	0.00	0	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Silent	SNP	ENST00000362021.4	37	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.496234	0.44352	.	.	ENSG00000165915	ENST00000533076	T	0.70516	-0.49	5.46	3.54	0.40534	.	.	.	.	.	T	0.71160	0.3307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71761	-0.4495	6	0.66056	D	0.02	-8.9814	3.8029	0.08765	0.098:0.2813:0.4988:0.1219	.	.	.	.	F	313	ENSP00000434290:C313F	ENSP00000434290:C313F	C	+	2	0	SLC39A13	47393209	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.003000	0.49505	1.303000	0.44873	0.462000	0.41574	TGC			0.622	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000395652.1		NM_152264	
POLR2G	5436	mdanderson.org	37	11	62529311	62529311	+	Silent	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:62529311C>T	ENST00000301788.7	+	2	162	c.57C>T	c.(55-57)ggC>ggT	p.G19G		NM_002696.2	NP_002687.1	P62487	RPB7_HUMAN	polymerase (RNA) II (DNA directed) polypeptide G	19					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, exonucleolytic (GO:0000291)|nucleotide-excision repair (GO:0006289)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translational initiation (GO:0045948)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)|translation initiation factor binding (GO:0031369)			lung(3)	3						GCTACTTCGGCCCCAACTTGC	0.607																																					p.G19G													.	.			0			c.C57T												146.0	142.0	143.0					11																	62529311		2202	4299	6501	SO:0001819	synonymous_variant	5436	exon2			CTTCGGCCCCAAC	U20659	CCDS31585.1	11q13.1	2013-01-21			ENSG00000168002	ENSG00000168002		"""RNA polymerase subunits"""	9194	protein-coding gene	gene with protein product		602013				7579693, 9256063	Standard	NM_002696		Approved	hRPB19, hsRPB7, RPB7	uc001nva.3	P62487	OTTHUMG00000167609	ENST00000301788.7:c.57C>T	11.37:g.62529311C>T			45	0	0		34	0.09	3	NM_002696	77	0.00	0	B2R5C0|P52433|Q2M1Z4	Silent	SNP	ENST00000301788.7	37	CCDS31585.1																																																																																					0.607	POLR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395344.1		NM_002696	
TSGA10IP	254187	broad.mit.edu	37	11	65715786	65715787	+	RNA	INS	-	-	CCAC	rs572156611|rs484752|rs60763649	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:65715786_65715787insCCAC	ENST00000532620.1	+	0	1382				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						catccatccatccacccatcca	0.396														289	0.0577077	0.1029	0.0375	5008	,	,		19036	0.126		0.0	False		,,,				2504	0.0				.													.	TSGA10IP	31		0			.																																											254187	.			CATCCATCCACCC	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65715787_65715790dupCCAC			11	0	0		10	0.80	8	.	0		0	Q3SXZ9|Q3SY01|Q96M26	RNA	INS	ENST00000532620.1	37																																																																																						0.396	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000391373.2		NM_152762	
ARAP1	116985	mdanderson.org	37	11	72406494	72406494	+	Missense_Mutation	SNP	C	C	T	rs375239868		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:72406494C>T	ENST00000393609.3	-	26	3716	c.3514G>A	c.(3514-3516)Ggt>Agt	p.G1172S	ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000334211.8_Missense_Mutation_p.G927S|ARAP1_ENST00000426523.1_Missense_Mutation_p.G927S|ARAP1_ENST00000455638.2_Missense_Mutation_p.G1172S|ARAP1_ENST00000429686.1_Missense_Mutation_p.G866S|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000359373.5_Missense_Mutation_p.G1172S|ARAP1_ENST00000393605.3_Missense_Mutation_p.G932S	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1172	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						ATGAAGTCACCGGCATGCTGC	0.592																																					p.G1172S	Ovarian(102;1198 1520 13195 17913 37529)												.	.			0			c.G3514A							C	SER/GLY,SER/GLY,SER/GLY	0,4400		0,0,2200	76.0	66.0	69.0		3514,2596,2779	3.9	1.0	11		69	1,8585	1.2+/-3.3	0,1,4292	no	missense,missense,missense	ARAP1	NM_001040118.2,NM_001135190.1,NM_015242.4	56,56,56	0,1,6492	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1172/1451,866/1134,927/1206	72406494	1,12985	2200	4293	6493	SO:0001583	missense	116985	exon26			AGTCACCGGCATG	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3514G>A	11.37:g.72406494C>T	ENSP00000377233:p.Gly1172Ser		65	0	0		52	0.06	3	NM_001040118	43	0.00	0	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992511	0.74703	0.0	1.16E-4	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686	T;T;T;T;T;T;T	0.09911	2.93;2.93;2.97;3.02;2.93;3.02;2.99	4.85	3.91	0.45181	Ras-association (1);	0.148043	0.43579	D	0.000541	T	0.22551	0.0544	L	0.55481	1.735	0.40153	D	0.97697	D;D;P;D;D	0.57257	0.979;0.966;0.671;0.979;0.974	D;P;B;P;P	0.63381	0.914;0.5;0.19;0.725;0.861	T	0.00839	-1.1545	10	0.56958	D	0.05	.	8.9308	0.35668	0.1686:0.6684:0.163:0.0	.	927;866;1172;1172;932	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	S	1172;1172;932;927;1172;927;866	ENSP00000352332:G1172S;ENSP00000390461:G1172S;ENSP00000377230:G932S;ENSP00000335506:G927S;ENSP00000377233:G1172S;ENSP00000392264:G927S;ENSP00000403127:G866S	ENSP00000335506:G927S	G	-	1	0	ARAP1	72084142	0.944000	0.32072	0.972000	0.41901	0.833000	0.47200	3.105000	0.50314	0.982000	0.38575	0.460000	0.39030	GGT			0.592	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000347428.1		NM_001040118	
HEPHL1	341208	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	93796882	93796882	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:93796882delG	ENST00000315765.9	+	3	632	c.624delG	c.(622-624)aagfs	p.K208fs		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	208					copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TGGTCTGCAAGGAAGGTAAGG	0.517																																					p.K208fs													.	HEPHL1	144		0			c.623delA												87.0	86.0	86.0					11																	93796882		1932	4124	6056	SO:0001589	frameshift_variant	341208	exon3			CTGCAAGGAAGGT	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.624delG	11.37:g.93796882delG	ENSP00000313699:p.Lys208fs		75	0	0		61	0.25	15	NM_001098672	0		0	Q3C1W7	Frame_Shift_Del	DEL	ENST00000315765.9	37	CCDS44710.1																																																																																					0.517	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396103.2		XM_291947	
ARHGAP20	57569	broad.mit.edu	37	11	110451483	110451483	+	Silent	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr11:110451483G>T	ENST00000260283.4	-	16	2471	c.2187C>A	c.(2185-2187)tcC>tcA	p.S729S	ARHGAP20_ENST00000529591.1_Silent_p.S272S|ARHGAP20_ENST00000357139.3_Silent_p.S703S|ARHGAP20_ENST00000528829.1_Silent_p.S693S|ARHGAP20_ENST00000533353.1_Silent_p.S703S|ARHGAP20_ENST00000527598.1_Silent_p.S693S|ARHGAP20_ENST00000524756.1_Silent_p.S706S	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	729					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CATCACAGCTGGACTTGCGTA	0.458																																					p.S729S													.	ARHGAP20	150		0			c.C2187A												63.0	66.0	65.0					11																	110451483		2201	4298	6499	SO:0001819	synonymous_variant	57569	exon16			ACAGCTGGACTTG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2187C>A	11.37:g.110451483G>T			104	0	0		89	0.03	3	NM_020809	1	0.00	0	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Silent	SNP	ENST00000260283.4	37	CCDS31673.1																																																																																					0.458	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390628.1		NM_020809	
CHD4	1108	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	6707254	6707254	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr12:6707254G>C	ENST00000357008.2	-	12	1861	c.1698C>G	c.(1696-1698)caC>caG	p.H566Q	CHD4_ENST00000544040.1_Missense_Mutation_p.H559Q|CHD4_ENST00000544484.1_Missense_Mutation_p.H563Q|CHD4_ENST00000309577.6_Missense_Mutation_p.H566Q	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	566	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TCACCTGACAGTGCAGCTCCA	0.468																																					p.H566Q	Colon(32;586 792 4568 16848 45314)												.	.			0			c.C1698G												109.0	111.0	110.0					12																	6707254		2203	4300	6503	SO:0001583	missense	1108	exon12			CTGACAGTGCAGC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.1698C>G	12.37:g.6707254G>C	ENSP00000349508:p.His566Gln		102	0	0		95	0.04	4	NM_001273	76	0.21	16	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	8.194	0.796682	0.16327	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	4.21	0.194	0.15143	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.054528	0.64402	D	0.000001	T	0.71660	0.3366	M	0.69358	2.11	0.50313	D	0.999869	P;P;P	0.47302	0.893;0.757;0.531	B;P;B	0.50708	0.36;0.648;0.107	T	0.68876	-0.5293	10	0.54805	T	0.06	1.9451	8.8688	0.35303	0.4797:0.0:0.5203:0.0	.	566;566;559	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	Q	563;559;566;566;540	ENSP00000440392:H563Q;ENSP00000440542:H559Q;ENSP00000312419:H566Q;ENSP00000349508:H566Q	ENSP00000312419:H566Q	H	-	3	2	CHD4	6577515	1.000000	0.71417	0.996000	0.52242	0.399000	0.30720	0.843000	0.27640	-0.151000	0.11176	0.467000	0.42956	CAC			0.468	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001273	
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		4	0	0		11	0.36	4	.	4	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
PLXNC1	10154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94631464	94631464	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr12:94631464C>T	ENST00000258526.4	+	10	2254	c.2005C>T	c.(2005-2007)Cca>Tca	p.P669S		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	669					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GTCCATTGAGCCACAGAAAGT	0.403																																					p.P669S													.	.			0			c.C2005T												81.0	72.0	75.0					12																	94631464		2203	4300	6503	SO:0001583	missense	10154	exon10			ATTGAGCCACAGA	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2005C>T	12.37:g.94631464C>T	ENSP00000258526:p.Pro669Ser		65	0	0		61	0.18	11	NM_005761	0		0	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048869	0.75846	.	.	ENSG00000136040	ENST00000258526	D	0.94330	-3.4	5.99	5.99	0.97316	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.101382	0.64402	D	0.000001	D	0.94295	0.8167	N	0.20986	0.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94977	0.8122	10	0.87932	D	0	.	18.2507	0.90002	0.0:1.0:0.0:0.0	.	669	O60486	PLXC1_HUMAN	S	669	ENSP00000258526:P669S	ENSP00000258526:P669S	P	+	1	0	PLXNC1	93155595	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.939000	0.48995	2.840000	0.97914	0.655000	0.94253	CCA			0.403	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408126.2			
ABCB9	23457	mdanderson.org	37	12	123425487	123425487	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr12:123425487A>G	ENST00000542678.1	-	8	4274	c.1436T>C	c.(1435-1437)gTg>gCg	p.V479A	ABCB9_ENST00000442833.2_Missense_Mutation_p.V479A|ABCB9_ENST00000346530.5_Missense_Mutation_p.V436A|ABCB9_ENST00000442028.2_Missense_Mutation_p.V479A|ABCB9_ENST00000344275.7_Missense_Mutation_p.V479A|ABCB9_ENST00000280560.8_Missense_Mutation_p.V479A|ABCB9_ENST00000540285.1_Intron|ABCB9_ENST00000392439.3_Missense_Mutation_p.V479A|ABCB9_ENST00000541983.1_5'UTR			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	479					peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GAACTCGAACACCTTCTCAGC	0.637																																					p.V479A	Ovarian(49;786 1333 9175 38236)												.	.			0			c.T1436C												58.0	38.0	44.0					12																	123425487		2203	4300	6503	SO:0001583	missense	23457	exon8			TCGAACACCTTCT	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.1436T>C	12.37:g.123425487A>G	ENSP00000440288:p.Val479Ala		66	0	0		58	0.07	4	NM_001243014	3	0.00	0	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	A	33	5.196608	0.94960	.	.	ENSG00000150967	ENST00000280560;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028;ENST00000542448;ENST00000545373	D;D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	5.38	5.38	0.77491	ABC transporter, transmembrane domain, type 1 (1);	0.061488	0.64402	D	0.000004	D	0.89487	0.6729	M	0.62209	1.925	0.58432	D	0.999997	P;D;D;D	0.89917	0.927;0.994;1.0;0.972	P;D;D;P	0.73380	0.685;0.919;0.98;0.831	D	0.90649	0.4581	10	0.87932	D	0	-34.6871	15.4021	0.74849	1.0:0.0:0.0:0.0	.	86;479;436;479	B4DFR8;Q9NP78-3;Q9NP78-2;Q9NP78	.;.;.;ABCB9_HUMAN	A	479;436;479;479;479;105;86	ENSP00000280560:V479A;ENSP00000280559:V436A;ENSP00000376234:V479A;ENSP00000440288:V479A;ENSP00000394898:V479A;ENSP00000440244:V105A;ENSP00000444834:V86A	ENSP00000280560:V479A	V	-	2	0	ABCB9	121991440	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.303000	0.96183	2.035000	0.60131	0.533000	0.62120	GTG			0.637	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400956.1		NM_019624	
CATSPERB	79820	mdanderson.org	37	14	92191427	92191427	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr14:92191427G>T	ENST00000256343.3	-	3	321	c.165C>A	c.(163-165)aaC>aaA	p.N55K		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	55					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ACCTTACCAAGTTTTCTAAGA	0.328																																					p.N55K													.	.			0			c.C165A												66.0	60.0	62.0					14																	92191427		2201	4294	6495	SO:0001583	missense	79820	exon3			TACCAAGTTTTCT	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.165C>A	14.37:g.92191427G>T	ENSP00000256343:p.Asn55Lys		35	0	0		31	0.10	3	NM_024764	0		0	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	G	9.896	1.205645	0.22205	.	.	ENSG00000133962	ENST00000256343;ENST00000553329;ENST00000554560;ENST00000556661;ENST00000553676	T	0.42131	0.98	5.0	1.21	0.21127	.	1.103650	0.06965	N	0.817035	T	0.29423	0.0733	L	0.29908	0.895	0.09310	N	0.999997	B	0.17268	0.021	B	0.18561	0.022	T	0.27872	-1.0061	10	0.44086	T	0.13	-1.1561	4.0212	0.09667	0.2853:0.1809:0.5338:0.0	.	55	Q9H7T0	CTSRB_HUMAN	K	55	ENSP00000256343:N55K	ENSP00000256343:N55K	N	-	3	2	CATSPERB	91261180	0.008000	0.16893	0.042000	0.18584	0.007000	0.05969	0.084000	0.14891	0.014000	0.14944	0.650000	0.86243	AAC			0.328	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411769.1		NM_024764	
BCL11B	64919	hgsc.bcm.edu	37	14	99641568	99641568	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr14:99641568C>G	ENST00000357195.3	-	4	1614	c.1605G>C	c.(1603-1605)gaG>gaC	p.E535D	BCL11B_ENST00000443726.2_Missense_Mutation_p.E341D|BCL11B_ENST00000345514.2_Missense_Mutation_p.E464D	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	535	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E535_E536delEE(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		cctcctcctcctcgtcctcct	0.697			T	TLX3	T-ALL																																p.E535D				Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,colon,carcinoma,0,1	BCL11B	0	1	1	Deletion - In frame(1)	prostate(1)	c.G1605C												5.0	5.0	5.0					14																	99641568		2084	4070	6154	SO:0001583	missense	64919	exon4			CTCCTCCTCGTCC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1605G>C	14.37:g.99641568C>G	ENSP00000349723:p.Glu535Asp		10	0	0		16	0.13	2	NM_138576	0		0	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167616	0.38315	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13657	2.57;2.6;2.57	3.81	0.863	0.19062	.	0.158674	0.40144	N	0.001176	T	0.07324	0.0185	N	0.22421	0.69	0.40982	D	0.984788	B;B	0.31413	0.322;0.185	B;B	0.31390	0.129;0.048	T	0.38394	-0.9663	10	0.30854	T	0.27	-8.4478	4.8239	0.13407	0.0:0.4986:0.1502:0.3512	.	464;535	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	D	535;464;341	ENSP00000349723:E535D;ENSP00000280435:E464D;ENSP00000387419:E341D	ENSP00000280435:E464D	E	-	3	2	BCL11B	98711321	0.591000	0.26824	0.998000	0.56505	0.990000	0.78478	-0.193000	0.09573	-0.059000	0.13154	0.561000	0.74099	GAG			0.697	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000072332.2		NM_138576	
BEGAIN	57596	mdanderson.org	37	14	101005030	101005030	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr14:101005030G>A	ENST00000355173.2	-	7	1129	c.1058C>T	c.(1057-1059)aCg>aTg	p.T353M	CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000443071.2_Missense_Mutation_p.T353M|BEGAIN_ENST00000556751.1_Missense_Mutation_p.T289M	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	353						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				CACCGCGGCCGTGGCCTTGGC	0.716																																					p.T353M	NSCLC(159;1889 2010 9965 27479 40101)												.	.			0			c.C1058T												20.0	17.0	18.0					14																	101005030		2119	4132	6251	SO:0001583	missense	57596	exon7			GCGGCCGTGGCCT	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1058C>T	14.37:g.101005030G>A	ENSP00000347301:p.Thr353Met		25	0	0		39	0.08	3	NM_020836	0		0	Q9NPU3|Q9P282	Missense_Mutation	SNP	ENST00000355173.2	37	CCDS9962.1	.	.	.	.	.	.	.	.	.	.	G	4.037	0.004535	0.07866	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071	.	.	.	4.17	2.17	0.27698	.	0.868280	0.10388	N	0.680710	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	P	0.38992	0.653	B	0.37480	0.251	T	0.07328	-1.0778	9	0.45353	T	0.12	.	6.057	0.19816	0.1025:0.0:0.4596:0.4378	.	353	Q9BUH8	BEGIN_HUMAN	M	353;289;353	.	ENSP00000347301:T353M	T	-	2	0	BEGAIN	100074783	0.011000	0.17503	0.086000	0.20670	0.043000	0.13939	1.724000	0.38064	1.881000	0.54492	0.462000	0.41574	ACG			0.716	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000414329.1		NM_020836	
THBS1	7057	mdanderson.org	37	15	39881513	39881513	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr15:39881513G>T	ENST00000260356.5	+	12	2049	c.1884G>T	c.(1882-1884)caG>caT	p.Q628H		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	628					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CCGGCTCACAGCCCTTCGGCC	0.577																																					p.Q628H													.	.			0			c.G1884T												73.0	77.0	75.0					15																	39881513		2200	4297	6497	SO:0001583	missense	7057	exon12			CTCACAGCCCTTC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1884G>T	15.37:g.39881513G>T	ENSP00000260356:p.Gln628His		45	0	0		39	0.08	3	NM_003246	6	0.00	0	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.12|18.12	3.553742|3.553742	0.65425|0.65425	.|.	.|.	ENSG00000137801|ENSG00000137801	ENST00000260356|ENST00000397593	T|.	0.78707|.	-1.2|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Epidermal growth factor-like (1);|.	0.000000|.	0.34268|.	N|.	0.004111|.	T|T	0.78509|0.78509	0.4294|0.4294	M|M	0.74467|0.74467	2.265|2.265	0.50632|0.50632	D|D	0.999886|0.999886	D;P|.	0.63046|.	0.992;0.91|.	P;P|.	0.57911|.	0.829;0.503|.	T|T	0.80286|0.80286	-0.1446|-0.1446	10|6	0.22109|0.87932	T|D	0.4|0	-16.896|-16.896	19.6845|19.6845	0.95976|0.95976	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	543;628|.	B4E3J7;P07996|.	.;TSP1_HUMAN|.	H|I	628|62	ENSP00000260356:Q628H|.	ENSP00000260356:Q628H|ENSP00000380721:S62I	Q|S	+|+	3|2	2|0	THBS1|THBS1	37668805|37668805	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.579000|0.579000	0.36224|0.36224	4.110000|4.110000	0.57831|0.57831	2.656000|2.656000	0.90262|0.90262	0.655000|0.655000	0.94253|0.94253	CAG|AGC			0.577	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257831.2		NM_003246	
LRRC57	255252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42839488	42839488	+	Missense_Mutation	SNP	C	C	T	rs548606804	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr15:42839488C>T	ENST00000323443.2	-	3	830	c.463G>A	c.(463-465)Gtc>Atc	p.V155I	HAUS2_ENST00000568846.2_5'Flank|LRRC57_ENST00000563454.1_Missense_Mutation_p.V155I|LRRC57_ENST00000397130.3_Missense_Mutation_p.V155I|HAUS2_ENST00000568876.1_5'Flank|HAUS2_ENST00000260372.3_5'Flank			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	155						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		AGTTCGATGACTTGCAGCTCT	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		20408	0.002		0.0	False		,,,				2504	0.0				p.V155I													.	.			0			c.G463A												99.0	87.0	91.0					15																	42839488		2203	4299	6502	SO:0001583	missense	255252	exon4			CGATGACTTGCAG	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.463G>A	15.37:g.42839488C>T	ENSP00000326817:p.Val155Ile		53	0	0		47	0.17	8	NM_153260	38	0.29	11	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	37	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547070	0.45383	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.50277	0.75;0.75	5.2	5.2	0.72013	.	0.279885	0.39985	N	0.001210	T	0.43875	0.1267	L	0.43923	1.385	0.32738	N	0.50805	B	0.14438	0.01	B	0.09377	0.004	T	0.48258	-0.9051	10	0.34782	T	0.22	.	19.1136	0.93328	0.0:1.0:0.0:0.0	.	155	Q8N9N7	LRC57_HUMAN	I	155	ENSP00000326817:V155I;ENSP00000380319:V155I	ENSP00000326817:V155I	V	-	1	0	LRRC57	40626780	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	3.693000	0.54735	2.599000	0.87857	0.655000	0.94253	GTC			0.453	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253174.1		NM_153260	
DUOX2	50506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45399065	45399065	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr15:45399065G>A	ENST00000603300.1	-	15	1998	c.1796C>T	c.(1795-1797)gCc>gTc	p.A599V	DUOX2_ENST00000389039.6_Missense_Mutation_p.A599V	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	599					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GATGGTGATGGCAAAACCAGG	0.597																																					p.A599V													DUOX2,colon,carcinoma,-1,1	DUOX2	-1	1	0			c.C1796T												59.0	56.0	57.0					15																	45399065		2196	4297	6493	SO:0001583	missense	50506	exon15			GTGATGGCAAAAC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.1796C>T	15.37:g.45399065G>A	ENSP00000475084:p.Ala599Val		113	0	0		128	0.20	26	NM_014080	0		0	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571103	0.28003	.	.	ENSG00000140279	ENST00000389039	.	.	.	4.99	4.07	0.47477	.	0.156244	0.56097	D	0.000032	T	0.27798	0.0684	N	0.14661	0.345	0.24273	N	0.995234	B;B	0.20887	0.015;0.049	B;B	0.19946	0.011;0.027	T	0.16276	-1.0408	9	0.38643	T	0.18	-13.4042	14.2565	0.66055	0.0:0.8429:0.1571:0.0	.	599;161	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	V	599	.	ENSP00000373691:A599V	A	-	2	0	DUOX2	43186357	0.997000	0.39634	0.998000	0.56505	0.518000	0.34316	3.555000	0.53727	1.091000	0.41335	-0.502000	0.04539	GCC			0.597	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_014080	
GOLGA6B	55889	mdanderson.org	37	15	72953691	72953691	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr15:72953691G>T	ENST00000421285.3	+	8	651	c.651G>T	c.(649-651)caG>caT	p.Q217H		NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	217						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						ACGTGACACAGGTGAGGCTTT	0.592																																					p.Q217H													GOLGA6B,NS,carcinoma,+2,1	GOLGA6B	2	1	0			c.G651T												28.0	34.0	32.0					15																	72953691		1329	2409	3738	SO:0001630	splice_region_variant	55889	exon8			GACACAGGTGAGG		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.651+1G>T	15.37:g.72953691G>T			37	0	0		43	0.07	3	NM_018652	2	0.00	0	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	11.53	1.667334	0.29604	.	.	ENSG00000215186	ENST00000421285	T	0.28069	1.63	0.39	0.39	0.16275	.	.	.	.	.	T	0.24812	0.0602	M	0.69523	2.12	0.80722	D	1	P	0.41498	0.752	B	0.32465	0.146	T	0.10520	-1.0626	9	0.46703	T	0.11	.	6.668	0.23052	2.0E-4:0.0:0.9998:0.0	.	217	A6NDN3	GOG6B_HUMAN	H	217	ENSP00000408132:Q217H	ENSP00000408132:Q217H	Q	+	3	2	GOLGA6B	70740745	1.000000	0.71417	0.053000	0.19242	0.049000	0.14656	1.646000	0.37249	0.472000	0.27344	0.134000	0.15878	CAG			0.592	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257474.4		NM_018652	Missense_Mutation
MAN2A2	4122	hgsc.bcm.edu;mdanderson.org	37	15	91455346	91455346	+	Missense_Mutation	SNP	G	G	A	rs146996561		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr15:91455346G>A	ENST00000559717.1	+	15	2642	c.2183G>A	c.(2182-2184)cGc>cAc	p.R728H	MAN2A2_ENST00000431652.2_Missense_Mutation_p.R236H|MAN2A2_ENST00000360468.3_Missense_Mutation_p.R728H|MAN2A2_ENST00000430376.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	728					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GATGGGCACCGCACGCTGCCC	0.667																																					p.R728H													.	.			0			c.G2183A							G	HIS/ARG	0,4396		0,0,2198	63.0	60.0	61.0		2183	1.8	0.2	15	dbSNP_134	61	1,8595	1.2+/-3.3	0,1,4297	no	missense	MAN2A2	NM_006122.2	29	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	benign	728/1151	91455346	1,12991	2198	4298	6496	SO:0001583	missense	4122	exon14			GGCACCGCACGCT	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2183G>A	15.37:g.91455346G>A	ENSP00000452948:p.Arg728His		73	0	0		53	0.08	4	NM_006122	11	0.00	0	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.191580	0.38707	0.0	1.16E-4	ENSG00000196547	ENST00000360468;ENST00000431652	T;T	0.78816	-1.21;-1.21	5.29	1.83	0.25207	Glycosyl hydrolases 38, C-terminal (1);Glycosyl hydrolase, family 13, all-beta (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.406531	0.30584	N	0.009317	T	0.69214	0.3086	M	0.64997	1.995	0.26295	N	0.978066	B;B;B	0.12013	0.005;0.0;0.002	B;B;B	0.16289	0.015;0.005;0.008	T	0.59241	-0.7491	10	0.45353	T	0.12	-12.6347	4.9597	0.14059	0.4073:0.1598:0.4329:0.0	.	236;356;728	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	H	728;236	ENSP00000353655:R728H;ENSP00000388221:R236H	ENSP00000353655:R728H	R	+	2	0	MAN2A2	89256350	0.455000	0.25736	0.154000	0.22540	0.974000	0.67602	0.748000	0.26305	0.080000	0.16959	0.456000	0.33151	CGC	0		0.667	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418246.5		NM_006122	
MKL2	57496	mdanderson.org	37	16	14340783	14340783	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr16:14340783A>G	ENST00000341243.5	+	10	1633	c.1633A>G	c.(1633-1635)Acc>Gcc	p.T545A	MKL2_ENST00000571589.1_Missense_Mutation_p.T556A|MKL2_ENST00000574045.1_Missense_Mutation_p.T556A|MKL2_ENST00000318282.5_Missense_Mutation_p.T556A			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	545					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCTGAGTCCCACCAGCAGCAC	0.468																																					p.T556A													.	.			0			c.A1666G												60.0	58.0	59.0					16																	14340783		2197	4300	6497	SO:0001583	missense	57496	exon12			AGTCCCACCAGCA	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1633A>G	16.37:g.14340783A>G	ENSP00000345841:p.Thr545Ala		46	0	0		43	0.07	3	NM_014048	4	0.00	0	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	37		.	.	.	.	.	.	.	.	.	.	A	0.512	-0.866192	0.02590	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.83	-0.72	0.11195	.	0.527316	0.21816	N	0.068686	T	0.20536	0.0494	L	0.33485	1.01	0.09310	N	0.999994	B;B	0.09022	0.002;0.001	B;B	0.09377	0.002;0.004	T	0.24512	-1.0158	9	0.06236	T	0.91	-12.8918	3.805	0.08773	0.5428:0.0:0.2167:0.2405	.	556;556	B4DGT8;Q9ULH7-4	.;.	A	556;545	.	ENSP00000339086:T556A	T	+	1	0	MKL2	14248284	0.000000	0.05858	0.789000	0.31954	0.304000	0.27724	0.473000	0.22132	-0.129000	0.11620	0.533000	0.62120	ACC			0.468	MKL2-202	KNOWN	basic	protein_coding	protein_coding				NM_014048	
NUP88	4927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	5308484	5308484	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr17:5308484C>T	ENST00000573584.1	-	6	1446	c.937G>A	c.(937-939)Gct>Act	p.A313T		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	313					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						CAGAGTACAGCACACGCATCA	0.453																																					p.A313T													.	.			0			c.G937A												219.0	163.0	182.0					17																	5308484		2203	4300	6503	SO:0001583	missense	4927	exon6			GTACAGCACACGC	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.937G>A	17.37:g.5308484C>T	ENSP00000458954:p.Ala313Thr		67	0	0		65	0.12	8	NM_002532	38	0.24	9	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341321	0.81911	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	T	0.47528	0.84	4.81	3.81	0.43845	.	0.114925	0.64402	D	0.000018	T	0.53965	0.1829	M	0.70595	2.14	0.58432	D	0.999994	D;D;P	0.57571	0.98;0.959;0.834	P;P;P	0.55577	0.779;0.718;0.57	T	0.57768	-0.7754	10	0.06365	T	0.9	-1.9037	11.7862	0.52043	0.0:0.9116:0.0:0.0884	.	313;182;313	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	T	313;182	ENSP00000225696:A313T	ENSP00000225696:A313T	A	-	1	0	NUP88	5249208	1.000000	0.71417	0.853000	0.33588	0.859000	0.49053	4.570000	0.60872	1.334000	0.45468	0.655000	0.94253	GCT			0.453	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216918.3		NM_002532	
KRTAP1-1	81851	hgsc.bcm.edu;broad.mit.edu	37	17	39197304	39197304	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr17:39197304T>C	ENST00000306271.4	-	1	409	c.346A>G	c.(346-348)Atc>Gtc	p.I116V		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	116						keratin filament (GO:0045095)		p.I116V(1)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CACCACCTGATACGGGTGCTC	0.662																																					p.I116V													KRTAP1-1,NS,malignant_melanoma,0,1	KRTAP1-1	0	1	1	Substitution - Missense(1)	NS(1)	c.A346G												22.0	27.0	25.0					17																	39197304		2019	4148	6167	SO:0001583	missense	81851	exon1			ACCTGATACGGGT	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.346A>G	17.37:g.39197304T>C	ENSP00000305975:p.Ile116Val		79	0.0126582278	1		73	0.04	3	NM_030967	0		0	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	8.173	0.792133	0.16258	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.29655	1.56	4.28	-1.23	0.09465	.	.	.	.	.	T	0.12135	0.0295	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34079	-0.9843	9	0.20046	T	0.44	.	9.4726	0.38851	0.0:0.573:0.0:0.427	.	116	Q07627	KRA11_HUMAN	V	116;106	ENSP00000305975:I116V	ENSP00000305975:I116V	I	-	1	0	KRTAP1-1	36450830	0.132000	0.22450	0.024000	0.17045	0.516000	0.34256	0.017000	0.13399	-0.199000	0.10317	0.529000	0.55759	ATC			0.662	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257696.1		NM_030967	
STAT3	6774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40500474	40500474	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr17:40500474G>C	ENST00000264657.5	-	2	373	c.61C>G	c.(61-63)Ctc>Gtc	p.L21V	STAT3_ENST00000389272.3_Intron|STAT3_ENST00000404395.3_Missense_Mutation_p.L21V|STAT3_ENST00000585517.1_Missense_Mutation_p.L21V|STAT3_ENST00000588969.1_Missense_Mutation_p.L21V	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	21					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		TCACTGTAGAGCTGATGGAGC	0.498									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.L21V													.	.			0			c.C61G												102.0	94.0	97.0					17																	40500474		2203	4300	6503	SO:0001583	missense	6774	exon2	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	TGTAGAGCTGATG	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.61C>G	17.37:g.40500474G>C	ENSP00000264657:p.Leu21Val		63	0	0		52	0.13	7	NM_003150	17	0.06	1	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920609	0.73213	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.60548	0.18;0.18	5.81	4.65	0.58169	STAT transcription factor, protein interaction (4);	0.000000	0.64402	D	0.000001	T	0.72787	0.3504	M	0.62209	1.925	0.48087	D	0.999589	D;D;D	0.57257	0.975;0.979;0.979	P;D;D	0.74023	0.904;0.982;0.982	T	0.74659	-0.3591	10	0.66056	D	0.02	-31.2948	15.7688	0.78149	0.0759:0.0:0.9241:0.0	.	21;21;21	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	V	21	ENSP00000264657:L21V;ENSP00000384943:L21V	ENSP00000264657:L21V	L	-	1	0	STAT3	37754000	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.184000	0.50926	2.750000	0.94351	0.655000	0.94253	CTC			0.498	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000319353.3		NM_139276, NM_003150	
CUEDC1	404093	mdanderson.org	37	17	55962728	55962728	+	Silent	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr17:55962728G>T	ENST00000577830.1	-	2	611	c.198C>A	c.(196-198)atC>atA	p.I66I	CUEDC1_ENST00000577840.1_Intron|CUEDC1_ENST00000360238.2_Silent_p.I66I|CUEDC1_ENST00000407144.2_Silent_p.I66I	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	66	CUE. {ECO:0000255|PROSITE- ProRule:PRU00468}.									endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						GCACGCATTCGATGATGTCGT	0.632																																					p.I66I													.	.			0			c.C198A												64.0	65.0	65.0					17																	55962728		2203	4300	6503	SO:0001819	synonymous_variant	404093	exon2			GCATTCGATGATG	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.198C>A	17.37:g.55962728G>T			25	0	0		22	0.09	2	NM_001271875	0		0	D3DTZ2|Q9NWD0	Silent	SNP	ENST00000577830.1	37	CCDS11599.1																																																																																					0.632	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443305.1		NM_017949	
CSNK1G2	1455	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	1953897	1953897	+	Intron	SNP	G	G	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr19:1953897G>A	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000314315.3_RNA|CSNK1G2-AS1_ENST00000586395.1_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTTCTCAGAGGCCGGCTGTC	0.637																																					.	Ovarian(91;880 1392 21236 36928 37598)												.	.			0			.												97.0	101.0	100.0					19																	1953897		2154	4261	6415	SO:0001627	intron_variant	255193	.			CTCAGAGGCCGGC	AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+12480G>A	19.37:g.1953897G>A			48	0	0		61	0.10	6	.	0		0	B5BU42|O00704|Q8WUB1	RNA	SNP	ENST00000255641.8	37	CCDS12077.1																																																																																					0.637	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449287.1		NM_001319	
SF3A2	8175	mdanderson.org	37	19	2248153	2248153	+	Missense_Mutation	SNP	G	G	A	rs539335935		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr19:2248153G>A	ENST00000221494.5	+	9	1421	c.1003G>A	c.(1003-1005)Gga>Aga	p.G335R	AMH_ENST00000221496.4_5'Flank|MIR4321_ENST00000592276.1_RNA	NM_007165.4	NP_009096.2	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2, 66kDa	335	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGCTCCTGGAGTCCACCC	0.736													G|||	1	0.000199681	0.0	0.0014	5008	,	,		6143	0.0		0.0	False		,,,				2504	0.0				p.G335R													.	.			0			c.G1003A												2.0	3.0	3.0					19																	2248153		1638	3480	5118	SO:0001583	missense	8175	exon9			GCTCCTGGAGTCC	L21990	CCDS12084.1	19p13.3	2012-10-02	2002-08-29		ENSG00000104897	ENSG00000104897			10766	protein-coding gene	gene with protein product		600796	"""splicing factor 3a, subunit 2, 66kD"""			8211113, 8541848	Standard	NM_007165		Approved	SF3a66, SAP62, PRPF11, Prp11	uc002lvg.3	Q15428	OTTHUMG00000180414	ENST00000221494.5:c.1003G>A	19.37:g.2248153G>A	ENSP00000221494:p.Gly335Arg		20	0	0		18	0.11	2	NM_007165	301	0.00	0	B2RBU1|D6W605|O75245	Missense_Mutation	SNP	ENST00000221494.5	37	CCDS12084.1	.	.	.	.	.	.	.	.	.	.	G	9.346	1.064154	0.20067	.	.	ENSG00000104897	ENST00000221494	T	0.46819	0.86	4.89	2.31	0.28768	.	0.642391	0.13609	N	0.375252	T	0.31734	0.0806	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26395	-1.0104	10	0.72032	D	0.01	-0.3077	7.5928	0.28031	0.2711:0.0:0.7289:0.0	.	335	Q15428	SF3A2_HUMAN	R	335	ENSP00000221494:G335R	ENSP00000221494:G335R	G	+	1	0	SF3A2	2199153	0.064000	0.20934	0.020000	0.16555	0.011000	0.07611	2.293000	0.43558	0.874000	0.35823	0.563000	0.77884	GGA			0.736	SF3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451268.3			
SLC5A5	6528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17988612	17988612	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr19:17988612G>C	ENST00000222248.3	+	6	1126	c.779G>C	c.(778-780)gGc>gCc	p.G260A		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	260					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TCCATGTATGGCGTGAACCAG	0.597																																					p.G260A	Melanoma(65;1008 1708 7910 46650)												.	.			0			c.G779C												165.0	134.0	145.0					19																	17988612		2203	4300	6503	SO:0001583	missense	6528	exon6			TGTATGGCGTGAA		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.779G>C	19.37:g.17988612G>C	ENSP00000222248:p.Gly260Ala		97	0	0		100	0.22	22	NM_000453	4	0.50	2	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326067	0.60743	.	.	ENSG00000105641	ENST00000222248	D	0.97850	-4.57	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.97093	0.9050	L	0.41027	1.25	0.80722	D	1	P	0.50617	0.937	P	0.55303	0.773	D	0.96121	0.9085	10	0.30078	T	0.28	.	16.867	0.86032	0.0:0.0:1.0:0.0	.	260	Q92911	SC5A5_HUMAN	A	260	ENSP00000222248:G260A	ENSP00000222248:G260A	G	+	2	0	SLC5A5	17849612	1.000000	0.71417	0.153000	0.22517	0.261000	0.26267	7.635000	0.83286	2.675000	0.91044	0.555000	0.69702	GGC			0.597	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466690.1			
CAPNS1	826	broad.mit.edu	37	19	36631958	36631958	+	Silent	SNP	C	C	G	rs567500165		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr19:36631958C>G	ENST00000246533.3	+	2	643	c.45C>G	c.(43-45)ggC>ggG	p.G15G	CAPNS1_ENST00000588780.1_Silent_p.G15G|CAPNS1_ENST00000588815.1_Silent_p.G15G|CAPNS1_ENST00000587718.1_Silent_p.G15G|CAPNS1_ENST00000590874.1_Silent_p.G15G|CAPNS1_ENST00000589146.1_Silent_p.G15G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	15	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcgggggaggcg	0.736													C|||	1	0.000199681	0.0	0.0	5008	,	,		3971	0.001		0.0	False		,,,				2504	0.0				p.G15G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C45G												6.0	7.0	7.0					19																	36631958		1958	3947	5905	SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGGGGA	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.45C>G	19.37:g.36631958C>G			67	0	0		73	0.05	4	NM_001749	4	0.00	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.736	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
STRN	6801	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	37094974	37094974	+	Silent	SNP	A	A	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:37094974A>G	ENST00000263918.4	-	12	1538	c.1530T>C	c.(1528-1530)taT>taC	p.Y510Y	STRN_ENST00000379213.2_Silent_p.Y461Y|RNU6-577P_ENST00000516947.1_RNA	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	510					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)	p.Y510*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTCTGAATGTATAGATAGGTT	0.299																																					p.Y510Y													STRN,extremity,malignant_melanoma,0,1	STRN	0	1	1	Substitution - Nonsense(1)	skin(1)	c.T1530C												102.0	107.0	105.0					2																	37094974		2203	4292	6495	SO:0001819	synonymous_variant	6801	exon12			GAATGTATAGATA	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1530T>C	2.37:g.37094974A>G			28	0	0		23	0.17	4	NM_003162	5	0.00	0	Q3KP65|Q53TQ8|Q9NP38	Silent	SNP	ENST00000263918.4	37	CCDS1784.1																																																																																					0.299	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218568.1			
MTA3	57504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	42836672	42836672	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:42836672A>G	ENST00000405094.1	+	4	265	c.265A>G	c.(265-267)Agg>Ggg	p.R89G	MTA3_ENST00000406911.1_Missense_Mutation_p.R89G|MTA3_ENST00000405592.1_Missense_Mutation_p.R33G|MTA3_ENST00000407270.3_Missense_Mutation_p.R89G|MTA3_ENST00000406652.1_Missense_Mutation_p.R33G			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	89	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						GTTGAAACATAGGGAACTCTT	0.378																																					p.R89G													.	.			0			c.A265G												111.0	107.0	108.0					2																	42836672		1877	4120	5997	SO:0001583	missense	57504	exon4			AAACATAGGGAAC	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.265A>G	2.37:g.42836672A>G	ENSP00000385823:p.Arg89Gly		156	0	0		128	0.10	13	NM_020744	69	0.33	23	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	37		.	.	.	.	.	.	.	.	.	.	A	13.77	2.336272	0.41398	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28	5.31	4.11	0.48088	.	0.000000	0.85682	D	0.000000	D	0.93759	0.8005	M	0.89904	3.07	0.48452	D	0.999659	D;D;D	0.89917	0.996;0.995;1.0	D;D;D	0.80764	0.948;0.972;0.994	D	0.93599	0.6928	10	0.87932	D	0	-19.1551	10.7674	0.46301	0.6948:0.3052:0.0:0.0	.	89;89;33	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	G	33;33;89;89;89;89	ENSP00000383973:R33G;ENSP00000384249:R33G;ENSP00000385045:R89G;ENSP00000385241:R89G;ENSP00000385823:R89G	ENSP00000282366:R89G	R	+	1	2	MTA3	42690176	1.000000	0.71417	0.963000	0.40424	0.140000	0.21249	2.099000	0.41767	0.796000	0.33947	0.459000	0.35465	AGG			0.378	MTA3-017	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000318159.1		NM_020744	
USP34	9736	mdanderson.org	37	2	61575520	61575520	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:61575520G>T	ENST00000398571.2	-	15	1846	c.1770C>A	c.(1768-1770)agC>agA	p.S590R		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	590					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TAACCTCATTGCTAGATCCAT	0.502																																					p.S590R													.	.			0			c.C1770A												110.0	113.0	112.0					2																	61575520		2084	4219	6303	SO:0001583	missense	9736	exon15			CTCATTGCTAGAT	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.1770C>A	2.37:g.61575520G>T	ENSP00000381577:p.Ser590Arg		38	0	0		67	0.06	4	NM_014709	5	0.00	0	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.904573	0.72868	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.04083	3.71	6.07	3.28	0.37604	.	0.085362	0.85682	D	0.000000	T	0.09862	0.0242	N	0.22421	0.69	0.51482	D	0.999928	D	0.61697	0.99	D	0.69142	0.962	T	0.16188	-1.0411	10	0.62326	D	0.03	.	11.5911	0.50945	0.2336:0.0:0.7664:0.0	.	590	Q70CQ2	UBP34_HUMAN	R	438;438;590	ENSP00000381577:S590R	ENSP00000263989:S438R	S	-	3	2	USP34	61429024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.263000	0.33004	1.575000	0.49775	0.650000	0.86243	AGC			0.502	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325650.4			
SFXN5	94097	hgsc.bcm.edu;mdanderson.org	37	2	73215427	73215427	+	Silent	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:73215427G>T	ENST00000272433.2	-	10	715	c.585C>A	c.(583-585)acC>acA	p.T195T	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Silent_p.T195T	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	195					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						TGAGAAGGCGGGTGGCTGGGG	0.512																																					p.T195T													.	.			0			c.C585A												127.0	113.0	118.0					2																	73215427		2203	4300	6503	SO:0001819	synonymous_variant	94097	exon10			AAGGCGGGTGGCT	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.585C>A	2.37:g.73215427G>T			88	0	0		83	0.05	4	NM_144579	5	0.00	0	A8K116|Q494Y3|Q53T29	Silent	SNP	ENST00000272433.2	37	CCDS1922.1	.	.	.	.	.	.	.	.	.	.	G	10.11	1.260795	0.23051	.	.	ENSG00000144040	ENST00000411783	.	.	.	5.39	2.59	0.31030	.	.	.	.	.	T	0.58680	0.2139	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51631	-0.8681	4	.	.	.	-34.5012	9.415	0.38517	0.221:0.0:0.779:0.0	.	.	.	.	T	185	.	.	P	-	1	0	SFXN5	73068935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.613000	0.46351	0.338000	0.23692	0.591000	0.81541	CCG			0.512	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251991.1		NM_144579	
ATF2	1386	broad.mit.edu	37	2	175979466	175979466	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:175979466G>T	ENST00000264110.2	-	8	876	c.578C>A	c.(577-579)aCc>aAc	p.T193N	ATF2_ENST00000487334.2_Missense_Mutation_p.T175N|ATF2_ENST00000345739.5_Missense_Mutation_p.T135N|ATF2_ENST00000392544.1_Missense_Mutation_p.T193N|ATF2_ENST00000409635.1_Missense_Mutation_p.T135N|ATF2_ENST00000538946.1_Missense_Mutation_p.T175N|ATF2_ENST00000426833.3_Missense_Mutation_p.T175N|ATF2_ENST00000409499.1_Intron|ATF2_ENST00000392543.2_Intron|ATF2_ENST00000409833.1_Missense_Mutation_p.T193N|ATF2_ENST00000409437.1_Intron	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	193					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	AGTACTTGAGGTTGGTGAAGG	0.413																																					p.T193N	Pancreas(17;87 705 4534 15538 30988)												.	ATF2	52		0			c.C578A												281.0	251.0	262.0					2																	175979466		2203	4300	6503	SO:0001583	missense	1386	exon8			CTTGAGGTTGGTG	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.578C>A	2.37:g.175979466G>T	ENSP00000264110:p.Thr193Asn		90	0	0		160	0.03	4	NM_001880	25	0.00	0	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	ENST00000264110.2	37	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872511	0.91587	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409635;ENST00000392544;ENST00000426833;ENST00000538946;ENST00000487334;ENST00000437522;ENST00000409833	T;T;T;T;T;T;D;D	0.92858	-1.38;0.18;0.18;-1.38;-1.3;-0.86;-3.11;-3.12	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.93242	0.7847	L	0.33485	1.01	0.80722	D	1	D;D;D;D	0.71674	0.998;0.979;0.993;0.962	D;P;D;P	0.73708	0.981;0.714;0.933;0.714	D	0.90640	0.4574	10	0.17832	T	0.49	-10.7559	19.1885	0.93654	0.0:0.0:1.0:0.0	.	175;170;135;193	A4D7U4;B3KY57;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	N	193;135;170;135;193;175;175;175;135;193	ENSP00000264110:T193N;ENSP00000340576:T135N;ENSP00000387093:T135N;ENSP00000376327:T193N;ENSP00000407911:T175N;ENSP00000437952:T175N;ENSP00000443513:T175N;ENSP00000386526:T193N	ENSP00000264110:T193N	T	-	2	0	ATF2	175687712	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.393000	0.97256	2.537000	0.85549	0.484000	0.47621	ACC			0.413	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000255562.1		NM_001880	
FZD5	7855	mdanderson.org	37	2	208632213	208632213	+	Silent	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:208632213G>T	ENST00000295417.3	-	2	1804	c.1251C>A	c.(1249-1251)ctC>ctA	p.L417L		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	417					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		CCAGCAGGAAGAGCGTGCCCA	0.647																																					p.L417L													.	.			0			c.C1251A												42.0	43.0	43.0					2																	208632213		2203	4300	6503	SO:0001819	synonymous_variant	7855	exon2			CAGGAAGAGCGTG	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.1251C>A	2.37:g.208632213G>T			36	0	0		30	0.10	3	NM_003468	6	0.00	0	A8K2X1|B2RCZ1|Q53R22	Silent	SNP	ENST00000295417.3	37	CCDS33366.1																																																																																					0.647	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337060.1		NM_003468	
ACADL	33	mdanderson.org	37	2	211068162	211068162	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:211068162G>T	ENST00000233710.3	-	8	1104	c.877C>A	c.(877-879)Ctg>Atg	p.L293M	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	293					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		GCAATTAACAGCCTTTCCTAT	0.303																																					p.L293M													.	.			0			c.C877A												78.0	70.0	73.0					2																	211068162		2202	4299	6501	SO:0001583	missense	33	exon8			TTAACAGCCTTTC	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.877C>A	2.37:g.211068162G>T	ENSP00000233710:p.Leu293Met		54	0	0		45	0.07	3	NM_001608	0		0	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	37	CCDS2389.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.651006	0.47362	.	.	ENSG00000115361	ENST00000233710	D	0.96885	-4.16	5.43	1.0	0.19881	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.066651	0.64402	D	0.000010	D	0.96901	0.8988	M	0.75447	2.3	0.50171	D	0.999852	D	0.89917	1.0	D	0.91635	0.999	D	0.94504	0.7712	10	0.45353	T	0.12	.	6.2931	0.21071	0.291:0.0:0.5842:0.1248	.	293	P28330	ACADL_HUMAN	M	293	ENSP00000233710:L293M	ENSP00000233710:L293M	L	-	1	2	ACADL	210776407	0.995000	0.38212	0.834000	0.33040	0.840000	0.47671	2.060000	0.41394	0.260000	0.21731	0.404000	0.27445	CTG			0.303	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256561.2		NM_001608	
GIGYF2	26058	mdanderson.org	37	2	233677194	233677194	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr2:233677194G>T	ENST00000409547.1	+	20	2411	c.2100G>T	c.(2098-2100)caG>caT	p.Q700H	GIGYF2_ENST00000452341.2_Missense_Mutation_p.Q531H|GIGYF2_ENST00000409196.3_Missense_Mutation_p.Q694H|GIGYF2_ENST00000409480.1_Missense_Mutation_p.Q722H|GIGYF2_ENST00000373566.3_Missense_Mutation_p.Q722H|GIGYF2_ENST00000373563.4_Missense_Mutation_p.Q700H|GIGYF2_ENST00000409451.3_Missense_Mutation_p.Q721H	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	700	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CAGCTTCACAGCCTACAGGTA	0.378																																					p.Q721H													.	.			0			c.G2163T												66.0	63.0	64.0					2																	233677194		2203	4300	6503	SO:0001583	missense	26058	exon20			TTCACAGCCTACA	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2100G>T	2.37:g.233677194G>T	ENSP00000386537:p.Gln700His		43	0	0		47	0.06	3	NM_001103147	39	0.00	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137302	0.56936	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.77098	-0.95;-0.91;-0.95;-0.91;-1.07;-0.91;-0.93;-1.06;-0.86	5.19	4.11	0.48088	.	0.063541	0.64402	D	0.000004	D	0.86159	0.5866	M	0.72894	2.215	0.40782	D	0.983184	D;D;D;D	0.61697	0.974;0.99;0.99;0.972	P;P;D;P	0.72982	0.838;0.856;0.979;0.735	D	0.87448	0.2399	10	0.54805	T	0.06	-2.2708	14.601	0.68441	0.0835:0.0:0.9165:0.0	.	531;721;700;694	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	H	722;643;700;722;700;700;643;694;721;694;531	ENSP00000362667:Q722H;ENSP00000362664:Q700H;ENSP00000386765:Q722H;ENSP00000386537:Q700H;ENSP00000404195:Q643H;ENSP00000387070:Q694H;ENSP00000387170:Q721H;ENSP00000410297:Q694H;ENSP00000411505:Q531H	ENSP00000362664:Q700H	Q	+	3	2	GIGYF2	233385438	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.836000	0.27545	2.416000	0.81992	0.655000	0.94253	CAG			0.378	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000330316.2		NM_001103146	
TMX4	56255	mdanderson.org	37	20	8000229	8000229	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr20:8000229G>T	ENST00000246024.2	-	1	247	c.32C>A	c.(31-33)aCg>aAg	p.T11K	RP5-971N18.3_ENST00000607924.1_RNA|RP5-971N18.3_ENST00000457707.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	11					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CAGGAGCGCCGTTAGCTGCGG	0.781																																					p.T11K													.	.			0			c.C32A												2.0	2.0	2.0					20																	8000229		1269	2802	4071	SO:0001583	missense	56255	exon1			AGCGCCGTTAGCT		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.32C>A	20.37:g.8000229G>T	ENSP00000246024:p.Thr11Lys		13	0	0		22	0.14	3	NM_021156	3	0.00	0	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	37	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.698229	0.48307	.	.	ENSG00000125827	ENST00000246024;ENST00000527925	T;T	0.17213	2.93;2.29	4.91	0.378	0.16204	.	1.042650	0.07565	N	0.917582	T	0.06962	0.0177	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42172	-0.9467	10	0.12766	T	0.61	0.0868	3.3212	0.07050	0.14:0.2516:0.4798:0.1286	.	11	Q9H1E5	TMX4_HUMAN	K	11	ENSP00000246024:T11K;ENSP00000435735:T11K	ENSP00000246024:T11K	T	-	2	0	TMX4	7948229	0.154000	0.22792	0.003000	0.11579	0.139000	0.21198	0.500000	0.22562	0.083000	0.17047	-0.302000	0.09304	ACG			0.781	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000077928.2		NM_021156	
PIGT	51604	mdanderson.org	37	20	44045270	44045270	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr20:44045270C>T	ENST00000279036.6	+	2	381	c.301C>T	c.(301-303)Cca>Tca	p.P101S	PIGT_ENST00000372689.5_Missense_Mutation_p.P101S|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000545755.1_Intron|PIGT_ENST00000341555.5_Intron|PIGT_ENST00000535404.1_5'UTR|PIGT_ENST00000543458.2_Missense_Mutation_p.P101S	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	101					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				ATACTGGGGGCCACCCTTCCT	0.587																																					p.P101S													.	.			0			c.C301T												45.0	41.0	43.0					20																	44045270		2203	4300	6503	SO:0001583	missense	51604	exon2			TGGGGGCCACCCT		CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.301C>T	20.37:g.44045270C>T	ENSP00000279036:p.Pro101Ser		59	0	0		49	0.06	3	NM_001184729	58	0.00	0	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	ENST00000279036.6	37	CCDS13353.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.685634	0.29962	.	.	ENSG00000124155	ENST00000543458;ENST00000372689;ENST00000279036	T;T;T	0.38560	1.13;1.13;1.13	5.94	1.71	0.24356	.	0.450892	0.25810	N	0.028159	T	0.17534	0.0421	N	0.04994	-0.135	0.80722	D	1	B;B;B	0.18013	0.0;0.001;0.025	B;B;B	0.22152	0.004;0.001;0.038	T	0.05370	-1.0889	10	0.21014	T	0.42	0.0528	4.5797	0.12253	0.1325:0.6159:0.1159:0.1358	.	101;101;101	B7Z3N1;B7Z7C5;Q969N2	.;.;PIGT_HUMAN	S	101	ENSP00000441577:P101S;ENSP00000361774:P101S;ENSP00000279036:P101S	ENSP00000279036:P101S	P	+	1	0	PIGT	43478684	0.999000	0.42202	0.455000	0.27031	0.940000	0.58332	2.467000	0.45093	0.080000	0.16959	0.557000	0.71058	CCA			0.587	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079434.2		NM_015937	
TNFRSF6B	8771	mdanderson.org	37	20	62328829	62328829	+	Silent	SNP	C	C	T	rs1291205	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr20:62328829C>T	ENST00000369996.1	+	2	673	c.573C>T	c.(571-573)acC>acT	p.T191T	RTEL1-TNFRSF6B_ENST00000482936.1_3'UTR|ARFRP1_ENST00000485858.1_5'Flank	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	191					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			CCCATGACACCCTGTGCACCA	0.672																																					p.T191T													TNFRSF6B,caecum,carcinoma,0,1	TNFRSF6B	0	1	0			c.C573T												29.0	21.0	24.0					20																	62328829		2164	4269	6433	SO:0001819	synonymous_variant	8771	exon2			TGACACCCTGTGC	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.573C>T	20.37:g.62328829C>T			59	0	0		59	0.05	3	NM_003823	36	0.00	0		Silent	SNP	ENST00000369996.1	37	CCDS13532.1																																																																																					0.672	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080182.1			
SON	6651	hgsc.bcm.edu	37	21	34927489	34927489	+	Silent	SNP	G	G	C	rs545015873	byFrequency	TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr21:34927489G>C	ENST00000356577.4	+	3	6427	c.5952G>C	c.(5950-5952)cgG>cgC	p.R1984R	SON_ENST00000381679.4_Silent_p.R1984R|SON_ENST00000290239.6_Silent_p.R1984R|SON_ENST00000300278.4_Silent_p.R1984R|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1984	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1984R(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						ccagccgccggagccgcaccc	0.701													g|||	4	0.000798722	0.0023	0.0	5008	,	,		5843	0.0		0.001	False		,,,				2504	0.0				p.R1984R													SON_ENST00000300278,NS,carcinoma,0,2	SON_ENST00000300278	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.G5952C												20.0	22.0	21.0					21																	34927489		2199	4293	6492	SO:0001819	synonymous_variant	6651	exon3			CCGCCGGAGCCGC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5952G>C	21.37:g.34927489G>C			11	0	0		12	0.25	3	NM_032195	53	0.00	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	g	3.291	-0.145003	0.06627	.	.	ENSG00000159140	ENST00000436227	.	.	.	4.22	-0.891	0.10573	.	.	.	.	.	T	0.57519	0.2059	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	10.594	0.45327	0.0789:0.5195:0.4016:0.0	.	.	.	.	A	979	.	.	G	+	2	0	SON	33849359	0.998000	0.40836	0.805000	0.32314	0.728000	0.41692	0.803000	0.27083	-0.153000	0.11137	-0.126000	0.14955	GGA			0.701	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140978.2		NM_138927	
MCM3AP	8888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47700450	47700450	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr21:47700450G>C	ENST00000397708.1	-	4	1737	c.1483C>G	c.(1483-1485)Cat>Gat	p.H495D	MCM3AP_ENST00000291688.1_Missense_Mutation_p.H495D			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	495	DNA primase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ATGTCTTTATGCAAACTTTTC	0.348																																					p.H495D													.	.			0			c.C1483G												74.0	79.0	77.0					21																	47700450		2203	4300	6503	SO:0001583	missense	8888	exon3			CTTTATGCAAACT	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1483C>G	21.37:g.47700450G>C	ENSP00000380820:p.His495Asp		339	0	0		441	0.12	51	NM_003906	6	0.17	1	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626758	0.66901	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03524	3.9;3.9	5.32	5.32	0.75619	.	0.296155	0.40385	N	0.001113	T	0.06280	0.0162	M	0.62723	1.935	0.40295	D	0.97854	P	0.41041	0.736	B	0.35550	0.205	T	0.27839	-1.0062	10	0.45353	T	0.12	-9.5776	16.7618	0.85514	0.0:0.0:1.0:0.0	.	495	O60318	MCM3A_HUMAN	D	495	ENSP00000380820:H495D;ENSP00000291688:H495D	ENSP00000291688:H495D	H	-	1	0	MCM3AP	46524878	0.993000	0.37304	0.963000	0.40424	0.991000	0.79684	2.473000	0.45145	2.495000	0.84180	0.591000	0.81541	CAT			0.348	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207254.1		NM_003906	
AP000350.10	0	mdanderson.org	37	22	24237063	24237063	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr22:24237063G>T	ENST00000433835.3	+	5	536	c.536G>T	c.(535-537)cGc>cTc	p.R179L	AP000350.4_ENST00000406213.1_3'UTR|MIF_ENST00000215754.7_Silent_p.A71A																							TCGGCGGCGCGCAGAACCGCT	0.726																																					p.A71A													.	.			0			c.G213T																																									SO:0001583	missense	4282	exon2			CGGCGCGCAGAAC																												ENST00000433835.3:c.536G>T	22.37:g.24237063G>T	ENSP00000400325:p.Arg179Leu		9	0	0		15	0.13	2	NM_002415	1519	0.00	0		Silent	SNP	ENST00000433835.3	37																																																																																						0.726	AP000350.10-005	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000334403.3			
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	52537884	52537884	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr3:52537884G>T	ENST00000321725.6	+	9	1064	c.988G>T	c.(988-990)Gcc>Tcc	p.A330S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	330					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CGACCGGTCTGCCACTTGCCA	0.657																																					p.A330S													.	.			0			c.G988T												50.0	46.0	47.0					3																	52537884		2203	4300	6503	SO:0001583	missense	23166	exon9			CGGTCTGCCACTT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.988G>T	3.37:g.52537884G>T	ENSP00000312946:p.Ala330Ser		95	0	0		76	0.07	5	NM_015136	0		0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735483	0.49045	.	.	ENSG00000010327	ENST00000321725	T	0.12672	2.66	5.13	5.13	0.70059	.	0.070133	0.56097	D	0.000036	T	0.21674	0.0522	L	0.53671	1.685	0.46901	D	0.999243	D;P	0.54397	0.966;0.884	P;B	0.49252	0.604;0.292	T	0.00544	-1.1679	10	0.66056	D	0.02	.	14.1066	0.65093	0.0:0.0:1.0:0.0	.	330;330	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	S	330	ENSP00000312946:A330S	ENSP00000312946:A330S	A	+	1	0	STAB1	52512924	1.000000	0.71417	0.997000	0.53966	0.179000	0.23085	5.800000	0.69108	2.396000	0.81511	0.563000	0.77884	GCC			0.657	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351380.2		NM_015136	
KCNAB1	7881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	156232196	156232196	+	Silent	SNP	G	G	A	rs370190413		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr3:156232196G>A	ENST00000490337.1	+	9	766	c.702G>A	c.(700-702)gcG>gcA	p.A234A	KCNAB1_ENST00000302490.8_Silent_p.A216A|KCNAB1_ENST00000471742.1_Silent_p.A223A|KCNAB1_ENST00000389636.5_Silent_p.A205A|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Silent_p.A187A	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	234					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AAGGCATGGCGATGTACTGGG	0.393																																					p.A234A													KCNAB1_ENST00000471742,colon,carcinoma,+1,2	KCNAB1_ENST00000471742	1	2	0			c.G702A							G	,,	1,4405	2.1+/-5.4	0,1,2202	190.0	183.0	185.0		669,648,702	-11.0	0.0	3		185	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNAB1	NM_003471.3,NM_172159.3,NM_172160.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	223/409,216/402,234/420	156232196	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7881	exon9			CATGGCGATGTAC	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.702G>A	3.37:g.156232196G>A			83	0	0		80	0.14	11	NM_172160	0		0	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	ENST00000490337.1	37	CCDS3174.1																																																																																					0.393	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000351411.1		NM_003471	
SDHAP1	255812	broad.mit.edu	37	3	195698636	195698648	+	RNA	DEL	GCCTGTAATCCCA	GCCTGTAATCCCA	-	rs202154697		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	GCCTGTAATCCCA	GCCTGTAATCCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr3:195698636_195698648delGCCTGTAATCCCA	ENST00000427841.1	-	0	1557					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		agtggctcacgcctgtaatcccagcactttagg	0.413																																					.	Ovarian(67;1158 1227 12109 20189 43170)												.	.			0			.																																											0	.			GCTCACGCCTGTA	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195698636_195698648delGCCTGTAATCCCA			5	0	0		7	0.43	3	.	0		0		RNA	DEL	ENST00000427841.1	37																																																																																						0.413	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000341367.1			
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	C	rs121913506		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr4:55599320G>C	ENST00000288135.5	+	17	2543	c.2446G>C	c.(2446-2448)Gac>Cac	p.D816H		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816H			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446C												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>C	4.37:g.55599320G>C	ENSP00000288135:p.Asp816His		61	0	0		60	0.43	26	NM_000222	68	0.72	49	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721319	0.68959	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83837	-1.77;-1.77	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.80732	0.4679	L	0.49699	1.58	0.80722	D	1	P;B	0.44734	0.842;0.353	B;B	0.38156	0.266;0.154	D	0.83488	0.0068	10	0.72032	D	0.01	.	19.6484	0.95791	0.0:0.0:1.0:0.0	rs28933969	812;816	P10721-2;P10721	.;KIT_HUMAN	H	816;812	ENSP00000288135:D816H;ENSP00000390987:D812H	ENSP00000288135:D816H	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
KDM3B	51780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	137729063	137729063	+	Splice_Site	SNP	T	T	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr5:137729063T>C	ENST00000314358.5	+	9	3031		c.e9+2		KDM3B_ENST00000394866.1_Splice_Site|KDM3B_ENST00000542866.1_Splice_Site	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CTTCCGGAGGTACCCAAACTC	0.448																																					.													.	.			0			c.2831+2T>C												44.0	43.0	43.0					5																	137729063		2203	4300	6503	SO:0001630	splice_region_variant	51780	exon9			CGGAGGTACCCAA	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2831+2T>C	5.37:g.137729063T>C			107	0	0		95	0.21	20	NM_016604	109	1.00	109	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Splice_Site	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890912	0.72524	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.43	0.83839	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM3B	137756962	1.000000	0.71417	0.994000	0.49952	0.661000	0.39034	7.895000	0.87343	2.283000	0.76528	0.533000	0.62120	.			0.448	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000373597.1		NM_016604	Intron
PCDHB14	56122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140605294	140605294	+	Silent	SNP	G	G	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr5:140605294G>A	ENST00000239449.4	+	1	2217	c.2217G>A	c.(2215-2217)gtG>gtA	p.V739V	PCDHB14_ENST00000515856.2_Silent_p.V586V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	739					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGGACGTGAGCGGCACCG	0.622																																					p.V739V	Ovarian(141;50 1831 27899 33809 37648)												.	.			0			c.G2217A												81.0	96.0	91.0					5																	140605294		2203	4298	6501	SO:0001819	synonymous_variant	56122	exon1			GGACGTGAGCGGC	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2217G>A	5.37:g.140605294G>A			100	0	0		73	0.25	18	NM_018934	1	0.00	0	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	37	CCDS4256.1																																																																																					0.622	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251814.2		NM_018934	
TAF7	6879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140699523	140699523	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr5:140699523C>G	ENST00000313368.5	-	1	807	c.89G>C	c.(88-90)aGg>aCg	p.R30T		NM_005642.2	NP_005633.2	Q15545	TAF7_HUMAN	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	30					DNA-templated transcription, initiation (GO:0006352)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of histone acetylation (GO:0035067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermine transport (GO:0000296)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	histone acetyltransferase binding (GO:0035035)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|vitamin D receptor binding (GO:0042809)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTACTGCCCTTCTCACAGT	0.463																																					p.R30T													.	.			0			c.G89C												174.0	162.0	166.0					5																	140699523		2203	4300	6503	SO:0001583	missense	6879	exon1			ACTGCCCTTCTCA	AF349038	CCDS4259.1	5q31	2008-02-05	2002-08-29	2001-12-07	ENSG00000178913	ENSG00000178913			11541	protein-coding gene	gene with protein product		600573	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, F, 55kD"""	TAF2F		7824954	Standard	NM_005642		Approved	TAFII55	uc003ljg.3	Q15545	OTTHUMG00000129628	ENST00000313368.5:c.89G>C	5.37:g.140699523C>G	ENSP00000312709:p.Arg30Thr		114	0	0		114	0.31	35	NM_005642	259	0.59	154	B2RBV9|Q13036	Missense_Mutation	SNP	ENST00000313368.5	37	CCDS4259.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214106	0.58452	.	.	ENSG00000178913	ENST00000313368	T	0.23348	1.91	5.61	4.73	0.59995	TAFII55 protein, conserved region (1);	0.050491	0.85682	D	0.000000	T	0.25865	0.0630	L	0.45422	1.42	0.48341	D	0.999635	P	0.43231	0.801	B	0.43225	0.412	T	0.01405	-1.1363	10	0.66056	D	0.02	-11.1251	11.8756	0.52546	0.0:0.9162:0.0:0.0838	.	30	Q15545	TAF7_HUMAN	T	30	ENSP00000312709:R30T	ENSP00000312709:R30T	R	-	2	0	TAF7	140679707	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.285000	0.51716	2.826000	0.97356	0.655000	0.94253	AGG			0.463	TAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251823.2		NM_005642	
CSNK1A1	1452	mdanderson.org	37	5	148929653	148929653	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr5:148929653C>T	ENST00000377843.2	-	2	694	c.215G>A	c.(214-216)gGc>gAc	p.G72D	CSNK1A1_ENST00000261798.5_Missense_Mutation_p.G72D|CSNK1A1_ENST00000504676.1_5'UTR|CSNK1A1_ENST00000515768.1_Missense_Mutation_p.G72D|CSNK1A1_ENST00000515748.2_Missense_Mutation_p.G72D|CSNK1A1_ENST00000515435.1_5'UTR	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GTGGGGGATGCCAACCCCACC	0.547																																					p.G72D	Colon(5;64 69 1309 10383)												CSNK1A1_ENST00000515768,colon,carcinoma,+1,2	CSNK1A1_ENST00000515768	1	2	0			c.G215A												97.0	104.0	102.0					5																	148929653		2192	4299	6491	SO:0001583	missense	1452	exon2			GGGATGCCAACCC	AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.215G>A	5.37:g.148929653C>T	ENSP00000367074:p.Gly72Asp		65	0	0		47	0.06	3	NM_001025105	49	0.00	0	D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Missense_Mutation	SNP	ENST00000377843.2	37	CCDS47303.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890921	0.91889	.	.	ENSG00000113712	ENST00000261798;ENST00000377843;ENST00000322237;ENST00000515768;ENST00000515748	T;T;T;T	0.65364	-0.15;-0.15;-0.15;1.97	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	D	0.90249	0.6951	H	0.99881	4.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.94792	0.7963	10	0.87932	D	0	.	19.6758	0.95932	0.0:1.0:0.0:0.0	.	72;72;72	Q71TU5;P48729;P48729-2	.;KC1A_HUMAN;.	D	72	ENSP00000261798:G72D;ENSP00000367074:G72D;ENSP00000421689:G72D;ENSP00000421268:G72D	ENSP00000261798:G72D	G	-	2	0	CSNK1A1	148909846	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.521000	0.81832	2.644000	0.89710	0.561000	0.74099	GGC			0.547	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_001892	
JARID2	3720	mdanderson.org	37	6	15496957	15496957	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr6:15496957C>T	ENST00000341776.2	+	7	1745	c.1501C>T	c.(1501-1503)Cgg>Tgg	p.R501W	JARID2_ENST00000397311.3_Missense_Mutation_p.R329W|JARID2_ENST00000541660.1_Missense_Mutation_p.R463W	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	501					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TCGGCCGAAGCGGGCCACGGC	0.642																																					p.R501W													JARID2,NS,carcinoma,-1,1	JARID2	-1	1	0			c.C1501T												31.0	38.0	35.0					6																	15496957		2203	4300	6503	SO:0001583	missense	3720	exon7			CCGAAGCGGGCCA	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1501C>T	6.37:g.15496957C>T	ENSP00000341280:p.Arg501Trp		59	0	0		42	0.07	3	NM_004973	29	0.00	0	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905723	0.72868	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.91894	-2.22;-2.15;-2.93	5.4	1.3	0.21679	.	0.000000	0.85682	D	0.000000	D	0.91181	0.7222	L	0.34521	1.04	0.53688	D	0.999973	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.965	D	0.90975	0.4823	10	0.87932	D	0	-13.1975	15.919	0.79544	0.656:0.344:0.0:0.0	.	463;365;501	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	W	365;501;329;463	ENSP00000341280:R501W;ENSP00000380478:R329W;ENSP00000444623:R463W	ENSP00000341280:R501W	R	+	1	2	JARID2	15604936	1.000000	0.71417	0.987000	0.45799	0.945000	0.59286	0.767000	0.26575	-0.054000	0.13266	0.561000	0.74099	CGG			0.642	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000039926.1		NM_004973	
UBR2	23304	broad.mit.edu	37	6	42633186	42633186	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr6:42633186G>T	ENST00000372899.1	+	33	3996	c.3738G>T	c.(3736-3738)tgG>tgT	p.W1246C	RNU6-890P_ENST00000384121.1_RNA|UBR2_ENST00000372901.1_Missense_Mutation_p.W1246C|UBR2_ENST00000372883.3_3'UTR	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1246					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGACTCAGTGGATTAGAACAA	0.308																																					p.W1246C													.	UBR2	134		0			c.G3738T												90.0	102.0	98.0					6																	42633186		2203	4298	6501	SO:0001583	missense	23304	exon33			TCAGTGGATTAGA	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.3738G>T	6.37:g.42633186G>T	ENSP00000361990:p.Trp1246Cys		160	0	0		181	0.02	4	NM_015255	14	0.00	0	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082409	0.76528	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.59083	0.29;0.29	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	T	0.77938	-0.2400	10	0.54805	T	0.06	-10.0745	19.8472	0.96713	0.0:0.0:1.0:0.0	.	1246;1246	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	C	1246	ENSP00000361990:W1246C;ENSP00000361992:W1246C	ENSP00000361990:W1246C	W	+	3	0	UBR2	42741164	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.750000	0.85110	2.768000	0.95171	0.650000	0.86243	TGG			0.308	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040558.2		NM_015255	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	145095443	145095443	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr6:145095443C>T	ENST00000367545.3	+	59	8575	c.8575C>T	c.(8575-8577)Cgt>Tgt	p.R2859C	UTRN_ENST00000367526.4_Missense_Mutation_p.R414C	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2859	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAATAATGTACGTTTTTCTGC	0.323																																					p.R2859C													UTRN,NS,carcinoma,0,1	UTRN	0	1	0			c.C8575T												103.0	96.0	98.0					6																	145095443		2203	4300	6503	SO:0001583	missense	7402	exon59			AATGTACGTTTTT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8575C>T	6.37:g.145095443C>T	ENSP00000356515:p.Arg2859Cys		122	0	0		147	0.13	19	NM_007124	23	0.22	5	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766115	0.69878	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.72942	-0.7;-0.7	5.93	5.06	0.68205	EF-hand domain, type 1 (1);	0.000000	0.50627	D	0.000101	D	0.84929	0.5581	M	0.89785	3.06	0.52501	D	0.999957	D	0.89917	1.0	D	0.83275	0.996	D	0.87087	0.2170	10	0.87932	D	0	.	15.5297	0.75948	0.0:0.9331:0.0:0.0669	.	2859	P46939	UTRO_HUMAN	C	2859;414	ENSP00000356515:R2859C;ENSP00000356496:R414C	ENSP00000356496:R414C	R	+	1	0	UTRN	145137136	0.924000	0.31332	0.970000	0.41538	0.804000	0.45430	2.022000	0.41030	2.826000	0.97356	0.655000	0.94253	CGT			0.323	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042551.1			
HDAC9	9734	mdanderson.org	37	7	18875602	18875602	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr7:18875602A>G	ENST00000432645.2	+	20	2657	c.2657A>G	c.(2656-2658)gAg>gGg	p.E886G	HDAC9_ENST00000401921.1_Missense_Mutation_p.E845G|HDAC9_ENST00000441542.2_Missense_Mutation_p.E889G|HDAC9_ENST00000406451.4_Missense_Mutation_p.E886G	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	886	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GGAGATGTTGAGTACCTTGAA	0.423																																					p.E889G													.	.			0			c.A2666G												76.0	73.0	74.0					7																	18875602		1845	4086	5931	SO:0001583	missense	9734	exon20			ATGTTGAGTACCT	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2657A>G	7.37:g.18875602A>G	ENSP00000410337:p.Glu886Gly		58	0	0		48	0.06	3	NM_178425	0		0	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.934774	0.52866	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.42	5.42	0.78866	Histone deacetylase domain (2);	0.000000	0.53938	D	0.000041	T	0.79885	0.4523	L	0.57130	1.785	0.80722	D	1	D;P;B;B;B	0.89917	1.0;0.692;0.346;0.398;0.346	D;B;B;B;B	0.91635	0.999;0.253;0.213;0.318;0.213	T	0.81488	-0.0910	10	0.87932	D	0	-21.0372	9.9037	0.41364	0.9238:0.0:0.0762:0.0	.	134;845;889;886;886	Q8N926;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5	.;.;.;HDAC9_HUMAN;.	G	886;845;886;889;798	ENSP00000384657:E886G;ENSP00000383912:E845G;ENSP00000410337:E886G;ENSP00000408617:E889G	ENSP00000339165:E798G	E	+	2	0	HDAC9	18842127	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.574000	0.82434	2.044000	0.60594	0.460000	0.39030	GAG			0.423	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000376176.1			
SCARA3	51435	ucsc.edu	37	8	27509049	27509049	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr8:27509049G>T	ENST00000301904.3	+	3	151	c.131G>T	c.(130-132)cGc>cTc	p.R44L	SCARA3_ENST00000337221.4_Missense_Mutation_p.R44L	NM_016240.2	NP_057324.2	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3	44					receptor-mediated endocytosis (GO:0006898)|response to oxidative stress (GO:0006979)|UV protection (GO:0009650)	collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)	p.R44H(1)		breast(1)|large_intestine(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	9		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		CGCTGCAGCCGCTGCCAGAAG	0.622																																					p.R44L													SCARA3,colon,carcinoma,0,1	SCARA3	93	1	1	Substitution - Missense(1)	large_intestine(1)	c.G131T												55.0	54.0	54.0					8																	27509049		2203	4300	6503	SO:0001583	missense	51435	exon3			GCAGCCGCTGCCA	AB007829	CCDS34870.1, CCDS34871.1	8p21	2010-03-24			ENSG00000168077	ENSG00000168077			19000	protein-coding gene	gene with protein product	"""macrophage scavenger receptor-like 1"""	602728				9747040, 9580669	Standard	NM_182826		Approved	CSR1, CSR, MSLR1, APC7, MSRL1	uc003xga.1	Q6AZY7	OTTHUMG00000163898	ENST00000301904.3:c.131G>T	8.37:g.27509049G>T	ENSP00000301904:p.Arg44Leu		27	0	0		43	0.09	4	NM_182826	3	0.00	0	Q9UM15|Q9UM16	Missense_Mutation	SNP	ENST00000301904.3	37	CCDS34871.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829809	0.91036	.	.	ENSG00000168077	ENST00000337221;ENST00000301904	T;D	0.92595	2.19;-3.07	5.94	5.94	0.96194	.	0.046963	0.85682	D	0.000000	D	0.93360	0.7883	L	0.29908	0.895	0.41880	D	0.99031	D;D	0.69078	0.997;0.995	D;P	0.67231	0.95;0.891	D	0.94076	0.7340	10	0.87932	D	0	-24.5666	17.8674	0.88799	0.0:0.0:1.0:0.0	.	44;44	Q6AZY7-2;Q6AZY7	.;SCAR3_HUMAN	L	44	ENSP00000337985:R44L;ENSP00000301904:R44L	ENSP00000301904:R44L	R	+	2	0	SCARA3	27564968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.782000	0.47758	2.820000	0.97059	0.650000	0.86243	CGC			0.622	SCARA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376258.2		NM_016240	
ZFAT	57623	hgsc.bcm.edu;broad.mit.edu	37	8	135615099	135615099	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr8:135615099G>T	ENST00000377838.3	-	6	1037	c.863C>A	c.(862-864)gCc>gAc	p.A288D	ZFAT_ENST00000520727.1_Missense_Mutation_p.A276D|ZFAT_ENST00000429442.2_Missense_Mutation_p.A276D|ZFAT_ENST00000520214.1_Missense_Mutation_p.A276D|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520356.1_Missense_Mutation_p.A276D|ZFAT_ENST00000523399.1_Missense_Mutation_p.A226D	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	288					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A288D(1)|p.A276D(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCTCAGGTGGGCCTGCAGCGA	0.517																																					p.A288D													ZFAT_ENST00000377838,NS,carcinoma,0,2	ZFAT_ENST00000377838	0	2	2	Substitution - Missense(2)	endometrium(2)	c.C863A												98.0	101.0	100.0					8																	135615099		2009	4168	6177	SO:0001583	missense	57623	exon6			AGGTGGGCCTGCA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.863C>A	8.37:g.135615099G>T	ENSP00000367069:p.Ala288Asp		118	0.0084745763	1		146	0.04	6	NM_020863	3	0.00	0	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160311	0.78226	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93;3.93	6.04	5.16	0.70880	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	L	0.39245	1.2	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.97110	0.998;1.0;0.999;0.959	T	0.40384	-0.9566	10	0.12103	T	0.63	-27.1517	16.4288	0.83833	0.0:0.1314:0.8685:0.0	.	226;276;276;288	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	D	276;276;276;288;276;276;226;276	ENSP00000427879:A276D;ENSP00000427831:A276D;ENSP00000394501:A276D;ENSP00000367069:A288D;ENSP00000428483:A276D;ENSP00000429091:A226D	ENSP00000326997:A276D	A	-	2	0	ZFAT	135684281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.062000	0.89475	1.545000	0.49373	0.563000	0.77884	GCC			0.517	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378272.1		NM_001029939	
GNAQ	2776	mdanderson.org	37	9	80646047	80646047	+	Silent	SNP	G	G	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr9:80646047G>A	ENST00000286548.4	-	1	327	c.105C>T	c.(103-105)gaC>gaT	p.D35D		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	35					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CCCGGCGGGCGTCCCGCTTGT	0.716			Mis		uveal melanoma																																p.D35D				Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	.			0			c.C105T												10.0	11.0	11.0					9																	80646047		2164	4251	6415	SO:0001819	synonymous_variant	2776	exon1			GCGGGCGTCCCGC		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.105C>T	9.37:g.80646047G>A			33	0.0303030303	1		44	0.09	4	NM_002072	14	0.00	0	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Silent	SNP	ENST00000286548.4	37	CCDS6658.1																																																																																					0.716	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052761.1		NM_002072	
MURC	347273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	103340547	103340547	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr9:103340547C>A	ENST00000307584.5	+	1	187	c.122C>A	c.(121-123)gCc>gAc	p.A41D	RN7SKP87_ENST00000364096.1_RNA	NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	41					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				GACAAAGTAGCCTCCATCGTG	0.463																																					p.A41D													.	.			0			c.C122A												115.0	113.0	113.0					9																	103340547		2203	4300	6503	SO:0001583	missense	347273	exon1			AAGTAGCCTCCAT	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.122C>A	9.37:g.103340547C>A	ENSP00000418668:p.Ala41Asp		93	0	0		81	0.12	10	NM_001018116	2	0.00	0	B1PRL3|B4DT88	Missense_Mutation	SNP	ENST00000307584.5	37	CCDS35083.1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453865	0.63290	.	.	ENSG00000170681	ENST00000307584	T	0.61040	0.14	5.39	5.39	0.77823	.	0.062015	0.64402	D	0.000006	T	0.71213	0.3313	L	0.50333	1.59	0.52501	D	0.999959	D	0.76494	0.999	D	0.72075	0.976	T	0.73023	-0.4113	10	0.66056	D	0.02	-16.1833	16.6642	0.85248	0.0:1.0:0.0:0.0	.	41	Q5BKX8	MURC_HUMAN	D	41	ENSP00000418668:A41D	ENSP00000418668:A41D	A	+	2	0	MURC	102380368	1.000000	0.71417	0.657000	0.29651	0.980000	0.70556	6.089000	0.71384	2.532000	0.85374	0.655000	0.94253	GCC			0.463	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053419.2		NM_001018116	
STKLD1	169436	mdanderson.org	37	9	136265624	136265624	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr9:136265624G>T	ENST00000371957.3	+	12	1272	c.1165G>T	c.(1165-1167)Gcc>Tcc	p.A389S	C9orf96_ENST00000371955.1_Missense_Mutation_p.A14S	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		389							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCAGCTGTGTGCCTGCTCCCT	0.682																																					p.A389S													.	.			0			c.G1165T												143.0	97.0	113.0					9																	136265624		2203	4300	6503	SO:0001583	missense	169436	exon12			CTGTGTGCCTGCT																												ENST00000371957.3:c.1165G>T	9.37:g.136265624G>T	ENSP00000361025:p.Ala389Ser		18	0	0		11	0.18	2	NM_153710	0		0	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	G	7.067	0.567560	0.13560	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.62941	-0.01;-0.01	4.48	2.53	0.30540	Armadillo-like helical (1);Armadillo-type fold (1);	0.634581	0.14786	N	0.298503	T	0.51058	0.1652	M	0.62723	1.935	0.09310	N	1	P	0.45126	0.851	B	0.39339	0.297	T	0.36212	-0.9757	10	0.15952	T	0.53	-11.5035	5.5265	0.16960	0.1046:0.0:0.7013:0.1941	.	389	Q8NE28	SGK71_HUMAN	S	389;14	ENSP00000361025:A389S;ENSP00000361023:A14S	ENSP00000361023:A14S	A	+	1	0	C9orf96	135255445	0.299000	0.24426	0.266000	0.24541	0.805000	0.45488	1.151000	0.31651	0.440000	0.26502	0.561000	0.74099	GCC			0.682	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054855.1			
ADAMTS13	11093	mdanderson.org	37	9	136302973	136302973	+	Missense_Mutation	SNP	C	C	G	rs370215524		TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chr9:136302973C>G	ENST00000371929.3	+	13	1984	c.1540C>G	c.(1540-1542)Cgg>Ggg	p.R514G	ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.R514G|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.R186G|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.R483G	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	514	Cysteine-rich.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AAGTGGCCCCCGGGAGGACGG	0.632																																					p.R514G													.	.			0			c.C1540G												83.0	89.0	87.0					9																	136302973		2203	4300	6503	SO:0001583	missense	11093	exon13			GGCCCCCGGGAGG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1540C>G	9.37:g.136302973C>G	ENSP00000360997:p.Arg514Gly		67	0	0		42	0.07	3	NM_139025	0		0	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	C	4.939	0.174449	0.09391	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.42	3.45	0.39498	.	.	.	.	.	T	0.54498	0.1862	L	0.40543	1.245	0.09310	N	1	B;B;P	0.35944	0.394;0.27;0.529	B;B;B	0.30029	0.08;0.11;0.11	T	0.39702	-0.9601	9	0.49607	T	0.09	.	11.0125	0.47671	0.362:0.638:0.0:0.0	.	514;483;514	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	G	514;514;483;186	ENSP00000360997:R514G;ENSP00000347927:R514G;ENSP00000348997:R483G;ENSP00000444504:R186G	ENSP00000347927:R514G	R	+	1	2	ADAMTS13	135292794	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.103000	0.10940	0.537000	0.28751	0.655000	0.94253	CGG			0.632	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054920.1		NM_139025	
GDPD2	54857	mdanderson.org	37	X	69647059	69647059	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chrX:69647059G>T	ENST00000374382.3	+	9	1026	c.775G>T	c.(775-777)Gtg>Ttg	p.V259L	GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000453994.2_Missense_Mutation_p.V259L|GDPD2_ENST00000536730.1_Missense_Mutation_p.V180L|GDPD2_ENST00000538649.1_Missense_Mutation_p.V180L	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	259	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					TGAGACTGATGTGATGGTCAG	0.577																																					p.V259L													.	.			0			c.G775T												92.0	76.0	82.0					X																	69647059		2203	4300	6503	SO:0001583	missense	54857	exon9			ACTGATGTGATGG	AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.775G>T	X.37:g.69647059G>T	ENSP00000363503:p.Val259Leu		35	0	0		44	0.07	3	NM_001171192	46	0.00	0	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269035	0.80469	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.35	5.35	0.76521	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.64402	D	0.000001	T	0.42314	0.1197	L	0.52905	1.665	0.44719	D	0.997712	D;D;P;P	0.89917	1.0;0.988;0.93;0.91	D;P;P;P	0.85130	0.997;0.884;0.893;0.508	T	0.08472	-1.0720	9	.	.	.	-16.4712	16.4918	0.84203	0.0:0.0:1.0:0.0	.	259;45;180;259	B4DVC9;B3KUI6;B4DRH4;Q9HCC8	.;.;.;GDPD2_HUMAN	L	259;180;180;259	ENSP00000414019:V259L;ENSP00000445982:V180L;ENSP00000444601:V180L;ENSP00000363503:V259L	.	V	+	1	0	GDPD2	69563784	1.000000	0.71417	0.996000	0.52242	0.750000	0.42670	6.850000	0.75420	2.464000	0.83262	0.600000	0.82982	GTG			0.577	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057070.1		NM_017711	
COL4A6	1288	broad.mit.edu	37	X	107430450	107430450	+	Silent	SNP	T	T	C			TCGA-XE-AAOF-01A-11D-A435-10	TCGA-XE-AAOF-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d2135c99-4713-45f2-a010-698436b06fd4	38ca9ea0-821a-4a17-bb22-6e3b0e5743c0	g.chrX:107430450T>C	ENST00000372216.4	-	23	1930	c.1830A>G	c.(1828-1830)aaA>aaG	p.K610K	COL4A6_ENST00000545689.1_Silent_p.K609K|COL4A6_ENST00000334504.7_Silent_p.K609K|COL4A6_ENST00000394872.2_Silent_p.K610K|COL4A6_ENST00000538570.1_Silent_p.K609K	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	610	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CAGGATGGCCTTTTTCACCAG	0.512									Alport syndrome with Diffuse Leiomyomatosis																												p.K610K	Melanoma(87;1895 1945 2589 7165)												.	COL4A6	270		0			c.A1830G												127.0	118.0	121.0					X																	107430450		2203	4300	6503	SO:0001819	synonymous_variant	1288	exon23	Familial Cancer Database		ATGGCCTTTTTCA	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1830A>G	X.37:g.107430450T>C			84	0	0		86	0.03	3	NM_001847	3	0.00	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1																																																																																					0.512	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057875.2			
