#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SSBP3	23648	broad.mit.edu	37	1	54871665	54871665	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:54871665T>C	ENST00000371320.3	-	1	427	c.17A>G	c.(16-18)aAa>aGa	p.K6R	SSBP3_ENST00000371319.3_Missense_Mutation_p.K6R|SSBP3_ENST00000417664.2_5'Flank|SSBP3_ENST00000357475.4_Missense_Mutation_p.K6R	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	6					head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CGCCGAGCCTTTGCCTTTGGC	0.736																																					p.K6R													.	SSBP3	65		0			c.A17G												4.0	5.0	5.0					1																	54871665		2079	4010	6089	SO:0001583	missense	23648	exon1			GAGCCTTTGCCTT		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.17A>G	1.37:g.54871665T>C	ENSP00000360371:p.Lys6Arg		96	0.0104166667	1		55	0.09	5	NM_001009955	83	0.00	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645914	0.47258	.	.	ENSG00000157216	ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	2.64	2.64	0.31445	.	0.000000	0.46758	U	0.000271	T	0.45155	0.1328	L	0.38838	1.175	0.35702	D	0.815734	B;B;B	0.18968	0.02;0.004;0.032	B;B;B	0.24006	0.018;0.012;0.05	T	0.52540	-0.8562	9	0.62326	D	0.03	.	8.2855	0.31926	0.0:0.0:0.0:1.0	.	6;6;6	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	R	6	.	ENSP00000350067:K6R	K	-	2	0	SSBP3	54644253	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.586000	0.53950	0.978000	0.38470	0.240000	0.17902	AAA			0.736	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022721.1		NM_018070	
SEC22B	9554	broad.mit.edu	37	1	145116147	145116148	+	RNA	INS	-	-	A	rs56026824|rs113058116	byFrequency	TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:145116147_145116148insA	ENST00000453618.1	+	0	1233_1234							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											AGTAGATTGTTATTTCGTTTTT	0.416													A|A|AA|insertion	2465	0.492212	0.497	0.4914	5008	,	,		69600	0.4891		0.4891	False		,,,				2504	0.4928				.													.	.			0			.																																											9554	.			GATTGTTATTTCG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116148_145116148dupA			5	0	0		11	0.36	4	.	131	0.00	0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.416	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V													NBPF10,NS,carcinoma,0,2	NBPF10	0	2	2	Substitution - Missense(2)	kidney(2)	c.C130G																																									SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val		50	0.04	2		65	0.06	4	NM_001039703	5	0.00	0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT			0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding		OTTHUMT00000038550.3		NM_001039703	
TDRKH	11022	broad.mit.edu	37	1	151747281	151747281	+	Splice_Site	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:151747281G>T	ENST00000368822.1	-	12	2171	c.1538C>A	c.(1537-1539)gCc>gAc	p.A513D	TDRKH_ENST00000458431.2_Splice_Site_p.A513D|TDRKH_ENST00000368825.3_Splice_Site_p.A468D|TDRKH_ENST00000368824.3_Splice_Site_p.A513D|TDRKH_ENST00000368827.6_Splice_Site_p.A513D|TDRKH_ENST00000368823.1_Splice_Site_p.A509D|TDRKH_ENST00000440583.2_Splice_Site_p.A289D			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	513					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGTTTCTGTGGCCTGAGTGGA	0.463																																					p.A513D													.	TDRKH	45		0			c.C1538A												180.0	168.0	172.0					1																	151747281		1955	4154	6109	SO:0001630	splice_region_variant	11022	exon12			TCTGTGGCCTGAG	AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1537-1C>A	1.37:g.151747281G>T			80	0	0		95	0.04	4	NM_001083965	52	0.00	0	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Splice_Site	SNP	ENST00000368822.1	37	CCDS41394.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281011	0.59758	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.25414	2.16;1.81;2.16;2.16;2.16;2.16;1.8	6.16	5.25	0.73442	.	0.565317	0.19793	N	0.105934	T	0.12646	0.0307	N	0.22421	0.69	0.38416	D	0.946045	B;P;P	0.46706	0.31;0.857;0.883	B;P;B	0.48524	0.176;0.58;0.422	T	0.03112	-1.1071	10	0.19590	T	0.45	-8.6283	11.8458	0.52383	0.0815:0.0:0.9185:0.0	.	468;509;513	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	D	513;468;513;509;513;513;289	ENSP00000357819:A513D;ENSP00000357817:A468D;ENSP00000357815:A513D;ENSP00000357813:A509D;ENSP00000357812:A513D;ENSP00000395718:A513D;ENSP00000416645:A289D	ENSP00000357812:A513D	A	-	2	0	TDRKH	150013905	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	1.603000	0.36794	2.937000	0.99478	0.650000	0.86243	GCC			0.463	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000036648.2		NM_006862	Missense_Mutation
PROX1	5629	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	214170542	214170542	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:214170542C>T	ENST00000366958.4	+	2	1272	c.664C>T	c.(664-666)Cag>Tag	p.Q222*	PROX1_ENST00000498508.2_Nonsense_Mutation_p.Q222*|PROX1_ENST00000261454.4_Nonsense_Mutation_p.Q222*|PROX1_ENST00000435016.1_Nonsense_Mutation_p.Q222*	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	222					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		ACAGAGTTTCCAGCAGCTGGT	0.537																																					p.Q222X													.	.			0			c.C664T												34.0	39.0	37.0					1																	214170542		2203	4300	6503	SO:0001587	stop_gained	5629	exon2			AGTTTCCAGCAGC	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.664C>T	1.37:g.214170542C>T	ENSP00000355925:p.Gln222*		61	0	0		80	0.08	6	NM_001270616	2	0.00	0	A6NK29|A8K2B1|Q5SW76|Q8TB91	Nonsense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	C	43	9.992226	0.99313	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	.	.	.	6.07	6.07	0.98685	.	0.118769	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-4.393	20.2697	0.98465	0.0:1.0:0.0:0.0	.	.	.	.	X	222	.	ENSP00000261454:Q222X	Q	+	1	0	PROX1	212237165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.147000	0.71783	2.885000	0.99019	0.655000	0.94253	CAG			0.537	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000089727.6		NM_002763	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215847769	215847769	+	Missense_Mutation	SNP	C	C	T	rs550096037		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr1:215847769C>T	ENST00000307340.3	-	63	13870	c.13484G>A	c.(13483-13485)cGt>cAt	p.R4495H	USH2A_ENST00000366943.2_Missense_Mutation_p.R4495H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4495	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTAAAATCACGATAGCGTGT	0.463										HNSCC(13;0.011)			T|||	1	0.000199681	0.0	0.0	5008	,	,		18421	0.001		0.0	False		,,,				2504	0.0				p.R4495H													.	.			0			c.G13484A												142.0	139.0	140.0					1																	215847769		2203	4300	6503	SO:0001583	missense	7399	exon63			AAATCACGATAGC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13484G>A	1.37:g.215847769C>T	ENSP00000305941:p.Arg4495His		112	0	0		112	0.20	22	NM_206933	0		0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.611154	0.00835	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56776	0.44;0.44	4.22	4.22	0.49857	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.188196	0.25698	N	0.028893	T	0.18173	0.0436	N	0.00566	-1.37	0.20489	N	0.999891	B	0.02656	0.0	B	0.01281	0.0	T	0.15292	-1.0442	10	0.35671	T	0.21	.	6.0096	0.19567	0.1536:0.0848:0.0:0.7616	.	4495	O75445	USH2A_HUMAN	H	4495	ENSP00000305941:R4495H;ENSP00000355910:R4495H	ENSP00000305941:R4495H	R	-	2	0	USH2A	213914392	0.996000	0.38824	0.135000	0.22099	0.243000	0.25628	2.701000	0.47094	0.595000	0.29777	-0.516000	0.04426	CGT			0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128138.1		NM_007123	
SIRT1	23411	mdanderson.org	37	10	69676305	69676305	+	Silent	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr10:69676305G>T	ENST00000212015.6	+	9	2252	c.2199G>T	c.(2197-2199)gtG>gtT	p.V733V	SIRT1_ENST00000432464.1_Silent_p.V438V|SIRT1_ENST00000403579.1_Silent_p.V430V|SIRT1_ENST00000406900.1_Silent_p.V430V	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	733					angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						CTATATCTGTGAAACAGGAAG	0.408																																					p.V733V													.	.			0			c.G2199T												89.0	83.0	85.0					10																	69676305		2203	4300	6503	SO:0001819	synonymous_variant	23411	exon9			ATCTGTGAAACAG	AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.2199G>T	10.37:g.69676305G>T			44	0	0		33	0.09	3	NM_012238	149	0.00	0	Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Silent	SNP	ENST00000212015.6	37	CCDS7273.1																																																																																					0.408	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048296.1			
DNMBP	23268	mdanderson.org	37	10	101643788	101643788	+	Missense_Mutation	SNP	C	C	T	rs376611193		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr10:101643788C>T	ENST00000324109.4	-	15	4068	c.3977G>A	c.(3976-3978)cGc>cAc	p.R1326H	DNMBP_ENST00000472036.1_5'Flank|DNMBP_ENST00000342239.3_Missense_Mutation_p.R1350H|DNMBP_ENST00000543621.1_Missense_Mutation_p.R572H|DNMBP_ENST00000540316.1_Missense_Mutation_p.R262H	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1326	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AATCAGCCAGCGGTTCTGGCT	0.463																																					p.R1326H													.	.			0			c.G3977A								HIS/ARG	0,4406		0,0,2203	61.0	63.0	62.0		3977	5.9	1.0	10		62	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNMBP	NM_015221.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1326/1578	101643788	1,13005	2203	4300	6503	SO:0001583	missense	23268	exon15			AGCCAGCGGTTCT	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3977G>A	10.37:g.101643788C>T	ENSP00000315659:p.Arg1326His		73	0	0		48	0.06	3	NM_015221	22	0.00	0	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	C	35	5.505180	0.96371	0.0	1.16E-4	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.94	5.94	0.96194	Src homology-3 domain (2);	0.000000	0.46145	D	0.000314	D	0.83317	0.5228	M	0.81682	2.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.80944	-0.1156	10	0.36615	T	0.2	-13.9976	19.9687	0.97276	0.0:1.0:0.0:0.0	.	1326;572;1350	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	H	1350;1326;572;572;262	ENSP00000344914:R1350H;ENSP00000315659:R1326H;ENSP00000443657:R572H;ENSP00000443573:R262H	ENSP00000315659:R1326H	R	-	2	0	DNMBP	101633778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.759000	0.85235	2.820000	0.97059	0.650000	0.86243	CGC			0.463	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049832.2		NM_015221	
PDZD8	118987	hgsc.bcm.edu;mdanderson.org	37	10	119044191	119044191	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr10:119044191G>T	ENST00000334464.5	-	5	2292	c.2053C>A	c.(2053-2055)Ctt>Att	p.L685I	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	685					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TTACGATAAAGAATTTCTGAT	0.423																																					p.L685I													.	.			0			c.C2053A												96.0	94.0	95.0					10																	119044191		2203	4300	6503	SO:0001583	missense	118987	exon5			GATAAAGAATTTC	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2053C>A	10.37:g.119044191G>T	ENSP00000334642:p.Leu685Ile		125	0	0		111	0.05	5	NM_173791	37	0.00	0	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	G	7.876	0.729149	0.15507	.	.	ENSG00000165650	ENST00000334464	D	0.86030	-2.06	5.87	5.87	0.94306	.	0.306918	0.35207	N	0.003376	T	0.77903	0.4200	N	0.19112	0.55	0.30405	N	0.779647	B	0.24258	0.1	B	0.21708	0.036	T	0.68123	-0.5492	10	0.25106	T	0.35	-3.0129	20.2043	0.98273	0.0:0.0:1.0:0.0	.	685	Q8NEN9	PDZD8_HUMAN	I	685	ENSP00000334642:L685I	ENSP00000334642:L685I	L	-	1	0	PDZD8	119034181	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	4.815000	0.62634	2.779000	0.95612	0.591000	0.81541	CTT			0.423	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050565.1		NM_173791	
DCHS1	8642	mdanderson.org	37	11	6653321	6653321	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr11:6653321G>T	ENST00000299441.3	-	6	3833	c.3422C>A	c.(3421-3423)aCc>aAc	p.T1141N	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1141	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGCTGTAGGTCAGACGTCC	0.597																																					p.T1141N													.	.			0			c.C3422A												84.0	82.0	83.0					11																	6653321		2201	4296	6497	SO:0001583	missense	8642	exon6			CTGTAGGTCAGAC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3422C>A	11.37:g.6653321G>T	ENSP00000299441:p.Thr1141Asn		17	0	0		21	0.10	2	NM_003737	15	0.00	0	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992035	0.54041	.	.	ENSG00000166341	ENST00000299441	T	0.01787	4.64	4.66	4.66	0.58398	Cadherin (4);Cadherin-like (1);	0.000000	0.47852	D	0.000209	T	0.06962	0.0177	L	0.51914	1.62	0.41280	D	0.986909	D	0.69078	0.997	D	0.80764	0.994	T	0.55988	-0.8053	10	0.18710	T	0.47	.	17.0688	0.86567	0.0:0.0:1.0:0.0	.	1141	Q96JQ0	PCD16_HUMAN	N	1141	ENSP00000299441:T1141N	ENSP00000299441:T1141N	T	-	2	0	DCHS1	6609897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.659000	0.37387	2.584000	0.87258	0.561000	0.74099	ACC			0.597	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257258.1		NM_003737	
OR1S2	219958	broad.mit.edu	37	11	57970760	57970760	+	Missense_Mutation	SNP	C	C	T	rs200054918		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr11:57970760C>T	ENST00000302592.6	-	1	893	c.894G>A	c.(892-894)atG>atA	p.M298I		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M298I(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TGAAGGGGTTCATCATGGGTG	0.468																																					p.M298I													OR1S2,NS,carcinoma,0,3	OR1S2	119	3	1	Substitution - Missense(1)	endometrium(1)	c.G894A												160.0	152.0	155.0					11																	57970760		2201	4296	6497	SO:0001583	missense	219958	exon1			GGGGTTCATCATG	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.894G>A	11.37:g.57970760C>T	ENSP00000305469:p.Met298Ile		83	0.0120481928	1		79	0.06	5	NM_001004459	0		0	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.903545	0.33628	.	.	ENSG00000197887	ENST00000302592	T	0.34072	1.38	4.75	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	1.116300	0.06795	N	0.787733	T	0.30386	0.0763	L	0.33137	0.985	0.26469	N	0.975316	B	0.02656	0.0	B	0.06405	0.002	T	0.34378	-0.9831	10	0.72032	D	0.01	.	10.1183	0.42605	0.0:0.7564:0.0:0.2436	.	298	Q8NGQ3	OR1S2_HUMAN	I	298	ENSP00000305469:M298I	ENSP00000305469:M298I	M	-	3	0	OR1S2	57727336	0.014000	0.17966	0.995000	0.50966	0.993000	0.82548	-0.853000	0.04303	0.694000	0.31654	0.655000	0.94253	ATG			0.468	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394703.2		NM_001004459	
INTS5	80789	mdanderson.org	37	11	62416258	62416258	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr11:62416258G>A	ENST00000330574.2	-	2	1346	c.1294C>T	c.(1294-1296)Cgt>Tgt	p.R432C	GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000540933.1_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	432					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						CAAGCCTCACGCACGGTGTCT	0.632																																					p.R432C													.	.			0			c.C1294T												48.0	43.0	45.0					11																	62416258		2202	4299	6501	SO:0001583	missense	80789	exon2			CCTCACGCACGGT	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.1294C>T	11.37:g.62416258G>A	ENSP00000327889:p.Arg432Cys		121	0	0		88	0.05	4	NM_030628	48	0.02	1	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	ENST00000330574.2	37	CCDS8027.1	.	.	.	.	.	.	.	.	.	.	G	9.360	1.067850	0.20067	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.79	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.52306	0.1726	N	0.24115	0.695	0.40204	D	0.977546	D	0.89917	1.0	D	0.72338	0.977	T	0.54316	-0.8312	9	0.87932	D	0	.	5.4546	0.16584	0.095:0.0:0.5367:0.3683	.	432	Q6P9B9	INT5_HUMAN	C	432	.	ENSP00000327889:R432C	R	-	1	0	INTS5	62172834	1.000000	0.71417	0.568000	0.28447	0.394000	0.30568	3.115000	0.50391	0.585000	0.29608	-0.140000	0.14226	CGT			0.632	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395327.1		NM_030628	
MYO7A	4647	mdanderson.org	37	11	76913417	76913417	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr11:76913417G>T	ENST00000409709.3	+	37	5388	c.5116G>T	c.(5116-5118)Gag>Tag	p.E1706*	MYO7A_ENST00000409619.2_Nonsense_Mutation_p.E1657*|MYO7A_ENST00000458637.2_Nonsense_Mutation_p.E1668*	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1706					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GGCGGAGCCCGAGGTGCGTGC	0.627																																					p.E1706X													.	.			0			c.G5116T												25.0	32.0	30.0					11																	76913417		2049	4180	6229	SO:0001587	stop_gained	4647	exon37			GAGCCCGAGGTGC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5116G>T	11.37:g.76913417G>T	ENSP00000386331:p.Glu1706*		45	0	0		46	0.07	3	NM_000260	8	0.00	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Nonsense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	G	41	9.075171	0.99057	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	.	.	.	5.04	5.04	0.67666	.	0.115591	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	18.3999	0.90513	0.0:0.0:1.0:0.0	.	.	.	.	X	1706;1668;1657;879;1705;1675;1582;848;321	.	ENSP00000345075:E1582X	E	+	1	0	MYO7A	76591065	1.000000	0.71417	0.940000	0.37924	0.878000	0.50629	7.421000	0.80204	2.340000	0.79590	0.543000	0.68304	GAG			0.627	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328133.1		NM_000260	
WBP11	51729	broad.mit.edu	37	12	14940229	14940229	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr12:14940229G>T	ENST00000261167.2	-	12	1929	c.1696C>A	c.(1696-1698)Cca>Aca	p.P566T		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	566					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GTGATCTGTGGCTTGGCACTG	0.512																																					p.P566T													.	WBP11	66		0			c.C1696A												369.0	367.0	368.0					12																	14940229		2203	4300	6503	SO:0001583	missense	51729	exon12			TCTGTGGCTTGGC	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1696C>A	12.37:g.14940229G>T	ENSP00000261167:p.Pro566Thr		63	0	0		223	0.02	5	NM_016312	1950	0.00	1	Q96AY8	Missense_Mutation	SNP	ENST00000261167.2	37	CCDS8666.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180114	0.78564	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	D;D	0.95272	-3.66;-3.66	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97842	1.0269	10	0.87932	D	0	-13.2801	16.0637	0.80856	0.0:0.0:1.0:0.0	.	566	Q9Y2W2	WBP11_HUMAN	T	566;532	ENSP00000261167:P566T;ENSP00000442868:P532T	ENSP00000261167:P566T	P	-	1	0	WBP11	14831496	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.992000	0.93519	2.670000	0.90874	0.655000	0.94253	CCA			0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
CAPRIN2	65981	broad.mit.edu	37	12	30863206	30863206	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr12:30863206G>T	ENST00000298892.5	-	17	3614	c.2864C>A	c.(2863-2865)aCc>aAc	p.T955N	CAPRIN2_ENST00000308433.5_Missense_Mutation_p.T671N|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.T1005N|CAPRIN2_ENST00000395805.2_3'UTR	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CAGATTAGAGGTTCTGGCTGC	0.473																																					p.T1005N													.	CAPRIN2	109		0			c.C3014A												135.0	137.0	136.0					12																	30863206		2203	4300	6503	SO:0001583	missense	65981	exon18			TTAGAGGTTCTGG	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2864C>A	12.37:g.30863206G>T	ENSP00000298892:p.Thr955Asn		125	0	0		331	0.02	6	NM_001002259	278	0.00	0		Missense_Mutation	SNP	ENST00000298892.5	37	CCDS8720.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365937	0.82463	.	.	ENSG00000110888	ENST00000298892;ENST00000251071;ENST00000308433	D;D;D	0.86297	-2.1;-2.1;-2.1	5.81	4.92	0.64577	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	D	0.91016	0.7174	L	0.42529	1.33	0.50813	D	0.999891	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.92072	0.5665	10	0.87932	D	0	-8.3052	16.3283	0.82996	0.0:0.0:0.8668:0.1332	.	1005;955	Q6IMN6;Q6IMN6-2	CAPR2_HUMAN;.	N	955;1005;671	ENSP00000298892:T955N;ENSP00000251071:T1005N;ENSP00000309785:T671N	ENSP00000251071:T1005N	T	-	2	0	CAPRIN2	30754473	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.611000	0.98342	1.438000	0.47492	0.655000	0.94253	ACC			0.473	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000402778.1		NM_023925	
FLJ12825	440101	broad.mit.edu	37	12	54472994	54472996	+	lincRNA	DEL	TTC	TTC	-			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr12:54472994_54472996delTTC	ENST00000515617.1	+	0	311				RP11-834C11.6_ENST00000504891.1_lincRNA|RP11-834C11.7_ENST00000505259.2_RNA	NR_026655.1																						AAGCTGTTCTttcttcttcttct	0.433																																					.													.	.			0			.																																											0	.			TGTTCTTTCTTCT																													12.37:g.54473003_54473005delTTC			6	0	0		6	0.50	3	.	3	0.00	0		RNA	DEL	ENST00000515617.1	37																																																																																						0.433	RP11-834C11.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000358961.1			
RPGRIP1	57096	mdanderson.org	37	14	21769151	21769151	+	Missense_Mutation	SNP	C	C	T	rs371371555		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr14:21769151C>T	ENST00000400017.2	+	3	245	c.245C>T	c.(244-246)aCc>aTc	p.T82I	RPGRIP1_ENST00000557771.1_Missense_Mutation_p.T82I|RPGRIP1_ENST00000206660.6_Missense_Mutation_p.T82I|RPGRIP1_ENST00000556336.1_Missense_Mutation_p.T82I	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	82					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CTGCGGTTGACCGCTGCTGGC	0.612																																					p.T82I													.	.			0			c.C245T							C	ILE/THR	2,3762		0,2,1880	46.0	51.0	49.0		245	-0.5	0.0	14		49	0,8096		0,0,4048	no	missense	RPGRIP1	NM_020366.3	89	0,2,5928	TT,TC,CC		0.0,0.0531,0.0169	benign	82/1287	21769151	2,11858	1882	4048	5930	SO:0001583	missense	57096	exon3			GGTTGACCGCTGC	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.245C>T	14.37:g.21769151C>T	ENSP00000382895:p.Thr82Ile		62	0	0		49	0.06	3	NM_020366	0		0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	ENST00000400017.2	37	CCDS45080.1	.	.	.	.	.	.	.	.	.	.	c	11.90	1.775824	0.31411	5.31E-4	0.0	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	3.86	-0.517	0.11947	.	0.553788	0.18526	N	0.138638	T	0.59998	0.2235	L	0.48642	1.525	0.18873	N	0.999989	P	0.45902	0.868	B	0.36666	0.23	T	0.54879	-0.8227	10	0.41790	T	0.15	-1.1262	2.0319	0.03531	0.3525:0.3703:0.1721:0.105	.	82	Q96KN7	RPGR1_HUMAN	I	82	ENSP00000450445:T82I;ENSP00000451219:T82I;ENSP00000382895:T82I;ENSP00000206660:T82I	ENSP00000206660:T82I	T	+	2	0	RPGRIP1	20838991	0.000000	0.05858	0.000000	0.03702	0.188000	0.23474	-0.707000	0.05041	-0.200000	0.10300	-0.556000	0.04195	ACC			0.612	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410258.1		NM_020366	
SLC7A7	9056	mdanderson.org	37	14	23244708	23244708	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr14:23244708G>T	ENST00000397532.3	-	7	1565	c.1040C>A	c.(1039-1041)gCc>gAc	p.A347D	SLC7A7_ENST00000397528.4_Missense_Mutation_p.A347D|SLC7A7_ENST00000555702.1_Missense_Mutation_p.A347D|SLC7A7_ENST00000554517.1_Missense_Mutation_p.A81D|SLC7A7_ENST00000397529.2_Missense_Mutation_p.A347D|SLC7A7_ENST00000285850.7_Missense_Mutation_p.A347D|SLC7A7_ENST00000554061.1_5'UTR			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7	347					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		CATGCAGATGGCATCAGGGAG	0.493																																					p.A347D													.	.			0			c.C1040A												123.0	113.0	117.0					14																	23244708		2203	4300	6503	SO:0001583	missense	9056	exon8			CAGATGGCATCAG	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692	ENST00000397532.3:c.1040C>A	14.37:g.23244708G>T	ENSP00000380666:p.Ala347Asp		42	0	0		35	0.09	3	NM_001126105	73	0.00	0	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	37	CCDS9574.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.94|15.94	2.981195|2.981195	0.53827|0.53827	.|.	.|.	ENSG00000155465|ENSG00000155465	ENST00000285850;ENST00000555702;ENST00000397532;ENST00000404278;ENST00000397529;ENST00000397528;ENST00000554517|ENST00000556350	D;D;D;D;D;D|.	0.89939|.	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59|.	5.49|5.49	5.49|5.49	0.81192|0.81192	Amino acid permease domain (1);|.	0.321128|.	0.33438|.	N|.	0.004901|.	T|T	0.75376|0.75376	0.3841|0.3841	M|M	0.71206|0.71206	2.165|2.165	0.43107|0.43107	D|D	0.994803|0.994803	B|.	0.23490|.	0.086|.	B|.	0.31245|.	0.126|.	T|T	0.74805|0.74805	-0.3540|-0.3540	10|5	0.62326|.	D|.	0.03|.	.|.	18.1386|18.1386	0.89631|0.89631	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	347|.	Q9UM01|.	YLAT1_HUMAN|.	D|T	347;347;347;320;347;347;81|62	ENSP00000285850:A347D;ENSP00000451881:A347D;ENSP00000380666:A347D;ENSP00000380663:A347D;ENSP00000380662:A347D;ENSP00000452083:A81D|.	ENSP00000285850:A347D|.	A|P	-|-	2|1	0|0	SLC7A7|SLC7A7	22314548|22314548	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.644000|1.644000	0.37228|0.37228	2.593000|2.593000	0.87608|0.87608	0.563000|0.563000	0.77884|0.77884	GCC|CCA			0.493	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071636.3			
VPS13C	54832	mdanderson.org	37	15	62204118	62204118	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr15:62204118G>T	ENST00000261517.5	-	63	8709	c.8636C>A	c.(8635-8637)tCa>tAa	p.S2879*	VPS13C_ENST00000249837.3_Nonsense_Mutation_p.S2836*|VPS13C_ENST00000395898.3_Nonsense_Mutation_p.S2836*|RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395896.4_Nonsense_Mutation_p.S2879*	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TAGTTCTAATGATGACTTGTT	0.383																																					p.S2879X													.	.			0			c.C8636A												122.0	114.0	117.0					15																	62204118		2203	4300	6503	SO:0001587	stop_gained	54832	exon63			TCTAATGATGACT	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8636C>A	15.37:g.62204118G>T	ENSP00000261517:p.Ser2879*		85	0	0		75	0.05	4	NM_020821	6	0.00	0		Nonsense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	50	16.510572	0.99865	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	.	.	.	5.71	5.71	0.89125	.	0.219800	0.40818	N	0.001015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6551	0.68828	0.0:0.0:0.8546:0.1454	.	.	.	.	X	2836;2879;2879;2879	.	ENSP00000249837:S2836X	S	-	2	0	VPS13C	59991410	1.000000	0.71417	0.678000	0.29963	0.962000	0.63368	6.070000	0.71220	2.682000	0.91365	0.491000	0.48974	TCA			0.383	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415997.1		NM_017684	
IGFALS	3483	mdanderson.org	37	16	1838172	1838172	+	IGR	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr16:1838172G>T	ENST00000215539.3	-	0	2116				NUBP2_ENST00000565134.1_Missense_Mutation_p.E240D|NUBP2_ENST00000565987.1_Nonsense_Mutation_p.E152*|NUBP2_ENST00000568706.1_Nonsense_Mutation_p.E71*|NUBP2_ENST00000262302.9_Nonsense_Mutation_p.E212*|NUBP2_ENST00000543305.1_Nonsense_Mutation_p.E71*			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit						cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GGGCGGCGGAGAGGAGCTGGC	0.692																																					p.E212X													.	.			0			c.G634T												20.0	24.0	22.0					16																	1838172		2171	4267	6438	SO:0001628	intergenic_variant	10101	exon6			GGCGGAGAGGAGC	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638		16.37:g.1838172G>T			35	0	0		32	0.09	3	NM_012225	214	0.00	0	B4DZY8|E9PGU3	Nonsense_Mutation	SNP	ENST00000215539.3	37	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	G	38	6.801187	0.97849	.	.	ENSG00000095906	ENST00000262302;ENST00000543305	.	.	.	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-9.0277	15.8635	0.79043	0.0:0.0:1.0:0.0	.	.	.	.	X	212;71	.	ENSP00000262302:E212X	E	+	1	0	NUBP2	1778173	1.000000	0.71417	0.956000	0.39512	0.816000	0.46133	5.916000	0.69981	2.148000	0.66965	0.561000	0.74099	GAG			0.692	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250509.2			
TK2	7084	broad.mit.edu	37	16	66565284	66565284	+	Splice_Site	SNP	T	T	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr16:66565284T>A	ENST00000451102.2	-	5	724	c.374A>T	c.(373-375)cAg>cTg	p.Q125L	TK2_ENST00000299697.7_Splice_Site_p.Q167L|TK2_ENST00000544898.1_Splice_Site_p.Q76L|TK2_ENST00000417693.3_Splice_Site_p.Q107L|TK2_ENST00000564917.1_Splice_Site_p.Q125L|TK2_ENST00000525974.1_Splice_Site_p.Q28L|TK2_ENST00000545043.2_Splice_Site_p.Q100L|TK2_ENST00000563369.2_Splice_Site_p.Q28L|TK2_ENST00000527284.1_Splice_Site_p.Q94L|TK2_ENST00000527800.1_Splice_Site_p.Q28L			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	125					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		GAAACCTACCTGAGGACGAGT	0.507																																					p.Q125L													.	TK2	17		0			c.A374T												114.0	83.0	94.0					16																	66565284		2201	4300	6501	SO:0001630	splice_region_variant	7084	exon5			CCTACCTGAGGAC		CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.375+1A>T	16.37:g.66565284T>A			70	0	0		65	0.05	3	NM_004614	20	0.00	0	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Splice_Site	SNP	ENST00000451102.2	37	CCDS10805.2	.	.	.	.	.	.	.	.	.	.	T	11.24	1.581023	0.28180	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000545043;ENST00000451102;ENST00000527800;ENST00000527284;ENST00000544898;ENST00000525974	D;D;D;D;D;D;D;D	0.97959	-4.63;-4.63;-4.63;-4.63;-4.63;-4.63;-4.63;-4.63	5.74	3.38	0.38709	.	0.547087	0.20964	N	0.082501	D	0.93969	0.8069	L	0.47716	1.5	0.36030	D	0.839316	B;B;B;B;B;B	0.28400	0.21;0.116;0.001;0.004;0.21;0.001	B;B;B;B;B;B	0.28465	0.09;0.05;0.001;0.038;0.09;0.002	D	0.90731	0.4642	10	0.18710	T	0.47	-38.0958	5.3303	0.15928	0.1581:0.0873:0.0:0.7547	.	167;125;76;89;167;94	Q8IZR3;O00142;F5GYK4;A4IF54;E5KNQ5;O00142-2	.;KITM_HUMAN;.;.;.;.	L	167;107;100;125;28;94;76;28	ENSP00000299697:Q167L;ENSP00000407469:Q107L;ENSP00000438143:Q100L;ENSP00000414334:Q125L;ENSP00000433770:Q28L;ENSP00000435312:Q94L;ENSP00000440898:Q76L;ENSP00000434594:Q28L	ENSP00000299697:Q167L	Q	-	2	0	TK2	65122785	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	1.695000	0.37763	2.193000	0.70182	0.402000	0.26972	CAG			0.507	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268806.4			Missense_Mutation
FUK	197258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70502854	70502854	+	Missense_Mutation	SNP	G	G	A	rs200140905	byFrequency	TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr16:70502854G>A	ENST00000288078.6	+	9	998	c.766G>A	c.(766-768)Gga>Aga	p.G256R	FUK_ENST00000378912.2_Missense_Mutation_p.G288R|FUK_ENST00000571514.1_5'UTR	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	256						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				CTTGGACTCCGGAGCCCGGCC	0.672													G|||	8	0.00159744	0.0	0.0	5008	,	,		16476	0.0		0.0	False		,,,				2504	0.0082				p.G256R													.	.			0			c.G766A												46.0	50.0	49.0					16																	70502854		1969	4143	6112	SO:0001583	missense	197258	exon9			GACTCCGGAGCCC		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.766G>A	16.37:g.70502854G>A	ENSP00000288078:p.Gly256Arg		67	0	0		77	0.23	18	NM_145059	34	0.41	14	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	.	.	.	.	.	.	.	.	.	.	G	34	5.374976	0.95923	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.36699	1.24;1.24	5.33	5.33	0.75918	L-fucokinase (1);	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63470	-0.6630	10	0.62326	D	0.03	-7.1129	19.4187	0.94712	0.0:0.0:1.0:0.0	.	288;256	Q8N0W3-2;Q8N0W3	.;FUK_HUMAN	R	256;288	ENSP00000288078:G256R;ENSP00000368192:G288R	ENSP00000288078:G256R	G	+	1	0	FUK	69060355	1.000000	0.71417	0.981000	0.43875	0.956000	0.61745	8.676000	0.91199	2.693000	0.91896	0.650000	0.86243	GGA	0.001		0.672	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157291.2		NM_145059	
IL34	146433	broad.mit.edu	37	16	70693984	70693984	+	Missense_Mutation	SNP	C	C	T	rs201277640		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr16:70693984C>T	ENST00000288098.2	+	6	1006	c.623C>T	c.(622-624)gCg>gTg	p.A208V	IL34_ENST00000566361.1_Missense_Mutation_p.A183V|FLJ00418_ENST00000597002.1_5'Flank|IL34_ENST00000429149.2_Missense_Mutation_p.A208V	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	208					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)	p.A208V(1)		breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						TTGCAGTATGCGGCCACCCAG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		14065	0.0		0.001	False		,,,				2504	0.0				p.A208V													IL34,bladder,carcinoma,0,3	IL34	26	3	1	Substitution - Missense(1)	urinary_tract(1)	c.C623T							C	VAL/ALA,VAL/ALA,VAL/ALA	1,4395	2.1+/-5.4	0,1,2197	96.0	105.0	102.0		620,623,623	-3.1	0.0	16		102	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	IL34	NM_001172771.1,NM_001172772.1,NM_152456.2	64,64,64	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	207/242,208/243,208/243	70693984	2,12994	2198	4300	6498	SO:0001583	missense	146433	exon7			AGTATGCGGCCAC	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.623C>T	16.37:g.70693984C>T	ENSP00000288098:p.Ala208Val		256	0	0		234	0.03	6	NM_152456	104	0.00	0	B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	37	CCDS10895.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	1.250	-0.618797	0.03663	2.27E-4	1.16E-4	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.34667	1.35;1.35	4.69	-3.08	0.05347	.	2.218580	0.03059	N	0.155676	T	0.10294	0.0252	N	0.01352	-0.895	0.09310	N	1	B;B	0.17465	0.022;0.022	B;B	0.08055	0.003;0.003	T	0.24261	-1.0165	10	0.05436	T	0.98	-0.0424	4.1458	0.10215	0.4149:0.3737:0.0:0.2114	.	207;208	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	V	208	ENSP00000397863:A208V;ENSP00000288098:A208V	ENSP00000288098:A208V	A	+	2	0	IL34	69251485	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.807000	0.01734	-0.832000	0.04251	-1.552000	0.00895	GCG			0.647	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268971.3		NM_152456	
HSDL1	83693	mdanderson.org	37	16	84163181	84163181	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr16:84163181G>T	ENST00000219439.4	-	5	1042	c.866C>A	c.(865-867)aCc>aAc	p.T289N	HSDL1_ENST00000434463.3_Missense_Mutation_p.T234N	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	289						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						ATATCCTGTGGTCCTTTTGGA	0.443																																					p.T289N													.	.			0			c.C866A												85.0	82.0	83.0					16																	84163181		2200	4300	6500	SO:0001583	missense	83693	exon5			CCTGTGGTCCTTT	AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.866C>A	16.37:g.84163181G>T	ENSP00000219439:p.Thr289Asn		55	0	0		44	0.07	3	NM_031463	47	0.00	0	B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Missense_Mutation	SNP	ENST00000219439.4	37	CCDS10942.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800130	0.90538	.	.	ENSG00000103160	ENST00000434463;ENST00000219439	D;T	0.89617	-2.54;0.67	5.3	5.3	0.74995	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95714	0.8606	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.913	D	0.96141	0.9100	10	0.72032	D	0.01	-35.9106	19.3134	0.94202	0.0:0.0:1.0:0.0	.	234;289	B4DSL2;Q3SXM5	.;HSDL1_HUMAN	N	234;289	ENSP00000407437:T234N;ENSP00000219439:T289N	ENSP00000219439:T289N	T	-	2	0	HSDL1	82720682	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.238000	0.95380	2.642000	0.89623	0.563000	0.77884	ACC			0.443	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269076.3		NM_031463	
C1QBP	708	mdanderson.org	37	17	5341589	5341589	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr17:5341589G>T	ENST00000225698.4	-	2	318	c.237C>A	c.(235-237)gaC>gaA	p.D79E	C1QBP_ENST00000574444.1_5'UTR	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	79	C1q binding.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	CAAAAGCTTTGTCTCCTAGAA	0.383																																					p.D79E													.	.			0			c.C237A												53.0	54.0	54.0					17																	5341589		2203	4300	6503	SO:0001583	missense	708	exon2			AGCTTTGTCTCCT	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.237C>A	17.37:g.5341589G>T	ENSP00000225698:p.Asp79Glu		63	0	0		52	0.06	3	NM_001212	515	0.00	0	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051361	0.55218	.	.	ENSG00000108561	ENST00000225698	.	.	.	4.77	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	L	0.49126	1.545	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	T	0.60136	-0.7322	9	0.15952	T	0.53	-35.0296	11.5569	0.50752	0.0874:0.0:0.9126:0.0	.	79	Q07021	C1QBP_HUMAN	E	79	.	ENSP00000225698:D79E	D	-	3	2	C1QBP	5282313	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	4.158000	0.58150	1.224000	0.43551	0.650000	0.86243	GAC			0.383	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439388.1		NM_001212	
KIF18B	146909	broad.mit.edu	37	17	43009468	43009468	+	Missense_Mutation	SNP	G	G	T	rs530568919		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr17:43009468G>T	ENST00000593135.1	-	10	1442	c.1345C>A	c.(1345-1347)Cag>Aag	p.Q449K	KIF18B_ENST00000587309.1_Missense_Mutation_p.Q461K|KIF18B_ENST00000339151.4_Missense_Mutation_p.Q461K|KIF18B_ENST00000590129.1_Missense_Mutation_p.Q470K|KIF18B_ENST00000438933.2_Missense_Mutation_p.Q461K	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	470					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				GACTGCTCCTGGTCTGAAGAG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17130	0.0		0.0	False		,,,				2504	0.0				p.Q461K													.	KIF18B	63		0			c.C1381A																																									SO:0001583	missense	146909	exon10			GCTCCTGGTCTGA		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.1345C>A	17.37:g.43009468G>T	ENSP00000465992:p.Gln449Lys		100	0	0		102	0.04	4	NM_001264573	67	0.00	0	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	ENST00000593135.1	37	CCDS45709.2	.	.	.	.	.	.	.	.	.	.	G	12.70	2.015266	0.35511	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.62941	-0.01;-0.01	5.46	1.06	0.20224	.	.	.	.	.	T	0.42426	0.1202	L	0.47716	1.5	0.09310	N	1	B;P;B	0.37207	0.131;0.587;0.122	B;B;B	0.32465	0.016;0.146;0.036	T	0.30736	-0.9968	9	0.06236	T	0.91	.	4.4762	0.11745	0.1694:0.0:0.5057:0.3248	.	470;458;470	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	K	461	ENSP00000412798:Q461K;ENSP00000341466:Q461K	ENSP00000341466:Q461K	Q	-	1	0	KIF18B	40364994	0.009000	0.17119	0.001000	0.08648	0.622000	0.37654	0.647000	0.24812	0.049000	0.15920	0.655000	0.94253	CAG			0.627	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000448724.1		NM_001080443	
MRPL45P2	653479	hgsc.bcm.edu	37	17	45560578	45560578	+	RNA	SNP	T	T	C	rs199837409		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr17:45560578T>C	ENST00000575291.1	-	0	507									mitochondrial ribosomal protein L45 pseudogene 2																		tttttttttttcttttttttg	0.443																																					.													.	.			0			.																																											653479	.			TTTTTTTCTTTTT			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45560578T>C			131	0	0		140	0.04	6	.	0		0		RNA	SNP	ENST00000575291.1	37																																																																																						0.443	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
CASKIN2	57513	mdanderson.org	37	17	73498038	73498038	+	Silent	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr17:73498038G>T	ENST00000321617.3	-	18	3703	c.3117C>A	c.(3115-3117)ccC>ccA	p.P1039P	CASKIN2_ENST00000433559.2_Silent_p.P957P	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	1039	Pro-rich.					cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGCTGGGCTCGGGCTGGGGAA	0.692																																					p.P1039P													.	.			0			c.C3117A												40.0	53.0	49.0					17																	73498038		2203	4299	6502	SO:0001819	synonymous_variant	57513	exon18			GGGCTCGGGCTGG	AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.3117C>A	17.37:g.73498038G>T			49	0	0		55	0.05	3	NM_020753	60	0.00	0	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Silent	SNP	ENST00000321617.3	37	CCDS11723.1																																																																																					0.692	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447609.1		NM_020753	
TBCD	6904	mdanderson.org	37	17	80739475	80739475	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr17:80739475C>T	ENST00000355528.4	+	7	779	c.649C>T	c.(649-651)Cgt>Tgt	p.R217C	TBCD_ENST00000397466.2_5'UTR|TBCD_ENST00000539345.2_Missense_Mutation_p.R217C	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	217					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			ATTTATCACACGTCCTGATGT	0.577											OREG0024827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R217C													.	.			0			c.C649T												70.0	73.0	72.0					17																	80739475		2136	4242	6378	SO:0001583	missense	6904	exon7			ATCACACGTCCTG	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.649C>T	17.37:g.80739475C>T	ENSP00000347719:p.Arg217Cys		37	0	0	1200	41	0.07	3	NM_005993	422	0.00	0	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873972	0.51695	.	.	ENSG00000141556	ENST00000355528;ENST00000269368;ENST00000536182	T	0.49139	0.79	5.32	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.77685	0.4167	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.87578	0.875;0.963;0.998	D	0.84325	0.0518	8	.	.	.	.	16.5485	0.84457	0.0:1.0:0.0:0.0	.	217;217;217	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	C	217;200;217	ENSP00000347719:R217C	.	R	+	1	0	TBCD	78332764	0.995000	0.38212	0.582000	0.28627	0.053000	0.15095	3.612000	0.54142	2.511000	0.84671	0.456000	0.33151	CGT			0.577	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439415.1		NM_005993	
ANKRD30B	374860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	14748512	14748512	+	Missense_Mutation	SNP	G	G	C	rs372583134		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr18:14748512G>C	ENST00000358984.4	+	1	274	c.94G>C	c.(94-96)Ggg>Cgg	p.G32R	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.G32R|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	32										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GAAGGACTACGGGACCATCTA	0.607																																					p.G32R													.	.			0			c.G94C												36.0	37.0	37.0					18																	14748512		692	1591	2283	SO:0001583	missense	374860	exon1			GACTACGGGACCA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.94G>C	18.37:g.14748512G>C	ENSP00000351875:p.Gly32Arg		70	0	0		74	0.22	16	NM_001145029	0		0	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	0.013	-1.617722	0.00828	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.31769	1.53;1.48	0.512	-1.02	0.10135	.	.	.	.	.	T	0.17195	0.0413	N	0.08118	0	0.09310	N	1	D	0.60575	0.988	P	0.51453	0.67	T	0.09357	-1.0678	8	0.42905	T	0.14	.	.	.	.	.	32	F8WAG3	.	R	32	ENSP00000351875:G32R;ENSP00000399031:G32R	ENSP00000351875:G32R	G	+	1	0	ANKRD30B	14738512	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.859000	0.01657	-1.971000	0.01002	-1.322000	0.01289	GGG			0.607	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000443557.1		NM_001145029	
GREB1L	80000	mdanderson.org	37	18	19080093	19080093	+	Silent	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr18:19080093G>T	ENST00000580732.2	+	22	4176	c.3795G>T	c.(3793-3795)gtG>gtT	p.V1265V	GREB1L_ENST00000269218.6_Silent_p.V1156V|GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000424526.1_Silent_p.V1265V			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1265						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TGGCCTGGGTGAGCTCCCTGC	0.622																																					p.V1265V													.	.			0			c.G3795T												20.0	24.0	22.0					18																	19080093		692	1591	2283	SO:0001819	synonymous_variant	80000	exon22			CTGGGTGAGCTCC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3795G>T	18.37:g.19080093G>T			59	0	0		50	0.06	3	NM_001142966	2	0.00	0	A4QN17|Q9H8F1	Silent	SNP	ENST00000580732.2	37	CCDS45836.1																																																																																					0.622	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443782.2		NM_024935	
HNRNPM	4670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8539106	8539106	+	Silent	SNP	G	G	C	rs375739833		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr19:8539106G>C	ENST00000325495.4	+	12	1139	c.1098G>C	c.(1096-1098)ggG>ggC	p.G366G	HNRNPM_ENST00000348943.3_Silent_p.G327G	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	366					alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						TTGGATCTGGGATGAACATGG	0.493																																					p.G366G													HNRNPM,NS,malignant_melanoma,+2,1	HNRNPM	2	1	0			c.G1098C												314.0	263.0	280.0					19																	8539106		2203	4300	6503	SO:0001819	synonymous_variant	4670	exon12			ATCTGGGATGAAC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1098G>C	19.37:g.8539106G>C			132	0	0		141	0.13	19	NM_005968	1490	0.23	338	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Silent	SNP	ENST00000325495.4	37	CCDS12203.1																																																																																					0.493	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000460894.1			
ZNF224	7767	mdanderson.org	37	19	44611473	44611473	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr19:44611473T>A	ENST00000336976.6	+	6	1414	c.1160T>A	c.(1159-1161)cTt>cAt	p.L387H	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	387					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				GCCTCGTGTCTTTTGAAACAT	0.418																																					p.L387H													.	.			0			c.T1160A												75.0	75.0	75.0					19																	44611473		2203	4300	6503	SO:0001583	missense	7767	exon6			CGTGTCTTTTGAA	AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.1160T>A	19.37:g.44611473T>A	ENSP00000337368:p.Leu387His		47	0	0		58	0.07	4	NM_013398	37	0.00	0	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	ENST00000336976.6	37	CCDS33046.1	.	.	.	.	.	.	.	.	.	.	t	17.31	3.357565	0.61293	.	.	ENSG00000186019	ENST00000336976	T	0.54071	0.59	3.59	3.59	0.41128	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.79275	0.4418	H	0.95224	3.64	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70410	-0.4879	9	0.87932	D	0	.	11.573	0.50845	0.0:0.0:0.0:1.0	.	387	Q9NZL3	ZN224_HUMAN	H	387	ENSP00000337368:L387H	ENSP00000337368:L387H	L	+	2	0	ZNF224	49303313	0.279000	0.24239	0.002000	0.10522	0.064000	0.16182	3.603000	0.54074	1.627000	0.50400	0.482000	0.46254	CTT			0.418	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460477.1		NM_013398	
MYPOP	339344	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	46394069	46394069	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr19:46394069C>T	ENST00000322217.5	-	3	1098	c.1012G>A	c.(1012-1014)Gtg>Atg	p.V338M		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	338	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						ACCACGGACACGGGCTCTGGG	0.736																																					p.V338M													.	.			0			c.G1012A												3.0	4.0	4.0					19																	46394069		1952	3838	5790	SO:0001583	missense	339344	exon3			CGGACACGGGCTC	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1012G>A	19.37:g.46394069C>T	ENSP00000325402:p.Val338Met		26	0	0		30	0.17	5	NM_001012643	1	1.00	1		Missense_Mutation	SNP	ENST00000322217.5	37	CCDS33055.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812649	0.32053	.	.	ENSG00000176182	ENST00000322217	T	0.50813	0.73	3.65	3.65	0.41850	.	0.142736	0.30193	N	0.010193	T	0.46073	0.1374	N	0.14661	0.345	0.20703	N	0.999861	D	0.76494	0.999	P	0.61275	0.886	T	0.34428	-0.9829	10	0.72032	D	0.01	-11.4596	11.5636	0.50792	0.0:1.0:0.0:0.0	.	338	Q86VE0	MYPOP_HUMAN	M	338	ENSP00000325402:V338M	ENSP00000325402:V338M	V	-	1	0	MYPOP	51085909	0.876000	0.30132	0.845000	0.33349	0.179000	0.23085	1.548000	0.36201	1.972000	0.57404	0.561000	0.74099	GTG			0.736	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461684.1		NM_001012643	
KCNC3	3748	mdanderson.org	37	19	50831872	50831872	+	Silent	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr19:50831872C>T	ENST00000477616.1	-	1	762	c.468G>A	c.(466-468)ctG>ctA	p.L156L	KCNC3_ENST00000474951.1_Intron|NR1H2_ENST00000542413.1_5'Flank|KCNC3_ENST00000376959.2_Silent_p.L156L|KCNC3_ENST00000391818.2_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	156					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	CTGGGCAGTGCAGCTTGCCGG	0.657																																					p.L156L	Melanoma(91;1496 2324 50908)												.	.			0			c.G468A												28.0	33.0	31.0					19																	50831872		2202	4298	6500	SO:0001819	synonymous_variant	3748	exon1			GCAGTGCAGCTTG	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.468G>A	19.37:g.50831872C>T			60	0	0		44	0.07	3	NM_004977	2	0.00	0		Silent	SNP	ENST00000477616.1	37	CCDS12793.1																																																																																					0.657	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314288.2		NM_004977	
ATRAID	51374	broad.mit.edu	37	2	27438402	27438402	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr2:27438402G>T	ENST00000606999.1	+	4	412	c.354G>T	c.(352-354)caG>caT	p.Q118H	ATRAID_ENST00000380171.3_Missense_Mutation_p.Q173H|CAD_ENST00000264705.4_5'Flank|CAD_ENST00000403525.1_5'Flank|ATRAID_ENST00000405489.3_Missense_Mutation_p.Q60H	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	118					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											GCTTTACTCAGCTCCAGACTC	0.458																																					p.Q173H													.	.			0			c.G519T												102.0	97.0	99.0					2																	27438402		2203	4300	6503	SO:0001583	missense	51374	exon4			TACTCAGCTCCAG	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.354G>T	2.37:g.27438402G>T	ENSP00000476080:p.Gln118His		167	0	0		177	0.03	5	NM_080592	518	0.00	1	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Missense_Mutation	SNP	ENST00000606999.1	37		.	.	.	.	.	.	.	.	.	.	G	19.57	3.852516	0.71719	.	.	ENSG00000138085	ENST00000380171;ENST00000405489;ENST00000419744	T;T	0.45668	1.57;0.89	5.58	5.58	0.84498	.	0.485095	0.24686	N	0.036423	T	0.62720	0.2451	M	0.69823	2.125	0.43304	D	0.9953	D;B	0.69078	0.997;0.001	D;B	0.68483	0.958;0.002	T	0.63097	-0.6713	10	0.52906	T	0.07	-24.1617	15.0792	0.72103	0.0:0.0:1.0:0.0	.	118;173	Q6UW56;Q6UW56-3	APR3_HUMAN;.	H	173;60;60	ENSP00000369518:Q173H;ENSP00000384033:Q60H	ENSP00000369518:Q173H	Q	+	3	2	C2orf28	27291906	0.998000	0.40836	1.000000	0.80357	0.888000	0.51559	1.338000	0.33873	2.630000	0.89119	0.650000	0.86243	CAG			0.458	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470709.1		NM_016085	
RGPD4	285190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	108496563	108496563	+	Splice_Site	SNP	G	G	C			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr2:108496563G>C	ENST00000408999.3	+	21	5141	c.5064G>C	c.(5062-5064)aaG>aaC	p.K1688N	RGPD4_ENST00000354986.4_Splice_Site_p.K1688N	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1688					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AGCAAATTAAGGTGAGATCAG	0.453																																					p.K1688N													.	.			0			c.G5064C												204.0	166.0	178.0					2																	108496563		692	1591	2283	SO:0001630	splice_region_variant	285190	exon21			AATTAAGGTGAGA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5064+1G>C	2.37:g.108496563G>C			751	0	0		795	0.05	36	NM_182588	0		0	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	g	7.195	0.592337	0.13812	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.45276	0.91;0.9	0.854	0.854	0.19007	.	.	.	.	.	T	0.26159	0.0638	L	0.46157	1.445	0.34406	D	0.695863	P	0.37233	0.588	B	0.22601	0.04	T	0.41645	-0.9497	9	0.87932	D	0	-13.5722	4.5888	0.12297	0.2312:0.0:0.7688:0.0	.	1688	Q7Z3J3	RGPD4_HUMAN	N	1688;1688;1055	ENSP00000347081:K1688N;ENSP00000386810:K1688N	ENSP00000347081:K1688N	K	+	3	2	RGPD4	107862995	1.000000	0.71417	0.827000	0.32855	0.561000	0.35649	1.976000	0.40579	0.767000	0.33267	0.398000	0.26397	AAG			0.453	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	Missense_Mutation
STK35	140901	hgsc.bcm.edu	37	20	2083851	2083851	+	Silent	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr20:2083851G>T	ENST00000381482.3	+	2	1003	c.732G>T	c.(730-732)gcG>gcT	p.A244A	STK35_ENST00000246032.3_Silent_p.A111A|STK35_ENST00000400064.3_Silent_p.A72A			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						TGGAGCTGGCGCTGGCTGAAT	0.672																																					p.A244A													.	.			0			c.G732T												18.0	19.0	19.0					20																	2083851		2202	4300	6502	SO:0001819	synonymous_variant	140901	exon2			GCTGGCGCTGGCT	AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.732G>T	20.37:g.2083851G>T			46	0	0		64	0.08	5	NM_080836	67	0.00	0	B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Silent	SNP	ENST00000381482.3	37	CCDS13024.2																																																																																					0.672	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077574.3		NM_080836	
SIGLEC1	6614	mdanderson.org	37	20	3674127	3674127	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr20:3674127G>T	ENST00000344754.4	-	13	3474	c.3475C>A	c.(3475-3477)Cgc>Agc	p.R1159S	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.R1159S	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1159	Ig-like C2-type 11.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CTGGAGAGGCGGGGTGCCCGA	0.652																																					p.R1159S													.	.			0			c.C3475A												29.0	35.0	33.0					20																	3674127		2203	4299	6502	SO:0001583	missense	6614	exon13			AGAGGCGGGGTGC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3475C>A	20.37:g.3674127G>T	ENSP00000341141:p.Arg1159Ser		25	0	0		26	0.08	2	NM_023068	20	0.00	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352183	0.41700	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.11930	2.73;2.73	5.52	3.52	0.40303	Immunoglobulin subtype (1);Immunoglobulin-like (1);	1.112820	0.06893	N	0.804582	T	0.15046	0.0363	N	0.25426	0.745	0.09310	N	1	D;P	0.55605	0.972;0.928	P;P	0.54238	0.746;0.644	T	0.04885	-1.0920	10	0.06757	T	0.87	.	7.3808	0.26854	0.0873:0.0:0.7482:0.1645	.	1159;1159	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	S	1159	ENSP00000341141:R1159S;ENSP00000202578:R1159S	ENSP00000202578:R1159S	R	-	1	0	SIGLEC1	3622127	0.013000	0.17824	0.037000	0.18230	0.240000	0.25518	1.473000	0.35387	1.319000	0.45190	0.655000	0.94253	CGC			0.652	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077761.2		NM_023068	
FRG1B	284802	bcgsc.ca	37	20	29623214	29623214	+	Missense_Mutation	SNP	C	C	T	rs367590609		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr20:29623214C>T	ENST00000278882.3	+	3	406	c.26C>T	c.(25-27)tCg>tTg	p.S9L	FRG1B_ENST00000439954.2_Silent_p.L10L|FRG1B_ENST00000358464.4_Missense_Mutation_p.S9L			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	9										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TACATGCACTCGACAATGGTC	0.393																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			TGCACTCGACAAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.26C>T	20.37:g.29623214C>T	ENSP00000278882:p.Ser9Leu		309	0.0291262136	9		308	0.06	18	.	208	0.01	2	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	6.225	0.409655	0.11812	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.93	-0.799	0.10901	.	0.226615	0.39020	N	0.001481	T	0.26268	0.0641	.	.	.	0.21064	N	0.999793	.	.	.	.	.	.	T	0.21827	-1.0234	6	0.72032	D	0.01	.	0.1722	0.00114	0.2331:0.1666:0.2366:0.3637	.	.	.	.	L	9	.	ENSP00000278882:S9L	S	+	2	0	FRG1B	28236875	0.975000	0.34042	0.996000	0.52242	0.067000	0.16453	-0.074000	0.11450	-0.180000	0.10637	-0.465000	0.05216	TCG			0.393	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
ZNF341	84905	mdanderson.org	37	20	32378974	32378974	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr20:32378974A>G	ENST00000375200.1	+	15	2581	c.2216A>G	c.(2215-2217)aAg>aGg	p.K739R	RP4-553F4.6_ENST00000423074.1_RNA|ZNF341_ENST00000342427.2_Missense_Mutation_p.K732R|RP4-553F4.6_ENST00000443171.1_RNA|RP4-553F4.6_ENST00000439444.1_RNA	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	739					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CAAAAGGACAAGGACCTGCAA	0.662																																					p.K732R													.	.			0			c.A2195G												28.0	31.0	30.0					20																	32378974		2203	4292	6495	SO:0001583	missense	84905	exon15			AGGACAAGGACCT	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.2216A>G	20.37:g.32378974A>G	ENSP00000364346:p.Lys739Arg		72	0	0		63	0.05	3	NM_032819	28	0.00	0	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		.	.	.	.	.	.	.	.	.	.	A	14.81	2.645569	0.47258	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.09911	3.16;2.93	4.97	3.79	0.43588	.	0.064046	0.64402	D	0.000011	T	0.14570	0.0352	L	0.29908	0.895	0.35171	D	0.771543	P;D;P;P	0.55172	0.808;0.97;0.915;0.949	B;P;B;P	0.54346	0.304;0.749;0.392;0.596	T	0.13683	-1.0500	10	0.49607	T	0.09	-7.3036	11.6341	0.51194	0.8515:0.1485:0.0:0.0	.	680;591;739;732	Q504V9;B3KU97;Q9BYN7;Q9BYN7-2	.;.;ZN341_HUMAN;.	R	732;739	ENSP00000344308:K732R;ENSP00000364346:K739R	ENSP00000344308:K732R	K	+	2	0	ZNF341	31842635	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	4.198000	0.58419	2.005000	0.58758	0.402000	0.26972	AAG			0.662	ZNF341-201	KNOWN	basic	protein_coding	protein_coding					
SEC22C	9117	mdanderson.org	37	3	42594863	42594863	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:42594863G>T	ENST00000264454.3	-	7	932	c.789C>A	c.(787-789)aaC>aaA	p.N263K	SEC22C_ENST00000536332.1_Intron|SEC22C_ENST00000417572.1_Intron|SEC22C_ENST00000423701.2_Intron|SEC22C_ENST00000273156.7_Intron			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	263					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		GCAGGTACATGTTGCCCAGGC	0.463																																					p.N263K													.	.			0			c.C789A												116.0	110.0	112.0					3																	42594863		2203	4300	6503	SO:0001583	missense	9117	exon7			GTACATGTTGCCC	AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.789C>A	3.37:g.42594863G>T	ENSP00000264454:p.Asn263Lys		59	0	0		55	0.05	3	NM_032970	34	0.00	0	O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	ENST00000264454.3	37	CCDS2700.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.30|17.30	3.354489|3.354489	0.61293|0.61293	.|.	.|.	ENSG00000093183|ENSG00000093183	ENST00000451653|ENST00000264454	.|T	.|0.19250	.|2.16	4.25|4.25	1.97|1.97	0.26223|0.26223	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40694|0.40694	0.1127|0.1127	M|M	0.71206|0.71206	2.165|2.165	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	T|T	0.14090|0.14090	-1.0485|-1.0485	5|10	.|0.66056	.|D	.|0.02	-16.032|-16.032	8.8708|8.8708	0.35314|0.35314	0.3017:0.0:0.6983:0.0|0.3017:0.0:0.6983:0.0	.|.	.|263	.|Q9BRL7	.|SC22C_HUMAN	N|K	185|263	.|ENSP00000264454:N263K	.|ENSP00000264454:N263K	H|N	-|-	1|3	0|2	SEC22C|SEC22C	42569867|42569867	0.991000|0.991000	0.36638|0.36638	0.499000|0.499000	0.27577|0.27577	0.995000|0.995000	0.86356|0.86356	2.074000|2.074000	0.41529|0.41529	0.328000|0.328000	0.23435|0.23435	0.591000|0.591000	0.81541|0.81541	CAT|AAC			0.463	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254734.1		NM_004206	
ATRIP	84126	mdanderson.org	37	3	48505443	48505443	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:48505443G>T	ENST00000320211.3	+	10	1999	c.1886G>T	c.(1885-1887)gGc>gTc	p.G629V	TREX1_ENST00000433541.1_5'Flank|TREX1_ENST00000422277.2_5'Flank|TREX1_ENST00000456089.1_5'Flank|TREX1_ENST00000444177.1_5'Flank|ATRIP_ENST00000412052.1_Missense_Mutation_p.G536V|ATRIP_ENST00000357105.6_Missense_Mutation_p.G502V|TREX1_ENST00000436480.2_5'Flank|ATRIP_ENST00000346691.4_Missense_Mutation_p.G629V|TREX1_ENST00000296443.9_5'Flank	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	629					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTTTCAGAAGGCTGCCTCCTG	0.542								Other conserved DNA damage response genes																													p.G629V													.	.			0			c.G1886T												104.0	106.0	105.0					3																	48505443		2203	4300	6503	SO:0001583	missense	84126	exon10			CAGAAGGCTGCCT	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1886G>T	3.37:g.48505443G>T	ENSP00000323099:p.Gly629Val		39	0	0		36	0.08	3	NM_130384	40	0.00	0	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.844005	0.32606	.	.	ENSG00000164053	ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	T;T;T;T	0.65364	1.53;-0.15;0.95;1.53	5.67	3.83	0.44106	.	0.340057	0.33253	N	0.005109	T	0.69468	0.3114	L	0.57536	1.79	0.45822	D	0.998696	D;P	0.69078	0.997;0.585	P;B	0.60949	0.881;0.319	T	0.67225	-0.5724	10	0.41790	T	0.15	-7.3287	9.7795	0.40640	0.0875:0.2191:0.6934:0.0	.	629;629	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	V	629;629;502;536	ENSP00000323099:G629V;ENSP00000302338:G629V;ENSP00000349620:G502V;ENSP00000400930:G536V	ENSP00000323099:G629V	G	+	2	0	ATRIP	48480447	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	1.266000	0.33039	0.765000	0.33221	-0.797000	0.03246	GGC			0.542	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257507.2		NM_130384	
ARIH2OS	646450	mdanderson.org	37	3	48955837	48955837	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:48955837C>T	ENST00000408959.2	-	1	981	c.746G>A	c.(745-747)cGc>cAc	p.R249H	ARIH2_ENST00000449376.1_5'Flank|ARIH2_ENST00000356401.4_5'Flank	NM_001123040.1	NP_001116512.1	Q8N7S6	ARI2O_HUMAN	ariadne homolog 2 opposite strand	249						integral component of membrane (GO:0016021)											GAGAACTGCGCGGCGAACGAG	0.582																																					p.R249H													.	.			0			c.G746A												80.0	78.0	78.0					3																	48955837		1568	3582	5150	SO:0001583	missense	646450	exon1			ACTGCGCGGCGAA	DA461567	CCDS43088.1	3p21.31	2012-10-08	2012-10-08	2012-10-08	ENSG00000221883	ENSG00000221883			34425	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 71"""	C3orf71			Standard	NM_001123040		Approved		uc010hkk.1	Q8N7S6	OTTHUMG00000156672	ENST00000408959.2:c.746G>A	3.37:g.48955837C>T	ENSP00000386193:p.Arg249His		51	0	0		46	0.07	3	NM_001123040	4	0.00	0		Missense_Mutation	SNP	ENST00000408959.2	37	CCDS43088.1	.	.	.	.	.	.	.	.	.	.	C	9.795	1.178900	0.21787	.	.	ENSG00000221883	ENST00000408959	.	.	.	2.79	-2.44	0.06502	.	.	.	.	.	T	0.16085	0.0387	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.19224	-1.0312	8	0.87932	D	0	.	4.1655	0.10305	0.0:0.3094:0.1882:0.5023	.	249	Q8N7S6	CC071_HUMAN	H	249	.	ENSP00000386193:R249H	R	-	2	0	C3orf71	48930841	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.091000	0.11146	-0.696000	0.05098	-0.258000	0.10820	CGC			0.582	ARIH2OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345247.1		NM_001123040	
CDHR4	389118	mdanderson.org	37	3	49829387	49829387	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:49829387G>T	ENST00000412678.2	-	16	2152	c.2144C>A	c.(2143-2145)gCc>gAc	p.A715D	CDHR4_ENST00000462108.1_5'UTR	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	715					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CAGCAGCTGGGCCAACCTAAA	0.517																																					p.A715D													.	.			0			c.C2144A												96.0	94.0	95.0					3																	49829387		692	1591	2283	SO:0001583	missense	389118	exon16			AGCTGGGCCAACC		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.2144C>A	3.37:g.49829387G>T	ENSP00000391409:p.Ala715Asp		50	0	0		50	0.06	3	NM_001007540	0		0	Q6UXT0	Missense_Mutation	SNP	ENST00000412678.2	37	CCDS46829.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695163	0.48202	.	.	ENSG00000187492	ENST00000412678	T	0.57752	0.38	5.06	1.28	0.21552	.	.	.	.	.	T	0.41949	0.1181	L	0.44542	1.39	0.09310	N	0.999999	P	0.44877	0.845	B	0.41860	0.368	T	0.17715	-1.0360	9	0.30854	T	0.27	.	7.2818	0.26316	0.3572:0.0:0.6428:0.0	.	715	A6H8M9	CDHR4_HUMAN	D	715	ENSP00000391409:A715D	ENSP00000391409:A715D	A	-	2	0	CDHR4	49804391	0.803000	0.28956	0.068000	0.19968	0.825000	0.46686	0.898000	0.28404	0.122000	0.18314	0.650000	0.86243	GCC			0.517	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350387.1		NM_001007540	
FOXL2NB	401089	mdanderson.org	37	3	138666289	138666289	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:138666289C>T	ENST00000383165.3	+	1	214	c.83C>T	c.(82-84)gCc>gTc	p.A28V	FOXL2_ENST00000330315.3_5'Flank	NM_001040061.2	NP_001035150.1	Q6ZUU3	FOXNB_HUMAN		28										large_intestine(1)|lung(3)	4						GCGCTCCAAGCCTCCTCGCGG	0.657																																					p.A28V													.	.			0			c.C83T												5.0	7.0	6.0					3																	138666289		1672	3781	5453	SO:0001583	missense	401089	exon1			TCCAAGCCTCCTC																												ENST00000383165.3:c.83C>T	3.37:g.138666289C>T	ENSP00000372651:p.Ala28Val		55	0	0		43	0.09	4	NM_001040061	0		0	A6NGX0	Missense_Mutation	SNP	ENST00000383165.3	37	CCDS43155.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.412941	0.42817	.	.	ENSG00000206262	ENST00000383165	.	.	.	3.65	2.75	0.32379	.	.	.	.	.	T	0.32852	0.0843	N	0.14661	0.345	0.23991	N	0.996242	D	0.60160	0.987	P	0.57283	0.817	T	0.09422	-1.0675	8	0.37606	T	0.19	.	8.0088	0.30340	0.0:0.876:0.0:0.124	.	28	Q6ZUU3	CC072_HUMAN	V	28	.	ENSP00000372651:A28V	A	+	2	0	C3orf72	140148979	0.913000	0.31002	0.999000	0.59377	0.985000	0.73830	1.653000	0.37323	0.784000	0.33661	0.561000	0.74099	GCC			0.657	C3orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357986.1			
RBP1	5947	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	139257745	139257745	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr3:139257745C>G	ENST00000483943.2	-	2	316	c.316G>C	c.(316-318)Gtg>Ctg	p.V106L	RBP1_ENST00000232219.2_Missense_Mutation_p.V106L|RBP1_ENST00000492918.1_Missense_Mutation_p.V106L|RP11-319G6.1_ENST00000515247.1_RNA|RP11-319G6.1_ENST00000381790.3_RNA	NM_001130993.1	NP_001124465.1	P09455	RET1_HUMAN	retinol binding protein 1, cellular	44					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	CCGTCCTGCACGATCTCTTTG	0.537																																					p.V106L													.	.			0			c.G316C												221.0	183.0	196.0					3																	139257745		2203	4300	6503	SO:0001583	missense	5947	exon2			CCTGCACGATCTC		CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000483943.2:c.316G>C	3.37:g.139257745C>G	ENSP00000424813:p.Val106Leu		134	0	0		120	0.07	8	NM_002899	172	0.09	15	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000483943.2	37	CCDS46925.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937842	0.34189	.	.	ENSG00000114115	ENST00000232219;ENST00000483943;ENST00000492918	T;T;T	0.08102	3.13;3.13;3.13	5.15	2.29	0.28610	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.284177	0.28209	N	0.016189	T	0.06325	0.0163	L	0.35341	1.055	0.30104	N	0.807205	B;B;B	0.19583	0.037;0.008;0.0	B;B;B	0.22386	0.039;0.02;0.001	T	0.18493	-1.0335	10	0.31617	T	0.26	.	7.0319	0.24972	0.0:0.3629:0.4846:0.1524	.	106;106;44	F2Z2F2;E7EWV0;P09455	.;.;RET1_HUMAN	L	106	ENSP00000232219:V106L;ENSP00000424813:V106L;ENSP00000429166:V106L	ENSP00000232219:V106L	V	-	1	0	RBP1	140740435	0.997000	0.39634	1.000000	0.80357	0.975000	0.68041	0.420000	0.21263	0.523000	0.28482	-0.519000	0.04390	GTG			0.537	RBP1-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000341497.2		NM_002899	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30725116	30725116	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr4:30725116C>T	ENST00000361762.2	+	1	3080	c.2072C>T	c.(2071-2073)aCg>aTg	p.T691M	PCDH7_ENST00000543491.1_Missense_Mutation_p.T691M	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	691	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GAAAATGACACGGGGACCATT	0.488																																					p.T691M													.	.			0			c.C2072T												118.0	118.0	118.0					4																	30725116		2203	4300	6503	SO:0001583	missense	5099	exon1			ATGACACGGGGAC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2072C>T	4.37:g.30725116C>T	ENSP00000355243:p.Thr691Met		80	0	0		57	0.26	15	NM_032457	1	0.00	0	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431137	0.62844	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.58060	0.36;0.36	5.25	5.25	0.73442	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.80706	0.4674	M	0.93808	3.46	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85549	0.1220	9	0.87932	D	0	.	19.0454	0.93018	0.0:1.0:0.0:0.0	.	691;644;691	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	M	691;691;644	ENSP00000355243:T691M;ENSP00000441802:T691M	ENSP00000330302:T644M	T	+	2	0	PCDH7	30334214	1.000000	0.71417	0.969000	0.41365	0.982000	0.71751	7.647000	0.83462	2.722000	0.93159	0.655000	0.94253	ACG			0.488	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000360366.1		NM_032457, NM_002589	
BMP2K	55589	broad.mit.edu	37	4	79792085	79792085	+	Missense_Mutation	SNP	G	G	C	rs376418550	byFrequency	TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr4:79792085G>C	ENST00000335016.5	+	11	1546	c.1380G>C	c.(1378-1380)caG>caC	p.Q460H	BMP2K_ENST00000502871.1_Missense_Mutation_p.Q460H	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	460	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.Q460H(3)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ATCCTCACcagcagcagcagc	0.577																																					p.Q460H													BMP2K_ENST00000502871,NS,carcinoma,0,7	BMP2K	169	7	3	Substitution - Missense(3)	endometrium(2)|prostate(1)	c.G1380C												40.0	45.0	44.0					4																	79792085		2203	4300	6503	SO:0001583	missense	55589	exon11			TCACCAGCAGCAG	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1380G>C	4.37:g.79792085G>C	ENSP00000334836:p.Gln460His		54	0	0		76	0.04	3	NM_017593	48	0.00	0	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.089|8.089	0.774118|0.774118	0.16051|0.16051	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000502613|ENST00000502871;ENST00000335016;ENST00000264889	.|T;T	.|0.74002	.|0.79;-0.8	5.12|5.12	2.26|2.26	0.28386|0.28386	.|.	.|1.238260	.|0.06146	.|N	.|0.673324	T|T	0.57504|0.57504	0.2058|0.2058	N|N	0.15975|0.15975	0.35|0.35	0.30181|0.30181	N|N	0.800383|0.800383	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.51803|0.51803	-0.8659|-0.8659	5|10	.|0.42905	.|T	.|0.14	0.0809|0.0809	5.9141|5.9141	0.19045|0.19045	0.0722:0.2493:0.5501:0.1284|0.0722:0.2493:0.5501:0.1284	.|.	.|460;460	.|Q9NSY1;Q4W5H2	.|BMP2K_HUMAN;.	P|H	153|460;460;474	.|ENSP00000421768:Q460H;ENSP00000334836:Q460H	.|ENSP00000264889:Q474H	A|Q	+|+	1|3	0|2	BMP2K|BMP2K	80011109|80011109	0.996000|0.996000	0.38824|0.38824	0.995000|0.995000	0.50966|0.50966	0.181000|0.181000	0.23173|0.23173	0.092000|0.092000	0.15066|0.15066	0.524000|0.524000	0.28502|0.28502	0.460000|0.460000	0.39030|0.39030	GCA|CAG			0.577	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_017593	
NKD2	85409	broad.mit.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	CAC	CAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.P86del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69																																					p.439_439del													.	NKD2	39		0			c.1315_1317del																																									SO:0001651	inframe_deletion	85409	exon10			CACGAGCACCACC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del		8	0	0		6	0.33	2	NM_033120	8	0.00	0	Q96EK8|Q9BSN0	In_Frame_Del	DEL	ENST00000296849.5	37	CCDS3859.1																																																																																					0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206720.2		NM_033120	
FST	10468	mdanderson.org	37	5	52781043	52781043	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:52781043C>A	ENST00000256759.3	+	5	1321	c.938C>A	c.(937-939)tCc>tAc	p.S313Y	FST_ENST00000396947.3_Missense_Mutation_p.S313Y	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	313	Kazal-like 3. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GTAAAGCACTCCGGATCTTGC	0.507																																					p.S313Y													.	.			0			c.C938A												99.0	89.0	92.0					5																	52781043		2203	4300	6503	SO:0001583	missense	10468	exon5			AGCACTCCGGATC	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.938C>A	5.37:g.52781043C>A	ENSP00000256759:p.Ser313Tyr		45	0	0		31	0.10	3	NM_006350	1	0.00	0	B5BU94|Q9BTH0	Missense_Mutation	SNP	ENST00000256759.3	37	CCDS3959.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.45|11.45	1.643640|1.643640	0.29246|0.29246	.|.	.|.	ENSG00000134363|ENSG00000134363	ENST00000497789|ENST00000256759;ENST00000511025;ENST00000396947;ENST00000504226	.|T;T;T	.|0.04406	.|3.63;3.63;3.63	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Proteinase inhibitor I1, Kazal (2);	.|0.224055	.|0.47852	.|D	.|0.000205	T|T	0.13798|0.13798	0.0334|0.0334	L|L	0.58510|0.58510	1.815|1.815	0.50813|0.50813	D|D	0.999891|0.999891	.|D	.|0.53619	.|0.961	.|P	.|0.54706	.|0.759	T|T	0.00028|0.00028	-1.2300|-1.2300	5|10	.|0.72032	.|D	.|0.01	-19.1045|-19.1045	15.1729|15.1729	0.72888|0.72888	0.0:0.8595:0.1405:0.0|0.0:0.8595:0.1405:0.0	.|.	.|313	.|P19883	.|FST_HUMAN	T|Y	98|313;313;313;184	.|ENSP00000256759:S313Y;ENSP00000380151:S313Y;ENSP00000426315:S184Y	.|ENSP00000256759:S313Y	P|S	+|+	1|2	0|0	FST|FST	52816800|52816800	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.956000|3.956000	0.56722|0.56722	2.725000|2.725000	0.93324|0.93324	0.655000|0.655000	0.94253|0.94253	CCG|TCC			0.507	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253906.1		NM_013409	
TRIM23	373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	64906830	64906830	+	Nonsense_Mutation	SNP	G	G	C			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:64906830G>C	ENST00000231524.9	-	5	1057	c.686C>G	c.(685-687)tCa>tGa	p.S229*	TRIM23_ENST00000508808.1_5'Flank|TRIM23_ENST00000274327.7_Nonsense_Mutation_p.S229*|TRIM23_ENST00000381018.3_Nonsense_Mutation_p.S229*	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	229					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S229L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		ATCTAAAATTGATGCTCGGAT	0.343																																					p.S229X													TRIM23,bladder,carcinoma,0,1	TRIM23	0	1	1	Substitution - Missense(1)	urinary_tract(1)	c.C686G												98.0	95.0	96.0					5																	64906830		2203	4300	6503	SO:0001587	stop_gained	373	exon5			AAAATTGATGCTC	L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.686C>G	5.37:g.64906830G>C	ENSP00000231524:p.Ser229*		93	0	0		73	0.21	15	NM_033228	19	0.26	5	Q9BZY4|Q9BZY5	Nonsense_Mutation	SNP	ENST00000231524.9	37	CCDS3987.1	.	.	.	.	.	.	.	.	.	.	G	36	5.601784	0.96614	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.5302	0.95226	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000231524:S229X	S	-	2	0	TRIM23	64942586	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.397000	0.97276	2.633000	0.89246	0.591000	0.81541	TCA			0.343	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000215058.2		NM_001656	
NBPF22P	285622	broad.mit.edu	37	5	85586764	85586764	+	RNA	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:85586764C>T	ENST00000590707.1	+	0	1051					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		CAATTGTCTGCGACTACAGCT	0.572																																					.													.	.			0			.																																											0	.			TGTCTGCGACTAC	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85586764C>T			409	0.0048899756	2		330	0.02	5	.	0		0		RNA	SNP	ENST00000590707.1	37																																																																																						0.572	NBPF22P-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000453100.1		XM_208333	
SLC26A2	1836	mdanderson.org	37	5	149361140	149361140	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:149361140G>T	ENST00000286298.4	+	3	2252	c.1984G>T	c.(1984-1986)Gca>Tca	p.A662S		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	662	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTTAGATACAGCAGGGATCCA	0.458																																					p.A662S													.	.			0			c.G1984T												81.0	81.0	81.0					5																	149361140		2203	4300	6503	SO:0001583	missense	1836	exon3			GATACAGCAGGGA	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.1984G>T	5.37:g.149361140G>T	ENSP00000286298:p.Ala662Ser		54	0	0		40	0.08	3	NM_000112	5	0.00	0	A8K2U3|B2R6J1|Q6N051	Missense_Mutation	SNP	ENST00000286298.4	37	CCDS4300.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691963	0.68271	.	.	ENSG00000155850	ENST00000286298	D	0.85773	-2.03	5.89	5.89	0.94794	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.047834	0.85682	D	0.000000	D	0.86138	0.5861	L	0.58354	1.805	0.49582	D	0.999805	P	0.51240	0.943	P	0.55391	0.775	T	0.81814	-0.0760	10	0.05525	T	0.97	.	13.4486	0.61155	0.0715:0.0:0.9285:0.0	.	662	P50443	S26A2_HUMAN	S	662	ENSP00000286298:A662S	ENSP00000286298:A662S	A	+	1	0	SLC26A2	149341333	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.840000	0.86819	2.795000	0.96236	0.655000	0.94253	GCA			0.458	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252333.2		NM_000112	
LCP2	3937	mdanderson.org	37	5	169683547	169683547	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr5:169683547G>T	ENST00000046794.5	-	17	1748	c.1133C>A	c.(1132-1134)cCa>cAa	p.P378Q	LCP2_ENST00000521416.1_Missense_Mutation_p.P173Q	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	378					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		GAAGTATGGTGGCAGGGAGGC	0.488																																					p.P378Q													.	.			0			c.C1133A												97.0	103.0	101.0					5																	169683547		1919	4134	6053	SO:0001583	missense	3937	exon17			TATGGTGGCAGGG		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.1133C>A	5.37:g.169683547G>T	ENSP00000046794:p.Pro378Gln		67	0	0		51	0.06	3	NM_005565	102	0.01	1	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526552	0.44969	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	T;T	0.59224	0.42;0.28	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.72350	0.3449	M	0.63843	1.955	0.42892	D	0.994202	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.969	T	0.72750	-0.4199	9	.	.	.	-11.7225	15.1391	0.72595	0.0:0.0:1.0:0.0	.	173;378	E7ESF6;Q13094	.;LCP2_HUMAN	Q	378;173	ENSP00000046794:P378Q;ENSP00000428871:P173Q	.	P	-	2	0	LCP2	169616125	1.000000	0.71417	0.952000	0.39060	0.381000	0.30169	4.096000	0.57734	2.337000	0.79520	0.557000	0.71058	CCA			0.488	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371727.1		NM_005565	
MSH5	4439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31725947	31725947	+	Silent	SNP	G	G	C			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr6:31725947G>C	ENST00000375755.3	+	13	1306	c.1020G>C	c.(1018-1020)gtG>gtC	p.V340V	RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000395853.1_Silent_p.V14V|MSH5_ENST00000375703.3_Silent_p.V340V|MSH5_ENST00000431848.2_Silent_p.V39V|MSH5_ENST00000375750.3_Silent_p.V340V|MSH5_ENST00000534153.4_Silent_p.V357V|MSH5-SAPCD1_ENST00000493662.2_Silent_p.V357V|MSH5_ENST00000375742.3_Silent_p.V357V|MSH5_ENST00000375740.3_Silent_p.V357V	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	340					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						CACAGACTGTGTACAGTGCCC	0.552								Direct reversal of damage;Mismatch excision repair (MMR)																													p.V357V													.	.			0			c.G1071C												87.0	81.0	83.0					6																	31725947		1509	2708	4217	SO:0001819	synonymous_variant	4439	exon13			GACTGTGTACAGT	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1020G>C	6.37:g.31725947G>C			74	0	0		70	0.34	24	NM_025259	18	0.33	6	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	ENST00000375755.3	37	CCDS4720.1																																																																																					0.552	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076243.4			
SOGA3	387104	mdanderson.org	37	6	127796804	127796804	+	Silent	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr6:127796804G>T	ENST00000525778.1	-	6	3112	c.2367C>A	c.(2365-2367)atC>atA	p.I789I	SOGA3_ENST00000368268.2_Silent_p.I789I|SOGA3_ENST00000556132.1_Silent_p.I789I|SOGA3_ENST00000481848.2_Silent_p.I789I|SOGA3_ENST00000474293.2_5'UTR|SOGA3_ENST00000465909.2_Silent_p.I789I			Q5TF21	SOGA3_HUMAN	SOGA family member 3	789					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TGAGGCAGCGGATGTTGCGCA	0.701																																					p.I789I													.	.			0			c.C2367A												21.0	27.0	25.0					6																	127796804		2125	4231	6356	SO:0001819	synonymous_variant	387104	exon6			GCAGCGGATGTTG	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2367C>A	6.37:g.127796804G>T			14	0	0		9	0.22	2	NM_001012279	0		0		Silent	SNP	ENST00000525778.1	37	CCDS43505.1																																																																																					0.701	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388246.1		NM_001012279	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q													.	.			0			c.G180A												43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A			74	0	0		49	0.14	7	NM_003194	61	0.00	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																					0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000043271.2		NM_003194	
TRA2A	29896	broad.mit.edu	37	7	23545402	23545403	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr7:23545402_23545403delTC	ENST00000297071.4	-	7	1016_1017	c.800_801delGA	c.(799-801)cgafs	p.R267fs	TRA2A_ENST00000538367.1_Frame_Shift_Del_p.R166fs|TRA2A_ENST00000392502.4_Frame_Shift_Del_p.R165fs|TRA2A_ENST00000474586.1_5'Flank	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	267	Arg/Ser-rich (RS2 domain).				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						GTGATCTATATCGACTATAATA	0.332																																					p.267_267del	Pancreas(121;2137 2973 46590)												.	TRA2A	29		0			c.800_801del																																									SO:0001589	frameshift_variant	29896	exon7			TCTATATCGACTA	U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.800_801delGA	7.37:g.23545402_23545403delTC	ENSP00000297071:p.Arg267fs		166	0	0		155	0.06	9	NM_013293	447	0.08	37	B4DUA9	Frame_Shift_Del	DEL	ENST00000297071.4	37	CCDS5383.1																																																																																					0.332	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250257.1		NM_013293	
NOM1	64434	mdanderson.org	37	7	156756636	156756636	+	Missense_Mutation	SNP	G	G	T	rs369881632		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr7:156756636G>T	ENST00000275820.3	+	7	1964	c.1949G>T	c.(1948-1950)aGg>aTg	p.R650M		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	650						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CGGAAGCAGAGGATGAACACA	0.448																																					p.R650M													.	.			0			c.G1949T												82.0	78.0	79.0					7																	156756636		2203	4300	6503	SO:0001583	missense	64434	exon7			AGCAGAGGATGAA	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.1949G>T	7.37:g.156756636G>T	ENSP00000275820:p.Arg650Met		59	0	0		56	0.05	3	NM_138400	68	0.00	0	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105032	0.77096	.	.	ENSG00000146909	ENST00000275820	T	0.18657	2.2	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.56746	0.2006	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.70806	-0.4772	10	0.72032	D	0.01	-26.9365	17.3571	0.87340	0.0:0.0:1.0:0.0	.	650	Q5C9Z4	NOM1_HUMAN	M	650	ENSP00000275820:R650M	ENSP00000275820:R650M	R	+	2	0	NOM1	156449397	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	9.400000	0.97290	2.167000	0.68274	0.297000	0.19635	AGG			0.448	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327098.1		NM_138400	
GLI4	2738	mdanderson.org	37	8	144351632	144351632	+	Silent	SNP	A	A	T	rs6558341	byFrequency	TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr8:144351632A>T	ENST00000523522.1	+	1	105	c.66A>T	c.(64-66)ccA>ccT	p.P22P	GLI4_ENST00000344692.3_Silent_p.P22P|GLI4_ENST00000521682.1_Silent_p.P22P|ZFP41_ENST00000522452.1_Intron|GLI4_ENST00000517468.1_Silent_p.P22P|GLI4_ENST00000340042.1_Silent_p.P22P			P10075	GLI4_HUMAN	GLI family zinc finger 4	22					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TCTCATCACCAGGGACACCTG	0.622																																					p.P22P													.	.			0			c.A66T												188.0	181.0	183.0					8																	144351632		2203	4300	6503	SO:0001819	synonymous_variant	2738	exon2			ATCACCAGGGACA		CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.66A>T	8.37:g.144351632A>T			76	0	0		81	0.02	2	NM_138465	49	0.00	0	Q96CK9	Silent	SNP	ENST00000523522.1	37	CCDS6398.1																																																																																					0.622	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381128.2			
FAM205B	389715	broad.mit.edu	37	9	34835480	34835480	+	RNA	SNP	C	C	T	rs369553984		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr9:34835480C>T	ENST00000455647.2	-	0	913							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B									p.P3P(1)									GCAAGGCCATCGGATGCATCC	0.522																																					.													.	FAM205B	10		1	Substitution - coding silent(1)	endometrium(1)	.																																											0	.			GGCCATCGGATGC			9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34835480C>T			69	0.0144927536	1		65	0.08	5	.	0		0	Q6ZRJ7	RNA	SNP	ENST00000455647.2	37																																																																																						0.522	FAM205B-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000052246.5		NR_024481	
VCP	7415	mdanderson.org	37	9	35059088	35059088	+	Silent	SNP	T	T	C			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr9:35059088T>C	ENST00000358901.6	-	15	3028	c.2133A>G	c.(2131-2133)cgA>cgG	p.R711R		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	711					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCTGCCTCTCTCGTTCTCGCC	0.552																																					p.R711R													.	.			0			c.A2133G												157.0	128.0	138.0					9																	35059088		2203	4300	6503	SO:0001819	synonymous_variant	7415	exon15			CCTCTCTCGTTCT	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.2133A>G	9.37:g.35059088T>C			60	0	0		53	0.06	3	NM_007126	1518	0.00	1	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Silent	SNP	ENST00000358901.6	37	CCDS6573.1																																																																																					0.552	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052290.1		NM_007126	
Unknown	0	bcgsc.ca	37	9	76264707	76264707	+	IGR	SNP	G	G	A	rs529725494		TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr9:76264707G>A								RP11-128I7.1 (70293 upstream) : RNA5SP286 (101180 downstream)																							GCAGTTGATCGGAAACATGCG	0.577													g|||	1	0.000199681	0.0	0.0	5008	,	,		19090	0.001		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTGATCGGAAACA																													9.37:g.76264707G>A			20	0	0		20	0.35	7	.	0		0		RNA	SNP		37																																																																																					0	0.577										
PHF2	5253	mdanderson.org	37	9	96407931	96407931	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chr9:96407931G>A	ENST00000359246.4	+	4	687	c.320G>A	c.(319-321)cGt>cAt	p.R107H	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	107					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GTGGTGGCCCGTGTGCCAGGA	0.657																																					p.R107H													.	.			0			c.G320A												83.0	78.0	80.0					9																	96407931		2203	4300	6503	SO:0001583	missense	5253	exon4			TGGCCCGTGTGCC	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.320G>A	9.37:g.96407931G>A	ENSP00000352185:p.Arg107His		38	0	0		33	0.09	3	NM_005392	20	0.00	0	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136239	0.56936	.	.	ENSG00000197724	ENST00000359246	T	0.70282	-0.47	4.61	1.54	0.23209	.	0.068049	0.56097	D	0.000036	T	0.47967	0.1474	N	0.20445	0.575	0.80722	D	1	B	0.21753	0.06	B	0.06405	0.002	T	0.26573	-1.0099	10	0.35671	T	0.21	-14.888	5.2539	0.15537	0.5864:0.0:0.4136:0.0	.	107	O75151	PHF2_HUMAN	H	107	ENSP00000352185:R107H	ENSP00000352185:R107H	R	+	2	0	PHF2	95447752	1.000000	0.71417	0.501000	0.27601	0.776000	0.43924	7.308000	0.78929	0.568000	0.29311	0.460000	0.39030	CGT			0.657	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053162.1		NM_005392	
RIBC1	158787	broad.mit.edu	37	X	53457699	53457699	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chrX:53457699G>T	ENST00000375327.3	+	7	1172	c.1019G>T	c.(1018-1020)gGa>gTa	p.G340V	RIBC1_ENST00000414955.2_Missense_Mutation_p.G225V|HSD17B10_ENST00000495986.1_5'Flank|RP3-339A18.6_ENST00000418049.1_RNA	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	340										lung(2)	2						AGGGGTCTAGGATCCTTCAAC	0.512																																					p.G340V													.	RIBC1	20		0			c.G1019T												74.0	56.0	62.0					X																	53457699		2203	4300	6503	SO:0001583	missense	158787	exon7			GTCTAGGATCCTT	AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.1019G>T	X.37:g.53457699G>T	ENSP00000364476:p.Gly340Val		57	0	0		76	0.04	3	NM_001031745	6	0.00	0	B4E297|E9PDU2|Q5H931|Q96A80	Missense_Mutation	SNP	ENST00000375327.3	37	CCDS35299.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227944	0.39399	.	.	ENSG00000158423	ENST00000414955;ENST00000375327	T;T	0.22539	1.95;1.95	4.99	2.82	0.32997	.	0.049864	0.85682	D	0.000000	T	0.36552	0.0971	M	0.70595	2.14	0.23743	N	0.996967	D;B	0.76494	0.999;0.288	D;B	0.68483	0.958;0.174	T	0.08207	-1.0733	10	0.29301	T	0.29	-9.1939	6.6086	0.22739	0.3439:0.0:0.656:0.0	.	225;340	E9PDU2;Q8N443	.;RIBC1_HUMAN	V	225;340	ENSP00000401463:G225V;ENSP00000364476:G340V	ENSP00000364476:G340V	G	+	2	0	RIBC1	53474424	0.928000	0.31464	0.521000	0.27850	0.952000	0.60782	2.891000	0.48617	1.035000	0.39972	0.600000	0.82982	GGA			0.512	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056762.1		NM_144968	
FRMPD3	84443	broad.mit.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																					.													.	.			0			.												3.0	2.0	2.0					X																	106846480		690	1560	2250	SO:0001819	synonymous_variant	84443	.			ACAACAGCAGCAG	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A			122	0.0081967213	1		142	0.04	6	.	28	0.04	1	Q96JK8	Silent	SNP	ENST00000276185.4	37																																																																																						0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
AFF2	2334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	147891442	147891442	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chrX:147891442C>T	ENST00000370460.2	+	4	1563	c.1084C>T	c.(1084-1086)Cgg>Tgg	p.R362W	AFF2_ENST00000342251.3_Missense_Mutation_p.R358W|AFF2_ENST00000370457.5_Missense_Mutation_p.R358W|AFF2_ENST00000286437.5_Missense_Mutation_p.R32W|AFF2_ENST00000370458.1_Missense_Mutation_p.R358W	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	362					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AGAAATCTTGCGGGTGAGTTT	0.333																																					p.R362W													.	.			0			c.C1084T												209.0	178.0	189.0					X																	147891442		2203	4300	6503	SO:0001583	missense	2334	exon4			ATCTTGCGGGTGA	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1084C>T	X.37:g.147891442C>T	ENSP00000359489:p.Arg362Trp		113	0	0		139	0.35	48	NM_002025	0		0	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911042	0.72983	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458;ENST00000286437	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.15	5.87	3.92	0.45320	.	0.141084	0.45606	D	0.000353	T	0.74261	0.3693	L	0.39245	1.2	0.42677	D	0.993536	D;D;D;D;D;D;D	0.89917	0.998;0.997;0.997;0.997;0.997;0.998;1.0	P;P;P;P;P;P;D	0.97110	0.861;0.781;0.781;0.781;0.781;0.861;1.0	T	0.77278	-0.2647	10	0.87932	D	0	.	13.3558	0.60627	0.132:0.7567:0.1114:0.0	.	32;362;358;358;358;362;358	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;.;AFF2_HUMAN;.	W	362;358;358;358;32	ENSP00000359489:R362W;ENSP00000359486:R358W;ENSP00000345459:R358W;ENSP00000359487:R358W;ENSP00000286437:R32W	ENSP00000286437:R32W	R	+	1	2	AFF2	147699134	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.179000	0.42528	1.225000	0.43566	0.600000	0.82982	CGG			0.333	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058673.2		NM_002025	
WASH6P	653440	broad.mit.edu	37	X	155255062	155255062	+	RNA	SNP	C	C	G			TCGA-YU-A90P-01A-11D-A435-10	TCGA-YU-A90P-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	74fe6dad-8904-4817-9bd1-c10506bcf478	9a3ac787-1752-4e74-bb5b-2d9ec803541a	g.chrX:155255062C>G	ENST00000461007.1	+	0	3978				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CACCTTCCCCCCCAGACCCAG	0.627																																					.													.	.			0			.																																											0	.			TTCCCCCCCAGAC	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155255062C>G			89	0	0		123	0.02	3	.	114	0.21	24	A6NGF1|Q8N305	RNA	SNP	ENST00000461007.1	37																																																																																						0.627	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000058840.1	rescued with RNA-seq	NG_008380	
