#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MST1L	11223	ucsc.edu;bcgsc.ca	37	1	17084768	17084768	+	RNA	SNP	G	G	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr1:17084768G>C	ENST00000455405.2	-	0	248							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TAGAGACCCCGCGCAGAAATG	0.572																																					.													.	.			0			.																																											0	.			GACCCCGCGCAGA	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084768G>C			168	0.0238095238	4		122	0.11	13	.	5	0.20	1	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	0.011	-1.693221	0.00731	.	.	ENSG00000186715	ENST00000389184;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.12050	0.0293	.	.	.	.	.	.	B	0.06786	0.001	B	0.08055	0.003	T	0.38308	-0.9667	5	0.02654	T	1	.	3.5811	0.07954	2.0E-4:0.4998:0.4998:2.0E-4	rs2092129;rs3982161	512	Q2TV78	MSTP9_HUMAN	G	481;512	.	ENSP00000445850:A481G	A	-	2	0	MST1P9	16957355	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	3.026000	0.49689	-0.000000	0.14550	0.000000	0.15137	GCG			0.572	MST1L-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000400328.1		NM_001271733	
EPB41	2035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	29314195	29314195	+	Silent	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr1:29314195A>G	ENST00000343067.4	+	2	373	c.246A>G	c.(244-246)ctA>ctG	p.L82L	Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000373798.1_Silent_p.L82L|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000398863.2_Silent_p.L82L|EPB41_ENST00000356093.2_Silent_p.L82L|EPB41_ENST00000347529.3_Silent_p.L82L|EPB41_ENST00000373797.1_Silent_p.L82L	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	82					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		TTTCACGACTATTCTCCTCGT	0.448																																					p.L82L													EPB41_ENST00000343067,NS,carcinoma,+2,1	EPB41_ENST00000343067	2	1	0			c.A246G												144.0	135.0	138.0					1																	29314195		2203	4300	6503	SO:0001819	synonymous_variant	2035	exon2			ACGACTATTCTCC	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.246A>G	1.37:g.29314195A>G			315	0	0		401	0.12	47	NM_203343	63	0.14	9	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Silent	SNP	ENST00000343067.4	37	CCDS53288.1																																																																																					0.448	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010312.1		NM_203342	
TPR	7175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186283154	186283154	+	Silent	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr1:186283154C>T	ENST00000367478.4	-	51	7337	c.7041G>A	c.(7039-7041)gtG>gtA	p.V2347V	PRG4_ENST00000367486.3_3'UTR|PRG4_ENST00000367484.3_3'UTR|PRG4_ENST00000445192.2_3'UTR|RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367485.4_3'UTR|PRG4_ENST00000367483.4_3'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2347					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTGCATGGCTCACACCTGTAA	0.294			T	NTRK1	papillary thyroid																																p.V2347V				Dom	yes		1	1q25	7175	translocated promoter region		E	.	.			0			c.G7041A												96.0	92.0	93.0					1																	186283154		1805	4062	5867	SO:0001819	synonymous_variant	7175	exon51			ATGGCTCACACCT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.7041G>A	1.37:g.186283154C>T			84	0	0		105	0.14	15	NM_003292	448	0.17	75	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																					0.294	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086353.2		NM_003292	
NMT2	9397	broad.mit.edu;mdanderson.org	37	10	15210588	15210588	+	Silent	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr10:15210588C>T	ENST00000378165.4	-	1	104	c.24G>A	c.(22-24)gcG>gcA	p.A8A	NMT2_ENST00000535341.1_5'Flank|NMT2_ENST00000378150.1_5'UTR	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	8					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GCTGGCTGGCCGCAGACTCGC	0.731																																					p.A8A	Melanoma(117;1345 1645 4130 12688 30625)												.	NMT2	44		0			c.G24A												59.0	59.0	59.0					10																	15210588		2203	4300	6503	SO:0001819	synonymous_variant	9397	exon1			GCTGGCCGCAGAC	AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.24G>A	10.37:g.15210588C>T			31	0	0		49	0.06	3	NM_004808	39	0.28	11	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Silent	SNP	ENST00000378165.4	37	CCDS7109.1																																																																																					0.731	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046958.2		NM_004808	
CCSER2	54462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	86131820	86131820	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr10:86131820G>A	ENST00000224756.8	+	2	1197	c.1012G>A	c.(1012-1014)Gga>Aga	p.G338R	CCSER2_ENST00000372088.2_Missense_Mutation_p.G338R|CCSER2_ENST00000359979.4_Missense_Mutation_p.G338R	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	338					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											GACAGTTGATGGAAATAAAAA	0.403																																					p.G338R													.	.			0			c.G1012A												110.0	110.0	110.0					10																	86131820		2203	4299	6502	SO:0001583	missense	54462	exon2			GTTGATGGAAATA		CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.1012G>A	10.37:g.86131820G>A	ENSP00000224756:p.Gly338Arg		118	0	0		114	0.15	17	NM_018999	40	0.20	8	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	37	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921553	0.52653	.	.	ENSG00000107771	ENST00000359979;ENST00000224756;ENST00000372088	T;T;T	0.48201	0.82;2.17;2.15	5.73	0.745	0.18359	.	0.705648	0.13435	N	0.388136	T	0.49150	0.1540	L	0.44542	1.39	0.45183	D	0.998196	P;P;P	0.49783	0.773;0.573;0.928	B;B;P	0.53760	0.3;0.219;0.734	T	0.44847	-0.9301	10	0.72032	D	0.01	-1.5013	8.629	0.33908	0.4772:0.0:0.5228:0.0	.	338;338;338	Q9H7U1-3;Q9H7U1;Q9H7U1-2	.;F190B_HUMAN;.	R	338	ENSP00000353068:G338R;ENSP00000224756:G338R;ENSP00000361160:G338R	ENSP00000224756:G338R	G	+	1	0	FAM190B	86121800	0.989000	0.36119	0.952000	0.39060	0.991000	0.79684	0.253000	0.18296	-0.110000	0.12022	0.655000	0.94253	GGA			0.403	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049132.2		NM_018999	
LMNTD2	256329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	557032	557032	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:557032C>T	ENST00000329451.3	-	8	841	c.779G>A	c.(778-780)cGg>cAg	p.R260Q	RP11-496I9.1_ENST00000527620.1_RNA|RP11-496I9.1_ENST00000527113.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		260										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTGTGATGCCGCTCGGAATG	0.677																																					p.R260Q													.	.			0			c.G779A												25.0	27.0	26.0					11																	557032		2193	4296	6489	SO:0001583	missense	256329	exon8			TGATGCCGCTCGG																												ENST00000329451.3:c.779G>A	11.37:g.557032C>T	ENSP00000331167:p.Arg260Gln		41	0	0		37	0.16	6	NM_173573	4	0.25	1		Missense_Mutation	SNP	ENST00000329451.3	37	CCDS7701.1	.	.	.	.	.	.	.	.	.	.	C	9.740	1.164626	0.21538	.	.	ENSG00000185522	ENST00000329451;ENST00000441853	T;T	0.29655	1.56;1.56	3.3	-1.23	0.09465	.	3.162860	0.01176	N	0.006963	T	0.14830	0.0358	N	0.03608	-0.345	0.09310	N	1	B	0.18610	0.029	B	0.08055	0.003	T	0.18023	-1.0350	10	0.25751	T	0.34	-0.0295	8.2164	0.31514	0.0:0.5996:0.0:0.4004	.	260	Q8IXW0	CK035_HUMAN	Q	260;267	ENSP00000331167:R260Q;ENSP00000393529:R267Q	ENSP00000331167:R260Q	R	-	2	0	C11orf35	547032	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.973000	0.03798	-0.222000	0.09958	0.485000	0.47835	CGG			0.677	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254973.2			
DCDC1	341019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	30937241	30937241	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:30937241C>A	ENST00000597505.1	-	25	3469	c.3470G>T	c.(3469-3471)aGt>aTt	p.S1157I	DCDC1_ENST00000339794.5_Missense_Mutation_p.S236I|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTGCAATTTACTATGCTTTGG	0.423																																					p.S264I													.	.			0			c.G791T												95.0	72.0	80.0					11																	30937241		2202	4299	6501	SO:0001583	missense	100506627	exon8			AATTTACTATGCT	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3470G>T	11.37:g.30937241C>A	ENSP00000472625:p.Ser1157Ile		127	0	0		125	0.28	35	NM_020869	0		0	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	C	9.925	1.213288	0.22289	.	.	ENSG00000170959	ENST00000339794	T	0.27256	1.68	5.44	1.2	0.21068	Ricin B lectin (2);	1.406590	0.04254	N	0.339159	T	0.21347	0.0514	L	0.27053	0.805	0.09310	N	1	P	0.44309	0.832	B	0.43623	0.425	T	0.17319	-1.0373	10	0.59425	D	0.04	0.0536	4.5567	0.12140	0.0:0.4328:0.3101:0.2571	.	236	Q6ZRR9	DCDC5_HUMAN	I	236	ENSP00000341700:S236I	ENSP00000341700:S236I	S	-	2	0	DCDC5	30893817	0.000000	0.05858	0.002000	0.10522	0.033000	0.12548	-0.468000	0.06656	0.261000	0.21753	0.655000	0.94253	AGT			0.423	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000463167.1		NM_181807	
FAT3	120114	mdanderson.org	37	11	92257930	92257930	+	Silent	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:92257930G>T	ENST00000298047.6	+	2	3440	c.3423G>T	c.(3421-3423)gtG>gtT	p.V1141V	FAT3_ENST00000525166.1_Silent_p.V991V|FAT3_ENST00000409404.2_Silent_p.V1141V|FAT3_ENST00000541502.1_Silent_p.V1141V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1141	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTGAAGATGTGAATGACAATG	0.468										TCGA Ovarian(4;0.039)																											p.V1141V													.	.			0			c.G3423T												77.0	76.0	76.0					11																	92257930		2051	4209	6260	SO:0001819	synonymous_variant	120114	exon2			AGATGTGAATGAC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3423G>T	11.37:g.92257930G>T			130	0	0		56	0.05	3	NM_001008781	0		0	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																						0.468	FAT3-201	KNOWN	basic	protein_coding	protein_coding				NM_001008781	
CWF19L2	143884	broad.mit.edu;mdanderson.org	37	11	107309827	107309827	+	Nonsense_Mutation	SNP	G	G	T	rs141170726		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:107309827G>T	ENST00000282251.5	-	6	680	c.653C>A	c.(652-654)tCg>tAg	p.S218*	CWF19L2_ENST00000433523.1_Nonsense_Mutation_p.S218*	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	218							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TTTAGTAATCGATGACACACT	0.393																																					p.S218X													CWF19L2_ENST00000282251,NS,carcinoma,+1,2	CWF19L2	135	2	0			c.C653A												80.0	69.0	73.0					11																	107309827		2201	4298	6499	SO:0001587	stop_gained	143884	exon6			GTAATCGATGACA	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.653C>A	11.37:g.107309827G>T	ENSP00000282251:p.Ser218*		80	0.0125	1		40	0.08	3	NM_152434	6	0.00	0	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Nonsense_Mutation	SNP	ENST00000282251.5	37	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586398	0.66105	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	.	.	.	5.45	5.45	0.79879	.	0.320206	0.30940	N	0.008571	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0759	18.6475	0.91416	0.0:0.0:1.0:0.0	.	.	.	.	X	218	.	ENSP00000282251:S218X	S	-	2	0	CWF19L2	106815037	0.991000	0.36638	0.090000	0.20809	0.056000	0.15407	4.847000	0.62867	2.708000	0.92522	0.650000	0.86243	TCG			0.393	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328825.2		NM_152434	
DSCAML1	57453	mdanderson.org	37	11	117651489	117651489	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:117651489A>G	ENST00000321322.6	-	2	264	c.263T>C	c.(262-264)gTa>gCa	p.V88A	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V28A	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	28	Ig-like C2-type 1.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGAGTCATTTACAAAGTAGAG	0.607																																					p.V88A													.	.			0			c.T263C												12.0	12.0	12.0					11																	117651489		2184	4255	6439	SO:0001583	missense	57453	exon2			TCATTTACAAAGT		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.263T>C	11.37:g.117651489A>G	ENSP00000315465:p.Val88Ala		16	0	0		8	0.13	1	NM_020693	1	0.00	0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.627132	0.28978	.	.	ENSG00000177103	ENST00000527706;ENST00000321322	T;T	0.62941	1.55;-0.01	5.1	5.1	0.69264	Immunoglobulin-like (1);	.	.	.	.	T	0.66489	0.2794	L	0.31578	0.945	0.54753	D	0.999982	D	0.69078	0.997	P	0.61397	0.888	T	0.67860	-0.5561	9	0.45353	T	0.12	.	15.2119	0.73230	1.0:0.0:0.0:0.0	.	28	Q8TD84	DSCL1_HUMAN	A	28;88	ENSP00000434335:V28A;ENSP00000315465:V88A	ENSP00000315465:V88A	V	-	2	0	DSCAML1	117156699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.526000	0.81920	2.053000	0.61076	0.460000	0.39030	GTA			0.607	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392907.2		NM_020693	
OR10S1	219873	mdanderson.org	37	11	123848041	123848041	+	Missense_Mutation	SNP	A	A	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr11:123848041A>T	ENST00000531945.1	-	1	447	c.358T>A	c.(358-360)Ttt>Att	p.F120I		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTGGCCAGAAAGTGGAAGCAA	0.542																																					p.F120I													.	.			0			c.T358A												95.0	75.0	82.0					11																	123848041		2202	4299	6501	SO:0001583	missense	219873	exon1			CCAGAAAGTGGAA	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.358T>A	11.37:g.123848041A>T	ENSP00000431914:p.Phe120Ile		91	0	0		53	0.06	3	NM_001004474	0		0	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599931	0.46318	.	.	ENSG00000196248	ENST00000531945	T	0.00414	7.52	4.74	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.160723	0.28865	U	0.013893	T	0.00328	0.0010	L	0.52364	1.645	0.26821	N	0.968786	B	0.27229	0.172	B	0.18871	0.023	T	0.42816	-0.9429	10	0.59425	D	0.04	-16.6231	8.4066	0.32619	0.761:0.0:0.239:0.0	.	120	Q8NGN2	O10S1_HUMAN	I	120	ENSP00000431914:F120I	ENSP00000431914:F120I	F	-	1	0	OR10S1	123353251	0.000000	0.05858	0.999000	0.59377	0.963000	0.63663	-0.623000	0.05546	0.340000	0.23745	0.467000	0.42956	TTT			0.542	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387265.2		NM_001004474	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2908333	2908333	+	Silent	SNP	G	G	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr12:2908333G>C	ENST00000001008.4	+	5	781	c.594G>C	c.(592-594)ctG>ctC	p.L198L	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	198	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			GGGAGAACCTGGATCTGCCTT	0.557																																					p.L198L													.	.			0			c.G594C												96.0	89.0	92.0					12																	2908333		2203	4300	6503	SO:0001819	synonymous_variant	2288	exon5			GAACCTGGATCTG	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.594G>C	12.37:g.2908333G>C			52	0	0		109	0.17	19	NM_002014	2602	0.18	473	D3DUQ1|Q9UCP1|Q9UCV7	Silent	SNP	ENST00000001008.4	37	CCDS8512.1																																																																																					0.557	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206861.1			
NCOR2	9612	mdanderson.org	37	12	124887102	124887102	+	Silent	SNP	C	C	T	rs7488825		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr12:124887102C>T	ENST00000405201.1	-	14	1488	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	NCOR2_ENST00000404621.1_Silent_p.Q495Q|NCOR2_ENST00000429285.2_Silent_p.Q495Q|NCOR2_ENST00000356219.3_Silent_p.Q496Q|NCOR2_ENST00000404121.2_Silent_p.Q66Q|NCOR2_ENST00000397355.1_Silent_p.Q496Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	496	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgttgttgctgctgctgTC	0.627																																					p.Q496Q													.	.			0			c.G1488A												9.0	10.0	9.0					12																	124887102		2049	4171	6220	SO:0001819	synonymous_variant	9612	exon16			TTGTTGCTGCTGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1488G>A	12.37:g.124887102C>T			55	0	0		56	0.09	5	NM_006312	26	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.627	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
USP12	219333	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	27664080	27664081	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	AG	AG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr13:27664080_27664081delAG	ENST00000282344.6	-	6	929_930	c.673_674delCT	c.(673-675)ctgfs	p.L225fs		NM_182488.3	NP_872294.2	O75317	UBP12_HUMAN	ubiquitin specific peptidase 12	225	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		TTCACTGCACAGAGTTTCTGTG	0.322																																					p.225_225del	Ovarian(37;808 911 7590 44442 44991)												.	USP12	35		0			c.674_675del																																									SO:0001589	frameshift_variant	219333	exon6			CTGCACAGAGTTT	AL049221	CCDS31952.1	13q12.13	2010-05-12	2005-08-08	2003-10-08	ENSG00000152484	ENSG00000152484		"""Ubiquitin-specific peptidases"""	20485	protein-coding gene	gene with protein product			"""ubiquitin specific protease 12 like 1"", ""ubiquitin specific protease 12"""	USP12L1		12838346	Standard	NM_182488		Approved		uc001uqy.3	O75317	OTTHUMG00000016626	ENST00000282344.6:c.673_674delCT	13.37:g.27664082_27664083delAG	ENSP00000282344:p.Leu225fs		263	0	0		225	0.18	40	NM_182488	34	0.00	0	A8K0X0|Q5VZV3|Q8TC49	Frame_Shift_Del	DEL	ENST00000282344.6	37	CCDS31952.1																																																																																					0.322	USP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044264.1		NM_182488	
RP11-597A11.1	0	broad.mit.edu	37	14	20122481	20122482	+	RNA	INS	-	-	A	rs368043035		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr14:20122481_20122482insA	ENST00000548261.1	+	0	245																											AAACGAAGTGCAAAAAAAAAAA	0.327																																					.													.	.			0			.																																											0	.			GAAGTGCAAAAAA																													14.37:g.20122492_20122492dupA			6	0	0		9	0.44	4	.	0		0		RNA	INS	ENST00000548261.1	37																																																																																						0.327	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
LTB4R2	56413	mdanderson.org	37	14	24780613	24780613	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr14:24780613C>T	ENST00000528054.1	+	1	2453	c.836C>T	c.(835-837)gCg>gTg	p.A279V	CIDEB_ENST00000555817.1_5'UTR|LTB4R_ENST00000345363.3_5'Flank|LTB4R_ENST00000396789.4_5'Flank|CIDEB_ENST00000336557.5_5'Flank|LTB4R2_ENST00000543919.1_Missense_Mutation_p.A248V|CIDEB_ENST00000258807.5_5'UTR|LTB4R2_ENST00000533293.1_Missense_Mutation_p.A248V			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	279					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		CTTCTGCAGGCGGTCGCAGCG	0.716																																					p.A248V													.	.			0			c.C743T												18.0	22.0	21.0					14																	24780613		2195	4280	6475	SO:0001583	missense	56413	exon2			TGCAGGCGGTCGC	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.836C>T	14.37:g.24780613C>T	ENSP00000432146:p.Ala279Val		18	0	0		23	0.09	2	NM_019839	13	0.00	0	Q5KU28|Q9NPE5	Missense_Mutation	SNP	ENST00000528054.1	37		.	.	.	.	.	.	.	.	.	.	C	2.533	-0.308068	0.05458	.	.	ENSG00000213906	ENST00000528054;ENST00000533293;ENST00000543919;ENST00000530080	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	4.5	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.172727	0.26991	U	0.021467	T	0.15262	0.0368	N	0.14661	0.345	0.09310	N	0.999999	B	0.13145	0.007	B	0.11329	0.006	T	0.34079	-0.9843	10	0.02654	T	1	.	6.9923	0.24761	0.0:0.5895:0.0:0.4105	.	279	Q9NPC1	LT4R2_HUMAN	V	279;248;248;248	ENSP00000432146:A279V;ENSP00000433290:A248V;ENSP00000445772:A248V;ENSP00000434760:A248V	ENSP00000337731:A279V	A	+	2	0	LTB4R2	23850453	0.002000	0.14202	0.125000	0.21846	0.168000	0.22595	-0.243000	0.08915	0.004000	0.14682	0.491000	0.48974	GCG			0.716	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000073194.4			
BCL11B	64919	mdanderson.org	37	14	99641140	99641140	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr14:99641140C>T	ENST00000357195.3	-	4	2042	c.2033G>A	c.(2032-2034)aGc>aAc	p.S678N	BCL11B_ENST00000443726.2_Missense_Mutation_p.S484N|BCL11B_ENST00000345514.2_Missense_Mutation_p.S607N	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	678					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GAGCCCGGGGCTGGGCAGCGG	0.761			T	TLX3	T-ALL																																p.S678N				Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	.			0			c.G2033A												11.0	11.0	11.0					14																	99641140		2115	4113	6228	SO:0001583	missense	64919	exon4			CCGGGGCTGGGCA	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2033G>A	14.37:g.99641140C>T	ENSP00000349723:p.Ser678Asn		25	0	0		20	0.10	2	NM_138576	1	0.00	0	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474695	0.43942	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13089	2.69;2.65;2.62	3.95	3.05	0.35203	.	0.235594	0.30244	N	0.010064	T	0.22627	0.0546	L	0.44542	1.39	0.39947	D	0.974481	D;D	0.58620	0.98;0.983	P;P	0.60609	0.758;0.877	T	0.02047	-1.1223	10	0.23891	T	0.37	-14.8228	12.0783	0.53657	0.0:0.9129:0.0:0.0871	.	607;678	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	N	678;607;484	ENSP00000349723:S678N;ENSP00000280435:S607N;ENSP00000387419:S484N	ENSP00000280435:S607N	S	-	2	0	BCL11B	98710893	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.369000	0.52365	0.757000	0.33036	0.561000	0.74099	AGC			0.761	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000072332.2		NM_138576	
HERC2P3	283755	broad.mit.edu	37	15	20613289	20613292	+	RNA	DEL	AGAA	AGAA	-	rs543661120|rs75930221	byFrequency	TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	AGAA	AGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr15:20613289_20613292delAGAA	ENST00000428453.1	-	0	4041							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						ggaaactgttagaaagagcaaaaa	0.387														257	0.0513179	0.0197	0.0706	5008	,	,		63968	0.0069		0.1024	False		,,,				2504	0.0736				.													.	HERC2P3	53		0			.																																											0	.			ACTGTTAGAAAGA	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20613289_20613292delAGAA			4	0	0		6	0.33	2	.	1	0.00	0		RNA	DEL	ENST00000428453.1	37																																																																																						0.387	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000347772.2		NG_008269	
ATP2A1	487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	28914470	28914470	+	Splice_Site	SNP	T	T	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr16:28914470T>A	ENST00000357084.3	+	20	3129		c.e20+2		ATP2A1_ENST00000395503.4_Splice_Site|ATP2A1_ENST00000536376.1_Splice_Site	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1						apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCCCTGCCGGTGAGGTTTCTT	0.677																																					.													.	.			0			c.2862+2T>A												73.0	70.0	71.0					16																	28914470		2197	4300	6497	SO:0001630	splice_region_variant	487	exon20			TGCCGGTGAGGTT		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2862+2T>A	16.37:g.28914470T>A			46	0	0		51	0.25	13	NM_173201	5	1.00	5	A8K5J9|B3KY17|O14984	Splice_Site	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.265674	0.59431	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000536376	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.794	0.63160	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP2A1	28821971	1.000000	0.71417	0.978000	0.43139	0.585000	0.36419	8.016000	0.88706	2.096000	0.63516	0.459000	0.35465	.			0.677	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254686.2		NM_004320	Intron
ZNF668	79759	mdanderson.org	37	16	31075770	31075770	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr16:31075770T>C	ENST00000538906.1	-	2	795	c.11A>G	c.(10-12)gAg>gGg	p.E4G	ZNF668_ENST00000426488.2_Missense_Mutation_p.E27G|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000300849.4_Missense_Mutation_p.E4G|ZNF668_ENST00000535577.1_Missense_Mutation_p.E4G|ZNF668_ENST00000539836.3_Missense_Mutation_p.E27G|ZNF668_ENST00000394983.2_Missense_Mutation_p.E4G|AC135050.5_ENST00000568708.1_RNA	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						CTCTGCAGCCTCCACTTCCAT	0.597																																					p.E27G	Colon(181;1111 1980 5060 10512 25785)												.	.			0			c.A80G												25.0	31.0	29.0					16																	31075770		2161	4263	6424	SO:0001583	missense	79759	exon3			GCAGCCTCCACTT		CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.11A>G	16.37:g.31075770T>C	ENSP00000440149:p.Glu4Gly		32	0	0		25	0.08	2	NM_001172669	29	0.00	0	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	ENST00000538906.1	37	CCDS10701.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616676	0.46736	.	.	ENSG00000167394	ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849;ENST00000414399;ENST00000442862;ENST00000417935;ENST00000426488	T;T;T;T;T;T;T;T	0.58797	3.05;3.05;3.05;3.05;3.05;0.31;3.03;0.42	5.04	3.93	0.45458	.	0.436137	0.22622	N	0.057681	T	0.40272	0.1110	N	0.19112	0.55	0.32510	N	0.537703	B	0.26935	0.164	B	0.17433	0.018	T	0.50874	-0.8776	10	0.72032	D	0.01	-29.2139	10.2265	0.43229	0.0:0.0:0.3201:0.6799	.	4	Q96K58	ZN668_HUMAN	G	27;4;4;4;4;4;4;4;4	ENSP00000442573:E27G;ENSP00000441349:E4G;ENSP00000440149:E4G;ENSP00000378434:E4G;ENSP00000300849:E4G;ENSP00000412340:E4G;ENSP00000416853:E4G;ENSP00000390671:E4G	ENSP00000300849:E4G	E	-	2	0	ZNF668	30983271	0.441000	0.25626	0.996000	0.52242	0.964000	0.63967	1.927000	0.40094	0.915000	0.36847	0.459000	0.35465	GAG			0.597	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000108516.2		NM_024706	
LDHD	197257	mdanderson.org	37	16	75148547	75148547	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr16:75148547G>A	ENST00000450168.2	-	5	556	c.506C>T	c.(505-507)gCc>gTc	p.A169V	LDHD_ENST00000300051.4_Missense_Mutation_p.A169V	NM_194436.2	NP_919417.1			lactate dehydrogenase D											endometrium(1)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	16						CGCCCCGGTGGCCGCCATGCC	0.716																																					p.A169V													.	.			0			c.C506T												10.0	12.0	11.0					16																	75148547		2077	4055	6132	SO:0001583	missense	197257	exon5			CCGGTGGCCGCCA	AY092767	CCDS10913.1, CCDS45529.1	16q22.3	2011-01-27			ENSG00000166816	ENSG00000166816			19708	protein-coding gene	gene with protein product		607490				12127981	Standard	NM_153486		Approved		uc002fdm.3	Q86WU2	OTTHUMG00000137605	ENST00000450168.2:c.506C>T	16.37:g.75148547G>A	ENSP00000417011:p.Ala169Val		12	0	0		23	0.09	2	NM_194436	3	0.00	0		Missense_Mutation	SNP	ENST00000450168.2	37	CCDS45529.1	.	.	.	.	.	.	.	.	.	.	G	32	5.126900	0.94429	.	.	ENSG00000166816	ENST00000450168;ENST00000300051	T;T	0.51817	0.69;0.69	5.38	4.37	0.52481	FAD-linked oxidase, FAD-binding, subdomain 2 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.111999	0.64402	D	0.000013	T	0.80281	0.4594	H	0.98351	4.21	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	D	0.87929	0.2709	10	0.87932	D	0	-31.5389	15.1995	0.73122	0.0:0.1414:0.8586:0.0	.	169;169	Q86WU2-2;Q86WU2	.;LDHD_HUMAN	V	169	ENSP00000417011:A169V;ENSP00000300051:A169V	ENSP00000300051:A169V	A	-	2	0	LDHD	73706048	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	8.338000	0.90038	2.510000	0.84645	0.462000	0.41574	GCC			0.716	LDHD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434651.1		NM_153486	
PRDM7	11105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	90124710	90124710	+	Missense_Mutation	SNP	C	C	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr16:90124710C>G	ENST00000449207.2	-	10	1485	c.1466G>C	c.(1465-1467)gGt>gCt	p.G489A	PRDM7_ENST00000407825.1_3'UTR|PRDM7_ENST00000325921.6_3'UTR	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	489					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)	p.G489A(1)		lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		AGAGTTTGGACCTTTCTTTGA	0.473																																					p.G489A													PRDM7_ENST00000449207,NS,carcinoma,0,1	PRDM7_ENST00000449207	0	1	1	Substitution - Missense(1)	breast(1)	c.G1466C												49.0	52.0	51.0					16																	90124710		2198	4300	6498	SO:0001583	missense	11105	exon10			TTTGGACCTTTCT	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.1466G>C	16.37:g.90124710C>G	ENSP00000396732:p.Gly489Ala		96	0	0		97	0.33	32	NM_001098173	2	1.00	2	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	C	8.291	0.817671	0.16607	.	.	ENSG00000126856	ENST00000449207	T	0.15603	2.41	2.72	-0.823	0.10815	.	.	.	.	.	T	0.06234	0.0161	N	0.08118	0	0.18873	N	0.999988	B	0.29378	0.243	B	0.26094	0.066	T	0.38457	-0.9660	8	.	.	.	-2.6514	2.8206	0.05470	0.2175:0.5022:0.0:0.2803	.	489	Q9NQW5	PRDM7_HUMAN	A	489	ENSP00000396732:G489A	.	G	-	2	0	PRDM7	88652211	0.000000	0.05858	0.002000	0.10522	0.070000	0.16714	-0.879000	0.04188	-0.288000	0.09051	-0.339000	0.08088	GGT			0.473	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000420560.1			
RABEP1	9135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	5212059	5212059	+	Silent	SNP	T	T	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:5212059T>C	ENST00000546142.2	+	2	292	c.105T>C	c.(103-105)ctT>ctC	p.L35L	RABEP1_ENST00000341923.6_Silent_p.L35L|RABEP1_ENST00000537505.1_Intron|RABEP1_ENST00000408982.2_Silent_p.L35L|RABEP1_ENST00000262477.6_Silent_p.L35L			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	35					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AACAGCAGCTTGAACAAGAAT	0.363																																					p.L35L													.	.			0			c.T105C												57.0	54.0	55.0					17																	5212059		1813	4073	5886	SO:0001819	synonymous_variant	9135	exon2			GCAGCTTGAACAA	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.105T>C	17.37:g.5212059T>C			430	0	0		382	0.15	56	NM_004703	45	0.27	12	B2RAG7|O95369|Q8IVX3	Silent	SNP	ENST00000546142.2	37	CCDS45592.1																																																																																					0.363	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439349.1		NM_004703	
GPS2	2874	mdanderson.org	37	17	7217005	7217005	+	Silent	SNP	T	T	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:7217005T>A	ENST00000380728.2	-	7	816	c.516A>T	c.(514-516)gcA>gcT	p.A172A	RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000389167.5_Silent_p.A172A|GPS2_ENST00000391950.3_Silent_p.A172A			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	172					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CTGGTGTCCCTGCAAAAGCAG	0.552											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A172A													.	.			0			c.A516T												84.0	80.0	82.0					17																	7217005		2203	4300	6503	SO:0001819	synonymous_variant	2874	exon7			TGTCCCTGCAAAA	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.516A>T	17.37:g.7217005T>A			89	0	0	640	51	0.08	4	NM_004489	208	0.00	0	B4DXA1|Q6FHM8	Silent	SNP	ENST00000380728.2	37	CCDS11100.1																																																																																					0.552	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000220048.4		NM_004489	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		257	0.046692607	12		207	0.05	11	NM_145301	43	0.35	15	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
FLJ36000	284124	hgsc.bcm.edu	37	17	21904869	21904869	+	lincRNA	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:21904869A>G	ENST00000581223.2	+	0	0					NR_027084.1																						GGAGACGGCAACAAGCCCCGT	0.602																																					.													.	.			0			.																																											0	.			ACGGCAACAAGCC																													17.37:g.21904869A>G			74	0	0		57	0.14	8	.	7	0.00	0		RNA	SNP	ENST00000581223.2	37																																																																																						0.602	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
SPAG5	10615	mdanderson.org	37	17	26912638	26912638	+	Missense_Mutation	SNP	C	C	T	rs146987463		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:26912638C>T	ENST00000321765.5	-	8	2106	c.1774G>A	c.(1774-1776)Gcc>Acc	p.A592T		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	592	Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CGCTGGCTGGCGTGTGCACAG	0.542																																					p.A592T													.	.			0			c.G1774A							C	THR/ALA	0,4406		0,0,2203	132.0	127.0	129.0		1774	1.3	0.7	17	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	missense	SPAG5	NM_006461.3	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	592/1194	26912638	1,13005	2203	4300	6503	SO:0001583	missense	10615	exon8			GGCTGGCGTGTGC	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.1774G>A	17.37:g.26912638C>T	ENSP00000323300:p.Ala592Thr		58	0	0		52	0.06	3	NM_006461	137	0.00	0	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.516991	0.44763	0.0	1.16E-4	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	6.03	1.32	0.21799	.	0.548518	0.17847	N	0.160005	T	0.20333	0.0489	L	0.32530	0.975	0.22684	N	0.99885	D	0.55605	0.972	P	0.45099	0.469	T	0.14924	-1.0455	9	0.13470	T	0.59	-2.3061	6.8802	0.24168	0.5829:0.3282:0.0:0.0889	.	592	Q96R06	SPAG5_HUMAN	T	592;89	.	ENSP00000323300:A592T	A	-	1	0	SPAG5	23936765	0.253000	0.23982	0.679000	0.29978	0.995000	0.86356	0.373000	0.20484	0.360000	0.24265	0.655000	0.94253	GCC	0		0.542	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390564.2		NM_006461	
TBC1D29	26083	hgsc.bcm.edu	37	17	28890347	28890347	+	Silent	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:28890347A>G	ENST00000580161.1	+	6	2854	c.357A>G	c.(355-357)caA>caG	p.Q119Q	TBC1D29_ENST00000579181.1_Silent_p.Q119Q|TBC1D29_ENST00000584297.1_3'UTR|RP11-218M11.1_ENST00000563063.1_lincRNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	119							Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				TGCCAGGACAACAAGCCTTGA	0.552																																					p.Q119Q													.	.			0			c.A357G												71.0	63.0	66.0					17																	28890347		2203	4300	6503	SO:0001819	synonymous_variant	26083	exon5			AGGACAACAAGCC	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.357A>G	17.37:g.28890347A>G			156	0	0		95	0.04	4	NM_015594	5	0.00	0		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																					0.552	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000443632.1		NM_015594	
LRRC37BP1	147172	broad.mit.edu	37	17	28960373	28960381	+	RNA	DEL	GAACAGAAT	GAACAGAAT	-			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	GAACAGAAT	GAACAGAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:28960373_28960381delGAACAGAAT	ENST00000417404.1	+	0	1234_1242									leucine rich repeat containing 37B pseudogene 1																		TGAGAACATGGAACAGAATGAACAGAAAG	0.435																																					.													.	.			0			.																																											0	.			AACATGGAACAGA	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28960373_28960381delGAACAGAAT			210	0	0		179	0.10	18	.	28	0.00	0		RNA	DEL	ENST00000417404.1	37																																																																																						0.435	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
CDK12	51755	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	37627847	37627850	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	ACTC	ACTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:37627847_37627850delACTC	ENST00000447079.4	+	2	1795_1798	c.1762_1765delACTC	c.(1762-1767)actcacfs	p.TH588fs	CDK12_ENST00000430627.2_Frame_Shift_Del_p.TH588fs	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	588					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GCCCCCTTCTACTCACTCAAAGAC	0.5			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.587_588del				Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	161		0			c.1761_1764del																																									SO:0001589	frameshift_variant	51755	exon2			CCTTCTACTCACT	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1762_1765delACTC	17.37:g.37627851_37627854delACTC	ENSP00000398880:p.Thr588fs		242	0	0		273	0.31	85	NM_016507	44	0.00	0	A7E2B2|B4DYX4|B9EIQ6|O94978	Frame_Shift_Del	DEL	ENST00000447079.4	37	CCDS11337.1																																																																																					0.500	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256941.4		NM_016507	
KRT19	3880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39680453	39680453	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:39680453G>A	ENST00000361566.3	-	5	950	c.890C>T	c.(889-891)aCt>aTt	p.T297I	KRT15_ENST00000254043.3_5'Flank|KRT15_ENST00000393976.2_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	297	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				CCGCAGGTCAGTAACCTCGGA	0.577																																					p.T297I													.	.			0			c.C890T												50.0	52.0	52.0					17																	39680453		2203	4300	6503	SO:0001583	missense	3880	exon5			AGGTCAGTAACCT		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.890C>T	17.37:g.39680453G>A	ENSP00000355124:p.Thr297Ile		140	0	0		113	0.27	30	NM_002276	9	0.44	4	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	ENST00000361566.3	37	CCDS11399.1	.	.	.	.	.	.	.	.	.	.	G	8.460	0.855080	0.17106	.	.	ENSG00000171345	ENST00000361566	T	0.78364	-1.17	5.26	4.29	0.51040	Prefoldin (1);Filament (1);	0.000000	0.48286	D	0.000182	D	0.84234	0.5427	M	0.71871	2.18	0.47698	D	0.999497	D;D	0.64830	0.994;0.993	D;D	0.68943	0.912;0.961	T	0.81955	-0.0696	10	0.06236	T	0.91	.	15.9924	0.80217	0.0:0.1349:0.8651:0.0	.	460;297	B4DE59;P08727	.;K1C19_HUMAN	I	297	ENSP00000355124:T297I	ENSP00000355124:T297I	T	-	2	0	KRT19	36933979	0.998000	0.40836	0.819000	0.32651	0.167000	0.22549	2.649000	0.46656	1.212000	0.43366	-0.257000	0.10917	ACT			0.577	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257285.1		NM_002276	
KRT9	3857	broad.mit.edu	37	17	39728194	39728194	+	Silent	SNP	A	A	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:39728194A>C	ENST00000246662.4	-	1	116	c.51T>G	c.(49-51)ggT>ggG	p.G17G	KRT9_ENST00000588431.1_Intron	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	17	Head.|Poly-Gly.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				CGCCCCCGCCACCCCCGCCGC	0.642																																					p.G17G													.	KRT9	78		0			c.T51G																																									SO:0001819	synonymous_variant	3857	exon1			CCCGCCACCCCCG		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.51T>G	17.37:g.39728194A>C			40	0.325	13		42	0.40	17	NM_000226	0		0	O00109|Q0IJ47|Q14665	Silent	SNP	ENST00000246662.4	37	CCDS32654.1																																																																																					0.642	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257707.1		NM_000226	
NAGLU	4669	mdanderson.org	37	17	40696174	40696174	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:40696174G>T	ENST00000225927.2	+	6	2251	c.2150G>T	c.(2149-2151)aGc>aTc	p.S717I	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	717					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	AGGTACCCCAGCCAGCCGCGA	0.567																																					p.S717I													.	.			0			c.G2150T												41.0	40.0	40.0					17																	40696174		2203	4300	6503	SO:0001583	missense	4669	exon6			ACCCCAGCCAGCC		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.2150G>T	17.37:g.40696174G>T	ENSP00000225927:p.Ser717Ile		38	0	0		49	0.06	3	NM_000263	73	0.00	0		Missense_Mutation	SNP	ENST00000225927.2	37	CCDS11427.1	.	.	.	.	.	.	.	.	.	.	G	7.128	0.579337	0.13686	.	.	ENSG00000108784	ENST00000225927;ENST00000377405	D	0.98633	-5.04	5.07	-5.06	0.02946	Alpha-N-acetylglucosaminidase, C-terminal (1);	0.382986	0.31279	N	0.007937	D	0.93890	0.8045	L	0.36672	1.1	0.19775	N	0.99996	B	0.10296	0.003	B	0.12837	0.008	D	0.87173	0.2222	10	0.20046	T	0.44	-8.1757	4.5236	0.11971	0.0725:0.3666:0.2863:0.2747	.	717	P54802	ANAG_HUMAN	I	717;393	ENSP00000225927:S717I	ENSP00000225927:S717I	S	+	2	0	NAGLU	37949700	0.002000	0.14202	0.057000	0.19452	0.642000	0.38348	0.921000	0.28718	-0.308000	0.08792	0.561000	0.74099	AGC			0.567	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450385.1		NM_000263	
ERN1	2081	mdanderson.org	37	17	62144207	62144207	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:62144207G>T	ENST00000433197.3	-	8	761	c.666C>A	c.(664-666)taC>taA	p.Y222*	ERN1_ENST00000577567.1_5'Flank	NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						CAGGGGAGGCGTAGTTTTGGA	0.537																																					p.Y222X													.	.			0			c.C666A												70.0	74.0	73.0					17																	62144207		2145	4249	6394	SO:0001587	stop_gained	2081	exon8			GGAGGCGTAGTTT	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.666C>A	17.37:g.62144207G>T	ENSP00000401445:p.Tyr222*		122	0	0		132	0.04	5	NM_001433	4	0.00	0		Nonsense_Mutation	SNP	ENST00000433197.3	37	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	G	36	5.771728	0.96922	.	.	ENSG00000178607	ENST00000433197	.	.	.	5.57	-7.2	0.01495	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-14.7589	18.8112	0.92058	0.4028:0.0:0.5972:0.0	.	.	.	.	X	222	.	ENSP00000401445:Y222X	Y	-	3	2	ERN1	59497939	0.920000	0.31207	0.747000	0.31113	0.992000	0.81027	0.044000	0.13992	-1.602000	0.01599	-0.258000	0.10820	TAC			0.537	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443734.2		NM_001433	
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.			0			.																																											0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G			93	0	0		104	0.03	3	.	44	0.00	0		RNA	SNP	ENST00000430983.1	37																																																																																						0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000255102.1		NM_153032	
SGSH	6448	mdanderson.org	37	17	78195433	78195433	+	5'Flank	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr17:78195433G>T	ENST00000326317.6	-	0	0				SGSH_ENST00000572208.1_5'Flank|SLC26A11_ENST00000546047.2_Missense_Mutation_p.C25F|SGSH_ENST00000534910.1_5'Flank|SLC26A11_ENST00000572725.1_Missense_Mutation_p.C25F|SLC26A11_ENST00000571602.1_3'UTR|SLC26A11_ENST00000361193.3_Missense_Mutation_p.C25F|SGSH_ENST00000570923.1_5'Flank|SLC26A11_ENST00000411502.3_Missense_Mutation_p.C25F	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GCCTGCTGCTGCTCCCCTGCG	0.692																																					p.C25F													.	.			0			c.G74T												19.0	20.0	20.0					17																	78195433		2200	4297	6497	SO:0001631	upstream_gene_variant	284129	exon3			GCTGCTGCTCCCC	BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688			17.37:g.78195433G>T	Exception_encountered		24	0	0		29	0.14	4	NM_173626	37	0.00	0	A8K5E2	Missense_Mutation	SNP	ENST00000326317.6	37	CCDS11770.1	.	.	.	.	.	.	.	.	.	.	g	11.08	1.532943	0.27387	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.94232	-3.38;-3.38;-3.38	4.1	3.09	0.35607	.	0.096340	0.64402	D	0.000001	D	0.82508	0.5052	N	0.08118	0	0.54753	D	0.999981	B	0.12013	0.005	B	0.06405	0.002	T	0.77281	-0.2646	10	0.37606	T	0.19	-18.7518	7.1297	0.25493	0.0916:0.0:0.7412:0.1672	.	25	Q86WA9	S2611_HUMAN	F	25	ENSP00000403998:C25F;ENSP00000440724:C25F;ENSP00000355384:C25F	ENSP00000355384:C25F	C	+	2	0	SLC26A11	75810028	1.000000	0.71417	0.997000	0.53966	0.077000	0.17291	3.315000	0.51951	2.104000	0.64026	0.486000	0.48141	TGC			0.692	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437695.1		NM_000199	
TXNDC2	84203	mdanderson.org	37	18	9887407	9887407	+	Missense_Mutation	SNP	G	G	A	rs148775952		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr18:9887407G>A	ENST00000306084.6	+	2	1130	c.931G>A	c.(931-933)Gag>Aag	p.E311K	TXNDC2_ENST00000536353.2_Intron|TXNDC2_ENST00000357775.5_Missense_Mutation_p.E244K	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	311	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CCAGCCCAAGGAGGGTGACAT	0.597																																					p.E311K													.	.			0			c.G931A												126.0	122.0	124.0					18																	9887407		2203	4300	6503	SO:0001583	missense	84203	exon2			CCCAAGGAGGGTG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.931G>A	18.37:g.9887407G>A	ENSP00000304908:p.Glu311Lys		99	0.0101010101	1		113	0.05	6	NM_001098529	0		0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|-	12.62|12.62	1.993752|1.993752	0.35131|0.35131	.|.	.|.	ENSG00000168454|ENSG00000168454	ENST00000426718|ENST00000357775;ENST00000306084	.|T;T	.|0.10668	.|2.85;2.85	4.52|4.52	-4.64|-4.64	0.03349|0.03349	.|.	.|1.181070	.|0.06372	.|N	.|0.713675	.|T	.|0.13114	.|0.0318	L|L	0.52011|0.52011	1.625|1.625	0.09310|0.09310	N|N	1|1	.|P	.|0.39862	.|0.692	.|B	.|0.39465	.|0.3	.|T	.|0.24799	.|-1.0150	.|9	.|.	.|.	.|.	.|7.1303	16.7776|16.7776	0.85555|0.85555	0.0:0.1233:0.8005:0.0762|0.0:0.1233:0.8005:0.0762	.|.	.|311	.|Q86VQ3	.|TXND2_HUMAN	.|K	-1|244;311	.|ENSP00000350419:E244K;ENSP00000304908:E311K	.|.	.|E	+|+	.|1	.|0	TXNDC2|TXNDC2	9877407|9877407	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.974000|-0.974000	0.03794|0.03794	-1.039000|-1.039000	0.03275|0.03275	-0.969000|-0.969000	0.02612|0.02612	.|GAG			0.597	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254487.1			
MUM1	84939	mdanderson.org	37	19	1360218	1360218	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:1360218G>T	ENST00000415183.3	+	4	327	c.301G>T	c.(301-303)Gag>Tag	p.E101*	MUM1_ENST00000311401.5_Nonsense_Mutation_p.E32*|MUM1_ENST00000591806.1_Nonsense_Mutation_p.E101*|MUM1_ENST00000344663.3_Nonsense_Mutation_p.E101*			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	100					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTTCTGAGCGAGGGCTCGAT	0.592											OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E101X													.	.			0			c.G301T												91.0	88.0	89.0					19																	1360218		2203	4300	6503	SO:0001587	stop_gained	84939	exon5			CTGAGCGAGGGCT	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.301G>T	19.37:g.1360218G>T	ENSP00000394925:p.Glu101*		78	0	0	595	104	0.05	5	NM_032853	176	0.00	0	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Nonsense_Mutation	SNP	ENST00000415183.3	37		.	.	.	.	.	.	.	.	.	.	G	21.8	4.199896	0.79015	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183;ENST00000542512	.	.	.	4.7	1.17	0.20885	.	0.177626	0.37437	N	0.002094	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	6.8311	0.23911	0.0953:0.3393:0.5654:0.0	.	.	.	.	X	101;32;101;30	.	ENSP00000309135:E32X	E	+	1	0	MUM1	1311218	0.001000	0.12720	0.002000	0.10522	0.000000	0.00434	0.070000	0.14573	0.582000	0.29556	-0.136000	0.14681	GAG			0.592	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000449510.1		NM_032853	
APBA3	9546	mdanderson.org	37	19	3751225	3751225	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:3751225C>T	ENST00000316757.3	-	10	1818	c.1618G>A	c.(1618-1620)Gcc>Acc	p.A540T	AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	540	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGATGCGGGCGTGTGGCGTG	0.706																																					p.A540T													.	.			0			c.G1618A												14.0	13.0	13.0					19																	3751225		2153	4213	6366	SO:0001583	missense	9546	exon10			TGCGGGCGTGTGG	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1618G>A	19.37:g.3751225C>T	ENSP00000315136:p.Ala540Thr		25	0	0		41	0.07	3	NM_004886	60	0.00	0	O60483|Q9UPZ2	Missense_Mutation	SNP	ENST00000316757.3	37	CCDS12110.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575685	0.45902	.	.	ENSG00000011132	ENST00000316757	T	0.42131	0.98	4.45	4.45	0.53987	PDZ/DHR/GLGF (4);	0.164651	0.40469	N	0.001092	T	0.34424	0.0897	L	0.29908	0.895	0.46222	D	0.998933	P	0.46142	0.873	B	0.40636	0.335	T	0.32798	-0.9893	10	0.59425	D	0.04	.	16.1048	0.81213	0.0:1.0:0.0:0.0	.	540	O96018	APBA3_HUMAN	T	540	ENSP00000315136:A540T	ENSP00000315136:A540T	A	-	1	0	APBA3	3702225	1.000000	0.71417	0.408000	0.26446	0.068000	0.16541	5.663000	0.68038	2.028000	0.59812	0.561000	0.74099	GCC			0.706	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453634.2			
DNM2	1785	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10940946	10940946	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:10940946G>T	ENST00000355667.6	+	20	2515	c.2435G>T	c.(2434-2436)cGg>cTg	p.R812L	DNM2_ENST00000359692.6_Missense_Mutation_p.R808L|DNM2_ENST00000314646.5_Missense_Mutation_p.R812L|DNM2_ENST00000585892.1_Missense_Mutation_p.R812L|DNM2_ENST00000389253.4_Missense_Mutation_p.R812L|DNM2_ENST00000408974.4_Missense_Mutation_p.R808L	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	812	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			ATCCCATCCCGGCCTGGACCC	0.697			"""F, N, Splice, Mis, O"""		ETP ALL																																p.R812L				Rec	yes		19	19p13.2	1785	dynamin 2		L	.	.			0			c.G2435T												69.0	72.0	71.0					19																	10940946		2203	4300	6503	SO:0001583	missense	1785	exon20			CATCCCGGCCTGG		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.2435G>T	19.37:g.10940946G>T	ENSP00000347890:p.Arg812Leu		96	0	0		177	0.11	20	NM_001005361	319	0.16	52	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	37	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	g	18.27	3.587361	0.66105	.	.	ENSG00000079805	ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	T;T;T	0.61274	0.12;0.12;0.12	5.12	5.12	0.69794	.	0.068830	0.64402	D	0.000020	T	0.76278	0.3965	M	0.75615	2.305	0.52099	D	0.999947	D;B;D;D;D;D;D	0.69078	0.997;0.369;0.996;0.987;0.997;0.995;0.987	D;B;P;D;D;D;D	0.80764	0.994;0.097;0.762;0.931;0.986;0.968;0.931	T	0.79596	-0.1738	10	0.87932	D	0	-16.2448	17.3501	0.87321	0.0:0.0:1.0:0.0	.	406;812;541;808;808;812;812	Q8N1K8;F5H4R9;B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;.;.;DYN2_HUMAN;.	L	808;808;812;812;812	ENSP00000386192:R808L;ENSP00000373905:R812L;ENSP00000313164:R812L	ENSP00000313164:R812L	R	+	2	0	DNM2	10801946	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	8.584000	0.90798	2.403000	0.81681	0.550000	0.68814	CGG			0.697	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452592.1		NM_004945	
ZNF85	7639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21132152	21132152	+	Missense_Mutation	SNP	A	A	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:21132152A>T	ENST00000328178.8	+	4	945	c.832A>T	c.(832-834)Ata>Tta	p.I278L	ZNF85_ENST00000345030.6_Missense_Mutation_p.I245L|ZNF85_ENST00000601023.1_Missense_Mutation_p.I219L	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	278					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TACCCATAAGATAATTCATAC	0.343																																					p.I308L													.	.			0			c.A922T												26.0	29.0	28.0					19																	21132152		2199	4289	6488	SO:0001583	missense	7639	exon5			CATAAGATAATTC	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.832A>T	19.37:g.21132152A>T	ENSP00000329793:p.Ile278Leu		69	0	0		99	0.14	14	NM_001256171	40	0.53	21	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	2.344	-0.350528	0.05173	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.18016	2.24;2.24	1.35	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06462	0.0166	N	0.01277	-0.915	0.80722	D	1	P;B;B	0.36010	0.532;0.421;0.162	B;B;B	0.42087	0.281;0.121;0.375	T	0.32134	-0.9918	9	0.42905	T	0.14	.	4.6815	0.12738	0.72:0.0:0.0:0.28	.	245;219;278	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	L	278;245;153	ENSP00000329793:I278L;ENSP00000342340:I245L	ENSP00000329793:I278L	I	+	1	0	ZNF85	20923992	0.000000	0.05858	0.069000	0.20011	0.028000	0.11728	-0.898000	0.04105	0.569000	0.29329	0.379000	0.24179	ATA			0.343	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463430.1		NM_003429	
RHPN2	85415	mdanderson.org	37	19	33535186	33535186	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:33535186G>A	ENST00000254260.3	-	2	189	c.154C>T	c.(154-156)Cgg>Tgg	p.R52W	RHPN2_ENST00000400226.4_5'UTR	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	52	Interaction with Rho.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GTCCTCATCCGCACGGCTTTC	0.517																																					p.R52W													.	.			0			c.C154T												105.0	98.0	101.0					19																	33535186		2203	4300	6503	SO:0001583	missense	85415	exon2			TCATCCGCACGGC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.154C>T	19.37:g.33535186G>A	ENSP00000254260:p.Arg52Trp		106	0	0		146	0.03	5	NM_033103	23	0.00	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872578	0.72180	.	.	ENSG00000131941	ENST00000254260	T	0.36520	1.25	5.54	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.58793	0.2147	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63611	-0.6598	10	0.87932	D	0	.	12.3475	0.55130	0.0:0.0:0.5837:0.4162	.	52	Q8IUC4	RHPN2_HUMAN	W	52	ENSP00000254260:R52W	ENSP00000254260:R52W	R	-	1	2	RHPN2	38227026	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.128000	0.42045	1.461000	0.47929	0.561000	0.74099	CGG			0.517	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450828.2		NM_033103	
FFAR1	2864	mdanderson.org	37	19	35843316	35843316	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:35843316G>T	ENST00000246553.2	+	1	872	c.862G>T	c.(862-864)Gtg>Ttg	p.V288L		NM_005303.2	NP_005294.1	O14842	FFAR1_HUMAN	free fatty acid receptor 1	288					energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|positive regulation of GTPase activity (GO:0043547)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Icosapent(DB00159)	CCTGAAGACAGTGTGTGCGGC	0.647																																					p.V288L													.	.			0			c.G862T												15.0	9.0	11.0					19																	35843316		2147	4195	6342	SO:0001583	missense	2864	exon1			AAGACAGTGTGTG	AF024687	CCDS12458.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000126266	ENSG00000126266		"""GPCR / Class A : Fatty acid receptors"""	4498	protein-coding gene	gene with protein product		603820	"""G protein-coupled receptor 40"""	GPR40		15684720	Standard	NM_005303		Approved	FFA1R	uc002nzc.2	O14842		ENST00000246553.2:c.862G>T	19.37:g.35843316G>T	ENSP00000246553:p.Val288Leu		31	0	0		36	0.08	3	NM_005303	0		0	Q0VAS2|Q4VBL4	Missense_Mutation	SNP	ENST00000246553.2	37	CCDS12458.1	.	.	.	.	.	.	.	.	.	.	G	9.411	1.080525	0.20309	.	.	ENSG00000126266	ENST00000246553	T	0.20881	2.04	4.36	-0.467	0.12150	.	2.099990	0.03250	U	0.181677	T	0.10723	0.0262	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.19484	-1.0304	10	0.08599	T	0.76	1.4404	4.3076	0.10955	0.2148:0.0:0.5597:0.2255	.	288	O14842	FFAR1_HUMAN	L	288	ENSP00000246553:V288L	ENSP00000246553:V288L	V	+	1	0	FFAR1	40535156	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.242000	0.08928	-0.216000	0.10048	0.561000	0.74099	GTG			0.647	FFAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466112.2		NM_005303	
SIRT2	22933	broad.mit.edu	37	19	39369886	39369886	+	Missense_Mutation	SNP	A	A	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:39369886A>C	ENST00000249396.7	-	16	1380	c.1079T>G	c.(1078-1080)gTc>gGc	p.V360G	RINL_ENST00000591812.1_5'Flank|SIRT2_ENST00000392081.2_Missense_Mutation_p.V323G|RINL_ENST00000340740.3_5'Flank|SIRT2_ENST00000358931.5_3'UTR|RINL_ENST00000598904.1_5'Flank	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2	360					autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			GGGGTTGGGGACCCCCGCCCC	0.617																																					p.V360G													.	SIRT2	29		0			c.T1079G												48.0	48.0	48.0					19																	39369886		2203	4300	6503	SO:0001583	missense	22933	exon16			TTGGGGACCCCCG	AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.1079T>G	19.37:g.39369886A>C	ENSP00000249396:p.Val360Gly		42	0.0952380952	4		69	0.16	11	NM_012237	56	0.02	1	A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Missense_Mutation	SNP	ENST00000249396.7	37	CCDS12523.1	.	.	.	.	.	.	.	.	.	.	A	3.084	-0.188327	0.06299	.	.	ENSG00000068903	ENST00000249396;ENST00000392081	T;T	0.30714	1.52;1.53	5.1	-3.47	0.04753	.	3.863390	0.01454	U	0.015610	T	0.12561	0.0305	N	0.04959	-0.14	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.08680	-1.0710	10	0.19590	T	0.45	-4.8064	1.8765	0.03219	0.1503:0.3212:0.2819:0.2465	.	323;360;340	Q8IXJ6-2;Q8IXJ6;Q8IXJ6-3	.;SIRT2_HUMAN;.	G	360;323	ENSP00000249396:V360G;ENSP00000375931:V323G	ENSP00000249396:V360G	V	-	2	0	SIRT2	44061726	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-0.852000	0.04308	-0.676000	0.05238	-0.407000	0.06327	GTC			0.617	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000318278.1			
KLK11	11012	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51526395	51526395	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr19:51526395T>C	ENST00000594768.1	-	5	834	c.649A>G	c.(649-651)Acc>Gcc	p.T217A	KLK11_ENST00000453757.3_Missense_Mutation_p.T185A|KLK11_ENST00000594458.1_5'Flank|KLK11_ENST00000391804.3_Missense_Mutation_p.T210A|KLK11_ENST00000319720.7_Missense_Mutation_p.T185A|KLK10_ENST00000391805.1_5'Flank|KLK11_ENST00000600362.1_Missense_Mutation_p.T44A	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	217	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CACACCATGGTGTCTGTGATG	0.577																																					p.T217A													.	KLK11	28		0			c.A649G												145.0	91.0	109.0					19																	51526395		2203	4300	6503	SO:0001583	missense	11012	exon5			CCATGGTGTCTGT	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.649A>G	19.37:g.51526395T>C	ENSP00000473047:p.Thr217Ala		83	0.0120481928	1		147	0.10	14	NM_144947	0		0	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	CCDS12818.1	.	.	.	.	.	.	.	.	.	.	t	13.02	2.113504	0.37339	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	D;D;D	0.93247	-3.19;-3.19;-3.19	4.01	4.01	0.46588	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37437	U	0.002085	D	0.89403	0.6705	L	0.39898	1.24	0.26381	N	0.976739	B;P	0.37370	0.325;0.592	B;B	0.41135	0.283;0.348	T	0.80322	-0.1431	10	0.18276	T	0.48	.	10.9603	0.47381	0.0:0.0:0.0:1.0	.	217;210	Q9UBX7;Q8IXD7	KLK11_HUMAN;.	A	210;185;185;217	ENSP00000375680:T210A;ENSP00000324269:T185A;ENSP00000413958:T185A	ENSP00000324269:T185A	T	-	1	0	KLK11	56218207	0.342000	0.24809	0.959000	0.39883	0.713000	0.41058	1.311000	0.33562	1.681000	0.50988	0.369000	0.22263	ACC			0.577	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000464314.2		NM_006853	
EML6	400954	broad.mit.edu	37	2	55106753	55106753	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr2:55106753A>G	ENST00000356458.6	+	16	2934	c.2414A>G	c.(2413-2415)aAg>aGg	p.K805R		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	805						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GACTGGAAAAAGGGAGAAAAG	0.403																																					p.K805R													.	EML6	85		0			c.A2414G												221.0	202.0	207.0					2																	55106753		692	1591	2283	SO:0001583	missense	400954	exon16			GGAAAAAGGGAGA		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.2414A>G	2.37:g.55106753A>G	ENSP00000348842:p.Lys805Arg		226	0	0		222	0.02	4	NM_001039753	0		0	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.949118	0.34377	.	.	ENSG00000214595	ENST00000356458	T	0.04862	3.54	5.64	4.49	0.54785	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.32970	U	0.005440	T	0.07234	0.0183	L	0.45470	1.425	0.39951	D	0.974533	B	0.13594	0.008	B	0.17979	0.02	T	0.21655	-1.0239	10	0.26408	T	0.33	.	11.0079	0.47646	0.9268:0.0:0.0732:0.0	.	805	Q6ZMW3	EMAL6_HUMAN	R	805	ENSP00000348842:K805R	ENSP00000348842:K805R	K	+	2	0	EML6	54960257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.539000	0.53604	0.985000	0.38656	0.482000	0.46254	AAG			0.403	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000324997.3		XM_001725002	
GPR39	2863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	133174783	133174783	+	Silent	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr2:133174783G>A	ENST00000329321.3	+	1	637	c.168G>A	c.(166-168)caG>caA	p.Q56Q		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	56					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGTCACCCAGGTGCTGCAGA	0.537																																					p.Q56Q													.	.			0			c.G168A												173.0	154.0	160.0					2																	133174783		2203	4300	6503	SO:0001819	synonymous_variant	2863	exon1			CACCCAGGTGCTG	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.168G>A	2.37:g.133174783G>A			154	0	0		186	0.11	21	NM_001508	57	0.12	7	B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	ENST00000329321.3	37	CCDS2170.1																																																																																					0.537	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254582.1			
RAPGEF4	11069	hgsc.bcm.edu	37	2	173600785	173600785	+	Intron	SNP	C	C	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr2:173600785C>G	ENST00000397081.3	+	1	208				RAPGEF4-AS1_ENST00000435328.1_RNA|RAPGEF4-AS1_ENST00000455435.1_RNA|RAPGEF4_ENST00000264111.6_Intron|RAPGEF4_ENST00000409036.1_Intron	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			AGGTAGCTCGCCGGGGGCCGC	0.746																																					.													.	.			0			.												4.0	5.0	5.0					2																	173600785		1262	2952	4214	SO:0001627	intron_variant	91149	.			AGCTCGCCGGGGG	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.65+9C>G	2.37:g.173600785C>G			37	0	0		28	0.18	5	.	1	0.00	0	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	RNA	SNP	ENST00000397081.3	37	CCDS42775.1																																																																																					0.746	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257864.2		NM_007023	
BMPR2	659	ucsc.edu	37	2	203420129	203420129	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr2:203420129G>A	ENST00000374580.4	+	12	2280	c.1741G>A	c.(1741-1743)Gaa>Aaa	p.E581K	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	581					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GACTATAGGGGAAAAAAACCG	0.438																																					p.E581K													.	BMPR2	142		0			c.G1741A												114.0	107.0	109.0					2																	203420129		2203	4300	6503	SO:0001583	missense	659	exon12			ATAGGGGAAAAAA	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1741G>A	2.37:g.203420129G>A	ENSP00000363708:p.Glu581Lys		142	0.0070422535	1		163	0.02	3	NM_001204	55	0.13	7	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532542	0.85812	.	.	ENSG00000204217	ENST00000374580	D	0.84516	-1.86	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.88800	0.6535	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.90024	0.4130	10	0.72032	D	0.01	.	19.2493	0.93917	0.0:0.0:1.0:0.0	.	581	Q13873	BMPR2_HUMAN	K	581	ENSP00000363708:E581K	ENSP00000363708:E581K	E	+	1	0	BMPR2	203128374	1.000000	0.71417	0.999000	0.59377	0.845000	0.48019	9.624000	0.98398	2.542000	0.85734	0.650000	0.86243	GAA			0.438	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257743.1	rescued with RNA-seq	NM_001204	
TTLL4	9654	broad.mit.edu	37	2	219612368	219612368	+	Silent	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr2:219612368G>T	ENST00000392102.1	+	11	2638	c.2298G>T	c.(2296-2298)cgG>cgT	p.R766R	TTLL4_ENST00000442769.1_Silent_p.R702R|TTLL4_ENST00000457313.1_Silent_p.R601R|TTLL4_ENST00000258398.4_Silent_p.R766R	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	766	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TTGACCTGCGGATCTATGTTT	0.493																																					p.R766R	GBM(172;1818 2053 15407 20943 49753)												.	TTLL4	96		0			c.G2298T												165.0	148.0	153.0					2																	219612368		2203	4300	6503	SO:0001819	synonymous_variant	9654	exon11			CCTGCGGATCTAT		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2298G>T	2.37:g.219612368G>T			209	0	0		253	0.02	5	NM_014640	156	0.00	0	A8K6V5|Q8WW29	Silent	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243354	0.22796	.	.	ENSG00000135912	ENST00000448224	.	.	.	5.28	1.13	0.20643	.	.	.	.	.	T	0.51584	0.1683	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35525	-0.9785	4	.	.	.	.	5.5235	0.16945	0.2991:0.1496:0.5514:0.0	.	.	.	.	V	98	.	.	G	+	2	0	TTLL4	219320612	0.999000	0.42202	0.998000	0.56505	0.995000	0.86356	0.552000	0.23376	0.016000	0.14998	0.655000	0.94253	GGA			0.493	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256726.1		NM_014640	
SNPH	9751	mdanderson.org	37	20	1285979	1285979	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr20:1285979G>T	ENST00000381873.3	+	6	1002	c.766G>T	c.(766-768)Gac>Tac	p.D256Y	SNPH_ENST00000381867.1_Missense_Mutation_p.D300Y	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	256					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)			endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GAGCCGGACGGACGCGCTGGA	0.682																																					p.D256Y													.	.			0			c.G766T												35.0	34.0	34.0					20																	1285979		2194	4277	6471	SO:0001583	missense	9751	exon6			CGGACGGACGCGC		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.766G>T	20.37:g.1285979G>T	ENSP00000371297:p.Asp256Tyr		40	0	0		38	0.08	3	NM_014723	27	0.00	0	Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625464	0.66901	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	4.75	4.75	0.60458	.	0.538271	0.17643	N	0.166948	T	0.65873	0.2733	L	0.43152	1.355	0.58432	D	0.999993	D;D	0.63046	0.992;0.992	P;P	0.56700	0.804;0.804	T	0.69540	-0.5118	9	0.87932	D	0	-9.0917	17.5386	0.87841	0.0:0.0:1.0:0.0	.	300;256	O15079-2;O15079	.;SNPH_HUMAN	Y	256;300	.	ENSP00000371291:D300Y	D	+	1	0	SNPH	1233979	1.000000	0.71417	0.995000	0.50966	0.800000	0.45204	5.071000	0.64382	2.479000	0.83701	0.561000	0.74099	GAC			0.682	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000145240.2		NM_014723	
NCOA6	23054	hgsc.bcm.edu	37	20	33345720	33345721	+	In_Frame_Ins	INS	-	-	TGC	rs575791036	byFrequency	TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr20:33345720_33345721insTGC	ENST00000374796.2	-	8	3400_3401	c.830_831insGCA	c.(829-831)caa>caGCAa	p.277_277Q>QQ	NCOA6_ENST00000359003.2_In_Frame_Ins_p.277_277Q>QQ			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	277	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gttgctgttgttgctgctgctg	0.54																																					p.Q277delinsQQ													.	NCOA6	219		0			c.831_832insGCA																																									SO:0001652	inframe_insertion	23054	exon7			CTGTTGTTGCTGC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.828_830dupGCA	20.37:g.33345727_33345729dupTGC	ENSP00000363929:p.Gln285dup		58	0	0		99	0.11	11	NM_014071	23	0.00	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	In_Frame_Ins	INS	ENST00000374796.2	37	CCDS13241.1																																																																																					0.540	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078811.2		NM_014071	
ARVCF	421	broad.mit.edu	37	22	19964943	19964943	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr22:19964943G>T	ENST00000263207.3	-	9	2156	c.1865C>A	c.(1864-1866)gCc>gAc	p.A622D	ARVCF_ENST00000344269.3_Missense_Mutation_p.A559D|ARVCF_ENST00000401994.1_Missense_Mutation_p.A559D|ARVCF_ENST00000406522.1_Missense_Mutation_p.A559D|ARVCF_ENST00000406259.1_Missense_Mutation_p.A622D	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	622					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CCCACCTTTGGCCTTCTTGCC	0.652																																					p.A622D													.	ARVCF	54		0			c.C1865A												87.0	85.0	86.0					22																	19964943		2203	4300	6503	SO:0001583	missense	421	exon9			CCTTTGGCCTTCT		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1865C>A	22.37:g.19964943G>T	ENSP00000263207:p.Ala622Asp		167	0	0		237	0.02	5	NM_001670	45	0.00	0	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241889	0.79912	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9	4.05	4.05	0.47172	Armadillo-type fold (1);	0.168793	0.52532	D	0.000072	T	0.66137	0.2759	L	0.36672	1.1	0.80722	D	1	B;P	0.49253	0.302;0.921	B;B	0.41466	0.174;0.358	T	0.67417	-0.5676	9	.	.	.	-9.5472	17.1156	0.86688	0.0:0.0:1.0:0.0	.	622;144	O00192;E7EV58	ARVC_HUMAN;.	D	622;559;559;559;622	ENSP00000263207:A622D;ENSP00000342042:A559D;ENSP00000384341:A559D;ENSP00000384732:A559D;ENSP00000385444:A622D	.	A	-	2	0	ARVCF	18344943	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.587000	0.36622	2.549000	0.85964	0.563000	0.77884	GCC			0.652	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000075314.5		NM_001670	
SEZ6L	23544	broad.mit.edu	37	22	26688869	26688869	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr22:26688869G>T	ENST00000248933.6	+	2	687	c.592G>T	c.(592-594)Gca>Tca	p.A198S	SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.A198S|SEZ6L_ENST00000404234.3_Missense_Mutation_p.A198S|SEZ6L_ENST00000343706.4_Missense_Mutation_p.A198S|SEZ6L_ENST00000529632.2_Missense_Mutation_p.A198S|SEZ6L_ENST00000402979.1_5'UTR			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	198					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TACAACACCCGCACCCCTGCA	0.667																																					p.A198S													.	SEZ6L	174		0			c.G592T												55.0	58.0	57.0					22																	26688869		2203	4298	6501	SO:0001583	missense	23544	exon2			ACACCCGCACCCC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.592G>T	22.37:g.26688869G>T	ENSP00000248933:p.Ala198Ser		178	0	0		210	0.02	4	NM_001184777	3	0.00	0	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003893	0.35320	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.28069	1.86;1.98;2.06;1.87;1.63	4.49	3.38	0.38709	.	0.165679	0.28431	N	0.015367	T	0.16128	0.0388	N	0.08118	0	0.21386	N	0.999706	P;P;P;D;P;P	0.53312	0.826;0.826;0.891;0.959;0.826;0.826	B;B;B;P;B;B	0.45753	0.103;0.103;0.28;0.492;0.103;0.103	T	0.09185	-1.0686	10	0.18710	T	0.47	.	9.3053	0.37872	0.0:0.1658:0.685:0.1491	.	198;198;198;198;198;198	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	S	198	ENSP00000384772:A198S;ENSP00000437037:A198S;ENSP00000354185:A198S;ENSP00000248933:A198S;ENSP00000342661:A198S	ENSP00000248933:A198S	A	+	1	0	SEZ6L	25018869	0.002000	0.14202	0.070000	0.20053	0.148000	0.21650	0.910000	0.28571	2.216000	0.71823	0.508000	0.49915	GCA			0.667	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000320359.3			
APOBEC3A	200315	hgsc.bcm.edu	37	22	39357586	39357586	+	Silent	SNP	T	T	C	rs202076860	byFrequency	TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr22:39357586T>C	ENST00000402255.1	+	4	573	c.369T>C	c.(367-369)cgT>cgC	p.R123R	APOBEC3A_ENST00000249116.2_Silent_p.R123R			P31941	ABC3A_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A	123					cellular response to xenobiotic stimulus (GO:0071466)|clearance of foreign intracellular DNA by conversion of DNA cytidine to uridine (GO:0044356)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5	Melanoma(58;0.04)					TGAGACTGCGTATCTTCGCTG	0.572													C|||	105	0.0209665	0.0083	0.0086	5008	,	,		10140	0.0486		0.0249	False		,,,				2504	0.0143				p.R123R													APOBEC3A,caecum,carcinoma,+1,1	APOBEC3A	1	1	0			c.T369C												101.0	99.0	100.0					22																	39357586		2128	4075	6203	SO:0001819	synonymous_variant	200315	exon3			ACTGCGTATCTTC	U03891	CCDS13981.1	22q13.1-q13.2	2014-01-28			ENSG00000128383	ENSG00000128383		"""Apolipoprotein B mRNA editing enzymes"""	17343	protein-coding gene	gene with protein product	"""phorbolin I"""	607109				11863358, 10469298	Standard	NM_145699		Approved	ARP3, PHRBN		P31941	OTTHUMG00000151004	ENST00000402255.1:c.369T>C	22.37:g.39357586T>C			78	0.0128205128	1		54	0.11	6	NM_145699	2	0.00	0	A0AVM1|Q12807|Q5JZ93|Q9UH18	Silent	SNP	ENST00000402255.1	37	CCDS13981.1																																																																																			0.001		0.572	APOBEC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320915.2		NM_145699	
DCP1A	55802	mdanderson.org	37	3	53376192	53376192	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr3:53376192G>T	ENST00000607628.1	-	3	392	c.283C>A	c.(283-285)Ctt>Att	p.L95I	DCP1A_ENST00000294241.6_Missense_Mutation_p.L95I|DCP1A_ENST00000606822.1_Missense_Mutation_p.L95I|DCP1A_ENST00000480258.1_5'UTR	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	95					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		CTATACAGAAGAAATGGTTCA	0.313																																					p.L95I													DCP1A,NS,carcinoma,0,1	DCP1A	0	1	0			c.C283A												50.0	48.0	49.0					3																	53376192		1807	4065	5872	SO:0001583	missense	55802	exon3			ACAGAAGAAATGG	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.283C>A	3.37:g.53376192G>T	ENSP00000475920:p.Leu95Ile		65	0	0		59	0.05	3	NM_018403	16	0.00	0	B4DHN9|U3KQM8	Missense_Mutation	SNP	ENST00000607628.1	37																																																																																						0.313	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_018403	
PARP14	54625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122420415	122420415	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr3:122420415A>G	ENST00000474629.2	+	6	3280	c.3014A>G	c.(3013-3015)aAa>aGa	p.K1005R		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1005	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TCATGGGAAAAAGGAAGCCTG	0.552																																					p.K1005R													.	.			0			c.A3014G												28.0	28.0	28.0					3																	122420415		1910	4138	6048	SO:0001583	missense	54625	exon6			GGGAAAAAGGAAG	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3014A>G	3.37:g.122420415A>G	ENSP00000418194:p.Lys1005Arg		119	0	0		137	0.17	23	NM_017554	6	0.00	0	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	A	5.720	0.317276	0.10845	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.09350	2.99	4.83	0.195	0.15151	Appr-1-p processing (1);	1.417150	0.04454	N	0.373217	T	0.03915	0.0110	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39820	-0.9595	10	0.15499	T	0.54	.	5.1325	0.14917	0.6103:0.14:0.2497:0.0	.	1005;1005	Q460N5-4;Q460N5	.;PAR14_HUMAN	R	1005;924	ENSP00000418194:K1005R	ENSP00000381228:K924R	K	+	2	0	PARP14	123903105	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.001000	0.13038	-0.125000	0.11703	-0.478000	0.04885	AAA			0.552	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356173.2		NM_017554	
FAM43A	131583	mdanderson.org	37	3	194407933	194407933	+	Silent	SNP	C	C	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr3:194407933C>A	ENST00000329759.4	+	1	1312	c.378C>A	c.(376-378)cgC>cgA	p.R126R		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	126										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		CCGAGGAGCGCGCGCTGCGCC	0.697																																					p.R126R													.	.			0			c.C378A												18.0	18.0	18.0					3																	194407933		2184	4270	6454	SO:0001819	synonymous_variant	131583	exon1			GGAGCGCGCGCTG	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.378C>A	3.37:g.194407933C>A			22	0	0		26	0.08	2	NM_153690	11	0.00	0	A3KME2|Q8IXP4|Q8WZ07	Silent	SNP	ENST00000329759.4	37	CCDS33923.1																																																																																					0.697	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342734.1		NM_153690	
PITX1	5307	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	134364535	134364535	+	Silent	SNP	C	C	G	rs61751190		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr5:134364535C>G	ENST00000265340.7	-	3	1295	c.879G>C	c.(877-879)tcG>tcC	p.S293S	PITX1_ENST00000506438.1_Silent_p.S293S	NM_002653.4	NP_002644.4	P78337	PITX1_HUMAN	paired-like homeodomain 1	293					anatomical structure morphogenesis (GO:0009653)|branchiomeric skeletal muscle development (GO:0014707)|cartilage development (GO:0051216)|embryonic hindlimb morphogenesis (GO:0035116)|myoblast fate commitment (GO:0048625)|pituitary gland development (GO:0021983)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)			central_nervous_system(1)|cervix(3)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	READ - Rectum adenocarcinoma(2;0.0607)		AGCCAAACGACGAGTGCTGTT	0.711																																					p.S293S													.	.			0			c.G879C												30.0	31.0	31.0					5																	134364535		2203	4300	6503	SO:0001819	synonymous_variant	5307	exon3			AAACGACGAGTGC	AF009648	CCDS4182.1	5q31.1	2011-06-20	2007-07-12		ENSG00000069011	ENSG00000069011		"""Homeoboxes / PRD class"""	9004	protein-coding gene	gene with protein product		602149	"""paired-like homeodomain transcription factor 1"""	BFT		9337397, 9070926	Standard	NM_002653		Approved	PTX1, POTX	uc010jea.3	P78337	OTTHUMG00000149983	ENST00000265340.7:c.879G>C	5.37:g.134364535C>G			72	0	0		62	0.29	18	NM_002653	0		0	A8K3M0|D3DQB0|O14677|O60425|Q9BTI5	Silent	SNP	ENST00000265340.7	37	CCDS4182.1																																																																																					0.711	PITX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251195.3			
PPP2R2B	5521	mdanderson.org	37	5	146070770	146070770	+	Missense_Mutation	SNP	C	C	T	rs374783257		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr5:146070770C>T	ENST00000394413.3	-	4	938	c.368G>A	c.(367-369)cGt>cAt	p.R123H	PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.R123H|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.R181H|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.R189H|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.R112H|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.R129H|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.R112H|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.R123H|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.R126H|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.R123H			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	123					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCTTATCACGCTCGCTGAC	0.507																																					p.R229H													PPP2R2B_ENST00000508545,NS,carcinoma,0,8	PPP2R2B_ENST00000508545	0	8	0			c.G686A							C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	97.0	103.0	101.0		368,368,368,368,377,308,335	5.8	1.0	5		101	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense	PPP2R2B	NM_001127381.1,NM_004576.2,NM_181674.2,NM_181675.2,NM_181676.2,NM_181677.2,NM_181678.2	29,29,29,29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	123/444,123/444,123/444,123/444,126/447,103/424,112/433	146070770	1,13005	2203	4300	6503	SO:0001583	missense	5521	exon5			TTATCACGCTCGC	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.368G>A	5.37:g.146070770C>T	ENSP00000377935:p.Arg123His		63	0	0		44	0.07	3	NM_181675	0		0	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000394413.3	37	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	C	35	5.567848	0.96540	2.27E-4	0.0	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	M	0.79805	2.47	0.80722	D	1	D;D;D;P;P;D	0.76494	0.999;0.999;0.999;0.58;0.793;0.999	D;P;P;B;B;P	0.64144	0.922;0.896;0.896;0.174;0.072;0.896	T	0.62248	-0.6894	10	0.87932	D	0	-32.0461	20.1577	0.98120	0.0:1.0:0.0:0.0	.	181;129;112;189;126;123	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	H	123;112;189;123;123;123;112;126;129;181	ENSP00000377935:R123H;ENSP00000431320:R112H;ENSP00000377936:R189H;ENSP00000377933:R123H;ENSP00000349283:R123H;ENSP00000398779:R123H;ENSP00000377932:R112H;ENSP00000336591:R126H;ENSP00000421396:R129H;ENSP00000377931:R181H	ENSP00000336591:R126H	R	-	2	0	AC011357.1	146050963	1.000000	0.71417	0.972000	0.41901	0.984000	0.73092	7.461000	0.80834	2.767000	0.95098	0.655000	0.94253	CGT			0.507	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251893.2		NM_181678	
BTN2A3P	54718	mdanderson.org	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			123	0	0		101	0.05	5	.	3	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56368856	56368856	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr6:56368856G>A	ENST00000361203.3	-	73	18552	c.18545C>T	c.(18544-18546)gCt>gTt	p.A6182V	DST_ENST00000370769.4_Missense_Mutation_p.A6293V|DST_ENST00000421834.2_Missense_Mutation_p.A4205V|DST_ENST00000370754.5_Missense_Mutation_p.A6471V|DST_ENST00000446842.2_Missense_Mutation_p.A5967V|DST_ENST00000340834.4_5'UTR|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.A4096V|DST_ENST00000244364.6_Missense_Mutation_p.A3879V			Q03001	DYST_HUMAN	dystonin	6182					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGACATTGAAGCTAATTTACC	0.423																																					p.A3879V													.	.			0			c.C11636T												113.0	102.0	106.0					6																	56368856		1889	4127	6016	SO:0001583	missense	667	exon59			ATTGAAGCTAATT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18545C>T	6.37:g.56368856G>A	ENSP00000354508:p.Ala6182Val		129	0	0		124	0.11	14	NM_015548	72	0.14	10	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	18.23	3.578339	0.65878	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.35	5.35	0.76521	.	0.000000	0.51477	D	0.000087	T	0.49389	0.1554	L	0.42245	1.32	0.32874	D	0.509660	D;D;D;P;P	0.71674	0.965;0.998;0.996;0.611;0.929	P;D;D;B;P	0.73380	0.846;0.98;0.925;0.321;0.572	T	0.40646	-0.9552	9	0.30078	T	0.28	.	14.3048	0.66377	0.0:0.0:0.8515:0.1485	.	4205;6293;6471;6291;3879	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	3879;6471;6293;4205;5967;4096;6182	ENSP00000244364:A3879V;ENSP00000359790:A6471V;ENSP00000359805:A6293V;ENSP00000400883:A4205V;ENSP00000393645:A5967V;ENSP00000359824:A4096V;ENSP00000354508:A6182V	ENSP00000244364:A3879V	A	-	2	0	DST	56476815	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	5.513000	0.67037	2.661000	0.90470	0.650000	0.86243	GCT			0.423	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000041021.3		NM_001723	
ZNF853	54753	mdanderson.org	37	7	6661823	6661823	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:6661823C>T	ENST00000457543.3	+	3	1759	c.1201C>T	c.(1201-1203)Cag>Tag	p.Q401*		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	401	Gln-rich.|Glu-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						GCAGGAGGTGCAGCTGGAGCT	0.731																																					p.Q401X													.	.			0			c.C1201T												2.0	4.0	4.0					7																	6661823		579	1407	1986	SO:0001587	stop_gained	54753	exon3			GAGGTGCAGCTGG	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.1201C>T	7.37:g.6661823C>T	ENSP00000455585:p.Gln401*		13	0	0		19	0.11	2	NM_017560	16	0.00	0		Nonsense_Mutation	SNP	ENST00000457543.3	37	CCDS59048.1																																																																																					0.731	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000324169.2		NM_017560	
ETV1	2115	broad.mit.edu	37	7	13949310	13949310	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:13949310T>C	ENST00000430479.1	-	11	1554	c.887A>G	c.(886-888)aAg>aGg	p.K296R	ETV1_ENST00000403685.1_Missense_Mutation_p.K278R|ETV1_ENST00000399357.3_Missense_Mutation_p.K193R|ETV1_ENST00000405192.2_Missense_Mutation_p.K273R|ETV1_ENST00000343495.5_Missense_Mutation_p.K278R|ETV1_ENST00000420159.2_Missense_Mutation_p.K238R|ETV1_ENST00000405358.4_Missense_Mutation_p.K310R|ETV1_ENST00000242066.5_Missense_Mutation_p.K278R|ETV1_ENST00000405218.2_Missense_Mutation_p.K296R|ETV1_ENST00000476720.2_5'Flank|ETV1_ENST00000403527.1_Missense_Mutation_p.K256R	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	296					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K256R(1)|p.K296R(1)	TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCTGGGGCCCTTTTCAAACAT	0.343			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.K296R				Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	ETV1_ENST00000403527,NS,carcinoma,0,2	ETV1	138	2	2	Substitution - Missense(2)	lung(2)	c.A887G												100.0	99.0	99.0					7																	13949310		1806	4074	5880	SO:0001583	missense	2115	exon11			GGGCCCTTTTCAA		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.887A>G	7.37:g.13949310T>C	ENSP00000405327:p.Lys296Arg		129	0	0		151	0.03	4	NM_004956	47	0.00	0	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	ENST00000430479.1	37	CCDS55088.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.842521	0.71488	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956	T;T;T;T;T;T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93	5.98	5.98	0.97165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.438355	0.28031	N	0.016867	T	0.45418	0.1341	L	0.46741	1.465	0.58432	D	0.999999	P;B;D;D;D;D;B	0.63046	0.955;0.044;0.979;0.99;0.99;0.992;0.055	P;B;P;D;D;D;B	0.83275	0.675;0.03;0.76;0.979;0.996;0.987;0.075	T	0.16630	-1.0396	10	0.37606	T	0.19	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	284;278;310;238;193;256;296	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;P50549	.;.;.;.;.;.;ETV1_HUMAN	R	296;278;278;238;193;273;310;256;296;278;238	ENSP00000405327:K296R;ENSP00000242066:K278R;ENSP00000340853:K278R;ENSP00000411626:K238R;ENSP00000382293:K193R;ENSP00000385381:K273R;ENSP00000384085:K310R;ENSP00000384138:K256R;ENSP00000385551:K296R;ENSP00000385686:K278R;ENSP00000393078:K238R	ENSP00000242066:K278R	K	-	2	0	ETV1	13915835	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	6.247000	0.72411	2.289000	0.77006	0.482000	0.46254	AAG			0.343	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326111.1		NM_004956	
COBL	23242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	51096836	51096836	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:51096836C>A	ENST00000265136.7	-	10	2122	c.1957G>T	c.(1957-1959)Ggc>Tgc	p.G653C	COBL_ENST00000395542.2_Missense_Mutation_p.G735C	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	653					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TCAGCACAGCCATACACTTTG	0.473																																					p.G653C	NSCLC(189;2119 2138 12223 30818 34679)												.	.			0			c.G1957T												153.0	135.0	141.0					7																	51096836		2203	4300	6503	SO:0001583	missense	23242	exon10			CACAGCCATACAC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1957G>T	7.37:g.51096836C>A	ENSP00000265136:p.Gly653Cys		176	0	0		270	0.32	87	NM_015198	43	0.28	12	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930763	0.52866	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542;ENST00000457306	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	5.83	3.06	0.35304	.	0.964777	0.08527	N	0.932559	T	0.45875	0.1364	L	0.43152	1.355	0.09310	N	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.912;0.912;0.972;0.991;0.991	T	0.22871	-1.0204	10	0.62326	D	0.03	.	7.9117	0.29796	0.0:0.6928:0.0:0.3072	.	653;710;653;735;195	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	C	653;545;538;735;151	ENSP00000265136:G653C;ENSP00000401204:G545C;ENSP00000413498:G538C;ENSP00000378912:G735C	ENSP00000265136:G653C	G	-	1	0	COBL	51064330	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.008000	0.12788	0.809000	0.34255	0.655000	0.94253	GGC			0.473	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000342682.1		NM_015198	
GS1-124K5.2	0	broad.mit.edu	37	7	65889152	65889152	+	RNA	DEL	T	T	-			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:65889152delT	ENST00000442578.1	-	0	826																											gcccagctaatttttttgtat	0.527																																					.													.	.			0			.																																											0	.			AGCTAATTTTTTT																													7.37:g.65889152delT			7	0	0		6	0.33	2	.	8	0.00	0		RNA	DEL	ENST00000442578.1	37																																																																																						0.527	GS1-124K5.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	pseudogene		OTTHUMT00000344730.1			
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Silent_p.G120G	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			465	0.0043010753	2		610	0.01	5	NM_001145268	4	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
ZNF277	11179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	111980956	111980956	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:111980956G>A	ENST00000361822.3	+	11	1168	c.1039G>A	c.(1039-1041)Gtc>Atc	p.V347I	AC004112.4_ENST00000431064.1_RNA|AC004112.4_ENST00000411413.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	347					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						AGTGAAACTGGTCAATTTTAT	0.343																																					p.V347I													.	.			0			c.G1039A												123.0	128.0	126.0					7																	111980956		2203	4300	6503	SO:0001583	missense	11179	exon11			AAACTGGTCAATT	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.1039G>A	7.37:g.111980956G>A	ENSP00000354501:p.Val347Ile		228	0	0		233	0.23	54	NM_021994	61	0.34	21	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	ENST00000361822.3	37	CCDS5755.2	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426265	0.62733	.	.	ENSG00000198839	ENST00000361822;ENST00000421864	T;T	0.35973	1.28;1.28	6.03	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	L	0.31752	0.955	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.29366	-1.0014	10	0.17832	T	0.49	-10.7078	15.5079	0.75757	0.0662:0.0:0.9338:0.0	.	347	Q9NRM2	ZN277_HUMAN	I	347;58	ENSP00000354501:V347I;ENSP00000415735:V58I	ENSP00000354501:V347I	V	+	1	0	ZNF277	111768192	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.169000	0.77578	1.564000	0.49628	0.555000	0.69702	GTC			0.343	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316843.2		NM_021994	
NOS3	4846	broad.mit.edu;mdanderson.org	37	7	150698654	150698654	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr7:150698654C>T	ENST00000484524.1	+	11	1451	c.1451C>T	c.(1450-1452)gCc>gTc	p.A484V	NOS3_ENST00000467517.1_Missense_Mutation_p.A484V|NOS3_ENST00000461406.1_Missense_Mutation_p.A278V|NOS3_ENST00000297494.3_Missense_Mutation_p.A484V	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AAGGGGAGTGCCGCCAAGGGC	0.602																																					p.A484V													.	NOS3	131		0			c.C1451T												125.0	150.0	142.0					7																	150698654		2203	4300	6503	SO:0001583	missense	4846	exon11			GGAGTGCCGCCAA		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1451C>T	7.37:g.150698654C>T	ENSP00000420215:p.Ala484Val		86	0	0		121	0.05	6	NM_001160111	4	0.00	0	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	C	0.362	-0.938608	0.02340	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	5.19	1.12	0.20585	Nitric oxide synthase, oxygenase domain (2);	1.021070	0.07829	N	0.961036	T	0.06872	0.0175	N	0.00510	-1.415	0.09310	N	1	B;B;B;B;B	0.10296	0.002;0.002;0.003;0.0;0.0	B;B;B;B;B	0.10450	0.005;0.005;0.004;0.001;0.004	T	0.29274	-1.0017	10	0.02654	T	1	-9.4019	17.4824	0.87677	0.0:0.3052:0.6947:0.0	.	484;484;484;278;484	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	V	484;278;484;484	ENSP00000297494:A484V;ENSP00000417143:A278V;ENSP00000420215:A484V;ENSP00000420551:A484V	ENSP00000297494:A484V	A	+	2	0	NOS3	150329587	0.000000	0.05858	0.000000	0.03702	0.661000	0.39034	0.071000	0.14594	-0.087000	0.12528	0.655000	0.94253	GCC			0.602	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000351550.1		NM_000603	
ERICH1	157697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	642586	642586	+	Nonsense_Mutation	SNP	G	G	A	rs150434775		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr8:642586G>A	ENST00000262109.7	-	3	273	c.196C>T	c.(196-198)Cga>Tga	p.R66*	ERICH1_ENST00000522706.1_Intron|ERICH1_ENST00000518277.1_5'UTR	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	66										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		TAGAGCCGTCGGGCAGTCGGG	0.567																																					p.R66X													.	.			0			c.C196T							G	stop/ARG	0,4406		0,0,2203	29.0	31.0	31.0		196	-0.4	0.0	8	dbSNP_134	31	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	ERICH1	NM_207332.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		66/444	642586	1,13005	2203	4300	6503	SO:0001587	stop_gained	157697	exon3			GCCGTCGGGCAGT		CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.196C>T	8.37:g.642586G>A	ENSP00000262109:p.Arg66*		333	0	0		451	0.21	93	NM_207332	44	0.05	2	A8K2J9|Q9P063	Nonsense_Mutation	SNP	ENST00000262109.7	37	CCDS5955.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396861	0.62177	0.0	1.16E-4	ENSG00000104714	ENST00000543819;ENST00000262109	.	.	.	4.66	-0.432	0.12291	.	0.069656	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.6168	13.6464	0.62283	0.0:0.0:0.7545:0.2455	.	.	.	.	X	66	.	ENSP00000262109:R66X	R	-	1	2	ERICH1	632586	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.124000	0.15728	0.096000	0.17463	-0.256000	0.11100	CGA	0		0.567	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251228.3		NM_207332	
FOXD4	2298	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	116901	116901	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr9:116901G>C	ENST00000382500.2	-	1	1516	c.1219C>G	c.(1219-1221)Ctg>Gtg	p.L407V		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	407					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGCGATGTCAGCCCAGAGCCC	0.701																																					p.L407V													.	.			0			c.C1219G												27.0	38.0	35.0					9																	116901		2196	4291	6487	SO:0001583	missense	2298	exon1			ATGTCAGCCCAGA	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.1219C>G	9.37:g.116901G>C	ENSP00000371940:p.Leu407Val		180	0	0		181	0.08	14	NM_207305	0		0	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	CCDS34975.1	.	.	.	.	.	.	.	.	.	.	.	15.26	2.780303	0.49891	.	.	ENSG00000170122	ENST00000382500	D	0.96334	-3.98	2.41	2.41	0.29592	.	266.961000	0.02578	U	0.098578	D	0.93697	0.7986	N	0.12182	0.205	0.24140	N	0.995739	D	0.53885	0.963	P	0.49853	0.624	D	0.88509	0.3088	10	0.87932	D	0	.	8.3775	0.32451	0.0:0.0:1.0:0.0	.	407	Q12950	FOXD4_HUMAN	V	407	ENSP00000371940:L407V	ENSP00000371940:L407V	L	-	1	2	FOXD4	106901	0.000000	0.05858	0.231000	0.23993	0.085000	0.17905	-0.019000	0.12546	1.347000	0.45714	0.473000	0.43528	CTG			0.701	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055433.1		NM_207305	
ABCA2	20	mdanderson.org	37	9	139917217	139917217	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chr9:139917217G>T	ENST00000371605.3	-	4	520	c.373C>A	c.(373-375)Cag>Aag	p.Q125K	ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Missense_Mutation_p.Q126K|ABCA2_ENST00000265662.5_Missense_Mutation_p.Q126K			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	125					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCCAGATGCTGGCGTAGGGCC	0.697																																					p.Q156K													.	.			0			c.C466A												14.0	18.0	17.0					9																	139917217		1959	4142	6101	SO:0001583	missense	20	exon5			GATGCTGGCGTAG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.373C>A	9.37:g.139917217G>T	ENSP00000360666:p.Gln125Lys		29	0	0		36	0.08	3	NM_212533	4	0.00	0	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	g	13.59	2.281879	0.40394	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.87412	-2.25;-2.25;-2.25	4.25	1.95	0.26073	.	3.201140	0.02312	U	0.072220	T	0.75781	0.3896	N	0.12887	0.27	0.28450	N	0.916369	B;B;B	0.19817	0.022;0.039;0.02	B;B;B	0.17433	0.006;0.01;0.018	T	0.62872	-0.6762	10	0.02654	T	1	.	10.8706	0.46881	0.0:0.1308:0.7162:0.1531	.	125;155;156	Q9BZC7;E7EU84;E7ETC3	ABCA2_HUMAN;.;.	K	126;125;156;126	ENSP00000265662:Q126K;ENSP00000360666:Q125K;ENSP00000344155:Q126K	ENSP00000265662:Q126K	Q	-	1	0	ABCA2	139037038	0.995000	0.38212	0.991000	0.47740	0.978000	0.69477	4.028000	0.57246	0.719000	0.32188	0.486000	0.48141	CAG			0.697	ABCA2-202	KNOWN	basic	protein_coding	protein_coding				NM_001606	
MT-CO1	4512	hgsc.bcm.edu;broad.mit.edu	37	M	5881	5881	+	5'Flank	SNP	G	G	A			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chrM:5881G>A	ENST00000361624.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGCTTCACTCAGCCATTTTAC	0.443																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			CACTCAGCCATTT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5881G>A	Exception_encountered		108	0	0		115	0.10	11	.	0		0	Q34770	RNA	SNP	ENST00000361624.2	37																																																																																						0.443	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024028	
CHRDL1	91851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	109924730	109924730	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chrX:109924730T>C	ENST00000372045.1	-	10	1243	c.1112A>G	c.(1111-1113)cAc>cGc	p.H371R	CHRDL1_ENST00000434224.1_Missense_Mutation_p.H298R|CHRDL1_ENST00000482160.1_Missense_Mutation_p.H299R|CHRDL1_ENST00000372042.1_Missense_Mutation_p.H379R|CHRDL1_ENST00000394797.4_Missense_Mutation_p.H377R|CHRDL1_ENST00000218054.4_Missense_Mutation_p.H377R|CHRDL1_ENST00000444321.2_Missense_Mutation_p.H378R			Q9BU40	CRDL1_HUMAN	chordin-like 1	371					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						AGTCCAAACGTGGACCTCTAC	0.443																																					p.H379R													.	.			0			c.A1136G												187.0	142.0	157.0					X																	109924730		2203	4300	6503	SO:0001583	missense	91851	exon10			CAAACGTGGACCT	AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.1112A>G	X.37:g.109924730T>C	ENSP00000361115:p.His371Arg		154	0	0		164	0.48	79	NM_001143981	11	0.55	6	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	T	19.17	3.775656	0.70107	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.30981	2.26;1.51;2.26;2.26;2.52;1.51;2.25	4.97	4.97	0.65823	.	0.050618	0.85682	D	0.000000	T	0.40670	0.1126	L	0.27053	0.805	0.47698	D	0.999498	D;D;D;D;D;D	0.57899	0.978;0.981;0.981;0.981;0.981;0.981	D;D;D;D;D;D	0.69824	0.942;0.966;0.966;0.966;0.966;0.95	T	0.16305	-1.0407	9	.	.	.	-13.8337	14.3338	0.66576	0.0:0.0:0.0:1.0	.	299;378;358;371;379;298	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	R	371;298;377;377;379;299;378	ENSP00000361115:H371R;ENSP00000389627:H298R;ENSP00000218054:H377R;ENSP00000378276:H377R;ENSP00000361112:H379R;ENSP00000418443:H299R;ENSP00000399739:H378R	.	H	-	2	0	CHRDL1	109811386	1.000000	0.71417	0.958000	0.39756	0.974000	0.67602	5.579000	0.67457	1.921000	0.55644	0.437000	0.28790	CAC			0.443	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000057912.1		NM_145234	
ARHGAP36	158763	mdanderson.org	37	X	130219013	130219013	+	Silent	SNP	G	G	T			TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chrX:130219013G>T	ENST00000276211.5	+	7	1275	c.930G>T	c.(928-930)ctG>ctT	p.L310L	ARHGAP36_ENST00000370922.1_Silent_p.L298L|ARHGAP36_ENST00000370921.1_Silent_p.L174L	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	310	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CAGATGATCTGTACATGTCAT	0.488																																					p.L310L													.	.			0			c.G930T												135.0	112.0	120.0					X																	130219013		2203	4300	6503	SO:0001819	synonymous_variant	158763	exon7			TGATCTGTACATG		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.930G>T	X.37:g.130219013G>T			56	0.0178571429	1		56	0.05	3	NM_144967	6	0.00	0	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	37	CCDS14628.1																																																																																					0.488	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355073.1		NM_144967	
Unknown	0	bcgsc.ca	37	Y	10029174	10029174	+	IGR	SNP	G	G	T	rs77341040		TCGA-YU-A90W-01A-11D-A435-10	TCGA-YU-A90W-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	88e283c8-569b-4e2a-81ec-1d38873ec4f8	1374f899-bff2-4251-a5f5-309ce22bb20f	g.chrY:10029174G>T								RNA5SP519 (98572 upstream) : AC010970.1 (4806 downstream)																							TTCCCAGTGGGACAGTATCAG	0.358																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100130277	.			CAGTGGGACAGTA																													Y.37:g.10029174G>T			41	0.0731707317	3		31	0.26	8	.	6	0.00	0		RNA	SNP		37																																																																																					0	0.358										
