#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
BMP8B	656	mdanderson.org	37	1	40226206	40226206	+	Missense_Mutation	SNP	G	G	T	rs147897246	byFrequency	TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr1:40226206G>T	ENST00000372827.3	-	7	1469	c.1094C>A	c.(1093-1095)gCg>gAg	p.A365E	PPIE_ENST00000372830.1_Intron|PPIE_ENST00000356511.2_Intron	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	365					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGCACAGCACGCCTTGGGGAC	0.627																																					p.A365E													BMP8B,NS,carcinoma,+1,1	BMP8B	1	1	0			c.C1094A												113.0	81.0	92.0					1																	40226206		2203	4300	6503	SO:0001583	missense	656	exon7			CAGCACGCCTTGG	BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.1094C>A	1.37:g.40226206G>T	ENSP00000361915:p.Ala365Glu		44	0.0227272727	1		52	0.06	3	NM_001720	1	0.00	0	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	ENST00000372827.3	37	CCDS444.1	.	.	.	.	.	.	.	.	.	.	g	15.47	2.843659	0.51164	.	.	ENSG00000116985	ENST00000372827	D	0.85411	-1.98	4.21	2.31	0.28768	Transforming growth factor-beta, C-terminal (3);	0.065108	0.64402	U	0.000012	D	0.91112	0.7202	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90212	0.4265	10	0.87932	D	0	.	9.5092	0.39067	0.1791:0.0:0.8209:0.0	.	365	P34820	BMP8B_HUMAN	E	365	ENSP00000361915:A365E	ENSP00000361915:A365E	A	-	2	0	BMP8B	39998793	1.000000	0.71417	0.979000	0.43373	0.171000	0.22731	5.194000	0.65125	0.511000	0.28236	-0.119000	0.15052	GCG			0.627	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025641.1		NM_001720	
DDX20	11218	mdanderson.org	37	1	112298730	112298730	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr1:112298730G>T	ENST00000369702.4	+	1	804	c.184G>T	c.(184-186)Gcc>Tcc	p.A62S	FAM212B_ENST00000412270.1_5'Flank|FAM212B_ENST00000444059.2_5'Flank|DDX20_ENST00000536167.1_Missense_Mutation_p.A62S	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	62					ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCGGAGCCGGCCGACTTCGA	0.716																																					p.A62S													.	.			0			c.G184T												8.0	8.0	8.0					1																	112298730		1973	3914	5887	SO:0001583	missense	11218	exon1			GAGCCGGCCGACT	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.184G>T	1.37:g.112298730G>T	ENSP00000358716:p.Ala62Ser		18	0	0		21	0.10	2	NM_007204	0		0	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	37	CCDS842.1	.	.	.	.	.	.	.	.	.	.	G	7.061	0.566473	0.13560	.	.	ENSG00000064703	ENST00000369702;ENST00000536167	T;T	0.41065	1.36;1.01	4.68	4.68	0.58851	RNA helicase, DEAD-box type, Q motif (1);	0.261887	0.37809	N	0.001929	T	0.14313	0.0346	L	0.50333	1.59	0.09310	N	1	B	0.25441	0.126	B	0.21546	0.035	T	0.11179	-1.0598	10	0.11794	T	0.64	-21.467	7.3242	0.26545	0.087:0.0:0.7438:0.1692	.	62	Q9UHI6	DDX20_HUMAN	S	62	ENSP00000358716:A62S;ENSP00000439026:A62S	ENSP00000358716:A62S	A	+	1	0	DDX20	112100253	0.424000	0.25490	0.626000	0.29213	0.633000	0.38033	2.169000	0.42434	2.419000	0.82065	0.655000	0.94253	GCC			0.716	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033063.2		NM_007204	
RFWD2	64326	mdanderson.org	37	1	176175758	176175758	+	Silent	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr1:176175758G>T	ENST00000367669.3	-	1	871	c.357C>A	c.(355-357)ctC>ctA	p.L119L	RFWD2_ENST00000308769.8_Silent_p.L119L|RP11-195C7.1_ENST00000456125.1_RNA	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	119					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GCCCGTTGCAGAGGGGGGCGA	0.617																																					p.L119L	Ovarian(134;1413 1765 5706 35534 51541)												.	.			0			c.C357A												35.0	35.0	35.0					1																	176175758		2189	4285	6474	SO:0001819	synonymous_variant	64326	exon1			GTTGCAGAGGGGG	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.357C>A	1.37:g.176175758G>T			24	0	0		34	0.09	3	NM_022457	6	0.00	0	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Silent	SNP	ENST00000367669.3	37	CCDS30944.1																																																																																					0.617	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084672.2		NM_022457	
PPP1R15B	84919	broad.mit.edu	37	1	204378635	204378636	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr1:204378635_204378636delAT	ENST00000367188.4	-	1	2283_2284	c.1904_1905delAT	c.(1903-1905)catfs	p.H635fs	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	635					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TTCTTTTGACATGTGTGTGTCT	0.411																																					p.635_635del													.	PPP1R15B	67		0			c.1904_1905del																																									SO:0001589	frameshift_variant	84919	exon1			TTTGACATGTGTG	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1904_1905delAT	1.37:g.204378635_204378636delAT	ENSP00000356156:p.His635fs		83	0	0		103	0.08	8	NM_032833	9	0.00	0	Q53GQ4|Q658M2|Q6P156|Q96SN1	Frame_Shift_Del	DEL	ENST00000367188.4	37	CCDS1445.1																																																																																					0.411	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087974.1		NM_032833	
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	225539365	225539365	+	Silent	SNP	T	T	C			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr1:225539365T>C	ENST00000445597.2	+	50	8625	c.8625T>C	c.(8623-8625)ggT>ggC	p.G2875G	DNAH14_ENST00000430092.1_Silent_p.G3678G|DNAH14_ENST00000439375.2_Silent_p.G3678G			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2875					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTGAAATAGGTGAAAGTCAAC	0.373																																					p.G3678G													.	.			0			c.T11034C												88.0	77.0	81.0					1																	225539365		692	1591	2283	SO:0001819	synonymous_variant	127602	exon70			AATAGGTGAAAGT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8625T>C	1.37:g.225539365T>C			154	0	0		216	0.08	18	NM_001373	0		0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37																																																																																						0.373	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000331217.3		XM_059166	
CNNM1	26507	mdanderson.org	37	10	101089191	101089191	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr10:101089191G>T	ENST00000356713.4	+	1	336	c.47G>T	c.(46-48)cGg>cTg	p.R16L	CNNM1_ENST00000446890.1_Missense_Mutation_p.R16L|CNNM1_ENST00000370534.4_5'Flank|CNNM1_ENST00000370528.3_Missense_Mutation_p.R16L	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	16					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		GTCAGGCTCCGGGACTGCTGC	0.731																																					p.R16L													.	.			0			c.G47T												3.0	4.0	3.0					10																	101089191		1351	2721	4072	SO:0001583	missense	26507	exon1			GGCTCCGGGACTG	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.47G>T	10.37:g.101089191G>T	ENSP00000349147:p.Arg16Leu		22	0	0		24	0.13	3	NM_020348	0		0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801485	0.31869	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528	D;D;D	0.83591	-1.74;-1.66;-1.65	3.96	3.02	0.34903	.	.	.	.	.	T	0.62478	0.2431	N	0.08118	0	0.80722	D	1	B;P	0.39216	0.397;0.664	B;B	0.32022	0.103;0.139	T	0.59878	-0.7371	9	0.30854	T	0.27	-0.4459	10.6485	0.45634	0.0:0.1957:0.8042:0.0	.	16;16	Q9NRU3-2;Q9NRU3	.;CNNM1_HUMAN	L	16	ENSP00000349147:R16L;ENSP00000406492:R16L;ENSP00000359559:R16L	ENSP00000349147:R16L	R	+	2	0	CNNM1	101079181	1.000000	0.71417	0.992000	0.48379	0.896000	0.52359	2.247000	0.43151	0.857000	0.35407	0.456000	0.33151	CGG			0.731	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049792.2		NM_020348	
MUC5B	727897	mdanderson.org	37	11	1258387	1258387	+	Missense_Mutation	SNP	G	G	A	rs202160055		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr11:1258387G>A	ENST00000529681.1	+	25	3348	c.3290G>A	c.(3289-3291)cGc>cAc	p.R1097H	MUC5B_ENST00000447027.1_Missense_Mutation_p.R1100H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1097	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCGCCTGCCGCTCCCAGGTG	0.682																																					p.R1097H													MUC5B,NS,carcinoma,+1,4	MUC5B	1	4	0			c.G3290A												10.0	16.0	14.0					11																	1258387		1900	4086	5986	SO:0001583	missense	727897	exon25			CCTGCCGCTCCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3290G>A	11.37:g.1258387G>A	ENSP00000436812:p.Arg1097His		15	0.0666666667	1		26	0.12	3	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	6.941	0.543406	0.13250	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.72505	-0.66;-0.66	4.38	-0.728	0.11162	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.30198	0.0757	N	0.00135	-2.02	0.26154	N	0.980103	B;B;B	0.24132	0.004;0.098;0.098	B;B;B	0.12837	0.001;0.008;0.008	T	0.37934	-0.9684	9	0.87932	D	0	.	8.5449	0.33415	0.6733:0.0:0.3267:0.0	rs35573593	1097;1790;1100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	H	1097;1100;1098;1167	ENSP00000436812:R1097H;ENSP00000415793:R1100H	ENSP00000343037:R1098H	R	+	2	0	MUC5B	1214963	0.002000	0.14202	0.101000	0.21167	0.007000	0.05969	0.139000	0.16036	-0.476000	0.06842	-0.379000	0.06801	CGC			0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
CCDC73	493860	mdanderson.org	37	11	32739692	32739692	+	Splice_Site	SNP	T	T	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr11:32739692T>A	ENST00000335185.5	-	3	180	c.137A>T	c.(136-138)gAa>gTa	p.E46V	CCDC73_ENST00000531481.1_Splice_Site_p.E46V|CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	46										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					AATTTCTGCTTCCTAAGTCAA	0.343																																					p.X46L													.	.			0			c.G137T												131.0	129.0	130.0					11																	32739692		1814	4069	5883	SO:0001630	splice_region_variant	493860	exon3			TCTGCTTCCTAAG	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.136-1A>T	11.37:g.32739692T>A			28	0	0		40	0.08	3	NM_001008391	0		0	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451491	0.43531	.	.	ENSG00000186714	ENST00000335185;ENST00000531481	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.65365	0.2684	L	0.43152	1.355	0.80722	D	1	D;D;P	0.61080	0.961;0.989;0.934	P;P;P	0.61658	0.732;0.892;0.835	T	0.67007	-0.5779	8	0.56958	D	0.05	.	12.4836	0.55859	0.0:0.0:0.0:1.0	.	46;46;46	A6H8Y7;Q6ZRK6-2;Q6ZRK6	.;.;CCD73_HUMAN	V	46	.	ENSP00000335325:E46V	E	-	2	0	CCDC73	32696268	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	4.138000	0.58017	2.254000	0.74563	0.533000	0.62120	GAA			0.343	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388874.2		NM_001008391	Missense_Mutation
TCN1	6947	hgsc.bcm.edu;mdanderson.org	37	11	59620746	59620746	+	Missense_Mutation	SNP	C	C	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr11:59620746C>A	ENST00000257264.3	-	8	1274	c.1170G>T	c.(1168-1170)caG>caT	p.Q390H	TCN1_ENST00000532419.1_5'Flank	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	390	Globular C-terminal beta domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACATAGGCCCTGAATACAGG	0.488																																					p.Q390H													TCN1,NS,carcinoma,-2,2	TCN1	-2	2	0			c.G1170T												147.0	144.0	145.0					11																	59620746		2201	4295	6496	SO:0001583	missense	6947	exon8			TAGGCCCTGAATA	J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.1170G>T	11.37:g.59620746C>A	ENSP00000257264:p.Gln390His		92	0	0		119	0.04	5	NM_001062	2	0.00	0	A8KAC5|Q8WV77	Missense_Mutation	SNP	ENST00000257264.3	37	CCDS7978.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784823	0.49997	.	.	ENSG00000134827	ENST00000257264	T	0.29917	1.55	5.21	4.21	0.49690	.	0.371791	0.22539	N	0.058742	T	0.46112	0.1376	M	0.67953	2.075	0.25466	N	0.98787	D	0.76494	0.999	D	0.65573	0.936	T	0.32455	-0.9906	10	0.12766	T	0.61	.	11.7285	0.51722	0.1883:0.8117:0.0:0.0	.	390	P20061	TCO1_HUMAN	H	390	ENSP00000257264:Q390H	ENSP00000257264:Q390H	Q	-	3	2	TCN1	59377322	0.357000	0.24938	0.997000	0.53966	0.638000	0.38207	0.257000	0.18369	2.418000	0.82041	0.650000	0.86243	CAG			0.488	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394503.1		NM_001062	
MAML2	84441	broad.mit.edu	37	11	95825254	95825254	+	Silent	SNP	C	C	T	rs61749250		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr11:95825254C>T	ENST00000524717.1	-	2	3225	c.1941G>A	c.(1939-1941)caG>caA	p.Q647Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	647					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q647Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.512			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q647Q				Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,caecum,carcinoma,0,2	MAML2	94	2	1	Substitution - coding silent(1)	endometrium(1)	c.G1941A							C		0,4198		0,0,2099	35.0	40.0	38.0		1941	1.7	0.1	11	dbSNP_129	38	5,8237		0,5,4116	no	coding-synonymous	MAML2	NM_032427.1		0,5,6215	TT,TC,CC		0.0607,0.0,0.0402		647/1157	95825254	5,12435	2099	4121	6220	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1941G>A	11.37:g.95825254C>T			60	0.0166666667	1		97	0.06	6	NM_032427	0		0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																					0.512	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395540.1			
FIGNL2	401720	mdanderson.org	37	12	52215308	52215308	+	lincRNA	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr12:52215308G>T	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							GTCCGCGGCGGGGTAGGAGGC	0.741																																					p.P297H													.	.			0			c.C890A												5.0	5.0	5.0					12																	52215308		1330	3202	4532			401720	exon2			GCGGCGGGGTAGG																													12.37:g.52215308G>T			8	0	0		15	0.13	2	NM_001013690	0		0		Missense_Mutation	SNP	ENST00000562343.2	37																																																																																						0.741	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000430848.2			
WASH3P	374666	broad.mit.edu	37	15	102506389	102506389	+	RNA	SNP	C	C	T	rs11858570		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr15:102506389C>T	ENST00000557932.1	+	0	135							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GGATGCCCTGCAGTACCTGCA	0.642																																					.													.	WASH3P	56		0			.																																											0	.			GCCCTGCAGTACC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506389C>T			20	0	0		48	0.13	6	.	14	0.00	0		RNA	SNP	ENST00000557932.1	37		.	.	.	.	.	.	.	.	.	.	c	9.761	1.169990	0.21621	.	.	ENSG00000185596	ENST00000338304;ENST00000398121;ENST00000378819	.	.	.	2.36	2.36	0.29203	.	0.088515	0.46442	U	0.000284	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.7439	8.255	0.31751	0.0:1.0:0.0:0.0	rs11858570	.	.	.	X	52;38;38	.	.	Q	+	1	0	WASH3P	100323912	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	3.549000	0.53681	1.335000	0.45486	0.184000	0.17185	CAG			0.642	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417608.1		NM_199163	
MTSS1L	92154	mdanderson.org	37	16	70697713	70697713	+	Missense_Mutation	SNP	G	G	T	rs547904006		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr16:70697713G>T	ENST00000338779.6	-	15	2385	c.2111C>A	c.(2110-2112)aCg>aAg	p.T704K	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	704					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						CGTCTCCTCCGTGGGGGTGGC	0.736													G|||	1	0.000199681	0.0008	0.0	5008	,	,		8270	0.0		0.0	False		,,,				2504	0.0				p.T704K													.	.			0			c.C2111A												4.0	4.0	4.0					16																	70697713		1794	3530	5324	SO:0001583	missense	92154	exon15			TCCTCCGTGGGGG		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.2111C>A	16.37:g.70697713G>T	ENSP00000341171:p.Thr704Lys		17	0	0		19	0.11	2	NM_138383	1	0.00	0	A6NJI7|Q9BUA8	Missense_Mutation	SNP	ENST00000338779.6	37	CCDS32476.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.132017	0.00338	.	.	ENSG00000132613	ENST00000338779	T	0.28454	1.61	4.06	1.92	0.25849	.	4.503820	0.01074	N	0.004869	T	0.15912	0.0383	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24440	-1.0160	10	0.06236	T	0.91	0.1931	7.6916	0.28571	0.115:0.2497:0.6353:0.0	.	704	Q765P7	MTSSL_HUMAN	K	704	ENSP00000341171:T704K	ENSP00000341171:T704K	T	-	2	0	MTSS1L	69255214	0.951000	0.32395	0.001000	0.08648	0.178000	0.23041	0.082000	0.14847	0.661000	0.30985	0.462000	0.41574	ACG			0.736	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434927.3		NM_138383	
HYDIN	54768	mdanderson.org	37	16	70972656	70972656	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr16:70972656G>T	ENST00000393567.2	-	44	7006	c.6856C>A	c.(6856-6858)Cgc>Agc	p.R2286S		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2286					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TTGTGCTTGCGTTCTGTGAGG	0.527																																					p.R2286S													LOC652153,NS,carcinoma,0,4	LOC652153	0	4	0			c.C6856A												57.0	56.0	56.0					16																	70972656		1962	4143	6105	SO:0001583	missense	54768	exon44			GCTTGCGTTCTGT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6856C>A	16.37:g.70972656G>T	ENSP00000377197:p.Arg2286Ser		54	0	0		63	0.05	3	NM_001270974	0		0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	4.675	0.125462	0.08931	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00912	5.55	5.6	-5.49	0.02584	.	0.995444	0.08124	U	0.994297	T	0.00608	0.0020	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.46803	-0.9165	10	0.15952	T	0.53	.	4.5547	0.12131	0.1229:0.0856:0.2829:0.5086	.	2285	F8WD23	.	S	2286;2285	ENSP00000377197:R2286S	ENSP00000313052:R2285S	R	-	1	0	HYDIN	69530157	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.304000	0.08199	-0.451000	0.07097	-0.216000	0.12614	CGC			0.527	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000398624.3			
USP32P3	347716	broad.mit.edu	37	17	20321835	20321836	+	RNA	INS	-	-	A	rs201907987		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr17:20321835_20321836insA	ENST00000583574.2	+	0	333									ubiquitin specific peptidase 32 pseudogene 3																		gggaaacaaacaaacaaaaaaa	0.421																																					.													.	.			0			.																																											0	.			AACAAACAAACAA			17p11.2	2013-02-15			ENSG00000189423	ENSG00000189423			43576	pseudogene	pseudogene							Standard	NG_002719		Approved				OTTHUMG00000179809		17.37:g.20321838_20321838dupA			228	0.0175438596	4		344	0.05	16	.	0		0		RNA	INS	ENST00000583574.2	37																																																																																						0.421	USP32P3-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000467714.1		NG_002719	
MRPL45P2	653479	broad.mit.edu	37	17	45567245	45567246	+	RNA	INS	-	-	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr17:45567245_45567246insA	ENST00000575291.1	-	0	385									mitochondrial ribosomal protein L45 pseudogene 2																		aactccatctcaaaaaaaaaaa	0.401																																					.													.	.			0			.																																											0	.			CCATCTCAAAAAA			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45567256_45567256dupA			4	0	0		10	0.30	3	.	0		0		RNA	INS	ENST00000575291.1	37																																																																																						0.401	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E													PRKCSH,caecum,carcinoma,0,1	PRKCSH	0	1	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A												27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A			67	0.0149253731	1		110	0.05	6	NM_001001329	4	0.00	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																					0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
TDRD12	91646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33247972	33247972	+	Silent	SNP	A	A	G			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr19:33247972A>G	ENST00000444215.2	+	8	1121	c.801A>G	c.(799-801)caA>caG	p.Q267Q	TDRD12_ENST00000421545.2_Silent_p.Q267Q			Q587J7	TDR12_HUMAN	tudor domain containing 12	267					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					TTCCGGCACAATCTCTGCAAC	0.398																																					p.Q267Q													.	.			0			c.A801G												71.0	64.0	66.0					19																	33247972		692	1591	2283	SO:0001819	synonymous_variant	91646	exon8			GGCACAATCTCTG	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.801A>G	19.37:g.33247972A>G			313	0	0		404	0.08	32	NM_001110822	25	0.44	11		Silent	SNP	ENST00000444215.2	37																																																																																						0.398	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000435933.1		NM_001015890	
IGSF23	147710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	45130819	45130819	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr19:45130819G>A	ENST00000402988.1	+	3	510	c.494G>A	c.(493-495)gGa>gAa	p.G165E		NM_001205280.1	NP_001192209.1	A1L1A6	IGS23_HUMAN	immunoglobulin superfamily, member 23	165						integral component of membrane (GO:0016021)											GGGATCCTGGGAGCCGGGGCA	0.617																																					p.G165E													.	.			0			c.G494A																																									SO:0001583	missense	147710	exon3			TCCTGGGAGCCGG		CCDS54277.1	19q13.31	2013-01-11			ENSG00000216588	ENSG00000216588		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	40040	protein-coding gene	gene with protein product							Standard	NM_001205280		Approved		uc021uvj.1	A1L1A6	OTTHUMG00000151531	ENST00000402988.1:c.494G>A	19.37:g.45130819G>A	ENSP00000385592:p.Gly165Glu		178	0	0		227	0.04	10	NM_001205280	0		0		Missense_Mutation	SNP	ENST00000402988.1	37	CCDS54277.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811437	0.32053	.	.	ENSG00000216588	ENST00000402988	T	0.39406	1.08	2.87	0.645	0.17782	.	.	.	.	.	T	0.29321	0.0730	L	0.29908	0.895	0.09310	N	1	P	0.50943	0.94	B	0.43950	0.437	T	0.15636	-1.0430	9	0.72032	D	0.01	.	4.1344	0.10164	0.1402:0.2427:0.6171:0.0	.	165	A1L1A6	IGS23_HUMAN	E	165	ENSP00000385592:G165E	ENSP00000385592:G165E	G	+	2	0	IGSF23	49822659	0.006000	0.16342	0.002000	0.10522	0.009000	0.06853	0.361000	0.20267	0.269000	0.21961	0.585000	0.79938	GGA			0.617	IGSF23-003	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000323031.1		NM_001205280	
MIR217HG	104355290	broad.mit.edu	37	2	56210467	56210467	+	lincRNA	DEL	T	T	-	rs35036811|rs397872576|rs71416150|rs116275598	byFrequency	TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:56210467delT	ENST00000606639.1	+	0	82				MIR217_ENST00000384817.1_RNA|AC011306.2_ENST00000446139.1_lincRNA																							TAAAAATAGCTTTTTAAAATT	0.338																																					.													.	.			0			.																																											0	.			AATAGCTTTTTAA																													2.37:g.56210467delT			10	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000606639.1	37																																																																																						0.338	RP11-481J13.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000470754.1			
VRK2	7444	bcgsc.ca;mdanderson.org	37	2	58316777	58316777	+	Silent	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:58316777G>T	ENST00000435505.2	+	10	1207	c.462G>T	c.(460-462)ctG>ctT	p.L154L	VRK2_ENST00000417641.2_Silent_p.L154L|VRK2_ENST00000340157.4_Silent_p.L154L|VRK2_ENST00000412104.2_Silent_p.L154L|VRK2_ENST00000440705.2_Silent_p.L131L			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	154	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TGGATGTACTGGAATATATAC	0.284																																					p.L154L													.	VRK2	46		0			c.G462T												64.0	70.0	68.0					2																	58316777		2202	4292	6494	SO:0001819	synonymous_variant	7444	exon7			TGTACTGGAATAT	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.462G>T	2.37:g.58316777G>T			407	0	0		553	0.02	13	NM_001130480	8	0.13	1	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Silent	SNP	ENST00000435505.2	37	CCDS1859.1																																																																																					0.284	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325304.2	rescued with RNA-seq	NM_006296	
VRK2	7444	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	58316816	58316816	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:58316816A>G	ENST00000435505.2	+	10	1246	c.501A>G	c.(499-501)atA>atG	p.I167M	VRK2_ENST00000417641.2_Missense_Mutation_p.I167M|VRK2_ENST00000340157.4_Missense_Mutation_p.I167M|VRK2_ENST00000412104.2_Missense_Mutation_p.I167M|VRK2_ENST00000440705.2_Missense_Mutation_p.I144M			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	167	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		I -> V (in dbSNP:rs1051061). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16704422, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9344656}.		cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						ATGGTGATATAAAAGCAGCAA	0.284																																					p.I167M													.	VRK2	46		0			c.A501G												77.0	83.0	81.0					2																	58316816		2203	4293	6496	SO:0001583	missense	7444	exon7			TGATATAAAAGCA	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.501A>G	2.37:g.58316816A>G	ENSP00000408002:p.Ile167Met		458	0	0		629	0.03	16	NM_001130480	15	0.07	1	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	37	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446296	0.63178	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000423109;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.67	3.21	0.36854	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	M	0.92970	3.365	0.37098	D	0.89974	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.997;0.998	T	0.68116	-0.5494	10	0.87932	D	0	-24.1341	6.6028	0.22710	0.6791:0.1256:0.0:0.1953	.	171;167;167;167	B7Z2X1;Q86Y07-2;Q86Y07-5;Q86Y07	.;.;.;VRK2_HUMAN	M	167;167;171;167;167;167;144	ENSP00000408002:I167M;ENSP00000402375:I167M;ENSP00000404156:I167M;ENSP00000342381:I167M;ENSP00000398323:I144M	ENSP00000342381:I167M	I	+	3	3	VRK2	58170320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.091000	0.30915	2.150000	0.67090	0.477000	0.44152	ATA			0.284	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325304.2	rescued with RNA-seq	NM_006296	
ANKRD36BP2	645784	broad.mit.edu	37	2	89104503	89104504	+	RNA	INS	-	-	C	rs149625899|rs67367050	byFrequency	TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:89104503_89104504insC	ENST00000393525.3	+	0	4868									ankyrin repeat domain 36B pseudogene 2																		gtagatttttttcagattttgg	0.307													-|-|C|insertion	512	0.102236	0.1067	0.0965	5008	,	,		29304	0.0694		0.1064	False		,,,				2504	0.1299				.													.	.			0			.																																											0	.			ATTTTTTTCAGAT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104503_89104504insC			6	0	0		17	0.53	9	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.307	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
DNAJC10	54431	bcgsc.ca;mdanderson.org	37	2	183582950	183582950	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:183582950C>T	ENST00000264065.7	+	3	552	c.137C>T	c.(136-138)gCa>gTa	p.A46V	DNAJC10_ENST00000469118.1_3'UTR|DNAJC10_ENST00000537515.1_Missense_Mutation_p.A46V	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	46	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCCAAAACTGCAAGCAGTAGA	0.348																																					p.A46V	Pancreas(56;860 1183 25669 35822 48585)												DNAJC10,NS,malignant_melanoma,+1,1	DNAJC10	76	1	0			c.C137T												83.0	86.0	85.0					2																	183582950		2203	4300	6503	SO:0001583	missense	54431	exon3			AAACTGCAAGCAG		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.137C>T	2.37:g.183582950C>T	ENSP00000264065:p.Ala46Val		77	0	0		104	0.05	5	NM_001271581	16	0.00	0	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	C	32	5.183057	0.94885	.	.	ENSG00000077232	ENST00000264065;ENST00000392392;ENST00000537410;ENST00000537515	T;T	0.39229	1.09;1.09	5.67	5.67	0.87782	Heat shock protein DnaJ, N-terminal (5);	0.111999	0.64402	D	0.000011	T	0.67961	0.2949	M	0.83384	2.64	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.66602	0.945;0.89	T	0.72194	-0.4364	10	0.87932	D	0	.	18.7591	0.91843	0.0:1.0:0.0:0.0	.	46;46	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	V	46	ENSP00000264065:A46V;ENSP00000441560:A46V	ENSP00000264065:A46V	A	+	2	0	DNAJC10	183291195	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	7.715000	0.84713	2.676000	0.91093	0.650000	0.86243	GCA			0.348	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334418.2		NM_018981	
NCL	4691	hgsc.bcm.edu;broad.mit.edu	37	2	232325382	232325384	+	In_Frame_Del	DEL	TCC	TCC	-	rs140018754		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	TCC	TCC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr2:232325382_232325384delTCC	ENST00000322723.4	-	4	1047_1049	c.807_809delGGA	c.(805-810)gaggaa>gaa	p.269_270EE>E	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	269	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TTAAGTACCTTCCTCCTCCTCTT	0.409																																					p.270_270del													.	NCL	80		0			c.808_810del									1,0,4265		0,0,1,0,0,2132						4.7	0.3			220	4,5,8245		0,0,4,0,5,4118	no	codingComplex	NCL	NM_005381.2		0,0,5,0,5,6250	A1A1,A1A2,A1R,A2A2,A2R,RR		0.109,0.0234,0.0799				5,5,12510				SO:0001651	inframe_deletion	4691	exon4			GTACCTTCCTCCT		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.807_809delGGA	2.37:g.232325388_232325390delTCC	ENSP00000318195:p.Glu271del		142	0	0		196	0.08	16	NM_005381	215	0.00	0	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	In_Frame_Del	DEL	ENST00000322723.4	37	CCDS33397.1																																																																																					0.409	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000332731.1		NM_005381	
SNRPB	6628	hgsc.bcm.edu	37	20	2443617	2443617	+	Intron	SNP	A	A	G			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr20:2443617A>G	ENST00000438552.2	-	5	722				SNORD119_ENST00000515997.1_RNA|SNRPB_ENST00000339610.6_Intron|SNRPB_ENST00000381342.2_Intron	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						TGGATCTCAGAGTAATCCTGC	0.448																																					.													.	.			0			.																																									SO:0001627	intron_variant	100113378	.			TCTCAGAGTAATC		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.559+117T>C	20.37:g.2443617A>G			38	0	0		68	0.06	4	.	1	0.00	0	Q15490|Q6IB35|Q9UIS5	RNA	SNP	ENST00000438552.2	37	CCDS13026.1																																																																																					0.448	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077585.2			
PMEPA1	56937	broad.mit.edu	37	20	56284608	56284608	+	Missense_Mutation	SNP	C	C	T	rs532526691		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr20:56284608C>T	ENST00000341744.3	-	1	350	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	PMEPA1_ENST00000265626.4_Intron|PMEPA1_ENST00000347215.4_Intron|PMEPA1_ENST00000472841.1_Intron|PMEPA1_ENST00000395816.3_Intron	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	11					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						gcggcggcggcggTGCTGTTG	0.751													.|||	1	0.000199681	0.0	0.0	5008	,	,		3302	0.0		0.0	False		,,,				2504	0.001				p.A11T													.	PMEPA1	29		0			c.G31A												21.0	18.0	19.0					20																	56284608		2097	4124	6221	SO:0001583	missense	56937	exon1			CGGCGGCGGTGCT	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.31G>A	20.37:g.56284608C>T	ENSP00000345826:p.Ala11Thr		98	0	0		134	0.03	4	NM_020182	1	0.00	0	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	ENST00000341744.3	37	CCDS13463.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739763	0.49045	.	.	ENSG00000124225	ENST00000341744;ENST00000395819	T;T	0.54279	0.84;0.58	2.87	2.87	0.33458	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.80722	D	1	B	0.24576	0.106	B	0.11329	0.006	T	0.05971	-1.0853	9	0.14656	T	0.56	-6.3608	11.1595	0.48507	0.0:1.0:0.0:0.0	.	11	Q969W9	PMEPA_HUMAN	T	11	ENSP00000345826:A11T;ENSP00000379164:A11T	ENSP00000345826:A11T	A	-	1	0	PMEPA1	55718014	0.998000	0.40836	0.975000	0.42487	0.817000	0.46193	1.549000	0.36212	1.142000	0.42291	0.163000	0.16589	GCC			0.751	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079858.2		NM_020182	
ZNF831	128611	mdanderson.org	37	20	57766775	57766775	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr20:57766775G>T	ENST00000371030.2	+	1	701	c.701G>T	c.(700-702)tGc>tTc	p.C234F		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	234							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GAGAGCAGGTGCCAGGGGATG	0.697																																					p.C234F													.	.			0			c.G701T												26.0	32.0	30.0					20																	57766775		1887	4115	6002	SO:0001583	missense	128611	exon1			GCAGGTGCCAGGG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.701G>T	20.37:g.57766775G>T	ENSP00000360069:p.Cys234Phe		37	0	0		56	0.05	3	NM_178457	0		0	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	0.622	-0.820887	0.02755	.	.	ENSG00000124203	ENST00000371030	T	0.04406	3.63	3.64	-2.35	0.06684	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44375	-0.9332	9	0.49607	T	0.09	.	5.1695	0.15103	0.4752:0.1522:0.3726:0.0	.	234	Q5JPB2	ZN831_HUMAN	F	234	ENSP00000360069:C234F	ENSP00000360069:C234F	C	+	2	0	ZNF831	57200170	0.000000	0.05858	0.010000	0.14722	0.003000	0.03518	-1.294000	0.02767	-0.018000	0.14079	-0.224000	0.12420	TGC			0.697	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000079916.2		NM_178457	
LAMA5	3911	mdanderson.org	37	20	60886347	60886347	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr20:60886347C>T	ENST00000252999.3	-	73	10025	c.9959G>A	c.(9958-9960)cGt>cAt	p.R3320H	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3320					angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGCGGGCTGACGGCTGCGGCG	0.692																																					p.R3320H													.	.			0			c.G9959A												28.0	27.0	27.0					20																	60886347		2189	4283	6472	SO:0001583	missense	3911	exon73			GGCTGACGGCTGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9959G>A	20.37:g.60886347C>T	ENSP00000252999:p.Arg3320His		58	0	0		63	0.05	3	NM_005560	5	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	c	14.62	2.589449	0.46214	.	.	ENSG00000130702	ENST00000252999	T	0.19669	2.13	4.6	1.35	0.21983	.	0.449907	0.20392	N	0.093237	T	0.14399	0.0348	L	0.47716	1.5	0.09310	N	0.999999	B	0.12630	0.006	B	0.06405	0.002	T	0.17623	-1.0363	10	0.52906	T	0.07	.	2.0538	0.03577	0.1586:0.4919:0.155:0.1945	.	3320	O15230	LAMA5_HUMAN	H	3320	ENSP00000252999:R3320H	ENSP00000252999:R3320H	R	-	2	0	LAMA5	60319742	0.960000	0.32886	0.817000	0.32601	0.096000	0.18686	0.475000	0.22164	0.931000	0.37242	0.486000	0.48141	CGT			0.692	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
EEF1A2	1917	broad.mit.edu	37	20	62120282	62120282	+	Missense_Mutation	SNP	T	T	G	rs200931909		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr20:62120282T>G	ENST00000298049.7	-	6	1323	c.1253A>C	c.(1252-1254)tAc>tCc	p.Y418S	EEF1A2_ENST00000217182.3_Missense_Mutation_p.Y418S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	418					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.Y418S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GAGAGGCGGGTACTGGGAGAA	0.667																																					p.Y418S													EEF1A2,bladder,carcinoma,0,5	EEF1A2	60	5	1	Substitution - Missense(1)	lung(1)	c.A1253C												28.0	29.0	29.0					20																	62120282		2189	4283	6472	SO:0001583	missense	1917	exon7			GGCGGGTACTGGG	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1253A>C	20.37:g.62120282T>G	ENSP00000298049:p.Tyr418Ser		66	0.2121212121	14		113	0.21	24	NM_001958	7	0.00	0	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	ENST00000298049.7	37	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511359	0.64522	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.44881	0.91;0.91	3.12	3.12	0.35913	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.170048	0.39759	N	0.001263	T	0.74405	0.3712	H	0.96142	3.775	0.80722	D	1	P	0.39696	0.683	D	0.68039	0.955	T	0.79629	-0.1724	10	0.87932	D	0	-10.4709	11.6664	0.51376	0.0:0.0:0.0:1.0	.	418	Q05639	EF1A2_HUMAN	S	418	ENSP00000298049:Y418S;ENSP00000217182:Y418S	ENSP00000217182:Y418S	Y	-	2	0	EEF1A2	61590726	1.000000	0.71417	0.999000	0.59377	0.696000	0.40369	5.966000	0.70395	1.187000	0.43000	0.392000	0.25879	TAC			0.667	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080495.1		NM_001958	
BAGE2	85319	broad.mit.edu	37	21	11064923	11064923	+	RNA	DEL	G	G	-	rs58468775		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr21:11064923delG	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccggccacttgggaggctgag	0.527																																					.													.	.			0			.																																											85319	.			CCACTTGGGAGGC	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11064923delG			5	0	0		6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.527	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
AC008132.13	0	broad.mit.edu	37	22	18842958	18842958	+	Intron	SNP	G	G	T	rs3875977	byFrequency	TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr22:18842958G>T	ENST00000412938.1	+	4	2208																											CCAGGAGGTGGCCTGGGCACC	0.572																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			GAGGTGGCCTGGG																												ENST00000412938.1:c.2209-345G>T	22.37:g.18842958G>T			60	0.0166666667	1		87	0.09	8	.	0		0		RNA	SNP	ENST00000412938.1	37																																																																																						0.572	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
FGD5	152273	mdanderson.org	37	3	14940334	14940334	+	Splice_Site	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr3:14940334G>T	ENST00000285046.5	+	7	3264		c.e7+1		FGD5_ENST00000476851.1_Splice_Site|FGD5_ENST00000543601.1_Splice_Site	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5						actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						CTCCTCACAGGTGGGCCCCAC	0.622																																					.													.	.			0			c.3154+1G>T												23.0	26.0	25.0					3																	14940334		1992	4142	6134	SO:0001630	splice_region_variant	152273	exon7			TCACAGGTGGGCC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3154+1G>T	3.37:g.14940334G>T			39	0	0		52	0.06	3	NM_152536	0		0	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Splice_Site	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289343	0.59976	.	.	ENSG00000154783	ENST00000285046;ENST00000543601;ENST00000457774	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7792	0.57466	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FGD5	14915338	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.289000	0.72696	2.059000	0.61396	0.591000	0.81541	.			0.622	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340628.1		NM_152536	Intron
SATB1	6304	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	18458414	18458414	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr3:18458414C>T	ENST00000338745.6	-	3	2102	c.368G>A	c.(367-369)aGc>aAc	p.S123N	SATB1_ENST00000475083.1_5'UTR|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.S123N|SATB1_ENST00000417717.2_Missense_Mutation_p.S123N	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	123	PDZ-like dimerization domain.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GGCAGCAGAGCTATGTGAATA	0.418																																					p.S123N													SATB1,NS,carcinoma,-1,1	SATB1	-1	1	0			c.G368A												176.0	157.0	163.0					3																	18458414		2203	4300	6503	SO:0001583	missense	6304	exon3			GCAGAGCTATGTG		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.368G>A	3.37:g.18458414C>T	ENSP00000341024:p.Ser123Asn		83	0	0		99	0.06	6	NM_002971	4	0.00	0	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	37	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291231	0.40494	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717;ENST00000440737;ENST00000452260;ENST00000415069;ENST00000457005	T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;0.71	5.33	5.33	0.75918	.	0.038908	0.85682	D	0.000000	D	0.88112	0.6349	L	0.58101	1.795	0.80722	D	1	D;B	0.67145	0.996;0.379	D;B	0.68192	0.956;0.105	D	0.88536	0.3106	10	0.66056	D	0.02	-16.3973	19.3886	0.94570	0.0:1.0:0.0:0.0	.	123;123	Q01826-2;Q01826	.;SATB1_HUMAN	N	123	ENSP00000341024:S123N;ENSP00000399708:S123N;ENSP00000399518:S123N;ENSP00000402982:S123N;ENSP00000406727:S123N;ENSP00000390529:S123N;ENSP00000398072:S123N	ENSP00000341024:S123N	S	-	2	0	SATB1	18433418	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.776000	0.85560	2.646000	0.89796	0.561000	0.74099	AGC			0.418	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252138.4		NM_001131010	
STAB1	23166	mdanderson.org	37	3	52557097	52557097	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr3:52557097G>T	ENST00000321725.6	+	63	7043	c.6967G>T	c.(6967-6969)Ggg>Tgg	p.G2323W		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2323	FAS1 7. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CACGTGCAATGGGAAGCTGCT	0.627																																					p.G2323W													.	.			0			c.G6967T												94.0	94.0	94.0					3																	52557097		2202	4300	6502	SO:0001583	missense	23166	exon63			TGCAATGGGAAGC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6967G>T	3.37:g.52557097G>T	ENSP00000312946:p.Gly2323Trp		57	0	0		46	0.07	3	NM_015136	9	0.00	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247343	0.59103	.	.	ENSG00000010327	ENST00000321725	D	0.92099	-2.97	5.74	5.74	0.90152	FAS1 domain (2);	0.184631	0.46758	D	0.000279	D	0.96371	0.8816	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96431	0.9319	10	0.87932	D	0	.	19.5294	0.95222	0.0:0.0:1.0:0.0	.	210;2323	B3KSK0;Q9NY15	.;STAB1_HUMAN	W	2323	ENSP00000312946:G2323W	ENSP00000312946:G2323W	G	+	1	0	STAB1	52532137	1.000000	0.71417	0.996000	0.52242	0.068000	0.16541	7.637000	0.83313	2.712000	0.92718	0.561000	0.74099	GGG			0.627	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351380.2		NM_015136	
TNIP2	79155	mdanderson.org	37	4	2749517	2749517	+	Silent	SNP	G	G	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr4:2749517G>A	ENST00000315423.7	-	2	518	c.432C>T	c.(430-432)tgC>tgT	p.C144C	TNIP2_ENST00000505186.1_5'Flank|TNIP2_ENST00000510267.1_Silent_p.C37C|TNIP2_ENST00000503235.1_Silent_p.C144C	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCAAGGAGCGGCACAGGACGT	0.647																																					p.C144C													.	.			0			c.C432T												120.0	114.0	116.0					4																	2749517		2203	4300	6503	SO:0001819	synonymous_variant	79155	exon2			GGAGCGGCACAGG	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.432C>T	4.37:g.2749517G>A			54	0	0		42	0.07	3	NM_024309	8	0.00	0		Silent	SNP	ENST00000315423.7	37	CCDS3362.1																																																																																					0.647	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206589.5		NM_024309	
KIT	3815	broad.mit.edu;bcgsc.ca	37	4	55593628	55593654	+	In_Frame_Del	DEL	GAAACAATTATGTTTACATAGACCCAA	GAAACAATTATGTTTACATAGACCCAA	-	rs587778431|rs200945282		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	GAAACAATTATGTTTACATAGACCCAA	GAAACAATTATGTTTACATAGACCCAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr4:55593628_55593654delGAAACAATTATGTTTACATAGACCCAA	ENST00000288135.5	+	11	1791_1817	c.1694_1720delGAAACAATTATGTTTACATAGACCCAA	c.(1693-1722)ggaaacaattatgtttacatagacccaaca>gca	p.565_574GNNYVYIDPT>A		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	565	Important for interaction with phosphotyrosine-binding proteins.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y570_L576del(9)|p.P573L(4)|p.V560_L576del(4)|p.N566N(4)|p.Y553_T574>S(3)|p.V559_G565del(3)|p.N567K(3)|p.V555_I571del(3)|p.V555_P573del(3)|p.I563_L576del(2)|p.Q556_L576del(2)|p.W557_P573>S(2)|p.Y568D(2)|p.N564_Y578del(2)|p.W557_Q575del(2)|p.N564_L576del(2)|p.I571_L576del(2)|p.Y568_T574del(2)|p.N566D(2)|p.D572N(2)|p.I571_N587del(1)|p.V555_G565del(1)|p.Y568Y(1)|p.Q556_N566>SNNLQLY(1)|p.Y568_L576>CV(1)|p.I563_D572del(1)|p.Y570D(1)|p.Y568S(1)|p.G565E(1)|p.E562_V569>D(1)|p.E561_P577del(1)|p.E562_P573del(1)|p.K558_G565del(1)|p.E554_I571del(1)|p.K558_Q575del(1)|p.V569_D572del(1)|p.V555_Y570del(1)|p.V569_L576del(1)|p.M552_T574>TESA(1)|p.571_572>GE(1)|p.V559_I571del(1)|p.Q556_D572>PS(1)|p.V555_N566>D(1)|p.I571L(1)|p.Y568C(1)|p.G565V(1)|p.Q556_D572del(1)|p.I571R(1)|p.V569G(1)|p.V569A(1)|p.N564_P573>T(1)|p.P573_T574insYIDP(1)|p.V569I(1)|p.K558_L576>NV(1)|p.V559_P573>A(1)|p.V560_I571del(1)|p.W557_I571del(1)|p.Y570*(1)|p.V569_Q575del(1)|p.V569_L576>G(1)|p.N564_P577del(1)|p.I571M(1)|p.V559_L576del(1)|p.N564_T574del(1)|p.K558_D572del(1)|p.Y570_L576delYIDPTQL(1)|p.N566S(1)|p.Q556_D572>H(1)|p.K558_Y570>N(1)|p.N567_L576>E(1)|p.D572Y(1)|p.M552_D572del(1)|p.Q556_T574del(1)|p.D572A(1)|p.Q556_P573del(1)|p.E554_D572del(1)|p.D572D(1)|p.T574A(1)|p.N567_P573del(1)|p.N567H(1)|p.N564_P573>TS(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCC	0.392		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.565_574del			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,caecum,carcinoma,+1,5	KIT	7396	5	119	Deletion - In frame(62)|Substitution - Missense(29)|Complex - deletion inframe(19)|Substitution - coding silent(6)|Substitution - Nonsense(1)|Complex - insertion inframe(1)|Insertion - In frame(1)	soft_tissue(93)|skin(10)|haematopoietic_and_lymphoid_tissue(7)|eye(4)|lung(3)|testis(1)|ovary(1)	c.1694_1720del																																									SO:0001651	inframe_deletion	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TAAATGGAAACAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1694_1720delGAAACAATTATGTTTACATAGACCCAA	4.37:g.55593628_55593654delGAAACAATTATGTTTACATAGACCCAA	ENSP00000288135:p.Gly565_Thr574delinsAla		126	0	0		158	0.05	8	NM_000222	0		0	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	In_Frame_Del	DEL	ENST00000288135.5	37	CCDS3496.1																																																																																					0.392	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
DSPP	1834	bcgsc.ca	37	4	88537036	88537036	+	Silent	SNP	C	C	T	rs111205183		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr4:88537036C>T	ENST00000282478.7	+	4	3255	c.3222C>T	c.(3220-3222)gaC>gaT	p.D1074D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1074D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1074	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagcgaca	0.537																																					p.D1074D													DSPP,NS,carcinoma,0,1	DSPP	174	1	0			c.C3222T												57.0	64.0	62.0					4																	88537036		1567	2840	4407	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3222C>T	4.37:g.88537036C>T			60	0	0		84	0.13	11	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
JMY	133746	mdanderson.org	37	5	78532852	78532852	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr5:78532852C>T	ENST00000396137.4	+	1	841	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	DMGDH_ENST00000520388.1_5'Flank	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	127					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		GGGGGACCCGCGGCTGCGGAG	0.687																																					p.R127W													.	.			0			c.C379T												4.0	6.0	5.0					5																	78532852		649	1515	2164	SO:0001583	missense	133746	exon1			GACCCGCGGCTGC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.379C>T	5.37:g.78532852C>T	ENSP00000379441:p.Arg127Trp		21	0	0		39	0.08	3	NM_152405	0		0	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	9.019	0.984344	0.18889	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.07021	3.23	3.59	-0.717	0.11208	.	.	.	.	.	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	D	0.54772	0.968	B	0.36959	0.237	T	0.39683	-0.9602	9	0.56958	D	0.05	.	3.6652	0.08253	0.1751:0.4855:0.0:0.3395	.	127	Q8N9B5	JMY_HUMAN	W	127	ENSP00000379441:R127W	ENSP00000282259:R127W	R	+	1	2	JMY	78568608	0.000000	0.05858	0.001000	0.08648	0.110000	0.19582	-0.749000	0.04813	-0.146000	0.11274	0.462000	0.41574	CGG			0.687	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254070.4		NM_152405	
SLC12A2	6558	broad.mit.edu	37	5	127420309	127420309	+	Silent	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr5:127420309G>T	ENST00000262461.2	+	1	852	c.663G>T	c.(661-663)gtG>gtT	p.V221V	CTC-228N24.3_ENST00000501702.2_lincRNA|SLC12A2_ENST00000343225.4_Silent_p.V221V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	221					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGGACGCTGTGCCCAGGATCG	0.637																																					p.V221V													.	SLC12A2	119		0			c.G663T												63.0	63.0	63.0					5																	127420309		2178	4241	6419	SO:0001819	synonymous_variant	6558	exon1			CGCTGTGCCCAGG		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.663G>T	5.37:g.127420309G>T			158	0.0126582278	2		244	0.04	10	NM_001046	9	0.00	0	Q8N713|Q8WWH7	Silent	SNP	ENST00000262461.2	37	CCDS4144.1																																																																																					0.637	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250972.1		NM_001046	
SOGA3	387104	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	127804080	127804080	+	Missense_Mutation	SNP	T	T	C	rs34142169		TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr6:127804080T>C	ENST00000525778.1	-	5	2280	c.1535A>G	c.(1534-1536)aAg>aGg	p.K512R	SOGA3_ENST00000556132.1_Missense_Mutation_p.K512R|SOGA3_ENST00000465909.2_Missense_Mutation_p.K512R|SOGA3_ENST00000368268.2_Missense_Mutation_p.K512R|SOGA3_ENST00000481848.2_Missense_Mutation_p.K512R			Q5TF21	SOGA3_HUMAN	SOGA family member 3	512					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CTGTTGAGCCTTTTTTTCAGA	0.294																																					p.K512R													C6orf174,right_upper_lobe,carcinoma,0,1	C6orf174	0	1	0			c.A1535G												133.0	121.0	125.0					6																	127804080		1790	4063	5853	SO:0001583	missense	387104	exon5			TGAGCCTTTTTTT	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1535A>G	6.37:g.127804080T>C	ENSP00000434570:p.Lys512Arg		91	0.010989011	1		120	0.05	6	NM_001012279	0		0		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.244722	0.39697	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.71	4.55	0.56014	.	0.138296	0.64402	N	0.000004	T	0.17023	0.0409	L	0.45137	1.4	0.47123	D	0.999325	B	0.18863	0.031	B	0.17098	0.017	T	0.04796	-1.0926	10	0.25751	T	0.34	-29.6827	9.5111	0.39078	0.0:0.0883:0.0:0.9117	.	512	Q5TF21	CF174_HUMAN	R	512	ENSP00000451768:K512R;ENSP00000357251:K512R;ENSP00000434570:K512R;ENSP00000435559:K512R	ENSP00000435559:K512R	K	-	2	0	C6orf174	127845773	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	3.156000	0.50708	0.979000	0.38497	0.528000	0.53228	AAG			0.294	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388246.1		NM_001012279	
TBP	6908	broad.mit.edu;mdanderson.org	37	6	170871034	170871034	+	Silent	SNP	G	G	A			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr6:170871034G>A	ENST00000392092.2	+	3	489	c.210G>A	c.(208-210)caG>caA	p.Q70Q	TBP_ENST00000230354.6_Silent_p.Q70Q|TBP_ENST00000540980.1_Silent_p.Q50Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	70	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcaacagc	0.572																																					p.Q70Q													.	TBP	58		0			c.G210A												20.0	24.0	23.0					6																	170871034		2049	3974	6023	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAGCAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.210G>A	6.37:g.170871034G>A			59	0.0169491525	1		87	0.05	4	NM_003194	6	0.00	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																					0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000043271.2		NM_003194	
MALSU1	115416	mdanderson.org	37	7	23349084	23349084	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr7:23349084G>T	ENST00000466681.1	+	4	780	c.627G>T	c.(625-627)gaG>gaT	p.E209D		NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	209					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											TAGCACCTGAGACAGTACCTG	0.368																																					p.E209D													.	.			0			c.G627T												121.0	113.0	116.0					7																	23349084		2203	4300	6503	SO:0001583	missense	115416	exon4			ACCTGAGACAGTA	BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.627G>T	7.37:g.23349084G>T	ENSP00000419370:p.Glu209Asp		40	0	0		71	0.06	4	NM_138446	200	0.00	0	A4D154	Missense_Mutation	SNP	ENST00000466681.1	37	CCDS5381.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640626	0.47153	.	.	ENSG00000156928	ENST00000466681	.	.	.	5.46	1.45	0.22620	.	0.084400	0.48286	D	0.000194	T	0.35508	0.0934	N	0.24115	0.695	0.28437	N	0.916998	D	0.67145	0.996	P	0.58266	0.836	T	0.19321	-1.0309	9	0.56958	D	0.05	-6.1559	9.085	0.36577	0.4622:0.0:0.5378:0.0	.	209	Q96EH3	CG030_HUMAN	D	209	.	ENSP00000419370:E209D	E	+	3	2	C7orf30	23315609	0.863000	0.29885	0.984000	0.44739	0.930000	0.56654	0.769000	0.26604	0.235000	0.21160	0.591000	0.81541	GAG			0.368	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250241.2		NM_138446	
EPPK1	83481	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	8	144940633	144940633	+	Silent	SNP	C	C	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr8:144940633C>T	ENST00000525985.1	-	2	6860	c.6789G>A	c.(6787-6789)ctG>ctA	p.L2263L				P58107	EPIPL_HUMAN	epiplakin 1	2263						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGCGCCTCCAGCAGCACCA	0.726																																					p.L2263L													.	.			0			c.G6789A												39.0	38.0	39.0					8																	144940633		2149	4248	6397	SO:0001819	synonymous_variant	83481	exon1			CGCCTCCAGCAGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6789G>A	8.37:g.144940633C>T			46	0	0		77	0.09	7	NM_031308	3	0.00	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																						0.726	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382675.1		NM_031308	
CDKN2A	1029	broad.mit.edu	37	9	21974753	21974753	+	Missense_Mutation	SNP	A	A	C			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr9:21974753A>C	ENST00000304494.5	-	1	344	c.74T>G	c.(73-75)gTa>gGa	p.V25G	CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000498124.1_Missense_Mutation_p.V25G|CDKN2A_ENST00000498628.2_Intron|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000446177.1_Missense_Mutation_p.V25G|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000579122.1_Missense_Mutation_p.V25G	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	25					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.0(1)|p.R22fs*14(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CACCTCCTCTACCCGACCCCG	0.736		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.V25G													CDKN2A_ENST00000498124,NS,carcinoma,0,3	CDKN2A	4810	3	1340	Whole gene deletion(1316)|Unknown(23)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(278)|skin(168)|central_nervous_system(163)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(50)|upper_aerodigestive_tract(47)|ovary(34)|kidney(31)|breast(30)|pancreas(29)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.T74G												19.0	24.0	22.0					9																	21974753		1918	3904	5822	SO:0001583	missense	1029	exon1			TCCTCTACCCGAC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.74T>G	9.37:g.21974753A>C	ENSP00000307101:p.Val25Gly		50	0.12	6		84	0.27	23	NM_058197	1	0.00	0	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972849	0.74246	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	D;D	0.91686	-2.89;-2.89	4.89	-9.23	0.00672	Ankyrin repeat-containing domain (3);	.	.	.	.	D	0.88284	0.6395	M	0.79258	2.445	0.09310	N	0.999991	P;P	0.43938	0.616;0.822	B;B	0.38225	0.215;0.268	T	0.81895	-0.0723	9	0.54805	T	0.06	.	9.0958	0.36638	0.6788:0.0:0.1437:0.1776	.	25;25	P42771;G3XAG3	CD2A1_HUMAN;.	G	25	ENSP00000307101:V25G;ENSP00000394932:V25G	ENSP00000307101:V25G	V	-	2	0	CDKN2A	21964753	0.000000	0.05858	0.000000	0.03702	0.362000	0.29581	-2.700000	0.00824	-2.114000	0.00832	-0.899000	0.02877	GTA			0.736	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000051915.1		NM_000077	
DNAI1	27019	mdanderson.org	37	9	34483453	34483453	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chr9:34483453G>T	ENST00000242317.4	+	2	227	c.56G>T	c.(55-57)aGc>aTc	p.S19I	DNAI1_ENST00000545019.1_Missense_Mutation_p.S19I	NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	19					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		TAGAGCATCAGCATAGGCAGA	0.388									Kartagener syndrome																												p.S19I													.	.			0			c.G56T												137.0	127.0	131.0					9																	34483453		2203	4300	6503	SO:0001583	missense	27019	exon2	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GCATCAGCATAGG	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.56G>T	9.37:g.34483453G>T	ENSP00000242317:p.Ser19Ile		33	0	0		47	0.06	3	NM_012144	0		0	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	ENST00000242317.4	37	CCDS6557.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950253	0.34377	.	.	ENSG00000122735	ENST00000242317;ENST00000545019	T;T	0.75589	-0.95;1.33	4.21	-8.42	0.00957	.	1.674770	0.02697	N	0.111374	T	0.56572	0.1994	L	0.36672	1.1	0.09310	N	1	B;B	0.25169	0.119;0.0	B;B	0.22753	0.041;0.0	T	0.45396	-0.9264	10	0.34782	T	0.22	.	1.6163	0.02704	0.4292:0.2589:0.1383:0.1737	.	19;19	B7Z7U1;Q9UI46	.;DNAI1_HUMAN	I	19	ENSP00000242317:S19I;ENSP00000443667:S19I	ENSP00000242317:S19I	S	+	2	0	DNAI1	34473453	0.000000	0.05858	0.000000	0.03702	0.896000	0.52359	-3.645000	0.00405	-3.361000	0.00179	-0.391000	0.06502	AGC			0.388	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052192.1			
UBA1	7317	mdanderson.org	37	X	47065031	47065031	+	Intron	SNP	G	G	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chrX:47065031G>T	ENST00000335972.6	+	15	1758				UBA1_ENST00000377269.3_5'Flank|UBA1_ENST00000490869.1_Intron|INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Intron	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1						cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						tggggccgaggtctttgagct	0.517																																					.													.	.			0			.																																									SO:0001627	intron_variant	8552	.			GCCGAGGTCTTTG	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1576-316G>T	X.37:g.47065031G>T			37	0	0		46	0.07	3	.	3	0.00	0	Q5JRR8|Q96E13	RNA	SNP	ENST00000335972.6	37	CCDS14275.1																																																																																					0.517	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056389.1		NM_003334	
MAMLD1	10046	broad.mit.edu	37	X	149639635	149639635	+	Missense_Mutation	SNP	A	A	T			TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chrX:149639635A>T	ENST00000370401.2	+	4	2100	c.1790A>T	c.(1789-1791)cAg>cTg	p.Q597L	MAMLD1_ENST00000262858.5_Missense_Mutation_p.Q597L|MAMLD1_ENST00000426613.2_Missense_Mutation_p.Q572L|MAMLD1_ENST00000432680.2_Missense_Mutation_p.Q572L|MAMLD1_ENST00000455522.2_Missense_Mutation_p.Q78L			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	597	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TTgcagctgcagcagcagcag	0.607																																					p.Q597L													.	MAMLD1	263		0			c.A1790T												67.0	59.0	62.0					X																	149639635		2203	4300	6503	SO:0001583	missense	10046	exon3			AGCTGCAGCAGCA	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1790A>T	X.37:g.149639635A>T	ENSP00000359428:p.Gln597Leu		139	0.0071942446	1		182	0.02	4	NM_005491	0		0	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.	.	.	.	.	.	.	.	.	.	A	11.70	1.717048	0.30413	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613;ENST00000455522	T;T;T;T;T	0.68181	0.18;-0.31;0.18;0.17;0.83	3.95	-2.22	0.06952	.	0.914301	0.09376	N	0.810639	T	0.65565	0.2703	L	0.44542	1.39	0.26213	N	0.979273	P;P;P;P	0.51351	0.835;0.835;0.944;0.835	P;P;P;P	0.49999	0.529;0.529;0.628;0.529	T	0.63198	-0.6691	10	0.66056	D	0.02	-0.2357	12.9577	0.58441	0.4497:0.5503:0.0:0.0	.	469;572;572;597	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	L	469;597;572;597;572;78	ENSP00000359428:Q597L;ENSP00000414517:Q572L;ENSP00000262858:Q597L;ENSP00000397438:Q572L;ENSP00000389106:Q78L	ENSP00000262858:Q597L	Q	+	2	0	MAMLD1	149390293	0.130000	0.22417	0.006000	0.13384	0.394000	0.30568	0.878000	0.28126	-0.614000	0.05687	-0.496000	0.04628	CAG			0.607	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000060844.2		NM_005491	
AVPR2	554	broad.mit.edu	37	X	153171699	153171710	+	In_Frame_Del	DEL	CGCCGCAGGGGA	CGCCGCAGGGGA	-	rs34709504|rs193922118|rs376722368|rs149668713	byFrequency	TCGA-ZM-AA0F-01A-21D-A435-10	TCGA-ZM-AA0F-10A-01D-A438-10	CGCCGCAGGGGA	CGCCGCAGGGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	8a8a23d5-716d-4e90-ab83-cfa3c3eccdad	29ee93c7-6fcd-4a76-bc26-beaa899b9be9	g.chrX:153171699_153171710delCGCCGCAGGGGA	ENST00000358927.2	+	3	948_959	c.739_750delCGCCGCAGGGGA	c.(739-750)cgccgcaggggadel	p.RRRG247del	AVPR2_ENST00000337474.5_In_Frame_Del_p.RRRG247del|AVPR2_ENST00000370049.1_In_Frame_Del_p.RRRG247del			P30518	V2R_HUMAN	arginine vasopressin receptor 2	247			Missing (in XNDI). {ECO:0000269|PubMed:1303257}.|R -> H (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)	p.R247_G250delRRRG(2)|p.R247H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GCCTGGGGGGCGCCGCAGGGGACGCCGGACAG	0.646														2	0.000529801	0.0	0.0	3775	,	,		15181	0.0		0.002	False		,,,				2504	0.0				p.247_250del													.	AVPR2	43		3	Deletion - In frame(2)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	c.739_750del	GRCh37	CD920835|CD941610	AVPR2	D	rs149668713			,	18,3701		0,2,16,1589,521					,	1.1	0.0			63	22,6462		0,19,3,2338,1767	no	coding,coding	AVPR2	NM_001146151.1,NM_000054.4	,	0,21,19,3927,2288	A1A1,A1R,A1,RR,R		0.3393,0.484,0.392	,	,		40,10163				SO:0001651	inframe_deletion	0	exon2			GGGGGGCGCCGCA	Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.739_750delCGCCGCAGGGGA	X.37:g.153171699_153171710delCGCCGCAGGGGA	ENSP00000351805:p.Arg247_Gly250del		50	0	0		71	0.17	12	NM_001146151	0		0	C5HF20|O43192|Q3MJD3|Q9UCV9	In_Frame_Del	DEL	ENST00000358927.2	37	CCDS14735.1																																																																																					0.646	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061127.2			
