#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MT-ND5	4540	genome.wustl.edu	37	M	13327	13327	+	Missense_Mutation	SNP	A	A	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chrM:13327A>G	ENST00000361567.2	+	1	991	c.991A>G	c.(991-993)Acc>Gcc	p.T331A	MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	331			T -> A. {ECO:0000269|PubMed:1757091}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TGCACATCTGTACCCACGCCT	0.418																																							0											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.991A>G	M.37:g.13327A>G	ENSP00000354813:p.Thr331Ala		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.T331A	ENST00000361567.2	37	c.991		MT																																																																																			0	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	protein_coding		24	0	0	0.00	0	0	A	YP_003024036	0	0		13327	1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	0	0	100	100.00	15	2	SNP	NULL	G
DMD	1756	genome.wustl.edu	37	X	31986629	31986629	+	Missense_Mutation	SNP	T	T	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chrX:31986629T>G	ENST00000357033.4	-	45	6647	c.6441A>C	c.(6439-6441)gaA>gaC	p.E2147D	DMD_ENST00000378707.3_5'UTR|DMD_ENST00000541735.1_5'UTR|DMD_ENST00000359836.1_5'UTR|DMD_ENST00000378677.2_Missense_Mutation_p.E2143D|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000474231.1_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2147					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CATCCTGGAGTTCCTGTAAGA	0.408																																							0											0													54.0	47.0	50.0					X																	31986629		2202	4298	6500	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6441A>C	X.37:g.31986629T>G	ENSP00000354923:p.Glu2147Asp		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.E2147D	ENST00000357033.4	37	c.6441	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314316	0.23908	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033	T;T	0.49720	0.77;0.77	5.22	0.0161	0.14106	.	0.000000	0.35207	U	0.003369	T	0.34745	0.0908	L	0.54323	1.7	0.80722	D	1	B;B;B;B;B;B	0.34161	0.439;0.015;0.061;0.018;0.043;0.043	B;B;B;B;B;B	0.35182	0.197;0.011;0.084;0.019;0.04;0.027	T	0.15122	-1.0448	10	0.08599	T	0.76	.	8.2072	0.31463	0.0:0.6465:0.167:0.1866	.	806;2139;2147;2143;806;803	P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;.;DMD_HUMAN;.;.;.	D	2139;806;803;2143;2147	ENSP00000367948:E2143D;ENSP00000354923:E2147D	ENSP00000354923:E2147D	E	-	3	2	DMD	31896550	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	0.916000	0.28651	-0.073000	0.12842	0.437000	0.28790	GAA	0	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	37	109	0	0.00	0	0	T	NM_004006	0	0		31986629	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	8	20	55.56	75.00	10	60	SNP	0.999	G
PKN2	5586	genome.wustl.edu	37	1	89250347	89250347	+	Silent	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr1:89250347C>T	ENST00000370521.3	+	7	1370	c.1011C>T	c.(1009-1011)ggC>ggT	p.G337G	PKN2_ENST00000316005.7_Silent_p.G337G|PKN2_ENST00000544045.1_Silent_p.G11G|PKN2_ENST00000370505.3_Silent_p.G180G|PKN2_ENST00000370513.5_Silent_p.G337G	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	337	C2.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		GTCTTATGGGCTGCCAAGATA	0.413																																							0											0													79.0	75.0	76.0					1																	89250347		1890	4117	6007	SO:0001819	synonymous_variant	0			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.1011C>T	1.37:g.89250347C>T			B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Silent	SNP	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.G337	ENST00000370521.3	37	c.1011	CCDS714.1	1																																																																																			0	superfamily_C2_dom,smart_C2_dom		0.413	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	protein_coding	OTTHUMT00000027828.3	68	211	0	0.00	0	0	C	NM_006256	0	0		89250347	1	no_errors	ENST00000370521	ensembl	human	known	74_37	silent	43	121	31.75	45.05	20	100	SNP	1	T
TNR	7143	genome.wustl.edu	37	1	175372743	175372743	+	Missense_Mutation	SNP	T	T	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr1:175372743T>C	ENST00000367674.2	-	4	1217	c.509A>G	c.(508-510)gAc>gGc	p.D170G	TNR_ENST00000263525.2_Missense_Mutation_p.D170G			Q92752	TENR_HUMAN	tenascin R	170	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGGGATATAGTCCAGTTGTCC	0.537																																							0											0													67.0	69.0	68.0					1																	175372743		2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.509A>G	1.37:g.175372743T>C	ENSP00000356646:p.Asp170Gly		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.D170G	ENST00000367674.2	37	c.509	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854549	0.71719	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.11385	2.78;2.78	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.10121	0.0248	L	0.28608	0.87	0.80722	D	1	P;P	0.40731	0.728;0.722	B;B	0.36719	0.138;0.231	T	0.07328	-1.0778	10	0.48119	T	0.1	.	16.2061	0.82131	0.0:0.0:0.0:1.0	.	170;170	B4DIX8;Q92752	.;TENR_HUMAN	G	170	ENSP00000356646:D170G;ENSP00000263525:D170G	ENSP00000263525:D170G	D	-	2	0	TNR	173639366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.901000	0.87382	2.311000	0.77944	0.533000	0.62120	GAC	0	NULL		0.537	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	47	160	0	0.00	0	0	T	NM_003285	0	0		175372743	-1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	29	130	44.23	44.73	23	106	SNP	1	C
IQSEC1	9922	genome.wustl.edu	37	3	12944297	12944297	+	Silent	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr3:12944297C>T	ENST00000273221.4	-	13	3039	c.2823G>A	c.(2821-2823)gcG>gcA	p.A941A		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	941					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTAGCGATCCCGCACTGCTGC	0.592																																							0											0													86.0	68.0	75.0					3																	12944297		2203	4300	6503	SO:0001819	synonymous_variant	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2823G>A	3.37:g.12944297C>T			O94863|Q96D85	Silent	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.A941	ENST00000273221.4	37	c.2823	CCDS33703.1	3																																																																																			0	NULL		0.592	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	protein_coding	OTTHUMT00000339865.2	42	107	0	0.00	0	0	C	NM_014869	0	0		12944297	-1	no_errors	ENST00000273221	ensembl	human	known	74_37	silent	21	63	27.59	36.36	8	36	SNP	1	T
TMIE	259236	genome.wustl.edu	37	3	46751098	46751098	+	Missense_Mutation	SNP	A	A	G	rs397517868|rs201683042		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr3:46751098A>G	ENST00000326431.3	+	4	546	c.391A>G	c.(391-393)Aag>Gag	p.K131E		NM_147196.2	NP_671729.2	Q8NEW7	TMIE_HUMAN	transmembrane inner ear	131	Lys-rich.			Missing (in Ref. 1; AAL89820 and 4; AAI26259/AAI26261). {ECO:0000305}.	inner ear morphogenesis (GO:0042472)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		gaagaagaagaagGACAGTGT	0.507																																							0											0													106.0	113.0	111.0					3																	46751098		1971	4153	6124	SO:0001583	missense	0			AY081842	CCDS43081.1	3p21	2010-01-06	2004-05-19		ENSG00000181585	ENSG00000181585			30800	protein-coding gene	gene with protein product		607237	"""deafness, autosomal recessive 6"""	DFNB6		12140191, 12145746	Standard	NM_147196		Approved		uc010hjk.1	Q8NEW7	OTTHUMG00000149909	ENST00000326431.3:c.391A>G	3.37:g.46751098A>G	ENSP00000324775:p.Lys131Glu		A0AV93|A8K0R0	Missense_Mutation	SNP	NULL	p.K131E	ENST00000326431.3	37	c.391	CCDS43081.1	3	.	.	.	.	.	.	.	.	.	.	A	13.67	2.306538	0.40795	.	.	ENSG00000181585	ENST00000326431	D	0.90844	-2.74	4.45	4.45	0.53987	.	1.302480	0.07113	U	0.842482	D	0.89976	0.6871	L	0.43152	1.355	0.28604	N	0.909003	P	0.51933	0.949	P	0.49953	0.627	T	0.80562	-0.1327	10	0.28530	T	0.3	-16.4732	10.3173	0.43745	1.0:0.0:0.0:0.0	.	131	Q8NEW7	TMIE_HUMAN	E	131	ENSP00000324775:K131E	ENSP00000324775:K131E	K	+	1	0	TMIE	46726102	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.575000	0.46025	1.988000	0.58038	0.533000	0.62120	AAG	0	NULL		0.507	TMIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIE	protein_coding	OTTHUMT00000313853.1	35	107	0	1.83	0	2	A	NM_147196	rs201683042	A->G		46751098	1	no_errors	ENST00000326431	ensembl	human	known	74_37	missense	24	80	11.11	4.71	3	4	SNP	1	G
CCDC51	79714	genome.wustl.edu	37	3	48474247	48474247	+	Missense_Mutation	SNP	C	C	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr3:48474247C>G	ENST00000395694.2	-	4	892	c.807G>C	c.(805-807)ttG>ttC	p.L269F	PLXNB1_ENST00000296440.6_5'Flank|CCDC51_ENST00000412398.2_Missense_Mutation_p.L160F|CCDC51_ENST00000442740.1_Missense_Mutation_p.L160F|CCDC51_ENST00000447018.1_Missense_Mutation_p.L160F|CCDC51_ENST00000395696.1_Missense_Mutation_p.L269F|PLXNB1_ENST00000448774.2_5'Flank	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	269						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCAGGCCCCTCAAGTCCACCA	0.602																																							0											0													69.0	74.0	72.0					3																	48474247		1974	4144	6118	SO:0001583	missense	0			AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.807G>C	3.37:g.48474247C>G	ENSP00000379047:p.Leu269Phe		Q9HA01	Missense_Mutation	SNP	NULL	p.L269F	ENST00000395694.2	37	c.807	CCDS2766.2	3	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690004	0.29962	.	.	ENSG00000164051	ENST00000447018;ENST00000395694;ENST00000412398;ENST00000395696;ENST00000442740	T;T;T;T;T	0.61859	0.15;0.07;0.15;0.07;0.15	5.53	3.37	0.38596	.	0.068074	0.64402	D	0.000010	T	0.46502	0.1396	L	0.40543	1.245	0.32970	D	0.522173	P	0.38078	0.617	B	0.38712	0.28	T	0.59815	-0.7383	10	0.52906	T	0.07	-1.7511	8.235	0.31620	0.1332:0.6947:0.0:0.1721	.	269	Q96ER9	CCD51_HUMAN	F	160;269;160;269;160	ENSP00000412300:L160F;ENSP00000379047:L269F;ENSP00000401194:L160F;ENSP00000379049:L269F;ENSP00000392898:L160F	ENSP00000379047:L269F	L	-	3	2	CCDC51	48449251	0.894000	0.30519	1.000000	0.80357	0.672000	0.39443	0.020000	0.13466	1.150000	0.42419	0.655000	0.94253	TTG	0	NULL		0.602	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC51	protein_coding	OTTHUMT00000344599.2	22	125	0	0.00	0	0	C	NM_024661	0	0		48474247	-1	no_errors	ENST00000395694	ensembl	human	known	74_37	missense	11	42	31.25	48.81	5	41	SNP	0.339	G
FAM200B	285550	genome.wustl.edu	37	4	15689810	15689810	+	Missense_Mutation	SNP	G	G	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr4:15689810G>C	ENST00000422728.2	+	2	2048	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	404							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						gctcaggaatgagattcactt	0.318																																							0											0													35.0	29.0	30.0					4																	15689810		692	1590	2282	SO:0001583	missense	0			BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.1210G>C	4.37:g.15689810G>C	ENSP00000393017:p.Glu404Gln			Missense_Mutation	SNP	superfamily_RNaseH-like_dom,superfamily_PAH	p.E404Q	ENST00000422728.2	37	c.1210	CCDS47028.1	4	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421435	0.42918	.	.	ENSG00000237765	ENST00000422728	T	0.40756	1.02	2.48	2.48	0.30137	Ribonuclease H-like (1);	.	.	.	.	T	0.58192	0.2105	M	0.70595	2.14	0.21256	N	0.999746	D	0.71674	0.998	D	0.68353	0.957	T	0.39881	-0.9592	8	.	.	.	.	8.5475	0.33430	0.0:0.0:1.0:0.0	.	404	P0CF97	F200B_HUMAN	Q	404	ENSP00000393017:E404Q	.	E	+	1	0	FAM200B	15298908	0.940000	0.31905	0.991000	0.47740	0.903000	0.53119	1.053000	0.30442	1.712000	0.51347	0.484000	0.47621	GAG	0	superfamily_RNaseH-like_dom		0.318	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM200B	protein_coding	OTTHUMT00000360100.1	54	115	0	0.00	0	0	G	NM_001145191	0	0		15689810	1	no_errors	ENST00000422728	ensembl	human	putative	74_37	missense	51	147	20.31	17.88	13	32	SNP	0.993	C
MAD2L1	4085	genome.wustl.edu	37	4	120986968	120986968	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr4:120986968C>T	ENST00000296509.6	-	2	418	c.79G>A	c.(79-81)Ggc>Agc	p.G27S	RP11-679C8.2_ENST00000511064.1_RNA|RP11-679C8.2_ENST00000504106.1_RNA|RP11-679C8.2_ENST00000508362.1_RNA|RP11-679C8.2_ENST00000503073.1_RNA	NM_002358.3	NP_002349.1	Q13257	MD2L1_HUMAN	MAD2 mitotic arrest deficient-like 1 (yeast)	27	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(2)|kidney(2)|large_intestine(2)|lung(3)	9						CTGTTGATGCCGAATGCTGCA	0.353																																							0											0													66.0	66.0	66.0					4																	120986968		2203	4300	6503	SO:0001583	missense	0			U65410	CCDS3715.1	4q27	2013-01-17	2001-11-28		ENSG00000164109	ENSG00000164109			6763	protein-coding gene	gene with protein product		601467	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 1"""			8824189, 9345911	Standard	NM_002358		Approved	MAD2, HSMAD2	uc003idl.2	Q13257	OTTHUMG00000132967	ENST00000296509.6:c.79G>A	4.37:g.120986968C>T	ENSP00000296509:p.Gly27Ser		Q53F56|Q548X9|Q6IRW7|Q8IZX3	Missense_Mutation	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.G27S	ENST00000296509.6	37	c.79	CCDS3715.1	4	.	.	.	.	.	.	.	.	.	.	C	31	5.082422	0.94050	.	.	ENSG00000164109	ENST00000296509	.	.	.	4.78	4.78	0.61160	DNA-binding HORMA (4);	0.049888	0.85682	D	0.000000	T	0.66396	0.2785	L	0.38692	1.165	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.81914	0.804;0.995	T	0.60596	-0.7232	9	0.18276	T	0.48	-13.5003	18.1808	0.89777	0.0:1.0:0.0:0.0	.	27;27	Q8IZX3;Q13257	.;MD2L1_HUMAN	S	27	.	ENSP00000296509:G27S	G	-	1	0	MAD2L1	121206416	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.334000	0.79224	2.341000	0.79615	0.655000	0.94253	GGC	0	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd		0.353	MAD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAD2L1	protein_coding	OTTHUMT00000256525.2	64	146	0	0.00	0	0	C		0	0		120986968	-1	no_errors	ENST00000296509	ensembl	human	known	74_37	missense	73	127	25.51	16.99	25	26	SNP	1	T
GALNTL6	442117	genome.wustl.edu	37	4	173942726	173942726	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr4:173942726C>T	ENST00000506823.1	+	12	2245	c.1588C>T	c.(1588-1590)Ctc>Ttc	p.L530F	GALNTL6_ENST00000508122.1_Missense_Mutation_p.L513F	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	530	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						CCCCGTTACACTCTATGACTG	0.478																																							0											0													159.0	152.0	155.0					4																	173942726		2203	4300	6503	SO:0001583	missense	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1588C>T	4.37:g.173942726C>T	ENSP00000423313:p.Leu530Phe		Q2L4S6	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L530F	ENST00000506823.1	37	c.1588	CCDS34104.1	4	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216529	0.58452	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.37411	1.2;1.2	5.81	5.81	0.92471	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.64402	D	0.000004	T	0.56337	0.1978	L	0.60012	1.86	0.80722	D	1	P	0.51351	0.944	P	0.59703	0.862	T	0.53436	-0.8439	10	0.59425	D	0.04	.	20.0817	0.97778	0.0:1.0:0.0:0.0	.	530	Q49A17	GLTL6_HUMAN	F	530;513	ENSP00000423313:L530F;ENSP00000423827:L513F	ENSP00000423313:L530F	L	+	1	0	GALNTL6	174179301	1.000000	0.71417	0.737000	0.30932	0.021000	0.10359	7.458000	0.80787	2.743000	0.94032	0.650000	0.86243	CTC	0	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.478	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	protein_coding	OTTHUMT00000362395.1	47	113	0	0.00	0	0	C	NM_001034845	0	0		173942726	1	no_errors	ENST00000506823	ensembl	human	known	74_37	missense	28	140	20	22.65	7	41	SNP	1	T
EFHC1	114327	genome.wustl.edu	37	6	52344482	52344482	+	Silent	SNP	T	T	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr6:52344482T>C	ENST00000371068.5	+	9	1640	c.1537T>C	c.(1537-1539)Ttg>Ctg	p.L513L	EFHC1_ENST00000433625.2_Silent_p.L422L|EFHC1_ENST00000538167.1_Silent_p.L494L	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	513	DM10 3. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					CGAGTATGTTTTGAAATACAT	0.488																																							0											0													170.0	166.0	168.0					6																	52344482		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1537T>C	6.37:g.52344482T>C			B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Silent	SNP	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_hand_dom	p.L513	ENST00000371068.5	37	c.1537	CCDS4942.1	6																																																																																			0	smart_Uncharacterised_DM10		0.488	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHC1	protein_coding	OTTHUMT00000040905.2	81	174	0	0.00	0	0	T	NM_018100	0	0		52344482	1	no_errors	ENST00000371068	ensembl	human	known	74_37	silent	39	110	40	30.82	26	49	SNP	0.104	C
TBX18	9096	genome.wustl.edu	37	6	85453986	85453986	+	Missense_Mutation	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr6:85453986G>A	ENST00000369663.5	-	6	1334	c.997C>T	c.(997-999)Cgc>Tgc	p.R333C	TBX18_ENST00000606784.1_Missense_Mutation_p.R175C|TBX18_ENST00000606521.1_5'UTR	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	333					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R333C(2)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CACCTGTTGCGCCCGGAGTCT	0.338																																							0											2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)											47.0	47.0	47.0					6																	85453986		2203	4299	6502	SO:0001583	missense	0			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.997C>T	6.37:g.85453986G>A	ENSP00000358677:p.Arg333Cys		A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.R333C	ENST00000369663.5	37	c.997	CCDS34495.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107078	0.77096	.	.	ENSG00000112837	ENST00000416980;ENST00000369663	T	0.80909	-1.43	5.92	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.80363	0.4609	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65874	0.932;0.939	D	0.83916	0.0298	10	0.72032	D	0.01	.	15.2612	0.73625	0.0:0.0:0.836:0.1639	.	249;333	Q8IW86;O95935	.;TBX18_HUMAN	C	248;333	ENSP00000358677:R333C	ENSP00000358677:R333C	R	-	1	0	TBX18	85510705	1.000000	0.71417	0.999000	0.59377	0.863000	0.49368	4.813000	0.62620	1.409000	0.46915	0.650000	0.86243	CGC	0	smart_TF_T-box		0.338	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX18	protein_coding	OTTHUMT00000041378.2	63	240	0	0.83	0	2	G	NM_001080508	0	0		85453986	-1	no_errors	ENST00000369663	ensembl	human	known	74_37	missense	34	118	34.62	32.18	18	56	SNP	1	A
GJB7	375519	genome.wustl.edu	37	6	87994415	87994415	+	Silent	SNP	G	G	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr6:87994415G>C	ENST00000525899.1	-	3	561	c.216C>G	c.(214-216)tcC>tcG	p.S72S	GJB7_ENST00000296882.3_Silent_p.S72S	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	72					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		GTCTGACTTGGGAAATGGGGA	0.458																																							0											0													118.0	111.0	113.0					6																	87994415		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.216C>G	6.37:g.87994415G>C			B3KXL0|Q96KP0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.S72	ENST00000525899.1	37	c.216	CCDS5008.1	6																																																																																			0	pfam_Connexin_N,smart_Connexin_N,prints_Connexin		0.458	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB7	protein_coding	OTTHUMT00000394780.1	34	242	0	0.00	0	0	G		0	0		87994415	-1	no_errors	ENST00000296882	ensembl	human	known	74_37	silent	17	140	37.04	36.65	10	81	SNP	0.999	C
REV3L	5980	genome.wustl.edu	37	6	111726735	111726735	+	Missense_Mutation	SNP	T	T	C	rs547946785		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr6:111726735T>C	ENST00000358835.3	-	5	957	c.503A>G	c.(502-504)aAt>aGt	p.N168S	REV3L_ENST00000368802.3_Missense_Mutation_p.N168S|REV3L_ENST00000368805.1_Missense_Mutation_p.N168S|REV3L_ENST00000435970.1_Missense_Mutation_p.N90S			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	168					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GCCATAAAGATTGTAGTCAAT	0.353								DNA polymerases (catalytic subunits)					T|||	1	0.000199681	0.0	0.0014	5008	,	,		13012	0.0		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0													124.0	130.0	128.0					6																	111726735		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.503A>G	6.37:g.111726735T>C	ENSP00000351697:p.Asn168Ser		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.N168S	ENST00000358835.3	37	c.503	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	T	27.4	4.827801	0.90955	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.50277	4.67;4.67;4.67;0.75	5.47	5.47	0.80525	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.041485	0.85682	D	0.000000	T	0.62502	0.2433	M	0.75777	2.31	0.44643	D	0.997629	D	0.89917	1.0	D	0.87578	0.998	T	0.67987	-0.5528	10	0.66056	D	0.02	-9.0345	15.5398	0.76035	0.0:0.0:0.0:1.0	.	168	O60673	DPOLZ_HUMAN	S	168;168;168;90	ENSP00000357792:N168S;ENSP00000357795:N168S;ENSP00000351697:N168S;ENSP00000402003:N90S	ENSP00000351697:N168S	N	-	2	0	REV3L	111833428	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.078000	0.62432	0.477000	0.44152	AAT	0	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom		0.353	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	protein_coding	OTTHUMT00000043695.1	78	210	0	0.00	0	0	T	NM_002912	rs547946785	T->C		111726735	-1	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	44	108	27.87	40.00	17	72	SNP	1	C
OPRM1	4988	genome.wustl.edu	37	6	154412608	154412608	+	Splice_Site	SNP	G	G	T	rs201410932		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr6:154412608G>T	ENST00000330432.7	+	3	1401		c.e3+1		OPRM1_ENST00000524163.1_Splice_Site|OPRM1_ENST00000520708.1_Splice_Site|OPRM1_ENST00000522236.1_Splice_Site|OPRM1_ENST00000518759.1_Splice_Site|OPRM1_ENST00000435918.2_Splice_Site|OPRM1_ENST00000419506.2_Splice_Site|OPRM1_ENST00000414028.2_Splice_Site|OPRM1_ENST00000452687.2_Splice_Site|OPRM1_ENST00000522555.1_Splice_Site|OPRM1_ENST00000434900.2_Splice_Site|OPRM1_ENST00000360422.4_Splice_Site|OPRM1_ENST00000428397.2_Missense_Mutation_p.V389L|OPRM1_ENST00000229768.5_Splice_Site|OPRM1_ENST00000337049.4_Splice_Site	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TAATCATCAGGTACGCAGTCT	0.403																																							0											0													33.0	34.0	34.0					6																	154412608		1788	3873	5661	SO:0001630	splice_region_variant	0			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1164+1G>T	6.37:g.154412608G>T			B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Splice_Site	SNP	0	e4+1	ENST00000330432.7	37	c.1443+1	CCDS55070.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.034336|4.034336	0.75617|0.75617	.|.	.|.	ENSG00000112038|ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236|ENST00000428397	.|T	.|0.69435	.|-0.4	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|.	.|.	.|.	.|.	.|T	.|0.44540	.|0.1298	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.06405	.|0.0;0.002	.|T	.|0.36163	.|-0.9759	.|7	.|.	.|.	.|.	.|.	20.8598|20.8598	0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|289;389	.|Q6UPP1;P35372-2	.|.;.	.|L	-1|389	.|ENSP00000411903:V389L	.|.	.|V	+|+	.|1	.|0	OPRM1|OPRM1	154454301|154454301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	9.504000|9.504000	0.97986|0.97986	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	.|GTA	0	0		0.403	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPRM1	protein_coding	OTTHUMT00000042786.2	25	239	0	0.00	0	0	G	NM_000914	0	0	Intron	154412608	1	no_errors	ENST00000434900	ensembl	human	known	74_37	splice_site	32	171	8.57	6.99	3	13	SNP	1	T
GET4	51608	genome.wustl.edu	37	7	927107	927107	+	Missense_Mutation	SNP	G	G	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr7:927107G>T	ENST00000265857.3	+	4	511	c.417G>T	c.(415-417)aaG>aaT	p.K139N	RP11-449P15.2_ENST00000609998.1_RNA|GET4_ENST00000407192.1_Missense_Mutation_p.K86N	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	139					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)				breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCTCCGGGAAGCTGGGCCACC	0.642																																							0											0													57.0	60.0	59.0					7																	927107		2202	4300	6502	SO:0001583	missense	0			AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.417G>T	7.37:g.927107G>T	ENSP00000265857:p.Lys139Asn		A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Missense_Mutation	SNP	pfam_UPF0363	p.K139N	ENST00000265857.3	37	c.417	CCDS5317.1	7	.	.	.	.	.	.	.	.	.	.	g	20.6	4.014364	0.75161	.	.	ENSG00000239857	ENST00000265857;ENST00000412734;ENST00000407192;ENST00000441491;ENST00000426056	.	.	.	5.57	2.08	0.27032	.	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	M	0.67953	2.075	0.80722	D	1	D	0.60160	0.987	P	0.60012	0.867	T	0.59236	-0.7492	9	0.27785	T	0.31	-6.023	6.6808	0.23119	0.7352:0.0:0.2648:0.0	.	139	Q7L5D6	GET4_HUMAN	N	139;93;86;151;100	.	ENSP00000265857:K139N	K	+	3	2	GET4	893633	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.826000	0.27407	0.587000	0.29643	0.556000	0.70494	AAG	0	pfam_UPF0363		0.642	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GET4	protein_coding	OTTHUMT00000231930.1	67	106	0	0.00	0	0	G	NM_015949	0	0		927107	1	no_errors	ENST00000265857	ensembl	human	known	74_37	missense	35	47	43.55	24.19	27	15	SNP	1	T
RSPH10B	222967	genome.wustl.edu	37	7	5983557	5983557	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr7:5983557C>T	ENST00000405415.1	-	13	1980	c.1594G>A	c.(1594-1596)Gcc>Acc	p.A532T	RSPH10B_ENST00000535104.1_Intron|RSPH10B_ENST00000404406.1_Missense_Mutation_p.A532T|RSPH10B_ENST00000539903.1_Intron|RSPH10B_ENST00000337579.3_Missense_Mutation_p.A532T|RSPH10B_ENST00000441023.2_Missense_Mutation_p.A532T			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	532										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		ATCTGGAAGGCATTTGGACGA	0.388																																							0											0													49.0	44.0	46.0					7																	5983557		2175	4276	6451	SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.1594G>A	7.37:g.5983557C>T	ENSP00000385443:p.Ala532Thr		A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.A532T	ENST00000405415.1	37	c.1594	CCDS34598.1	7	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362714	0.61403	.	.	ENSG00000155026	ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	3.71	2.79	0.32731	.	0.077164	0.49916	D	0.000126	T	0.75532	0.3862	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.921;0.998	T	0.77464	-0.2578	10	0.72032	D	0.01	.	9.0475	0.36356	0.0:0.8827:0.0:0.1173	.	532;391	P0C881;F5GXE3	R10B1_HUMAN;.	T	532;532;532;391;532	ENSP00000385443:A532T;ENSP00000384097:A532T;ENSP00000338556:A532T;ENSP00000400988:A532T	ENSP00000338556:A532T	A	-	1	0	RSPH10B	5950083	1.000000	0.71417	0.991000	0.47740	0.880000	0.50808	2.825000	0.48096	1.775000	0.52247	0.551000	0.68910	GCC	0	NULL		0.388	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	protein_coding	OTTHUMT00000325465.2	93	123	0	0.00	0	0	C	NM_173565	0	0		5983557	-1	no_errors	ENST00000337579	ensembl	human	known	74_37	missense	56	92	27.27	26.19	21	33	SNP	1	T
MPP6	51678	genome.wustl.edu	37	7	24727232	24727232	+	Nonstop_Mutation	SNP	G	G	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr7:24727232G>C	ENST00000222644.5	+	12	1872	c.1622G>C	c.(1621-1623)tGa>tCa	p.*541S	MPP6_ENST00000396475.2_Nonstop_Mutation_p.*541S|MPP6_ENST00000409761.1_Nonstop_Mutation_p.*429S			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						TGGGTTTACTGATGATTCAGT	0.343																																							0											0													95.0	103.0	100.0					7																	24727232		2203	4300	6503	SO:0001578	stop_lost	0			AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.1622G>C	7.37:g.24727232G>C	ENSP00000222644:p.*541Serext*1		B2RAF0	Nonstop_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.*541S	ENST00000222644.5	37	c.1622	CCDS5388.1	7	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584353	0.86748	.	.	ENSG00000105926	ENST00000222644;ENST00000409761;ENST00000396475	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.26203	N	0.979417	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4447	0.99122	0.0:0.0:1.0:0.0	.	.	.	.	S	541;429;541	.	.	X	+	2	2	MPP6	24693757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.834000	0.97654	0.655000	0.94253	TGA	0	NULL		0.343	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP6	protein_coding	OTTHUMT00000250272.4	75	224	0	0.00	0	0	G		0	0		24727232	1	no_errors	ENST00000222644	ensembl	human	known	74_37	nonstop	43	188	20.37	19.23	11	45	SNP	1	C
MSR1	4481	genome.wustl.edu	37	8	16026357	16026357	+	Silent	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr8:16026357C>T	ENST00000262101.5	-	4	361	c.240G>A	c.(238-240)acG>acA	p.T80T	MSR1_ENST00000350896.3_Silent_p.T80T|MSR1_ENST00000445506.2_Silent_p.T98T|MSR1_ENST00000381998.4_Silent_p.T80T|MSR1_ENST00000536385.1_Intron|MSR1_ENST00000355282.2_Silent_p.T80T			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	80	Spacer. {ECO:0000305}.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		AGCAATTCTTCGTTTCCCACT	0.383																																							0											0													124.0	118.0	120.0					8																	16026357		2203	4300	6503	SO:0001819	synonymous_variant	0			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.240G>A	8.37:g.16026357C>T			D3DSP3|O60505|P21759|Q45F10	Silent	SNP	pfam_SRCR,pfam_Macro_scav_rcpt,pfam_Collagen,superfamily_Srcr_rcpt-rel,superfamily_STAT_TF_coiled-coil,smart_Srcr_rcpt-rel,prints_Macro_scav_rcpt,prints_SRCR,pfscan_SRCR	p.T80	ENST00000262101.5	37	c.240	CCDS5995.1	8																																																																																			0	NULL		0.383	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	protein_coding	OTTHUMT00000211627.2	45	183	0	0.00	0	0	C		0	0		16026357	-1	no_errors	ENST00000262101	ensembl	human	known	74_37	silent	13	119	58.06	52.38	18	132	SNP	0.992	T
GEM	2669	genome.wustl.edu	37	8	95262574	95262574	+	Silent	SNP	G	G	T	rs142606096		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr8:95262574G>T	ENST00000297596.2	-	5	1119	c.855C>A	c.(853-855)ctC>ctA	p.L285L	GEM_ENST00000396194.2_Silent_p.L285L	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	285	Calmodulin-binding. {ECO:0000250}.				cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			ATTTGGACTTGAGCTTGAAGG	0.527																																					GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)		0											0													157.0	136.0	143.0					8																	95262574		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.855C>A	8.37:g.95262574G>T			B2RA31	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L285	ENST00000297596.2	37	c.855	CCDS6261.1	8																																																																																			0	pirsf_Small_GTPase_GEM/REM/Rad		0.527	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEM	protein_coding	OTTHUMT00000378566.1	53	188	0	0.53	0	1	G	NM_181702	0	0		95262574	-1	no_errors	ENST00000297596	ensembl	human	known	74_37	silent	78	314	22.77	16.71	23	63	SNP	1	T
ERP44	23071	genome.wustl.edu	37	9	102784465	102784465	+	Silent	SNP	G	G	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr9:102784465G>T	ENST00000262455.6	-	5	529	c.330C>A	c.(328-330)ctC>ctA	p.L110L		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	110	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						GAAACAATTTGAGGGTTGGGT	0.408																																							0											0													145.0	136.0	139.0					9																	102784465		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.330C>A	9.37:g.102784465G>T			O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Silent	SNP	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold	p.L110	ENST00000262455.6	37	c.330	CCDS35082.1	9																																																																																			0	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold		0.408	ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP44	protein_coding	OTTHUMT00000053402.1	51	204	0	0.00	0	0	G	XM_088476	0	0		102784465	-1	no_errors	ENST00000262455	ensembl	human	known	74_37	silent	7	50	84.44	72.53	38	132	SNP	1	T
FAM69B	138311	genome.wustl.edu	37	9	139616628	139616628	+	Missense_Mutation	SNP	G	G	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr9:139616628G>C	ENST00000371692.4	+	4	454	c.358G>C	c.(358-360)Gag>Cag	p.E120Q	SNHG7_ENST00000414282.1_RNA|FAM69B_ENST00000371691.1_Missense_Mutation_p.E33Q|SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000416970.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	120						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		GTGTGGCATTGAGGAGACCCT	0.642																																							0											0													84.0	83.0	84.0					9																	139616628		2203	4300	6503	SO:0001583	missense	0				CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.358G>C	9.37:g.139616628G>C	ENSP00000360757:p.Glu120Gln		Q5VUD7|Q8N5N0|Q8WYU5	Missense_Mutation	SNP	pfam_FAM69_kinase_dom	p.E120Q	ENST00000371692.4	37	c.358	CCDS7004.1	9	.	.	.	.	.	.	.	.	.	.	g	7.598	0.672139	0.14776	.	.	ENSG00000165716	ENST00000371692;ENST00000371691	T;T	0.46063	0.88;0.88	4.6	-1.72	0.08107	.	0.365309	0.29853	N	0.011036	T	0.32194	0.0821	M	0.64567	1.98	0.09310	N	1	B	0.18741	0.03	B	0.14023	0.01	T	0.20806	-1.0264	10	0.38643	T	0.18	-16.2139	6.3126	0.21173	0.2564:0.2491:0.4945:0.0	.	120	Q5VUD6	FA69B_HUMAN	Q	120;33	ENSP00000360757:E120Q;ENSP00000360756:E33Q	ENSP00000360756:E33Q	E	+	1	0	FAM69B	138736449	0.972000	0.33761	0.004000	0.12327	0.209000	0.24338	1.652000	0.37313	0.045000	0.15804	0.478000	0.44815	GAG	0	NULL		0.642	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69B	protein_coding	OTTHUMT00000055102.1	70	123	0	0.00	0	0	G	NM_152421	0	0		139616628	1	no_errors	ENST00000371692	ensembl	human	known	74_37	missense	26	49	44.68	36.36	21	28	SNP	0.003	C
ARMC4	55130	genome.wustl.edu	37	10	28233763	28233763	+	Silent	SNP	G	G	A	rs369884669		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr10:28233763G>A	ENST00000305242.5	-	11	1607	c.1515C>T	c.(1513-1515)acC>acT	p.T505T	ARMC4_ENST00000537576.1_Silent_p.T197T|ARMC4_ENST00000545014.1_Silent_p.T30T|ARMC4_ENST00000480504.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	505					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TGACTTCATCGGTTTCAAGCA	0.488																																							0											0								G		0,4406		0,0,2203	125.0	116.0	119.0		1515	-11.6	0.0	10		119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ARMC4	NM_018076.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		505/1045	28233763	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1515C>T	10.37:g.28233763G>A			A8K906|B7Z7I1|Q9H0C0	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.T505	ENST00000305242.5	37	c.1515	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	G	0.085	-1.176623	0.01646	0.0	1.16E-4	ENSG00000169126	ENST00000537573	.	.	.	5.78	-11.6	0.00059	.	.	.	.	.	T	0.48295	0.1492	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68131	-0.5490	5	0.87932	D	0	-31.5252	2.4674	0.04556	0.4516:0.2291:0.192:0.1273	.	.	.	.	L	197	.	ENSP00000438427:P197L	P	-	2	0	ARMC4	28273769	0.000000	0.05858	0.016000	0.15963	0.203000	0.24098	-3.710000	0.00387	-4.330000	0.00056	-3.444000	0.00036	CCG	0	superfamily_ARM-type_fold,smart_Armadillo		0.488	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	protein_coding	OTTHUMT00000047339.1	52	249	0	0.00	0	0	G	NM_018076	rs369884669	G->A		28233763	-1	no_errors	ENST00000305242	ensembl	human	known	74_37	silent	52	200	28.77	27.54	21	76	SNP	0.001	A
KIF18A	81930	genome.wustl.edu	37	11	28106202	28106202	+	Missense_Mutation	SNP	G	G	A	rs151125849	byFrequency	TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr11:28106202G>A	ENST00000263181.6	-	7	1341	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	351	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						TCCTTTGCCCGGTTAGCATAC	0.348													G|||	2	0.000399361	0.0	0.0	5008	,	,		16305	0.0		0.002	False		,,,				2504	0.0						0.9996,0.0003994											0													114.0	115.0	115.0					11																	28106202		2202	4299	6501	SO:0001583	missense	0			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.1051C>T	11.37:g.28106202G>A	ENSP00000263181:p.Arg351Trp		Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R351W	ENST00000263181.6	37	c.1051	CCDS7867.1	11	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	23.1	4.373244	0.82573	.	.	ENSG00000121621	ENST00000263181	T	0.79033	-1.23	5.11	5.11	0.69529	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.93729	0.7996	H	0.99600	4.65	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.96721	0.9532	10	0.87932	D	0	.	18.6085	0.91275	0.0:0.0:1.0:0.0	.	351	Q8NI77	KI18A_HUMAN	W	351	ENSP00000263181:R351W	ENSP00000263181:R351W	R	-	1	2	KIF18A	28062778	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	3.532000	0.53553	2.411000	0.81874	0.650000	0.86243	CGG	0	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom		0.348	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF18A	protein_coding	OTTHUMT00000388328.3	41	194	0	0.00	0	0	G	NM_031217	rs151125849	G->A		28106202	-1	no_errors	ENST00000263181	ensembl	human	known	74_37	missense	25	190	41.86	25.68	18	66	SNP	1	A
NTF3	4908	genome.wustl.edu	37	12	5603798	5603798	+	Missense_Mutation	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr12:5603798G>A	ENST00000331010.6	+	1	501	c.418G>A	c.(418-420)Gcg>Acg	p.A140T	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.A153T	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	140					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						GAAACGGTACGCGGAGCATAA	0.602																																					GBM(194;1104 2182 8339 9578 18493)		0											0													89.0	83.0	85.0					12																	5603798		2203	4300	6503	SO:0001583	missense	0				CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.418G>A	12.37:g.5603798G>A	ENSP00000328738:p.Ala140Thr		B7Z1T5|Q6FH50	Missense_Mutation	SNP	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pirsf_Nerve_growth_factor-like,pfscan_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel,prints_Neurotrophin-3	p.A153T	ENST00000331010.6	37	c.457	CCDS8538.1	12	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874751	0.72180	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.69306	-0.39;-0.39	5.52	3.64	0.41730	.	0.184965	0.47093	D	0.000259	T	0.58935	0.2157	M	0.63428	1.95	0.50467	D	0.99987	B;B	0.32731	0.382;0.382	B;B	0.23018	0.027;0.043	T	0.56426	-0.7981	10	0.41790	T	0.15	-11.2617	11.6622	0.51354	0.0:0.1345:0.7255:0.14	.	140;153	P20783;B7Z1T5	NTF3_HUMAN;.	T	153;140	ENSP00000397297:A153T;ENSP00000328738:A140T	ENSP00000328738:A140T	A	+	1	0	NTF3	5474059	0.999000	0.42202	0.996000	0.52242	0.962000	0.63368	4.787000	0.62432	0.659000	0.30945	0.591000	0.81541	GCG	0	pirsf_Nerve_growth_factor-like		0.602	NTF3-002	KNOWN	basic|CCDS	protein_coding	NTF3	protein_coding	OTTHUMT00000400486.1	50	124	0	0.00	0	0	G		0	0		5603798	1	no_errors	ENST00000423158	ensembl	human	known	74_37	missense	43	183	26.67	15.21	16	33	SNP	0.993	A
NANOGP1	404635	genome.wustl.edu	37	12	8051634	8051634	+	RNA	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr12:8051634C>T	ENST00000607111.1	+	0	854							Q8N7R0	NANG2_HUMAN	Nanog homeobox pseudogene 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|lung(4)|prostate(1)	6						CCTATCCAGTCAATCTCATGG	0.433																																							0											0																																												0			AY455283		12p13.31	2014-03-20			ENSG00000176654	ENSG00000176654		"""Homeoboxes / ANTP class : NKL subclass"""	23099	pseudogene	pseudogene						15108323, 15233988	Standard	NG_006522		Approved	NANOG2	uc001qtp.1	Q8N7R0	OTTHUMG00000166020		12.37:g.8051634C>T				RNA	SNP	0	NULL	ENST00000607111.1	37	NULL		12																																																																																			0	0		0.433	NANOGP1-002	KNOWN	basic	processed_transcript	NANOGP1	pseudogene	OTTHUMT00000470953.1	39	23	0	0.00	0	0	C		0	0		8051634	1	no_errors	ENST00000607111	ensembl	human	known	74_37	rna	59	38	16.9	15.56	12	7	SNP	0	T
TPCN1	53373	genome.wustl.edu	37	12	113733834	113733835	+	Missense_Mutation	DNP	GC	GC	AT	rs144203904	byFrequency	TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G|C	G|C	G|C	A|T	G|C	G|C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr12:113733834_113733835GC>AT	ENST00000335509.6	+	28	2718_2719	c.2404_2405GC>AT	c.(2404-2406)GCc>ATc	p.A802I	TPCN1_ENST00000550785.1_Missense_Mutation_p.A874I|TPCN1_ENST00000541517.1_Missense_Mutation_p.A874I|TPCN1_ENST00000392569.4_Missense_Mutation_p.A734I	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	802					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						AGCCCCCGCCGCCCAGCAGCCC	0.609																																							0											0																																										SO:0001583	missense	0			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	Exception_encountered	12.37:g.113733834_113733835delinsAT	ENSP00000335300:p.Ala802Ile		A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.A874T|p.A874V	ENST00000335509.6	37	c.2620|c.2621	CCDS31908.1	12																																																																																			0	NULL		0.609	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN1	protein_coding	OTTHUMT00000405156.3	39	47	0	0.00	0	0	G|C	NM_017901	0	0		113733834|113733835	1	no_errors	ENST00000541517	ensembl	human	known	74_37	missense	43|45	61|60	34.85|34.78	32.97|33.33	23|24	30	SNP	0|0.792	A|T
DNAH10	196385	genome.wustl.edu	37	12	124408355	124408355	+	Missense_Mutation	SNP	T	T	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr12:124408355T>A	ENST00000409039.3	+	65	11223	c.11198T>A	c.(11197-11199)aTc>aAc	p.I3733N	RP11-380L11.4_ENST00000602952.1_RNA|CCDC92_ENST00000544798.1_5'Flank	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3733					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AATATGACCATCAAGATAGAA	0.368																																							0											0													63.0	60.0	61.0					12																	124408355		1829	4085	5914	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11198T>A	12.37:g.124408355T>A	ENSP00000386770:p.Ile3733Asn		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.I3733N	ENST00000409039.3	37	c.11198	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607270	0.87157	.	.	ENSG00000197653	ENST00000409039	T	0.59906	0.23	5.49	5.49	0.81192	.	0.206180	0.41605	D	0.000845	T	0.63757	0.2538	M	0.78223	2.4	0.80722	D	1	P	0.43973	0.823	B	0.43867	0.434	T	0.66662	-0.5867	10	0.39692	T	0.17	.	15.5926	0.76550	0.0:0.0:0.0:1.0	.	3733	Q8IVF4	DYH10_HUMAN	N	3733	ENSP00000386770:I3733N	ENSP00000386770:I3733N	I	+	2	0	DNAH10	122974308	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.033000	0.88852	2.068000	0.61886	0.482000	0.46254	ATC	0	NULL		0.368	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	63	229	0	0.00	0	0	T		0	0		124408355	1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	118	314	9.92	16.49	13	62	SNP	1	A
FAM179B	23116	genome.wustl.edu	37	14	45433576	45433576	+	Missense_Mutation	SNP	G	G	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr14:45433576G>T	ENST00000361577.3	+	1	2166	c.1952G>T	c.(1951-1953)aGt>aTt	p.S651I	FAM179B_ENST00000382233.2_Missense_Mutation_p.S651I|KLHL28_ENST00000396128.4_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.S651I|KLHL28_ENST00000553817.1_Intron	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	651										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AGGGTATTAAGTGCAGGAAAA	0.448																																							0											0													60.0	59.0	59.0					14																	45433576		2203	4300	6503	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1952G>T	14.37:g.45433576G>T	ENSP00000355045:p.Ser651Ile		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S651I	ENST00000361577.3	37	c.1952	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020907	0.75275	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.04234	3.67;3.67;3.67	5.01	5.01	0.66863	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.13457	0.0326	L	0.27053	0.805	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.998;0.999	T	0.03875	-1.0996	10	0.87932	D	0	-11.8558	18.1161	0.89555	0.0:0.0:1.0:0.0	.	651;651;651;651	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	I	651	ENSP00000355045:S651I;ENSP00000354917:S651I;ENSP00000371668:S651I	ENSP00000354917:S651I	S	+	2	0	FAM179B	44503326	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.810000	0.91950	2.611000	0.88343	0.462000	0.41574	AGT	0	superfamily_ARM-type_fold		0.448	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	protein_coding	OTTHUMT00000276791.1	31	215	0	0.00	0	0	G	XM_113781	0	0		45433576	1	no_errors	ENST00000361577	ensembl	human	known	74_37	missense	39	189	22	28.03	11	74	SNP	1	T
ATP10A	57194	genome.wustl.edu	37	15	25924583	25924583	+	Missense_Mutation	SNP	G	G	A	rs147041252		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr15:25924583G>A	ENST00000356865.6	-	21	4516	c.4405C>T	c.(4405-4407)Cgt>Tgt	p.R1469C		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1469					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GGAAGTCCACGTCCCGCTTGT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		11688	0.0		0.001	False		,,,				2504	0.0						0.9998,0.0001997											0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	57.0	57.0		4405	-3.2	0.0	15	dbSNP_134	57	0,8600		0,0,4300	no	missense	ATP10A	NM_024490.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1469/1500	25924583	1,13005	2203	4300	6503	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4405C>T	15.37:g.25924583G>A	ENSP00000349325:p.Arg1469Cys		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R1469C	ENST00000356865.6	37	c.4405	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126091	0.37533	2.27E-4	0.0	ENSG00000206190	ENST00000356865	T	0.10860	2.83	5.26	-3.22	0.05125	.	12.486400	0.00166	N	0.000000	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38415	-0.9662	10	0.49607	T	0.09	0.0195	7.902	0.29740	0.5112:0.1081:0.3807:0.0	.	1469	O60312	AT10A_HUMAN	C	1469	ENSP00000349325:R1469C	ENSP00000349325:R1469C	R	-	1	0	ATP10A	23475676	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.010000	0.12743	-0.879000	0.04002	-0.126000	0.14955	CGT	0	NULL		0.567	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	protein_coding	OTTHUMT00000414830.1	64	85	0	0.00	0	0	G	NM_024490	rs147041252	G->A		25924583	-1	no_errors	ENST00000356865	ensembl	human	known	74_37	missense	43	88	23.21	23.48	13	27	SNP	0.001	A
OCA2	4948	genome.wustl.edu	37	15	28263684	28263684	+	Silent	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr15:28263684G>A	ENST00000354638.3	-	7	821	c.666C>T	c.(664-666)caC>caT	p.H222H	OCA2_ENST00000353809.5_Silent_p.H222H|OCA2_ENST00000382996.2_Silent_p.H222H	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	222					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TGGAGTCCACGTGGCTGCTAA	0.657									Oculocutaneous Albinism																														0											0													28.0	23.0	25.0					15																	28263684		2203	4299	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.666C>T	15.37:g.28263684G>A			Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.H222	ENST00000354638.3	37	c.666	CCDS10020.1	15																																																																																			0	NULL		0.657	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	protein_coding	OTTHUMT00000250823.1	71	58	0	0.00	0	0	G	NM_000275	0	0		28263684	-1	no_errors	ENST00000354638	ensembl	human	known	74_37	silent	70	43	15.66	15.69	13	8	SNP	0	A
CCDC144CP	348254	genome.wustl.edu	37	17	20243264	20243264	+	RNA	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr17:20243264G>A	ENST00000340196.4	+	0	2823				RN7SL17P_ENST00000583626.1_RNA			Q8IYA2	C144C_HUMAN	coiled-coil domain containing 144C, pseudogene																		ATTAGACTGCGACAATGATAA	0.373																																							0											0																																												0					17p11.2	2013-03-14	2013-03-14	2013-03-14	ENSG00000154898	ENSG00000154898			29073	pseudogene	pseudogene			"""coiled-coil domain containing 144C"""	CCDC144C		11997339	Standard	NR_023380		Approved		uc010cqy.1	Q8IYA2	OTTHUMG00000059513		17.37:g.20243264G>A			B7WNP5	RNA	SNP	0	NULL	ENST00000340196.4	37	NULL		17	.	.	.	.	.	.	.	.	.	.	.	0.371	-0.933983	0.02340	.	.	ENSG00000154898	ENST00000425519	.	.	.	1.32	-2.04	0.07343	.	.	.	.	.	T	0.31513	0.0799	.	.	.	0.22933	N	0.998542	.	.	.	.	.	.	T	0.40059	-0.9583	4	0.49607	T	0.09	.	2.4102	0.04422	0.2597:0.3248:0.4155:0.0	.	.	.	.	N	354	.	ENSP00000411747:D354N	D	+	1	0	CCDC144C	20183856	0.000000	0.05858	0.044000	0.18714	0.026000	0.11368	-0.254000	0.08781	-0.123000	0.11745	0.195000	0.17529	GAC	0	0		0.373	CCDC144CP-001	KNOWN	basic	processed_transcript	CCDC144CP	pseudogene	OTTHUMT00000132378.2	245	147	0	0.00	0	0	G	NR_023380	0	0		20243264	1	no_errors	ENST00000580574	ensembl	human	known	74_37	rna	125	81	65.18	65.24	234	152	SNP	0.004	A
TEX14	56155	genome.wustl.edu	37	17	56663351	56663351	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr17:56663351C>T	ENST00000240361.8	-	18	2984	c.2899G>A	c.(2899-2901)Gct>Act	p.A967T	TEX14_ENST00000349033.5_Missense_Mutation_p.A961T|TEX14_ENST00000389934.3_Missense_Mutation_p.A961T			Q8IWB6	TEX14_HUMAN	testis expressed 14	967					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCATTTTCAGCCTCGCTCTCT	0.512																																							0											0													151.0	151.0	151.0					17																	56663351		2203	4300	6503	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2899G>A	17.37:g.56663351C>T	ENSP00000240361:p.Ala967Thr		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.A967T	ENST00000240361.8	37	c.2899	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332485	0.41297	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.79141	-1.24;-1.24;-1.21	5.38	1.54	0.23209	.	0.796443	0.11641	N	0.543808	T	0.65575	0.2704	L	0.41236	1.265	0.09310	N	1	B;B;B	0.21147	0.031;0.052;0.052	B;B;B	0.19946	0.012;0.027;0.027	T	0.52902	-0.8513	10	0.35671	T	0.21	-0.0537	5.409	0.16339	0.0:0.4961:0.0:0.5039	.	967;961;961	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	T	967;961;961	ENSP00000240361:A967T;ENSP00000374584:A961T;ENSP00000268910:A961T	ENSP00000240361:A967T	A	-	1	0	TEX14	54018350	0.083000	0.21467	0.086000	0.20670	0.484000	0.33280	-0.031000	0.12287	0.476000	0.27440	0.561000	0.74099	GCT	0	NULL		0.512	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	protein_coding	OTTHUMT00000445446.1	67	133	0	0.00	0	0	C		0	0		56663351	-1	no_errors	ENST00000240361	ensembl	human	known	74_37	missense	42	70	55.79	61.11	53	110	SNP	0.144	T
DSG3	1830	genome.wustl.edu	37	18	29045307	29045307	+	Missense_Mutation	SNP	G	G	C			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr18:29045307G>C	ENST00000257189.4	+	10	1381	c.1298G>C	c.(1297-1299)gGa>gCa	p.G433A		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	433	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AACGATGGTGGATACCTAATG	0.294																																							0											0													78.0	84.0	82.0					18																	29045307		2203	4300	6503	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1298G>C	18.37:g.29045307G>C	ENSP00000257189:p.Gly433Ala		A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.G433A	ENST00000257189.4	37	c.1298	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	9.883	1.202002	0.22121	.	.	ENSG00000134757	ENST00000257189	T	0.62941	-0.01	5.82	5.82	0.92795	Cadherin (3);Cadherin-like (1);	0.000000	0.49916	D	0.000123	T	0.55593	0.1930	L	0.60957	1.885	0.32493	N	0.539934	B	0.20887	0.049	B	0.22601	0.04	T	0.62863	-0.6764	10	0.59425	D	0.04	.	6.5957	0.22672	0.1473:0.1551:0.6975:0.0	.	433	P32926	DSG3_HUMAN	A	433	ENSP00000257189:G433A	ENSP00000257189:G433A	G	+	2	0	DSG3	27299305	0.935000	0.31712	0.998000	0.56505	0.207000	0.24258	1.861000	0.39438	2.753000	0.94483	0.467000	0.42956	GGA	0	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.294	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	protein_coding	OTTHUMT00000254949.1	110	285	0	0.00	0	0	G	NM_001944	0	0		29045307	1	no_errors	ENST00000257189	ensembl	human	known	74_37	missense	140	365	8.5	10.51	13	43	SNP	0.998	C
RNF138	51444	genome.wustl.edu	37	18	29706742	29706742	+	Silent	SNP	A	A	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr18:29706742A>G	ENST00000261593.3	+	7	1106	c.648A>G	c.(646-648)caA>caG	p.Q216Q	RNF138_ENST00000257190.5_Silent_p.Q122Q|RP11-53I6.4_ENST00000583138.1_RNA	NM_001191324.1|NM_016271.4	NP_001178253.2|NP_057355.2	Q8WVD3	RN138_HUMAN	ring finger protein 138, E3 ubiquitin protein ligase	216					protein ubiquitination (GO:0016567)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	ligase activity (GO:0016874)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						AGAGACATCAATTTGATTATG	0.303																																							0											0													68.0	68.0	68.0					18																	29706742		2203	4298	6501	SO:0001819	synonymous_variant	0			AF162680	CCDS11903.1, CCDS11904.1	18q12.1	2013-01-28	2012-02-23		ENSG00000134758	ENSG00000134758		"""RING-type (C3HC4) zinc fingers"""	17765	protein-coding gene	gene with protein product	"""nemo-like kinase associated ring finger protein"""		"""ring finger protein 138"""			22155992, 16714285	Standard	NM_016271		Approved	STRIN, NARF	uc021uip.2	Q8WVD3	OTTHUMG00000132265	ENST00000261593.3:c.648A>G	18.37:g.29706742A>G			B2RE17|Q9H8K2|Q9UF87|Q9UKI6	Silent	SNP	pfam_Znf_MIZ,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q216	ENST00000261593.3	37	c.648	CCDS11903.1	18																																																																																			0	NULL		0.303	RNF138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF138	protein_coding	OTTHUMT00000255352.2	120	190	0	0.00	0	0	A	NM_016271	0	0		29706742	1	no_errors	ENST00000261593	ensembl	human	known	74_37	silent	151	261	20.11	23.24	38	79	SNP	1	G
ZNF730	100129543	genome.wustl.edu	37	19	23329318	23329318	+	Missense_Mutation	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr19:23329318G>A	ENST00000597761.2	+	4	1671	c.1472G>A	c.(1471-1473)cGg>cAg	p.R491Q		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						GCCTTTAGGCGGTTCTCACAC	0.353																																							0											0																																										SO:0001583	missense	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1472G>A	19.37:g.23329318G>A	ENSP00000472959:p.Arg491Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R491Q	ENST00000597761.2	37	c.1472	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.238674	0.00274	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.926	-1.85	0.07784	.	.	.	.	.	T	0.11110	0.0271	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26052	-1.0114	5	0.02654	T	1	.	4.5373	0.12040	0.7408:0.0:0.2592:0.0	.	.	.	.	Q	491	.	ENSP00000329365:R491Q	R	+	2	0	ZNF730	23121158	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-2.234000	0.01203	-1.284000	0.02390	-1.305000	0.01319	CGG	0	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.353	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	protein_coding	OTTHUMT00000465737.2	59	212	0	0.00	0	0	G	XM_001719792	0	0		23329318	1	no_errors	ENST00000597761	ensembl	human	known	74_37	missense	30	65	55.88	65.43	38	123	SNP	0	A
FFAR3	2865	genome.wustl.edu	37	19	35849879	35849879	+	Silent	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr19:35849879C>T	ENST00000327809.4	+	2	288	c.87C>T	c.(85-87)ctC>ctT	p.L29L	FFAR3_ENST00000594310.1_Silent_p.L29L	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	29					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.L29L(2)		endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGGTGGGGCTCCCCCTCAACC	0.647																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)		0											2	Substitution - coding silent(2)	lung(2)											88.0	82.0	84.0					19																	35849879		2199	4292	6491	SO:0001819	synonymous_variant	0			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.87C>T	19.37:g.35849879C>T			B2RWM8|Q14CM7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GPR40-rel_orph	p.L29	ENST00000327809.4	37	c.87	CCDS12459.1	19																																																																																			0	prints_GPCR_Rhodpsn		0.647	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	protein_coding	OTTHUMT00000418873.2	85	126	0	0.00	0	0	C	NM_005304	0	0		35849879	1	no_errors	ENST00000327809	ensembl	human	known	74_37	silent	61	93	15.28	13.89	11	15	SNP	0.89	T
RYR1	6261	genome.wustl.edu	37	19	39075660	39075660	+	Silent	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr19:39075660C>T	ENST00000359596.3	+	102	14724	c.14724C>T	c.(14722-14724)gaC>gaT	p.D4908D	RYR1_ENST00000360985.3_Silent_p.D4903D|RYR1_ENST00000355481.4_Silent_p.D4903D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4908					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCGCGGGTGACGAATACGAGC	0.592																																							0											0													262.0	198.0	219.0					19																	39075660		2203	4300	6503	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14724C>T	19.37:g.39075660C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.D4908	ENST00000359596.3	37	c.14724	CCDS33011.1	19																																																																																			0	pfam_Ion_trans_dom		0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	79	220	0	0.00	0	0	C		0	0		39075660	1	no_errors	ENST00000359596	ensembl	human	known	74_37	silent	39	136	36.07	22.29	22	39	SNP	0.992	T
ESF1	51575	genome.wustl.edu	37	20	13753210	13753210	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr20:13753210C>T	ENST00000202816.1	-	5	1308	c.1201G>A	c.(1201-1203)Gga>Aga	p.G401R		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TCTACTGGTCCTTGAACTTGC	0.328																																							0											0													186.0	177.0	180.0					20																	13753210		2203	4300	6503	SO:0001583	missense	0				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1201G>A	20.37:g.13753210C>T	ENSP00000202816:p.Gly401Arg		Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	pfam_NUC153	p.G401R	ENST00000202816.1	37	c.1201	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969487	0.92855	.	.	ENSG00000089048	ENST00000202816	T	0.77358	-1.09	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.90484	0.7019	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91462	0.5190	10	0.72032	D	0.01	22.4905	19.8105	0.96544	0.0:1.0:0.0:0.0	.	401	Q9H501	ESF1_HUMAN	R	401	ENSP00000202816:G401R	ENSP00000202816:G401R	G	-	1	0	ESF1	13701210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.096000	0.76960	2.755000	0.94549	0.650000	0.86243	GGA	0	NULL		0.328	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	protein_coding	OTTHUMT00000078049.1	35	210	0	0.00	0	0	C	NM_016649	0	0		13753210	-1	no_errors	ENST00000202816	ensembl	human	known	74_37	missense	32	192	27.27	33.33	12	96	SNP	1	T
LAMA5	3911	genome.wustl.edu	37	20	60895897	60895897	+	Silent	SNP	G	G	A			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr20:60895897G>A	ENST00000252999.3	-	49	6612	c.6546C>T	c.(6544-6546)ggC>ggT	p.G2182G		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2182	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGAGGAGGGCGCCGGCCCGTT	0.647																																							0											0													42.0	39.0	40.0					20																	60895897		2183	4280	6463	SO:0001819	synonymous_variant	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6546C>T	20.37:g.60895897G>A			Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.G2182	ENST00000252999.3	37	c.6546	CCDS33502.1	20																																																																																			0	NULL		0.647	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	67	60	0	0.00	0	0	G	NM_005560	0	0		60895897	-1	no_errors	ENST00000252999	ensembl	human	known	74_37	silent	25	20	46.94	60.00	23	30	SNP	0	A
CDKN2A	1029	genome.wustl.edu	37	9	21974777	21974780	+	Frame_Shift_Del	DEL	GCCA	GCCA	-	rs587782206		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	GCCA	GCCA	GCCA	-	GCCA	GCCA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr9:21974777_21974780delGCCA	ENST00000304494.5	-	1	317_320	c.47_50delTGGC	c.(46-51)ctggccfs	p.LA16fs	CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000361570.3_Intron|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.LA16fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.LA16fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.LA16fs|CDKN2A_ENST00000498628.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	16			L -> P (in a biliary tract tumor and a familial melanoma).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.L16fs*9(3)|p.L16P(2)|p.S12fs*6(1)|p.0(1)|p.A17_T18insTA(1)|p.A17fs*5(1)|p.L16_A17insAT(1)|p.S7_A19del(1)|p.A17T(1)|p.L16R(1)|p.S12fs*20(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGCGGCCGTGGCCAGCCAGTCAGC	0.755		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																													0											1352	Whole gene deletion(1316)|Unknown(23)|Deletion - Frameshift(6)|Substitution - Missense(4)|Insertion - In frame(2)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(279)|skin(170)|central_nervous_system(164)|lung(146)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(49)|ovary(35)|kidney(31)|pancreas(31)|breast(30)|thyroid(14)|biliary_tract(14)|NS(12)|stomach(12)|autonomic_ganglia(7)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CM023346|CM980321	CDKN2A	M																																				SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.47_50delTGGC	9.37:g.21974781_21974784delGCCA	ENSP00000307101:p.Leu16fs		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.L16fs	ENST00000304494.5	37	c.50_47	CCDS6510.1	9																																																																																			0	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.755	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	protein_coding	OTTHUMT00000051915.1	37	71	0	0.00	0	0	GCCA	NM_000077	rs587782206	GGCCA->G		21974780	-1	no_errors	ENST00000446177	ensembl	human	known	74_37	frame_shift_del	6	25	72.73	41.86	16	18	DEL	0.001:0.000:0.027:0.068	0
TP53	7157	genome.wustl.edu	37	17	7577096	7577096	+	Frame_Shift_Del	DEL	T	T	-	rs587781525		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr17:7577096delT	ENST00000269305.4	-	8	1031	c.842delA	c.(841-843)gacfs	p.D281fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Frame_Shift_Del_p.D281fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.D281fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.D281fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.D281fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281G(10)|p.0?(8)|p.D281V(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281>AGPY(2)|p.A276_R283delACPGRDRR(1)|p.D281R(1)|p.C275fs*20(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGTGCGCCGGTCTCTCCCAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		0	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	44	Substitution - Missense(18)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - insertion inframe(2)	haematopoietic_and_lymphoid_tissue(8)|upper_aerodigestive_tract(7)|breast(5)|lung(5)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|stomach(2)|urinary_tract(2)|oesophagus(1)	GRCh37	CM004343|CM056068	TP53	M							82.0	70.0	74.0					17																	7577096		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.842delA	17.37:g.7577096delT	ENSP00000269305:p.Asp281fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D281fs	ENST00000269305.4	37	c.842	CCDS11118.1	17																																																																																			0	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	41	222	0	0.00	0	0	T	NM_000546	0	0		7577096	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	8	37	81.82	72.99	36	100	DEL	1	0
EFCAB2	84288	genome.wustl.edu	37	1	245285221	245285221	+	Splice_Site	SNP	G	G	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr1:245285221G>T	ENST00000366522.2	+	8	922		c.e8-1		EFCAB2_ENST00000487845.1_Splice_Site|EFCAB2_ENST00000447569.2_Splice_Site			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			ttttattttagatggagtttc	0.423																																							0											0																																										SO:0001630	splice_region_variant	0			AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.782-1G>T	1.37:g.245285221G>T			B4DZE9|Q59G23|Q9BS36	Splice_Site	SNP	0	e8-1	ENST00000366522.2	37	c.782-1		1																																																																																			0	0		0.423	EFCAB2-001	KNOWN	basic	protein_coding	EFCAB2	protein_coding	OTTHUMT00000097407.2	8	0	0	0.00	0	0	G		0	0	Intron	245285221	1	no_errors	ENST00000366522	ensembl	human	known	74_37	splice_site	20	0	16.67	0.00	4	0	SNP	0.009	T
RABL6	55684	genome.wustl.edu	37	9	139731851	139731851	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr9:139731851C>T	ENST00000311502.7	+	9	1099	c.863C>T	c.(862-864)gCc>gTc	p.A288V	RABL6_ENST00000432842.2_Missense_Mutation_p.A250V|RABL6_ENST00000371663.4_Missense_Mutation_p.A289V|RABL6_ENST00000357466.2_Missense_Mutation_p.A288V|RABL6_ENST00000371675.3_Missense_Mutation_p.A173V			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	288					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCACTGGCGGCCAACGGGCAG	0.706																																							0											0													8.0	9.0	8.0					9																	139731851		1865	4034	5899	SO:0001583	missense	0			AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.863C>T	9.37:g.139731851C>T	ENSP00000311134:p.Ala288Val		A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.A289V	ENST00000311502.7	37	c.866	CCDS48058.1	9	.	.	.	.	.	.	.	.	.	.	.	18.46	3.629120	0.67015	.	.	ENSG00000196642	ENST00000371673;ENST00000371663;ENST00000311502;ENST00000357466;ENST00000432842;ENST00000371675;ENST00000435930	T;T;T;T;T;T	0.71341	-0.2;-0.21;1.97;0.8;-0.22;-0.56	4.33	4.33	0.51752	.	0.205916	0.41823	D	0.000802	T	0.76162	0.3949	L	0.53249	1.67	0.48341	D	0.999635	P;D;P;P	0.69078	0.78;0.997;0.705;0.58	B;P;B;B	0.55011	0.265;0.766;0.275;0.142	T	0.78570	-0.2153	10	0.51188	T	0.08	-18.5713	15.8222	0.78662	0.0:1.0:0.0:0.0	.	288;82;289;288	A8QVZ8;B1AMX5;Q3YEC7-2;Q3YEC7	.;.;.;PARF_HUMAN	V	289;289;288;288;250;173;82	ENSP00000360727:A289V;ENSP00000311134:A288V;ENSP00000350056:A288V;ENSP00000414081:A250V;ENSP00000360740:A173V;ENSP00000408442:A82V	ENSP00000311134:A288V	A	+	2	0	C9orf86	138851672	0.941000	0.31946	0.268000	0.24571	0.087000	0.18053	5.132000	0.64758	1.961000	0.56991	0.313000	0.20887	GCC	0	NULL		0.706	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	protein_coding	OTTHUMT00000055141.4	77	13	0	0.00	0	0	C	NM_024718	0	0		139731851	1	no_errors	ENST00000371663	ensembl	human	known	74_37	missense	41	3	8.89	0.00	4	0	SNP	0.98	T
SH3GL3	6457	genome.wustl.edu	37	15	84284968	84284968	+	Intron	SNP	T	T	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr15:84284968T>G	ENST00000427482.2	+	9	1144				SH3GL3_ENST00000434347.1_Intron|SH3GL3_ENST00000564054.1_Intron|AC087738.1_ENST00000411248.1_RNA|SH3GL3_ENST00000324537.5_Intron|SH3GL3_ENST00000535412.1_Intron	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3						central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						aattgcaggttttgccactaa	0.363																																							0											0																																										SO:0001627	intron_variant	0			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.839-1866T>G	15.37:g.84284968T>G			O43553|O43554	RNA	SNP	0	NULL	ENST00000427482.2	37	NULL	CCDS10325.2	15																																																																																			0	0		0.363	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000223180	protein_coding	OTTHUMT00000347797.1	47	0	0	0.00	0	0	T	NM_003027	0	0		84284968	1	no_errors	ENST00000411248	ensembl	human	novel	74_37	rna	37	0	54.32	0.00	44	0	SNP	0.008	G
NPIPA2	642799	genome.wustl.edu	37	16	14859247	14859247	+	Missense_Mutation	SNP	C	C	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr16:14859247C>T	ENST00000529166.1	+	8	1087	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	NPIPA2_ENST00000553201.1_Missense_Mutation_p.R344W			E9PIF3	NPIA2_HUMAN	nuclear pore complex interacting protein family, member A2	363																	CCACCCTCAGCGGATGATAAT	0.418																																							0											0																																										SO:0001583	missense	0				CCDS59263.1	16p13.11	2013-06-11			ENSG00000254852	ENSG00000254852			41979	protein-coding gene	gene with protein product							Standard	NM_001277324		Approved			E9PIF3	OTTHUMG00000166264	ENST00000529166.1:c.1087C>T	16.37:g.14859247C>T	ENSP00000432029:p.Arg363Trp			Missense_Mutation	SNP	NULL	p.R363W	ENST00000529166.1	37	c.1087		16	.	.	.	.	.	.	.	.	.	.	.	9.766	1.171381	0.21621	.	.	ENSG00000254852	ENST00000529166;ENST00000553201	T;T	0.52526	1.97;0.66	.	.	.	.	.	.	.	.	T	0.36608	0.0973	N	0.19112	0.55	0.09310	N	1	D	0.58620	0.983	P	0.49637	0.617	T	0.23119	-1.0197	7	0.87932	D	0	.	.	.	.	.	363	E9PJI5	.	W	363;344	ENSP00000432029:R363W;ENSP00000446882:R344W	ENSP00000432029:R363W	R	+	1	2	RP11-719K4.2	14766748	.	.	0.064000	0.19789	0.064000	0.16182	.	.	0.073000	0.16731	0.074000	0.15403	CGG	0	NULL		0.418	NPIPA2-002	NOVEL	basic|appris_candidate_longest	protein_coding	NPIPA2	protein_coding	OTTHUMT00000389062.1	33	0	2.86	0.00	1	0	C		0	0		14859247	1	no_errors	ENST00000529166	ensembl	human	novel	74_37	missense	80	0	9.09	0.00	8	0	SNP	0.065	T
KRTAP9-7	100505724	genome.wustl.edu	37	17	39432066	39432066	+	Silent	SNP	G	G	T			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr17:39432066G>T	ENST00000391354.1	+	1	156	c.117G>T	c.(115-117)gtG>gtT	p.V39V		NM_001277332.1	NP_001264261.1	A8MTY7	KRA97_HUMAN	keratin associated protein 9-7	39	17 X 5 AA repeats of C-C-[VGSREQH]- [SQTPN]-[STPAI].					keratin filament (GO:0045095)				ovary(1)	1						CCTGCTGTGTGTCCAGCTGCT	0.642																																							0											0																																										SO:0001819	synonymous_variant	0			AC006070	CCDS59287.1	17q21.2	2013-06-25			ENSG00000180386	ENSG00000180386		"""Keratin associated proteins"""	18915	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 1"""	KRTAP9L1			Standard	NM_001277332		Approved	KAP9.7	uc031rah.1	A8MTY7	OTTHUMG00000133605	ENST00000391354.1:c.117G>T	17.37:g.39432066G>T				Silent	SNP	NULL	p.V39	ENST00000391354.1	37	c.117	CCDS59287.1	17																																																																																			0	NULL		0.642	KRTAP9-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-7	protein_coding	OTTHUMT00000257713.1	70	0	0	0.00	0	0	G	XM_003118738	0	0		39432066	1	no_errors	ENST00000391354	ensembl	human	known	74_37	silent	136	0	11.69	0.00	18	0	SNP	0	T
AHDC1	27245	genome.wustl.edu	37	1	27878369	27878370	+	Frame_Shift_Ins	INS	-	-	G			TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr1:27878369_27878370insG	ENST00000247087.5	-	5	853_854	c.257_258insC	c.(256-258)ccafs	p.P86fs	AHDC1_ENST00000374011.2_Frame_Shift_Ins_p.P86fs			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	86	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGGCTGCCCGTGGGGGCAGCGG	0.738																																							0											0																																										SO:0001589	frameshift_variant	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.258dupC	1.37:g.27878374_27878374dupG	ENSP00000247087:p.Pro86fs		Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Frame_Shift_Ins	INS	NULL	p.R87fs	ENST00000247087.5	37	c.258_257	CCDS30652.1	1																																																																																			0	NULL		0.738	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	protein_coding	OTTHUMT00000009523.3	21	16	0	0.00	0	0	0		0	0		27878370	-1	no_errors	ENST00000247087	ensembl	human	known	74_37	frame_shift_ins	4	8	33.33	0.00	2	0	INS	0.012:0.992	G
PTPRZ1	5803	genome.wustl.edu	37	7	121513383	121513384	+	5'UTR	DEL	CA	CA	-	rs386360108|rs370737965		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr7:121513383_121513384delCA	ENST00000393386.2	+	0	241_242				PTPRZ1_ENST00000449182.1_5'Flank	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ctctctctctcacacacacaca	0.49																																							0											0																																										SO:0001623	5_prime_UTR_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.-170CA>-	7.37:g.121513393_121513394delCA			A4D0W5|C9JFM0|O76043|Q9UDR6	RNA	DEL	0	NULL	ENST00000393386.2	37	NULL	CCDS34740.1	7																																																																																			0	0		0.490	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	9	0	10	0.00	1	0	CA	NM_002851	rs386360108	TCA->T		121513384	1	no_errors	ENST00000471837	ensembl	human	known	74_37	rna	9	0	50	0.00	9	0	DEL	0.002:0.001	0
MCM3AP	8888	genome.wustl.edu	37	21	47662899	47662900	+	Intron	INS	-	-	A	rs56371413|rs75544878		TCGA-3S-A8YW-01A-11D-A423-09	TCGA-3S-A8YW-10A-01D-A426-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67b5676a-84a1-44fb-9301-b962911b7f93	b9e36959-d9a1-43d8-a24f-c35495eb6d7a	g.chr21:47662899_47662900insA	ENST00000397708.1	-	26	5551				MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000467026.1_Intron|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP_ENST00000291688.1_Intron|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AACCCTGTCTCAAAAAAAAAAA	0.351																																							0											0																																										SO:0001627	intron_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5297-54->T	21.37:g.47662910_47662910dupA			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	RNA	INS	0	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			0	0		0.351	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP-AS1	protein_coding	OTTHUMT00000207254.1	21	0	0	0.00	0	0	0	NM_003906	0	0		47662900	1	no_errors	ENST00000421927	ensembl	human	known	74_37	rna	8	0	33.33	0.00	4	0	INS	0.000:0.000	A
