#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
CXorf23	256643	genome.wustl.edu	37	X	19983216	19983216	+	Missense_Mutation	SNP	C	C	G			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chrX:19983216C>G	ENST00000379682.4	-	3	1253	c.1220G>C	c.(1219-1221)aGg>aCg	p.R407T	CXorf23_ENST00000356980.3_Missense_Mutation_p.R407T|CXorf23_ENST00000379687.3_Missense_Mutation_p.R407T			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	407						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TGATTTCTTCCTAAGATTGAT	0.313																																							0											0													87.0	77.0	80.0					X																	19983216		1815	4071	5886	SO:0001583	missense	0			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.1220G>C	X.37:g.19983216C>G	ENSP00000369004:p.Arg407Thr		A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Missense_Mutation	SNP	NULL	p.R407T	ENST00000379682.4	37	c.1220		X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.70|10.70	1.423099|1.423099	0.25639|0.25639	.|.	.|.	ENSG00000173681|ENSG00000173681	ENST00000379687;ENST00000379682;ENST00000356980;ENST00000539038|ENST00000340625	T;T;T|.	0.17691|.	2.26;2.26;2.26|.	5.15|5.15	-3.27|-3.27	0.05048|0.05048	.|.	.|.	.|.	.|.	.|.	T|.	0.16642|.	0.0400|.	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;P|.	0.37276|.	0.435;0.589|.	B;B|.	0.32864|.	0.117;0.154|.	T|.	0.25641|.	-1.0126|.	8|.	.|.	.|.	.|.	.|.	4.5518|4.5518	0.12116|0.12116	0.0937:0.3208:0.0914:0.4941|0.0937:0.3208:0.0914:0.4941	.|.	407;407|.	A2AJT9-2;A2AJT9|.	.;CX023_HUMAN|.	T|Y	407;407;407;295|15	ENSP00000369009:R407T;ENSP00000369004:R407T;ENSP00000349470:R407T|.	.|.	R|X	-|-	2|3	0|2	CXorf23|CXorf23	19893137|19893137	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.958000|0.958000	0.62258|0.62258	-1.089000|-1.089000	0.03376|0.03376	-0.905000|-0.905000	0.03871|0.03871	0.466000|0.466000	0.42574|0.42574	AGG|TAG	0	NULL		0.313	CXorf23-006	NOVEL	basic	protein_coding	CXorf23	protein_coding	OTTHUMT00000055991.2	140	274	0	0.00	0	0	C	NM_198279	0	0		19983216	-1	no_errors	ENST00000379687	ensembl	human	known	74_37	missense	134	504	16.25	15.41	26	92	SNP	0	G
PSMA5	5686	genome.wustl.edu	37	1	109957976	109957976	+	Missense_Mutation	SNP	T	T	C			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr1:109957976T>C	ENST00000271308.4	-	3	126	c.106A>G	c.(106-108)Aca>Gca	p.T36A	PSMA5_ENST00000538610.1_5'UTR|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	36					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		CCAATGGCTGTAGAACCAAGC	0.413																																							0											0													122.0	117.0	119.0					1																	109957976		2203	4300	6503	SO:0001583	missense	0			X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.106A>G	1.37:g.109957976T>C	ENSP00000271308:p.Thr36Ala		B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.T36A	ENST00000271308.4	37	c.106	CCDS799.1	1	.	.	.	.	.	.	.	.	.	.	t	17.87	3.493830	0.64186	.	.	ENSG00000143106	ENST00000271308	T	0.36699	1.24	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.26412	0.0645	M	0.62723	1.935	0.80722	D	1	B	0.15141	0.012	B	0.31390	0.129	T	0.10154	-1.0642	9	.	.	.	-2.5086	14.8871	0.70579	0.0:0.0:0.0:1.0	.	36	P28066	PSA5_HUMAN	A	36	ENSP00000271308:T36A	.	T	-	1	0	PSMA5	109759499	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	8.016000	0.88706	2.158000	0.67659	0.478000	0.44815	ACA	0	pfam_Proteasome_sua/b		0.413	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA5	protein_coding	OTTHUMT00000033192.2	51	260	0	0.00	0	0	T	NM_002790	0	0		109957976	-1	no_errors	ENST00000271308	ensembl	human	known	74_37	missense	41	274	12.77	15.69	6	51	SNP	1	C
RAB3GAP2	25782	genome.wustl.edu	37	1	220363843	220363843	+	Missense_Mutation	SNP	T	T	C			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr1:220363843T>C	ENST00000358951.2	-	15	1623	c.1507A>G	c.(1507-1509)Aaa>Gaa	p.K503E		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	503					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CCCATTATTTTATAGCCAGGA	0.368																																							0											0													73.0	74.0	73.0					1																	220363843		2203	4300	6503	SO:0001583	missense	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1507A>G	1.37:g.220363843T>C	ENSP00000351832:p.Lys503Glu		A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.K503E	ENST00000358951.2	37	c.1507	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	T	19.48	3.834834	0.71373	.	.	ENSG00000118873	ENST00000358951	T	0.30448	1.53	5.93	5.93	0.95920	.	0.043188	0.85682	D	0.000000	T	0.21103	0.0508	N	0.14661	0.345	0.45427	D	0.998406	P	0.40660	0.726	B	0.42827	0.399	T	0.03651	-1.1016	10	0.06236	T	0.91	.	16.3798	0.83452	0.0:0.0:0.0:1.0	.	503	Q9H2M9	RBGPR_HUMAN	E	503	ENSP00000351832:K503E	ENSP00000351832:K503E	K	-	1	0	RAB3GAP2	218430466	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.006000	0.70724	2.271000	0.75665	0.533000	0.62120	AAA	0	superfamily_WD40_repeat_dom		0.368	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	protein_coding	OTTHUMT00000090205.2	27	297	0	0.00	0	0	T	NM_012414	0	0		220363843	-1	no_errors	ENST00000358951	ensembl	human	known	74_37	missense	23	304	17.86	10.03	5	34	SNP	1	C
U2SURP	23350	genome.wustl.edu	37	3	142773813	142773813	+	Missense_Mutation	SNP	C	C	T			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr3:142773813C>T	ENST00000473835.2	+	27	2893	c.2803C>T	c.(2803-2805)Cca>Tca	p.P935S	U2SURP_ENST00000397933.2_Missense_Mutation_p.P526S|U2SURP_ENST00000493598.2_Missense_Mutation_p.P934S	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	935	Arg/Ser-rich.				RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						ATCCCCCAGCCCATCTCGCAG	0.468																																							0											0													61.0	57.0	58.0					3																	142773813		1926	4137	6063	SO:0001583	missense	0			BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.2803C>T	3.37:g.142773813C>T	ENSP00000418563:p.Pro935Ser		A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	pfam_Surp,pfam_RRM_dom,superfamily_Surp,superfamily_ENTH_VHS,smart_RRM_dom,smart_Surp,smart_CID_dom,pfscan_Surp,pfscan_RRM_dom	p.P935S	ENST00000473835.2	37	c.2803	CCDS46928.1	3	.	.	.	.	.	.	.	.	.	.	C	18.69	3.679033	0.68042	.	.	ENSG00000163714	ENST00000473835;ENST00000319822;ENST00000397933;ENST00000493598	T;T;T	0.39997	1.05;2.08;1.05	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.58623	0.2135	L	0.46157	1.445	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.993	D;D;D	0.75484	0.986;0.986;0.968	T	0.42548	-0.9445	10	0.19590	T	0.45	-8.9392	20.2982	0.98569	0.0:1.0:0.0:0.0	.	934;526;935	O15042-2;O15042-3;O15042	.;.;SR140_HUMAN	S	935;935;526;934	ENSP00000418563:P935S;ENSP00000381027:P526S;ENSP00000422011:P934S	ENSP00000322376:P935S	P	+	1	0	U2SURP	144256503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.262000	0.78410	2.873000	0.98535	0.563000	0.77884	CCA	0	NULL		0.468	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	U2SURP	protein_coding	OTTHUMT00000354603.2	51	153	0	0.00	0	0	C	NM_001080415	0	0		142773813	1	no_errors	ENST00000473835	ensembl	human	known	74_37	missense	47	185	12.96	4.64	7	9	SNP	1	T
LINC01410	103352539	genome.wustl.edu	37	9	66457330	66457330	+	lincRNA	SNP	G	G	T			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr9:66457330G>T	ENST00000424345.1	+	0	42				RNA5SP283_ENST00000365604.1_RNA																							cagcgacagagccttggagag	0.632																																							0											0																																												0																															9.37:g.66457330G>T				RNA	SNP	0	NULL	ENST00000424345.1	37	NULL		9																																																																																			0	0		0.632	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	lincRNA	OTTHUMT00000128851.1	55	14	1.79	0.00	1	0	G		0	0		66457330	1	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	66	27	8.33	10.00	6	3	SNP	0.2	T
HSPA14	51182	genome.wustl.edu	37	10	14909169	14909169	+	Missense_Mutation	SNP	A	A	G			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr10:14909169A>G	ENST00000378372.3	+	11	1320	c.1081A>G	c.(1081-1083)Atc>Gtc	p.I361V		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	361					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						TCTCAATTCTATCCCTCCTGA	0.418																																							0											0													112.0	113.0	113.0					10																	14909169		2203	4300	6503	SO:0001583	missense	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1081A>G	10.37:g.14909169A>G	ENSP00000367623:p.Ile361Val		A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.I361V	ENST00000378372.3	37	c.1081	CCDS7103.1	10	.	.	.	.	.	.	.	.	.	.	A	11.60	1.685587	0.29962	.	.	ENSG00000187522	ENST00000378372	T	0.00832	5.64	5.35	1.57	0.23409	.	0.284206	0.38605	N	0.001622	T	0.00754	0.0025	N	0.21448	0.665	0.18873	N	0.999985	P	0.35192	0.489	B	0.30179	0.112	T	0.52147	-0.8614	10	0.87932	D	0	-3.7532	6.8764	0.24149	0.7389:0.1263:0.1348:0.0	.	361	Q0VDF9	HSP7E_HUMAN	V	361	ENSP00000367623:I361V	ENSP00000367623:I361V	I	+	1	0	HSPA14	14949175	0.144000	0.22641	0.120000	0.21714	0.866000	0.49608	0.881000	0.28173	0.076000	0.16826	0.460000	0.39030	ATC	0	pfam_Hsp_70_fam,prints_Hsp_70_fam		0.418	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	protein_coding	OTTHUMT00000046910.1	45	235	0	0.00	0	0	A	NM_016299	0	0		14909169	1	no_errors	ENST00000378372	ensembl	human	known	74_37	missense	38	299	13.64	7.98	6	26	SNP	0.006	G
HTR7	3363	genome.wustl.edu	37	10	92508880	92508880	+	Silent	SNP	G	G	A			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr10:92508880G>A	ENST00000336152.3	-	2	1037	c.1011C>T	c.(1009-1011)acC>acT	p.T337T	HTR7_ENST00000371719.2_Silent_p.T337T|HTR7_ENST00000277874.6_Silent_p.T337T|HTR7_ENST00000371721.3_Silent_p.T337T	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	337					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GCCAGCACACGGTAAAGGCCC	0.532																																							0											0													81.0	73.0	76.0					10																	92508880		2203	4300	6503	SO:0001819	synonymous_variant	0			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.1011C>T	10.37:g.92508880G>A			B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT_7_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.T337	ENST00000336152.3	37	c.1011	CCDS7408.1	10																																																																																			0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.532	HTR7-001	KNOWN	basic|CCDS	protein_coding	HTR7	protein_coding	OTTHUMT00000049343.1	75	114	0	0.00	0	0	G	NM_000872	0	0		92508880	-1	no_errors	ENST00000336152	ensembl	human	known	74_37	silent	63	181	9.86	7.65	7	15	SNP	0.009	A
TRPM5	29850	genome.wustl.edu	37	11	2438977	2438977	+	Missense_Mutation	SNP	A	A	G			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr11:2438977A>G	ENST00000155858.6	-	7	997	c.989T>C	c.(988-990)aTc>aCc	p.I330T	TRPM5_ENST00000528453.1_Missense_Mutation_p.I330T|TRPM5_ENST00000452833.1_Missense_Mutation_p.I332T|TRPM5_ENST00000533060.1_Missense_Mutation_p.I330T	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGCCTTCAGGATGACCGTGTC	0.632																																					NSCLC(1;49 61 17205 18850 43201)		0											0													31.0	29.0	30.0					11																	2438977		2196	4296	6492	SO:0001583	missense	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.989T>C	11.37:g.2438977A>G	ENSP00000155858:p.Ile330Thr			Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.I332T	ENST00000155858.6	37	c.995	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266473	0.59540	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	4.05	2.91	0.33838	.	0.069433	0.56097	D	0.000029	T	0.76737	0.4029	M	0.84773	2.715	0.43652	D	0.99606	D;D;D	0.76494	0.999;0.999;0.984	D;D;D	0.71414	0.973;0.973;0.917	T	0.76107	-0.3080	10	0.87932	D	0	-20.3582	7.3539	0.26709	0.8964:0.0:0.1036:0.0	.	330;332;330	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	T	324;330;332;330;330;330	ENSP00000434383:I324T;ENSP00000155858:I330T;ENSP00000387965:I332T;ENSP00000434121:I330T;ENSP00000436809:I330T	ENSP00000155858:I330T	I	-	2	0	TRPM5	2395553	1.000000	0.71417	0.732000	0.30844	0.786000	0.44442	8.017000	0.88712	0.553000	0.29044	0.260000	0.18958	ATC	0	NULL		0.632	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	protein_coding	OTTHUMT00000027378.1	76	80	0	1.23	0	1	A	NM_014555	0	0		2438977	-1	no_errors	ENST00000452833	ensembl	human	known	74_37	missense	60	71	11.76	18.39	8	16	SNP	1	G
KIF21A	55605	genome.wustl.edu	37	12	39731002	39731002	+	Missense_Mutation	SNP	G	G	A			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr12:39731002G>A	ENST00000361418.5	-	17	2329	c.2314C>T	c.(2314-2316)Cgc>Tgc	p.R772C	KIF21A_ENST00000544797.2_Missense_Mutation_p.R759C|KIF21A_ENST00000541463.2_Missense_Mutation_p.R759C|KIF21A_ENST00000395670.3_Missense_Mutation_p.R772C|KIF21A_ENST00000361961.3_Missense_Mutation_p.R759C			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	772					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TTCATTAGGCGAACCTAACCA	0.338																																							0											0													134.0	119.0	124.0					12																	39731002		2203	4298	6501	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2314C>T	12.37:g.39731002G>A	ENSP00000354878:p.Arg772Cys		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.R772C	ENST00000361418.5	37	c.2314	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844139	0.71488	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463	T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1	5.35	5.35	0.76521	.	0.124666	0.36932	N	0.002322	T	0.47967	0.1474	M	0.71581	2.175	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79108	0.938;0.992;0.943;0.931;0.978	T	0.48681	-0.9014	10	0.87932	D	0	.	18.0809	0.89441	0.0:0.0:1.0:0.0	.	759;759;772;759;772	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3	.;.;KI21A_HUMAN;.;.	C	759;772;772;759;772;759	ENSP00000354851:R759C;ENSP00000379029:R772C;ENSP00000445606:R759C;ENSP00000354878:R772C;ENSP00000438075:R759C	ENSP00000344501:R772C	R	-	1	0	KIF21A	38017269	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.947000	0.49058	2.512000	0.84698	0.650000	0.86243	CGC	0	NULL		0.338	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	37	206	0	0.00	0	0	G	NM_017641	0	0		39731002	-1	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	39	337	11.36	10.37	5	39	SNP	1	A
RLBP1	6017	genome.wustl.edu	37	15	89761830	89761830	+	Missense_Mutation	SNP	G	G	A	rs200143313		TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr15:89761830G>A	ENST00000268125.5	-	4	546	c.107C>T	c.(106-108)cCg>cTg	p.P36L		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	36					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.P36L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	CTGGCTGCACGGGCCAAAGAC	0.617																																							0											1	Substitution - Missense(1)	endometrium(1)						G	LEU/PRO	1,4399	2.1+/-5.4	0,1,2199	72.0	65.0	68.0		107	-11.9	0.0	15		68	0,8598		0,0,4299	yes	missense	RLBP1	NM_000326.4	98	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	benign	36/318	89761830	1,12997	2200	4299	6499	SO:0001583	missense	0			BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.107C>T	15.37:g.89761830G>A	ENSP00000268125:p.Pro36Leu		B2R667	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran,pfscan_CRAL-TRIO_dom	p.P36L	ENST00000268125.5	37	c.107	CCDS32324.1	15	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689811	0.29962	2.27E-4	0.0	ENSG00000140522	ENST00000268125	T	0.78595	-1.19	5.95	-11.9	0.00025	Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.639785	0.16616	N	0.206698	T	0.51770	0.1694	L	0.33485	1.01	0.21499	N	0.999662	B	0.18166	0.026	B	0.10450	0.005	T	0.41840	-0.9486	10	0.08599	T	0.76	-4.7835	8.5754	0.33595	0.0533:0.3578:0.0883:0.5007	.	36	P12271	RLBP1_HUMAN	L	36	ENSP00000268125:P36L	ENSP00000268125:P36L	P	-	2	0	RLBP1	87562834	0.000000	0.05858	0.001000	0.08648	0.874000	0.50279	-0.344000	0.07780	-2.784000	0.00359	-0.262000	0.10625	CCG	0	pfam_CRAL/TRIO_N_dom		0.617	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLBP1	protein_coding	OTTHUMT00000421135.1	46	123	0	0.81	0	1	G	NM_000326	rs200143313	G->A		89761830	-1	no_errors	ENST00000268125	ensembl	human	known	74_37	missense	16	127	23.81	21.60	5	35	SNP	0	A
WDR81	124997	genome.wustl.edu	37	17	1628569	1628569	+	Missense_Mutation	SNP	G	G	A			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr17:1628569G>A	ENST00000409644.1	+	1	316	c.316G>A	c.(316-318)Gag>Aag	p.E106K	WDR81_ENST00000437219.2_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000309182.5_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	106					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GACGCGCGTGGAGGTGCATGG	0.687																																							0											0													3.0	4.0	4.0					17																	1628569		655	1526	2181	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.316G>A	17.37:g.1628569G>A	ENSP00000386609:p.Glu106Lys		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E106K	ENST00000409644.1	37	c.316	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	G	15.08	2.725786	0.48833	.	.	ENSG00000167716	ENST00000409644	T	0.50548	0.74	5.92	4.95	0.65309	.	.	.	.	.	T	0.59376	0.2189	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56968	-0.7891	6	0.44086	T	0.13	.	14.5145	0.67809	0.0697:0.0:0.9303:0.0	.	.	.	.	K	106	ENSP00000386609:E106K	ENSP00000386609:E106K	E	+	1	0	WDR81	1575319	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.923000	0.63412	2.800000	0.96347	0.650000	0.86243	GAG	0	NULL		0.687	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	protein_coding	OTTHUMT00000333118.2	41	65	0	0.00	0	0	G	NM_152348	0	0		1628569	1	no_errors	ENST00000409644	ensembl	human	known	74_37	missense	27	70	15.15	7.89	5	6	SNP	1	A
SLC25A11	8402	genome.wustl.edu	37	17	4843135	4843135	+	Missense_Mutation	SNP	T	T	C			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr17:4843135T>C	ENST00000225665.7	-	1	411	c.71A>G	c.(70-72)aAg>aGg	p.K24R	SLC25A11_ENST00000544061.2_Missense_Mutation_p.K24R|RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000572430.1_5'Flank|RNF167_ENST00000262482.6_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	24					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						AAACAGGAACTTGACGGACTT	0.672																																					Esophageal Squamous(144;1178 2388 18010 48797)		0											0													20.0	22.0	21.0					17																	4843135		2202	4299	6501	SO:0001583	missense	0			X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.71A>G	17.37:g.4843135T>C	ENSP00000225665:p.Lys24Arg		F5GY65|O75537|Q969P7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.K24R	ENST00000225665.7	37	c.71	CCDS11059.1	17	.	.	.	.	.	.	.	.	.	.	T	18.85	3.710655	0.68730	.	.	ENSG00000108528	ENST00000225665;ENST00000544061	T;T	0.79141	-1.24;-1.2	5.34	5.34	0.76211	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.72732	0.3497	L	0.48986	1.54	0.50632	D	0.999887	B	0.17038	0.02	B	0.20384	0.029	T	0.68969	-0.5269	10	0.40728	T	0.16	-22.9389	13.3116	0.60384	0.0:0.0:0.0:1.0	.	24	Q02978	M2OM_HUMAN	R	24	ENSP00000225665:K24R;ENSP00000440804:K24R	ENSP00000225665:K24R	K	-	2	0	SLC25A11	4783880	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.619000	0.54196	2.240000	0.73641	0.477000	0.44152	AAG	0	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.672	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A11	protein_coding	OTTHUMT00000216852.4	137	166	0	0.00	0	0	T	NM_003562	0	0		4843135	-1	no_errors	ENST00000225665	ensembl	human	known	74_37	missense	95	153	11.93	14.04	13	25	SNP	1	C
ZNF788	388507	genome.wustl.edu	37	19	12221205	12221205	+	5'UTR	SNP	G	G	A	rs191263400		TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr19:12221205G>A	ENST00000339302.4	+	0	294				ZNF788_ENST00000430298.2_Missense_Mutation_p.R30Q|ZNF788_ENST00000596883.1_Missense_Mutation_p.R50Q|ZNF788_ENST00000397759.3_5'Flank|ZNF20_ENST00000600335.1_Intron			Q6ZQV5	ZN788_HUMAN	zinc finger family member 788						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)	2						AATCTCTACCGAGAAGTGATG	0.458													.|||	1	0.000199681	0.0	0.0	5008	,	,		19722	0.001		0.0	False		,,,				2504	0.0				Melanoma(116;440 1644 18510 25456 49479)		0.9998,0.0001997											0																																										SO:0001623	5_prime_UTR_variant	0			AI566055		19p13.2	2013-01-08	2006-08-16		ENSG00000214189	ENSG00000214189		"""Zinc fingers, C2H2-type"""	33112	protein-coding gene	gene with protein product							Standard	NR_027049		Approved	FLJ46419	uc002mtd.3	Q6ZQV5	OTTHUMG00000156416	ENST00000339302.4:c.-344G>A	19.37:g.12221205G>A			Q6ZRE4	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R50Q	ENST00000339302.4	37	c.149		19	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.88	1.769729	0.31320	.	.	ENSG00000214189	ENST00000430298	T	0.02579	4.24	0.799	-0.389	0.12455	.	.	.	.	.	T	0.03608	0.0103	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.35624	-0.9781	5	0.62326	D	0.03	.	3.2535	0.06823	0.3398:0.0:0.4607:0.1996	.	.	.	.	Q	30	ENSP00000391703:R30Q	ENSP00000391703:R30Q	R	+	2	0	ZNF788	12082205	0.731000	0.28111	0.206000	0.23566	0.045000	0.14185	0.403000	0.20982	-0.708000	0.05015	-1.644000	0.00765	CGA	0	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.458	ZNF788-201	KNOWN	basic|appris_principal	protein_coding	ZNF788	protein_coding		78	187	0	0.00	0	0	G	XM_930581	rs191263400	G->A		12221205	1	no_errors	ENST00000596883	ensembl	human	putative	74_37	missense	67	206	9.33	10.00	7	23	SNP	0.013	A
CLIP3	25999	genome.wustl.edu	37	19	36517116	36517116	+	Missense_Mutation	SNP	G	G	T			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr19:36517116G>T	ENST00000360535.4	-	6	841	c.614C>A	c.(613-615)gCt>gAt	p.A205D	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.A205D	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	205					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCTGGAAGCAGCGATGTGCAG	0.647																																							0											0													59.0	54.0	56.0					19																	36517116		2203	4300	6503	SO:0001583	missense	0			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.614C>A	19.37:g.36517116G>T	ENSP00000353732:p.Ala205Asp		A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.A205D	ENST00000360535.4	37	c.614	CCDS12486.1	19	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193676	0.78902	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.81163	-1.46	4.85	4.85	0.62838	Ankyrin repeat-containing domain (4);	0.109898	0.64402	D	0.000011	D	0.93019	0.7778	H	0.97103	3.94	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95066	0.8200	10	0.87932	D	0	-7.9339	15.5007	0.75698	0.0:0.0:1.0:0.0	.	205	Q96DZ5	CLIP3_HUMAN	D	205;87;181	ENSP00000353732:A205D	ENSP00000353732:A205D	A	-	2	0	CLIP3	41208956	1.000000	0.71417	0.994000	0.49952	0.922000	0.55478	9.314000	0.96306	2.516000	0.84829	0.555000	0.69702	GCT	0	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.647	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP3	protein_coding	OTTHUMT00000457426.1	44	39	0	0.00	0	0	G	NM_015526	0	0		36517116	-1	no_errors	ENST00000360535	ensembl	human	known	74_37	missense	25	42	19.35	8.70	6	4	SNP	1	T
NLRP5	126206	genome.wustl.edu	37	19	56565026	56565026	+	Missense_Mutation	SNP	G	G	A	rs374153940	byFrequency	TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr19:56565026G>A	ENST00000390649.3	+	13	3151	c.3151G>A	c.(3151-3153)Gcc>Acc	p.A1051T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	1051					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TCATCTCACCGCCGCGTGCTG	0.567													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17707	0.0		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0								G	THR/ALA	3,4075		0,3,2036	67.0	65.0	65.0		3151	1.4	0.0	19		65	0,8386		0,0,4193	no	missense	NLRP5	NM_153447.4	58	0,3,6229	AA,AG,GG		0.0,0.0736,0.0241	probably-damaging	1051/1201	56565026	3,12461	2039	4193	6232	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.3151G>A	19.37:g.56565026G>A	ENSP00000375063:p.Ala1051Thr		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A1051T	ENST00000390649.3	37	c.3151	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357332	0.41801	7.36E-4	0.0	ENSG00000171487	ENST00000390649	T	0.13657	2.57	3.65	1.37	0.22104	.	0.945783	0.08591	N	0.923113	T	0.11067	0.0270	M	0.62016	1.91	0.09310	N	1	P	0.38335	0.627	B	0.28232	0.087	T	0.30909	-0.9962	10	0.16896	T	0.51	.	6.0035	0.19533	0.0:0.1983:0.5653:0.2364	.	1051	P59047	NALP5_HUMAN	T	1051	ENSP00000375063:A1051T	ENSP00000375063:A1051T	A	+	1	0	NLRP5	61256838	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.058000	0.14301	0.450000	0.26774	0.655000	0.94253	GCC	0	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.567	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	protein_coding	OTTHUMT00000313735.1	42	134	0	0.00	0	0	G	NM_153447	rs374153940	G->A		56565026	1	no_errors	ENST00000390649	ensembl	human	known	74_37	missense	24	119	17.24	13.67	5	19	SNP	0	A
ZNF736	728927	genome.wustl.edu	37	7	63809328	63809328	+	Missense_Mutation	SNP	C	C	G	rs374153714		TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chr7:63809328C>G	ENST00000423484.2	+	4	1209	c.1087C>G	c.(1087-1089)Cat>Gat	p.H363D	ZNF736_ENST00000355095.4_Missense_Mutation_p.H363D			B4DX44	ZN736_HUMAN	zinc finger protein 736	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						CAAGAGAATTCATATGGAAGA	0.398																																							0											0													17.0	17.0	17.0					7																	63809328		692	1591	2283	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.1087C>G	7.37:g.63809328C>G	ENSP00000400852:p.His363Asp			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H363D	ENST00000423484.2	37	c.1087	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302539	0.40795	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.67698	-0.28;-0.28	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85062	0.5611	H	0.97051	3.93	0.28285	N	0.923805	D	0.63880	0.993	D	0.72625	0.978	T	0.75051	-0.3454	9	0.87932	D	0	.	7.7491	0.28886	0.0:1.0:0.0:0.0	.	363	B4DX44	ZN736_HUMAN	D	363	ENSP00000347210:H363D;ENSP00000400852:H363D	ENSP00000347210:H363D	H	+	1	0	ZNF736	63446763	0.997000	0.39634	0.014000	0.15608	0.015000	0.08874	3.794000	0.55492	0.561000	0.29186	0.313000	0.20887	CAT	0	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.398	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	protein_coding	OTTHUMT00000344559.2	43	18	0	0.00	0	0	C	NM_001170905	0	0		63809328	1	no_errors	ENST00000355095	ensembl	human	known	74_37	missense	45	8	11.76	0.00	6	0	SNP	1	G
CXorf38	159013	genome.wustl.edu	37	X	40506570	40506570	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4V-A9QR-01A-11D-A423-09	TCGA-4V-A9QR-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	709cab9b-5e13-4d15-bbc6-f447d5d2e3ee	190d2d1b-cc59-4117-9b23-f3d5090c8f9a	g.chrX:40506570delG	ENST00000327877.5	-	1	229	c.203delC	c.(202-204)cctfs	p.P68fs	CXorf38_ENST00000378421.1_5'UTR|CXorf38_ENST00000378426.1_5'UTR|CXorf38_ENST00000440784.2_Frame_Shift_Del_p.P68fs|CXorf38_ENST00000378418.2_Frame_Shift_Del_p.P68fs	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	68										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						GCGGGCGCGAGGGCTGCACCG	0.751																																							0											0													2.0	3.0	3.0					X																	40506570		1314	2744	4058	SO:0001589	frameshift_variant	0			AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.203delC	X.37:g.40506570delG	ENSP00000330488:p.Pro68fs		B3KW28|D3DWB5|Q5JPF5|Q8N941	Frame_Shift_Del	DEL	NULL	p.P68fs	ENST00000327877.5	37	c.203	CCDS14253.1	X																																																																																			0	NULL		0.751	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf38	protein_coding	OTTHUMT00000060685.3	13	3	0	0.00	0	0	G	NM_144970	0	0		40506570	-1	no_errors	ENST00000327877	ensembl	human	known	74_37	frame_shift_del	4	6	33.33	0.00	2	0	DEL	0.997	0
