#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MT-ND2	4536	genome.wustl.edu	37	M	2833	2833	+	5'Flank	SNP	A	A	G			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chrM:2833A>G	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCGGAGCAGAACCCAACCT	0.428																																							0											0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2833A>G	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	0	NULL	ENST00000361453.3	37	NULL		MT																																																																																			0	0		0.428	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		360	0	0.28	0.00	1	0	A	YP_003024027	rs3928312	A->G		2833	1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	43	0	88.22	100.00	322	2	SNP	NULL	G
SDCCAG8	10806	genome.wustl.edu	37	1	243480113	243480113	+	Missense_Mutation	SNP	C	C	A	rs35859404	byFrequency	TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr1:243480113C>A	ENST00000366541.3	+	9	1104	c.986C>A	c.(985-987)aCg>aAg	p.T329K	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.T286K|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.T184K|SDCCAG8_ENST00000391846.1_Missense_Mutation_p.T329K	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	329	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TTGGCAGATACGCAGCAAAGA	0.393																																							0											0													97.0	92.0	94.0					1																	243480113		2203	4300	6503	SO:0001583	missense	0			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.986C>A	1.37:g.243480113C>A	ENSP00000355499:p.Thr329Lys		O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.T329K	ENST00000366541.3	37	c.986	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622046	0.28889	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.63	0.782	0.18567	.	0.716838	0.14432	N	0.319951	T	0.23572	0.0570	N	0.22421	0.69	0.09310	N	1	B;B	0.32573	0.21;0.376	B;B	0.31614	0.057;0.133	T	0.20840	-1.0263	10	0.14656	T	0.56	0.6172	8.2978	0.31995	0.0:0.3219:0.0:0.6781	.	286;329	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	K	286;329;329;184;109	ENSP00000348137:T286K;ENSP00000375721:T329K;ENSP00000355499:T329K;ENSP00000341260:T184K;ENSP00000410200:T109K	ENSP00000341260:T184K	T	+	2	0	SDCCAG8	241546736	0.142000	0.22610	0.048000	0.18961	0.854000	0.48673	0.243000	0.18106	-0.045000	0.13468	-0.302000	0.09304	ACG	0	NULL		0.393	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	protein_coding	OTTHUMT00000096485.1	74	104	0	0.00	0	0	C	NM_006642	0	0		243480113	1	no_errors	ENST00000366541	ensembl	human	known	74_37	missense	43	68	34.33	46.88	23	60	SNP	0.159	A
APOB	338	genome.wustl.edu	37	2	21231626	21231626	+	Missense_Mutation	SNP	C	C	G			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr2:21231626C>G	ENST00000233242.1	-	26	8241	c.8114G>C	c.(8113-8115)aGa>aCa	p.R2705T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2705					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGTGATTCTCGCTAGAGG	0.448																																							0											0													147.0	150.0	149.0					2																	21231626		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8114G>C	2.37:g.21231626C>G	ENSP00000233242:p.Arg2705Thr		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.R2705T	ENST00000233242.1	37	c.8114	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	2.968	-0.213142	0.06140	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00705	5.81	5.22	3.31	0.37934	.	0.890844	0.09774	N	0.757549	T	0.00815	0.0027	L	0.44542	1.39	0.18873	N	0.999985	B	0.30763	0.294	B	0.27887	0.084	T	0.46707	-0.9172	10	0.14252	T	0.57	.	5.852	0.18697	0.0:0.4999:0.3534:0.1467	.	2705	P04114	APOB_HUMAN	T	2705	ENSP00000233242:R2705T	ENSP00000233242:R2705T	R	-	2	0	APOB	21085131	0.000000	0.05858	0.105000	0.21289	0.246000	0.25737	0.465000	0.22004	2.437000	0.82529	0.561000	0.74099	AGA	0	NULL		0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	56	177	0	0.00	0	0	C		0	0		21231626	-1	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	29	127	51.67	27.84	31	49	SNP	0	G
COL6A6	131873	genome.wustl.edu	37	3	130313158	130313158	+	Missense_Mutation	SNP	C	C	T			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr3:130313158C>T	ENST00000358511.6	+	17	4535	c.4504C>T	c.(4504-4506)Cgt>Tgt	p.R1502C	COL6A6_ENST00000453409.2_Missense_Mutation_p.R1502C	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1502	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R1502S(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCCTGGTGACCGTGGAGCAAA	0.463																																							0											2	Substitution - Missense(2)	lung(2)											76.0	82.0	80.0					3																	130313158		1867	4091	5958	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4504C>T	3.37:g.130313158C>T	ENSP00000351310:p.Arg1502Cys		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R1502C	ENST00000358511.6	37	c.4504	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730378	0.30684	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.93366	-3.21;-3.21	5.17	4.24	0.50183	.	1.191030	0.06333	N	0.706531	D	0.93956	0.8065	M	0.90019	3.08	0.32836	D	0.50471	D	0.56968	0.978	B	0.41299	0.353	D	0.91787	0.5440	10	0.56958	D	0.05	.	7.7749	0.29030	0.0:0.7424:0.1664:0.0911	.	1502	A6NMZ7	CO6A6_HUMAN	C	1502	ENSP00000351310:R1502C;ENSP00000399236:R1502C	ENSP00000351310:R1502C	R	+	1	0	COL6A6	131795848	0.004000	0.15560	0.934000	0.37439	0.208000	0.24298	0.898000	0.28404	2.575000	0.86900	0.650000	0.86243	CGT	0	NULL		0.463	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	protein_coding	OTTHUMT00000356705.5	87	119	0	0.00	0	0	C	NM_001102608	0	0		130313158	1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	60	73	42.31	40.16	44	49	SNP	0.721	T
TNIP2	79155	genome.wustl.edu	37	4	2749564	2749564	+	Missense_Mutation	SNP	T	T	G			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr4:2749564T>G	ENST00000315423.7	-	2	471	c.385A>C	c.(385-387)Agc>Cgc	p.S129R	TNIP2_ENST00000510267.1_Missense_Mutation_p.S22R|TNIP2_ENST00000505186.1_5'Flank|TNIP2_ENST00000503235.1_Missense_Mutation_p.S129R	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTGCCATGCTCCTCCGTAGC	0.647																																							0											0													77.0	74.0	75.0					4																	2749564		2203	4300	6503	SO:0001583	missense	0			BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.385A>C	4.37:g.2749564T>G	ENSP00000321203:p.Ser129Arg			Missense_Mutation	SNP	pfam_EABR	p.S129R	ENST00000315423.7	37	c.385	CCDS3362.1	4	.	.	.	.	.	.	.	.	.	.	t	12.19	1.863565	0.32884	.	.	ENSG00000168884	ENST00000510267;ENST00000315423;ENST00000503235	T;T;T	0.49139	0.86;0.82;0.79	3.64	0.998	0.19857	.	0.121724	0.53938	D	0.000056	T	0.53449	0.1797	M	0.64404	1.975	0.24919	N	0.991992	D;B	0.71674	0.998;0.005	D;B	0.65323	0.934;0.003	T	0.45396	-0.9264	10	0.19147	T	0.46	-6.8035	5.8924	0.18921	0.0:0.092:0.1659:0.7421	.	129;129	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	R	22;129;129	ENSP00000427613:S22R;ENSP00000321203:S129R;ENSP00000426314:S129R	ENSP00000321203:S129R	S	-	1	0	TNIP2	2719362	0.556000	0.26538	0.402000	0.26371	0.027000	0.11550	1.934000	0.40163	0.114000	0.18032	0.449000	0.29647	AGC	0	NULL		0.647	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP2	protein_coding	OTTHUMT00000206589.5	35	72	0	0.00	0	0	T	NM_024309	0	0		2749564	-1	no_errors	ENST00000315423	ensembl	human	known	74_37	missense	31	69	11.43	4.17	4	3	SNP	0.539	G
TMEM63B	55362	genome.wustl.edu	37	6	44107320	44107320	+	Missense_Mutation	SNP	C	C	T	rs200560167		TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr6:44107320C>T	ENST00000259746.9	+	7	707	c.524C>T	c.(523-525)cCt>cTt	p.P175L	TMEM63B_ENST00000323267.6_Missense_Mutation_p.P175L|TMEM63B_ENST00000527188.1_3'UTR			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	175					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ATCGTGCTGCCTGTCAACTTC	0.627																																							0											0													130.0	98.0	109.0					6																	44107320		2203	4300	6503	SO:0001583	missense	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.524C>T	6.37:g.44107320C>T	ENSP00000259746:p.Pro175Leu		B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.P175L	ENST00000259746.9	37	c.524	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488442	0.84854	.	.	ENSG00000137216	ENST00000259746;ENST00000532634;ENST00000323267	T;T;T	0.73047	-0.71;-0.71;-0.71	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.83238	0.5211	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.86382	0.1730	10	0.87932	D	0	.	16.4299	0.83839	0.0:1.0:0.0:0.0	.	175;175;175	Q5T3F8-3;Q5T3F8;Q5T3F8-2	.;TM63B_HUMAN;.	L	175	ENSP00000259746:P175L;ENSP00000437163:P175L;ENSP00000327154:P175L	ENSP00000259746:P175L	P	+	2	0	TMEM63B	44215298	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	7.631000	0.83237	2.350000	0.79820	0.561000	0.74099	CCT	0	NULL		0.627	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	protein_coding	OTTHUMT00000040712.2	56	91	0	0.00	0	0	C	XM_166410	0	0		44107320	1	no_errors	ENST00000259746	ensembl	human	known	74_37	missense	26	56	27.78	41.05	10	39	SNP	1	T
FKBP1C	642489	genome.wustl.edu	37	6	63921516	63921516	+	Missense_Mutation	SNP	C	C	T			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr6:63921516C>T	ENST00000370659.1	+	1	166	c.55C>T	c.(55-57)Cgc>Tgc	p.R19C	FKBP1C_ENST00000356170.3_Intron					FK506 binding protein 1C											lung(3)	3						CTTCCCGAAGCGCAGCCAGAC	0.617																																							0											0																																										SO:0001583	missense	0					6q12	2013-01-16			ENSG00000198225	ENSG00000198225			21376	other	unknown							Standard	NG_008622		Approved	bA184C23.2			OTTHUMG00000014940	ENST00000370659.1:c.55C>T	6.37:g.63921516C>T	ENSP00000359693:p.Arg19Cys			Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	p.R19C	ENST00000370659.1	37	c.55		6	.	.	.	.	.	.	.	.	.	.	C	8.547	0.874668	0.17395	.	.	ENSG00000198225	ENST00000370659	D	0.86164	-2.08	3.83	-0.64	0.11493	.	0.204155	0.24339	U	0.039389	T	0.71710	0.3372	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.67015	-0.5777	7	0.62326	D	0.03	.	2.9907	0.05982	0.289:0.3906:0.0:0.3204	.	.	.	.	C	19	ENSP00000359693:R19C	ENSP00000359693:R19C	R	+	1	0	FKBP1C	63979475	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	0.415000	0.21181	-0.037000	0.13646	-0.384000	0.06662	CGC	0	pfam_PPIase_FKBP_dom		0.617	FKBP1C-001	KNOWN	basic|appris_principal	protein_coding	FKBP1C	protein_coding	OTTHUMT00000041070.1	57	25	1.72	0.00	1	0	C	NG_008622	0	0		63921516	1	no_errors	ENST00000370659	ensembl	human	known	74_37	missense	31	14	29.55	48.15	13	13	SNP	0	T
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	351	80	0.28	0.00	1	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	230	85	38.56	33.59	145	43	SNP	1	A
TMEM139	135932	genome.wustl.edu	37	7	142983162	142983162	+	Missense_Mutation	SNP	G	G	T			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr7:142983162G>T	ENST00000359333.3	+	2	625	c.112G>T	c.(112-114)Gtt>Ttt	p.V38F	TMEM139_ENST00000471161.1_Intron|TMEM139_ENST00000409102.1_Missense_Mutation_p.V38F|TMEM139_ENST00000410004.1_Missense_Mutation_p.V38F|CASP2_ENST00000310447.5_5'Flank|CASP2_ENST00000392925.2_5'Flank|TMEM139_ENST00000409244.1_Missense_Mutation_p.V38F|TMEM139_ENST00000409541.1_Missense_Mutation_p.V38F|AC073342.12_ENST00000446192.1_RNA|AC073342.12_ENST00000427392.1_RNA	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	38						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					CATCACCCCCGTTGCTTATTT	0.552																																							0											0													199.0	181.0	187.0					7																	142983162		2203	4300	6503	SO:0001583	missense	0			AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.112G>T	7.37:g.142983162G>T	ENSP00000352284:p.Val38Phe		B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Missense_Mutation	SNP	NULL	p.V38F	ENST00000359333.3	37	c.112	CCDS5878.1	7	.	.	.	.	.	.	.	.	.	.	G	8.000	0.755178	0.15846	.	.	ENSG00000178826	ENST00000409102;ENST00000359333;ENST00000409244;ENST00000409541;ENST00000410004	.	.	.	5.0	-0.397	0.12423	.	0.706432	0.12840	N	0.434871	T	0.28366	0.0701	L	0.29908	0.895	0.09310	N	1	P	0.36789	0.57	B	0.44133	0.442	T	0.25779	-1.0122	9	0.72032	D	0.01	-0.8864	4.5188	0.11949	0.2701:0.3085:0.4214:0.0	.	38	Q8IV31	TM139_HUMAN	F	38	.	ENSP00000352284:V38F	V	+	1	0	TMEM139	142693284	0.000000	0.05858	0.006000	0.13384	0.106000	0.19336	-0.200000	0.09478	0.006000	0.14734	-0.252000	0.11476	GTT	0	NULL		0.552	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM139	protein_coding	OTTHUMT00000327145.1	77	195	0	0.00	0	0	G	NM_153345	0	0		142983162	1	no_errors	ENST00000359333	ensembl	human	known	74_37	missense	43	102	40.28	39.77	29	68	SNP	0.004	T
UNC13B	10497	genome.wustl.edu	37	9	35377653	35377653	+	Missense_Mutation	SNP	G	G	C			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr9:35377653G>C	ENST00000378495.3	+	15	1999	c.1777G>C	c.(1777-1779)Gat>Cat	p.D593H	UNC13B_ENST00000378496.4_Missense_Mutation_p.D593H|UNC13B_ENST00000396787.1_Missense_Mutation_p.D605H	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	593	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTGTACTGGATGGCACCTC	0.522																																							0											0													54.0	46.0	49.0					9																	35377653		2203	4300	6503	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1777G>C	9.37:g.35377653G>C	ENSP00000367756:p.Asp593His		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.D593H	ENST00000378495.3	37	c.1777	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.094717	0.94149	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.63580	-0.05;-0.05;-0.05	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.976	T	0.74009	-0.3802	10	0.87932	D	0	-18.8428	20.4135	0.99023	0.0:0.0:1.0:0.0	.	593;593	F8W8M9;O14795	.;UN13B_HUMAN	H	605;593;593;180	ENSP00000380006:D605H;ENSP00000367756:D593H;ENSP00000367757:D593H	ENSP00000367756:D593H	D	+	1	0	UNC13B	35367653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.858000	0.99539	2.835000	0.97688	0.591000	0.81541	GAT	0	NULL		0.522	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	protein_coding	OTTHUMT00000052296.1	47	105	0	0.00	0	0	G	NM_006377	0	0		35377653	1	no_errors	ENST00000378496	ensembl	human	known	74_37	missense	21	53	25	41.30	7	38	SNP	1	C
C10orf71	118461	genome.wustl.edu	37	10	50532900	50532900	+	Silent	SNP	G	G	A			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr10:50532900G>A	ENST00000374144.3	+	3	2598	c.2310G>A	c.(2308-2310)aaG>aaA	p.K770K	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	770										endometrium(1)	1						AGGATGAGAAGGAGAATGTGA	0.507																																							0											0													82.0	75.0	77.0					10																	50532900		692	1591	2283	SO:0001819	synonymous_variant	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2310G>A	10.37:g.50532900G>A			A0AVL8	Silent	SNP	NULL	p.K770	ENST00000374144.3	37	c.2310	CCDS44387.1	10																																																																																			0	NULL		0.507	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	protein_coding	OTTHUMT00000047984.2	49	109	0	0.00	0	0	G	NM_199459	0	0		50532900	1	no_errors	ENST00000374144	ensembl	human	known	74_37	silent	18	70	37.93	24.47	11	23	SNP	0.725	A
DLG5	9231	genome.wustl.edu	37	10	79614094	79614094	+	Missense_Mutation	SNP	G	G	C			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr10:79614094G>C	ENST00000372391.2	-	4	576	c.571C>G	c.(571-573)Ctg>Gtg	p.L191V	DLG5_ENST00000372388.2_Missense_Mutation_p.L191V	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	191					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGGATCTTCAGCCTCTCATAG	0.592																																							0											0													86.0	69.0	75.0					10																	79614094		2203	4300	6503	SO:0001583	missense	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.571C>G	10.37:g.79614094G>C	ENSP00000361467:p.Leu191Val		A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	pfam_PDZ,pfam_DUF622,pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_SH3_domain,superfamily_DEATH-like_dom,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_CARD,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.L191V	ENST00000372391.2	37	c.571	CCDS7353.2	10	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942960	0.73672	.	.	ENSG00000151208	ENST00000372391;ENST00000372388	T;T	0.59502	0.26;0.26	5.55	4.65	0.58169	.	0.000000	0.29198	N	0.012841	T	0.77772	0.4180	M	0.85462	2.755	0.38345	D	0.944179	D	0.76494	0.999	D	0.79108	0.992	D	0.83580	0.0117	10	0.72032	D	0.01	.	14.2423	0.65966	0.0715:0.0:0.9285:0.0	.	191	Q8TDM6	DLG5_HUMAN	V	191	ENSP00000361467:L191V;ENSP00000361464:L191V	ENSP00000361464:L191V	L	-	1	2	DLG5	79284100	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	3.157000	0.50716	1.352000	0.45808	0.655000	0.94253	CTG	0	pfam_DUF622		0.592	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	protein_coding	OTTHUMT00000048900.2	28	72	0	0.00	0	0	G		0	0		79614094	-1	no_errors	ENST00000372391	ensembl	human	known	74_37	missense	16	46	41.38	30.30	12	20	SNP	1	C
RIN1	9610	genome.wustl.edu	37	11	66101499	66101499	+	Silent	SNP	T	T	C			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr11:66101499T>C	ENST00000311320.4	-	7	1608	c.1482A>G	c.(1480-1482)caA>caG	p.Q494Q	RIN1_ENST00000424433.2_Silent_p.Q389Q|RIN1_ENST00000530056.1_Silent_p.Q328Q|RIN1_ENST00000524804.1_5'Flank|RP11-867G23.12_ENST00000526655.1_RNA	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	494	Ras and 14-3-3 protein binding region.|VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						TCTGGCGCACTTGCTCCAACT	0.701																																							0											0													12.0	9.0	10.0					11																	66101499		2145	4235	6380	SO:0001819	synonymous_variant	0			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.1482A>G	11.37:g.66101499T>C			O15010|Q00427|Q96CC8	Silent	SNP	pfam_VPS9,pfam_Ras-assoc,smart_SH2,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.Q494	ENST00000311320.4	37	c.1482	CCDS31614.1	11																																																																																			0	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9		0.701	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN1	protein_coding	OTTHUMT00000392980.2	101	60	0	0.00	0	0	T	NM_004292	0	0		66101499	-1	no_errors	ENST00000311320	ensembl	human	known	74_37	silent	46	48	17.86	28.36	10	19	SNP	0.998	C
ARHGAP5	394	genome.wustl.edu	37	14	32563307	32563307	+	Missense_Mutation	SNP	T	T	G			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr14:32563307T>G	ENST00000345122.3	+	2	3747	c.3432T>G	c.(3430-3432)agT>agG	p.S1144R	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.S1144R|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.S1144R|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.S1144R	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1144					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CCTCAAAAAGTCATGGGGAAC	0.348																																					NSCLC(9;77 350 3443 29227 41353)		0											0													53.0	56.0	55.0					14																	32563307		2203	4300	6503	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3432T>G	14.37:g.32563307T>G	ENSP00000371897:p.Ser1144Arg		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.S1144R	ENST00000345122.3	37	c.3432	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	T	11.07	1.530880	0.27387	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	5.27	1.51	0.23008	.	0.500506	0.26156	N	0.026005	T	0.12817	0.0311	L	0.55481	1.735	0.43279	D	0.995245	P;B	0.36048	0.534;0.399	B;B	0.40741	0.339;0.273	T	0.04607	-1.0939	10	0.54805	T	0.06	.	8.7456	0.34585	0.0:0.3617:0.0:0.6383	.	1144;1144	Q13017-2;Q13017	.;RHG05_HUMAN	R	1144	ENSP00000452222:S1144R;ENSP00000441692:S1144R;ENSP00000371897:S1144R;ENSP00000393307:S1144R	ENSP00000371897:S1144R	S	+	3	2	ARHGAP5	31633058	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	0.501000	0.22578	0.382000	0.24878	0.383000	0.25322	AGT	0	NULL		0.348	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	protein_coding	OTTHUMT00000409735.1	77	206	0	0.00	0	0	T	NM_001030055	0	0		32563307	1	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	56	153	35.63	33.77	31	78	SNP	0.995	G
ANKRD20A8P	729171	genome.wustl.edu	37	2	95480630	95480630	+	RNA	SNP	C	C	T	rs200849671		TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr2:95480630C>T	ENST00000432432.2	-	0	2730					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		gccccagccccttgcaaacat	0.393																																							0											0																																												0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95480630C>T			A6NC18	RNA	SNP	0	NULL	ENST00000432432.2	37	NULL		2																																																																																			0	0		0.393	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	pseudogene	OTTHUMT00000451404.1	17	0	0	0.00	0	0	C		rs200849671	C->T		95480630	-1	no_errors	ENST00000432432	ensembl	human	known	74_37	rna	30	0	21.05	0.00	8	0	SNP	0	T
GLUD1	2746	genome.wustl.edu	37	10	88854216	88854216	+	Missense_Mutation	SNP	C	C	T			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr10:88854216C>T	ENST00000277865.4	-	1	407	c.311G>A	c.(310-312)gGc>gAc	p.G104D	GLUD1_ENST00000544149.1_5'Flank|GLUD1_ENST00000537649.1_5'Flank|FAM35A_ENST00000298784.1_5'Flank|FAM35A_ENST00000298786.4_5'Flank	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	104					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	CCGCAGGATGCCGCGCACCCG	0.662																																							0											0													86.0	76.0	80.0					10																	88854216		2203	4300	6503	SO:0001583	missense	0			M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.311G>A	10.37:g.88854216C>T	ENSP00000277865:p.Gly104Asp		B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.G104D	ENST00000277865.4	37	c.311	CCDS7382.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.300521	0.95601	.	.	ENSG00000148672	ENST00000277865;ENST00000513510	D	0.96885	-4.16	3.91	3.91	0.45181	.	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	L	0.47716	1.5	0.80722	D	1	P	0.42993	0.797	P	0.59357	0.856	D	0.96473	0.9350	10	0.46703	T	0.11	.	14.8433	0.70240	0.0:1.0:0.0:0.0	.	104	P00367	DHE3_HUMAN	D	104;36	ENSP00000277865:G104D	ENSP00000277865:G104D	G	-	2	0	GLUD1	88844196	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.070000	0.76763	2.013000	0.59113	0.313000	0.20887	GGC	0	NULL		0.662	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD1	protein_coding	OTTHUMT00000049188.1	71	15	0	0.00	0	0	C	NM_005271	0	0		88854216	-1	no_errors	ENST00000277865	ensembl	human	known	74_37	missense	50	6	7.41	0.00	4	0	SNP	1	T
PRB2	653247	genome.wustl.edu	37	12	11546677	11546677	+	Missense_Mutation	SNP	C	C	T	rs201144571	byFrequency	TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr12:11546677C>T	ENST00000389362.4	-	3	370	c.335G>A	c.(334-336)cGa>cAa	p.R112Q	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	112	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGAGGAGATCGGGGACTTCG	0.607																																							0											0								C	GLN/ARG	3,4403		0,3,2200	334.0	354.0	347.0		335	-1.7	0.0	12		347	5,8595		0,5,4295	no	missense	PRB2	NM_006248.3	43	0,8,6495	TT,TC,CC		0.0581,0.0681,0.0615	benign	112/417	11546677	8,12998	2203	4300	6503	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.335G>A	12.37:g.11546677C>T	ENSP00000374013:p.Arg112Gln		O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.R112Q	ENST00000389362.4	37	c.335	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	6.039	0.375532	0.11409	6.81E-4	5.81E-4	ENSG00000121335	ENST00000389362	T	0.03745	3.82	1.17	-1.67	0.08238	.	.	.	.	.	T	0.01765	0.0056	N	0.12182	0.205	0.09310	N	1	B	0.27932	0.194	B	0.12156	0.007	T	0.48896	-0.8994	9	0.19147	T	0.46	.	4.8565	0.13563	0.0:0.3318:0.0:0.6682	.	112	P02812	PRB2_HUMAN	Q	112	ENSP00000374013:R112Q	ENSP00000374013:R112Q	R	-	2	0	PRB2	11437944	.	.	0.001000	0.08648	0.028000	0.11728	.	.	-0.353000	0.08224	0.123000	0.15791	CGA	0	NULL		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	protein_coding	OTTHUMT00000346925.2	135	0	0.7	0.00	1	0	C	NM_006248	rs201144571	C->T		11546677	-1	no_errors	ENST00000389362	ensembl	human	known	74_37	missense	236	0	10.82	0.00	29	0	SNP	0.023	T
TPRXL	348825	genome.wustl.edu	37	3	14106280	14106285	+	In_Frame_Del	DEL	CCCCGT	CCCCGT	-			TCGA-4X-A9FA-01A-11D-A423-09	TCGA-4X-A9FA-10A-01D-A426-09	CCCCGT	CCCCGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3ee013e0-9818-421d-bce1-38fc71f63ad9	c4869f46-818c-485f-aa2b-690e81859d38	g.chr3:14106280_14106285delCCCCGT	ENST00000424053.1	+	3	1151_1156	c.604_609delCCCCGT	c.(604-609)ccccgtdel	p.PR202del	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000429201.1_In_Frame_Del_p.PR202del|TPRXL_ENST00000326972.8_In_Frame_Del_p.PR202del			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						cagCCCCAGCCCCCGTagcagcagcc	0.689																																							0											0																																										SO:0001651	inframe_deletion	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.604_609delCCCCGT	3.37:g.14106280_14106285delCCCCGT	ENSP00000400448:p.Pro202_Arg203del		Q8NAM5	In_Frame_Del	DEL	NULL	p.PR202in_frame_del	ENST00000424053.1	37	c.604_609		3																																																																																			0	NULL		0.689	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	protein_coding	OTTHUMT00000340436.1	18	8	0	0.00	0	0	CCCCGT	NR_002223	0	0		14106285	1	no_errors	ENST00000326972	ensembl	human	known	74_37	in_frame_del	8	5	33.33	0.00	4	0	DEL	0.896:0.880:0.863:0.844:0.843:0.841	0
