#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
SHROOM2	357	genome.wustl.edu	37	X	9864183	9864183	+	Silent	SNP	G	G	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chrX:9864183G>A	ENST00000380913.3	+	4	2325	c.2235G>A	c.(2233-2235)ccG>ccA	p.P745P		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	745	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GGCCCCACCCGCCCCGCATCG	0.627																																							0											0													10.0	11.0	11.0					X																	9864183		2172	4234	6406	SO:0001819	synonymous_variant	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2235G>A	X.37:g.9864183G>A			B9EIQ7	Silent	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P745	ENST00000380913.3	37	c.2235	CCDS14135.1	X																																																																																			0	pfam_ASD1		0.627	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	protein_coding	OTTHUMT00000055721.1	143	64	0.69	0.00	1	0	G	NM_001649	0	0		9864183	1	no_errors	ENST00000380913	ensembl	human	known	74_37	silent	131	28	7.75	9.68	11	3	SNP	0	A
PHKA2	5256	genome.wustl.edu	37	X	18966938	18966938	+	Missense_Mutation	SNP	C	C	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chrX:18966938C>T	ENST00000379942.4	-	5	1126	c.461G>A	c.(460-462)cGt>cAt	p.R154H		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	154					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GAAAATGATACGTAAGCCTAG	0.388																																							0											0													134.0	133.0	134.0					X																	18966938		2203	4300	6503	SO:0001583	missense	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.461G>A	X.37:g.18966938C>T	ENSP00000369274:p.Arg154His		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.R154H	ENST00000379942.4	37	c.461	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	C	1.475	-0.558728	0.03967	.	.	ENSG00000044446	ENST00000379942	D	0.89196	-2.48	5.91	5.05	0.67936	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.205916	0.49916	N	0.000124	T	0.76256	0.3962	N	0.04260	-0.245	0.49582	D	0.999805	B	0.11235	0.004	B	0.11329	0.006	T	0.69124	-0.5228	10	0.17369	T	0.5	-6.5843	14.37	0.66833	0.0:0.9273:0.0:0.0727	.	154	P46019	KPB2_HUMAN	H	154	ENSP00000369274:R154H	ENSP00000369274:R154H	R	-	2	0	PHKA2	18876859	1.000000	0.71417	0.992000	0.48379	0.092000	0.18411	2.456000	0.44997	1.246000	0.43901	-0.215000	0.12644	CGT	0	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.388	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	protein_coding	OTTHUMT00000055960.1	167	318	0	0.00	0	0	C	NM_000292	0	0		18966938	-1	no_errors	ENST00000379942	ensembl	human	known	74_37	missense	186	148	13.08	12.87	28	22	SNP	0.919	T
GRIK3	2899	genome.wustl.edu	37	1	37307518	37307518	+	Missense_Mutation	SNP	C	C	T	rs115314874		TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr1:37307518C>T	ENST00000373091.3	-	10	1365	c.1349G>A	c.(1348-1350)cGg>cAg	p.R450Q	GRIK3_ENST00000373093.4_Missense_Mutation_p.R450Q	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	450					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GTCTGATTTCCGAAACATGAC	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20688	0.0		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0													144.0	133.0	137.0					1																	37307518		2203	4300	6503	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1349G>A	1.37:g.37307518C>T	ENSP00000362183:p.Arg450Gln		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R450Q	ENST00000373091.3	37	c.1349	CCDS416.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.88	2.666942	0.47677	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.11385	2.78;2.78	4.95	4.04	0.47022	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.063724	0.64402	D	0.000006	T	0.09158	0.0226	L	0.49778	1.585	0.35636	D	0.810568	D;D	0.54964	0.969;0.969	B;B	0.37888	0.26;0.26	T	0.22521	-1.0214	10	0.87932	D	0	.	6.7645	0.23558	0.0:0.6987:0.1456:0.1557	.	450;450	A9Z1Z8;Q13003	.;GRIK3_HUMAN	Q	450	ENSP00000362183:R450Q;ENSP00000362185:R450Q	ENSP00000362183:R450Q	R	-	2	0	GRIK3	37080105	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	3.565000	0.53798	1.207000	0.43291	0.655000	0.94253	CGG	0	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd		0.572	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	protein_coding	OTTHUMT00000012053.1	80	266	0	0.00	0	0	C	NM_000831	rs115314874	C->T		37307518	-1	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	31	110	11.43	16.03	4	21	SNP	1	T
TAL1	6886	genome.wustl.edu	37	1	47685038	47685038	+	3'UTR	SNP	G	G	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr1:47685038G>A	ENST00000294339.3	-	0	1926				TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371884.2_3'UTR|TAL1_ENST00000371883.3_3'UTR	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1						angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						TCAGATGAGAGCTGACAACCC	0.547			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																		0		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0																																										SO:0001624	3_prime_UTR_variant	0			M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.*354C>T	1.37:g.47685038G>A			D3DQ24	RNA	SNP	0	NULL	ENST00000294339.3	37	NULL	CCDS547.1	1																																																																																			0	0		0.547	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TAL1	protein_coding	OTTHUMT00000021640.1	50	184	0	0.00	0	0	G	NM_003189	0	0		47685038	-1	no_errors	ENST00000459729	ensembl	human	known	74_37	rna	30	109	18.92	12.70	7	16	SNP	0.813	A
FMOD	2331	genome.wustl.edu	37	1	203316722	203316722	+	Missense_Mutation	SNP	A	A	G			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr1:203316722A>G	ENST00000354955.4	-	2	1140	c.677T>C	c.(676-678)aTc>aCc	p.I226T	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	226				I -> Y (in Ref. 1; CAA51418). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GTCCAGCAAGATCAGTGACCG	0.552																																							0											0													94.0	91.0	92.0					1																	203316722		2203	4300	6503	SO:0001583	missense	0			U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.677T>C	1.37:g.203316722A>G	ENSP00000347041:p.Ile226Thr		Q15331|Q8IV47	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I226T	ENST00000354955.4	37	c.677	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	A	8.349	0.830574	0.16820	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.54071	0.59	5.18	5.18	0.71444	.	0.116585	0.64402	D	0.000012	T	0.26882	0.0658	N	0.02357	-0.585	0.36266	D	0.854835	B	0.22604	0.072	B	0.18871	0.023	T	0.28870	-1.0030	10	0.18710	T	0.47	-15.0475	13.8772	0.63660	1.0:0.0:0.0:0.0	.	226	Q06828	FMOD_HUMAN	T	213;226	ENSP00000347041:I226T	ENSP00000347041:I226T	I	-	2	0	FMOD	201583345	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.058000	0.57463	1.956000	0.56807	0.533000	0.62120	ATC	0	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.552	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	protein_coding	OTTHUMT00000087472.1	50	208	0	0.00	0	0	A	NM_002023	0	0		203316722	-1	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	27	106	10	13.82	3	17	SNP	0.999	G
GALNT14	79623	genome.wustl.edu	37	2	31147089	31147089	+	Missense_Mutation	SNP	G	G	C			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr2:31147089G>C	ENST00000349752.5	-	13	1915	c.1276C>G	c.(1276-1278)Cag>Gag	p.Q426E	GALNT14_ENST00000356174.3_Missense_Mutation_p.Q393E|GALNT14_ENST00000420311.2_Missense_Mutation_p.Q391E|GALNT14_ENST00000406653.1_Missense_Mutation_p.Q406E|GALNT14_ENST00000486564.1_Intron|GALNT14_ENST00000324589.5_Missense_Mutation_p.Q431E	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	426	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TTCTGTCTCTGTCGGATATTG	0.517																																							0											0													249.0	229.0	236.0					2																	31147089		2203	4300	6503	SO:0001583	missense	0			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1276C>G	2.37:g.31147089G>C	ENSP00000288988:p.Gln426Glu		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Q426E	ENST00000349752.5	37	c.1276	CCDS1773.2	2	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440229	0.63067	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.61627	1.76;1.76;1.76;1.76;1.76;0.09	4.84	4.84	0.62591	Ricin B-related lectin (1);Ricin B lectin (3);	1.162510	0.06425	N	0.723093	T	0.81828	0.4905	M	0.85945	2.785	0.80722	D	1	D;D;P;D;D	0.89917	0.999;0.99;0.66;1.0;0.998	D;D;B;D;D	0.77004	0.965;0.979;0.208;0.98;0.989	T	0.74785	-0.3547	10	0.66056	D	0.02	.	17.9725	0.89117	0.0:0.0:1.0:0.0	.	391;393;431;426;406	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	E	426;431;406;393;391;393	ENSP00000288988:Q426E;ENSP00000314500:Q431E;ENSP00000385435:Q406E;ENSP00000348497:Q393E;ENSP00000415514:Q391E;ENSP00000406399:Q393E	ENSP00000314500:Q431E	Q	-	1	0	GALNT14	31000593	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	7.883000	0.87264	2.234000	0.73211	0.563000	0.77884	CAG	0	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.517	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	protein_coding	OTTHUMT00000157264.1	127	340	0	0.00	0	0	G	NM_024572	0	0		31147089	-1	no_errors	ENST00000349752	ensembl	human	known	74_37	missense	75	173	9.64	18.69	8	40	SNP	1	C
SEC62	7095	genome.wustl.edu	37	3	169684404	169684404	+	5'Flank	SNP	G	G	C			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr3:169684404G>C	ENST00000337002.4	+	0	0				SEC62_ENST00000480708.1_5'Flank|RP11-379K17.4_ENST00000600502.1_RNA|RP11-379K17.4_ENST00000487580.1_RNA|RP11-379K17.4_ENST00000469301.1_RNA|RP11-379K17.4_ENST00000483289.2_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)						cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						ACGTCCTAACGATTCTCCAGT	0.597																																							0											0																																										SO:0001631	upstream_gene_variant	0			D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753		3.37:g.169684404G>C	Exception_encountered		D3DNQ0|O00682|O00729	RNA	SNP	0	NULL	ENST00000337002.4	37	NULL	CCDS3210.1	3																																																																																			0	0		0.597	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128164	protein_coding	OTTHUMT00000352043.1	39	194	0	0.00	0	0	G		0	0		169684404	-1	no_errors	ENST00000469301	ensembl	human	known	74_37	rna	26	165	17.65	13.16	6	25	SNP	0	C
DOCK2	1794	genome.wustl.edu	37	5	169477375	169477375	+	Missense_Mutation	SNP	A	A	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr5:169477375A>T	ENST00000256935.8	+	41	4267	c.4187A>T	c.(4186-4188)gAt>gTt	p.D1396V	DOCK2_ENST00000520908.1_Missense_Mutation_p.D888V|DOCK2_ENST00000540750.1_Missense_Mutation_p.D457V|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1396	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCCCGGGAGATGATGTGAAG	0.572																																							0											0													118.0	110.0	113.0					5																	169477375		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4187A>T	5.37:g.169477375A>T	ENSP00000256935:p.Asp1396Val		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.D1396V	ENST00000256935.8	37	c.4187	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	A	13.33	2.205261	0.39003	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.10192	3.54;3.18;2.9	5.51	5.51	0.81932	.	0.236404	0.42172	D	0.000758	T	0.12817	0.0311	L	0.55743	1.74	0.80722	D	1	P;B	0.35401	0.499;0.281	B;B	0.31337	0.128;0.128	T	0.02885	-1.1098	10	0.40728	T	0.16	.	15.6344	0.76941	1.0:0.0:0.0:0.0	.	888;1396	E7ERW7;Q92608	.;DOCK2_HUMAN	V	1396;888;457	ENSP00000256935:D1396V;ENSP00000429283:D888V;ENSP00000438827:D457V	ENSP00000256935:D1396V	D	+	2	0	DOCK2	169409953	1.000000	0.71417	0.267000	0.24556	0.171000	0.22731	9.339000	0.96797	2.105000	0.64084	0.533000	0.62120	GAT	0	NULL		0.572	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	85	199	0	0.00	0	0	A	NM_004946	0	0		169477375	1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	60	116	17.81	5.69	13	7	SNP	0.999	T
ZNF318	24149	genome.wustl.edu	37	6	43308114	43308114	+	Missense_Mutation	SNP	G	G	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr6:43308114G>T	ENST00000361428.2	-	10	3699	c.3622C>A	c.(3622-3624)Cca>Aca	p.P1208T	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1208	Lys-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TCCTCCTTTGGTTTCTCACTA	0.498																																							0											0													127.0	132.0	130.0					6																	43308114		2203	4300	6503	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.3622C>A	6.37:g.43308114G>T	ENSP00000354964:p.Pro1208Thr		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.P1208T	ENST00000361428.2	37	c.3622	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132700	0.37630	.	.	ENSG00000171467	ENST00000361428	T	0.45668	0.89	5.69	3.91	0.45181	.	0.578573	0.18353	N	0.143813	T	0.28566	0.0707	L	0.32530	0.975	0.80722	D	1	D	0.56746	0.977	P	0.55923	0.787	T	0.05321	-1.0892	10	0.40728	T	0.16	-0.5897	7.6864	0.28542	0.1426:0.1348:0.7226:0.0	.	1208	Q5VUA4	ZN318_HUMAN	T	1208	ENSP00000354964:P1208T	ENSP00000354964:P1208T	P	-	1	0	ZNF318	43416092	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.456000	0.35201	0.752000	0.32923	0.655000	0.94253	CCA	0	NULL		0.498	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	protein_coding	OTTHUMT00000040601.2	62	243	0	0.00	0	0	G	NM_014345	0	0		43308114	-1	no_errors	ENST00000361428	ensembl	human	known	74_37	missense	50	136	15.25	13.38	9	21	SNP	1	T
LINC00326	285735	genome.wustl.edu	37	6	133427333	133427333	+	lincRNA	SNP	C	C	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr6:133427333C>T	ENST00000457339.1	+	0	2131									long intergenic non-protein coding RNA 326																		TTTCAGATCACGAAGAAGTTT	0.433																																							0											0													108.0	91.0	96.0					6																	133427333		692	1591	2283			0					6q23.2	2012-10-12	2011-08-10	2011-08-10	ENSG00000231023	ENSG00000231023		"""Long non-coding RNAs"""	41926	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 326"""	NCRNA00326			Standard	NR_026969		Approved		uc003qdz.3		OTTHUMG00000015597		6.37:g.133427333C>T				RNA	SNP	0	NULL	ENST00000457339.1	37	NULL		6																																																																																			0	0		0.433	LINC00326-002	KNOWN	basic	lincRNA	LINC00326	lincRNA	OTTHUMT00000317882.1	88	305	0	0.00	0	0	C	NR_026969	0	0		133427333	1	no_errors	ENST00000434443	ensembl	human	known	74_37	rna	41	119	12.77	13.57	6	19	SNP	0	T
KPNA7	402569	genome.wustl.edu	37	7	98805085	98805085	+	Missense_Mutation	SNP	G	G	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr7:98805085G>A	ENST00000327442.6	-	1	44	c.5C>T	c.(4-6)cCg>cTg	p.P2L		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	2	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						ATCTAAGGTCGGCATATTGAC	0.453																																							0											0													144.0	110.0	120.0					7																	98805085		692	1591	2283	SO:0001583	missense	0				CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.5C>T	7.37:g.98805085G>A	ENSP00000330878:p.Pro2Leu		A4D277	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.P2L	ENST00000327442.6	37	c.5	CCDS47651.1	7	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825386	0.50739	.	.	ENSG00000185467	ENST00000327442	T	0.25250	1.81	4.35	3.47	0.39725	Importin-alpha, importin-beta-binding domain (1);	0.798396	0.11629	N	0.544975	T	0.27559	0.0677	L	0.39898	1.24	0.31607	N	0.652022	D	0.69078	0.997	P	0.48738	0.588	T	0.24905	-1.0147	10	0.56958	D	0.05	0.736	8.8813	0.35376	0.1072:0.0:0.8928:0.0	.	2	A9QM74	IMA8_HUMAN	L	2	ENSP00000330878:P2L	ENSP00000330878:P2L	P	-	2	0	KPNA7	98643021	0.086000	0.21541	0.187000	0.23214	0.028000	0.11728	1.691000	0.37721	1.149000	0.42402	0.555000	0.69702	CCG	0	pfscan_Importin-a_IBB		0.453	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA7	protein_coding	OTTHUMT00000335118.1	70	307	0	0.00	0	0	G	NM_001145715	0	0		98805085	-1	no_errors	ENST00000327442	ensembl	human	known	74_37	missense	62	203	19.48	13.92	15	33	SNP	0.399	A
KAT6A	7994	genome.wustl.edu	37	8	41798719	41798719	+	Missense_Mutation	SNP	C	C	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr8:41798719C>A	ENST00000396930.3	-	16	3223	c.2680G>T	c.(2680-2682)Gct>Tct	p.A894S	KAT6A_ENST00000265713.2_Missense_Mutation_p.A894S|KAT6A_ENST00000406337.1_Missense_Mutation_p.A894S	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	894					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTGAGGAGCTGAAGACGTC	0.507																																							0											0													83.0	78.0	80.0					8																	41798719		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2680G>T	8.37:g.41798719C>A	ENSP00000380136:p.Ala894Ser		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A894S	ENST00000396930.3	37	c.2680	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	5.164	0.215767	0.09810	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.59364	0.27;0.27;0.27	5.56	-5.26	0.02772	.	1.084520	0.07020	N	0.826715	T	0.40094	0.1103	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.41805	-0.9488	10	0.12103	T	0.63	-0.2878	16.3728	0.83370	0.0:0.3162:0.0:0.6838	.	894	Q92794	KAT6A_HUMAN	S	894;894;894;474	ENSP00000265713:A894S;ENSP00000385888:A894S;ENSP00000380136:A894S	ENSP00000265713:A894S	A	-	1	0	KAT6A	41917876	0.000000	0.05858	0.006000	0.13384	0.275000	0.26752	-1.768000	0.01794	-1.761000	0.01310	-0.150000	0.13652	GCT	0	NULL		0.507	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	protein_coding	OTTHUMT00000318163.1	91	289	0	0.00	0	0	C	NM_006766	0	0		41798719	-1	no_errors	ENST00000265713	ensembl	human	known	74_37	missense	60	155	14.29	17.55	10	33	SNP	0.004	A
RHPN1	114822	genome.wustl.edu	37	8	144464787	144464787	+	Missense_Mutation	SNP	C	C	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr8:144464787C>T	ENST00000289013.6	+	15	2080	c.1979C>T	c.(1978-1980)cCg>cTg	p.P660L		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	685					signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			AAGCCAGCTCCGCCCTCATCC	0.697																																							0											0													26.0	33.0	31.0					8																	144464787		2068	4199	6267	SO:0001583	missense	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1979C>T	8.37:g.144464787C>T	ENSP00000289013:p.Pro660Leu		Q8TAV1|Q96PV9	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.P660L	ENST00000289013.6	37	c.1979	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	C	2.895	-0.228818	0.06022	.	.	ENSG00000158106	ENST00000289013	T	0.51071	0.72	2.61	-5.23	0.02798	.	.	.	.	.	T	0.22513	0.0543	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21008	-1.0258	9	0.37606	T	0.19	.	10.8187	0.46591	0.0:0.6003:0.2658:0.1339	.	660	Q8TCX5-2	.	L	660	ENSP00000289013:P660L	ENSP00000289013:P660L	P	+	2	0	RHPN1	144535930	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	-0.274000	0.08537	-2.718000	0.00390	-1.587000	0.00848	CCG	0	NULL		0.697	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	protein_coding	OTTHUMT00000381417.1	45	41	0	0.00	0	0	C		0	0		144464787	1	no_errors	ENST00000289013	ensembl	human	known	74_37	missense	20	37	16.67	9.76	4	4	SNP	0	T
SLC44A1	23446	genome.wustl.edu	37	9	108125217	108125217	+	Missense_Mutation	SNP	T	T	G			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr9:108125217T>G	ENST00000374720.3	+	9	1263	c.1016T>G	c.(1015-1017)tTc>tGc	p.F339C	SLC44A1_ENST00000343170.7_Missense_Mutation_p.F131C|SLC44A1_ENST00000374723.1_Missense_Mutation_p.F339C|SLC44A1_ENST00000374724.1_Missense_Mutation_p.F339C	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	339					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TTCCAACCCTTCTGGACTTTC	0.443																																							0											0													361.0	307.0	325.0					9																	108125217		2203	4300	6503	SO:0001583	missense	0			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1016T>G	9.37:g.108125217T>G	ENSP00000363852:p.Phe339Cys		A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.F339C	ENST00000374720.3	37	c.1016	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440052	0.83993	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.73	5.73	0.89815	.	0.043242	0.85682	D	0.000000	T	0.43545	0.1252	L	0.52573	1.65	0.54753	D	0.999982	D;D;D	0.63880	0.99;0.99;0.993	P;P;P	0.60789	0.879;0.879;0.87	T	0.32188	-0.9916	10	0.87932	D	0	-1.8888	16.3135	0.82905	0.0:0.0:0.0:1.0	.	339;339;339	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	C	339;339;339;131	ENSP00000363855:F339C;ENSP00000363852:F339C;ENSP00000363856:F339C;ENSP00000341856:F131C	ENSP00000341856:F131C	F	+	2	0	SLC44A1	107165038	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.595000	0.82710	2.313000	0.78055	0.519000	0.50382	TTC	0	pfam_Choline_transptr-like		0.443	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	protein_coding	OTTHUMT00000053500.1	149	436	0	0.00	0	0	T	NM_080546	0	0		108125217	1	no_errors	ENST00000374720	ensembl	human	known	74_37	missense	132	259	12.58	11.53	19	34	SNP	1	G
EIF4B	1975	genome.wustl.edu	37	12	53400247	53400247	+	5'UTR	SNP	G	G	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr12:53400247G>A	ENST00000262056.9	+	0	306				EIF4B_ENST00000420463.3_5'UTR|EIF4B_ENST00000551527.1_3'UTR|EIF4B_ENST00000416762.3_5'UTR	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						GGTCTTTTGCGTTCTCTTTCC	0.637																																							0											0													100.0	107.0	104.0					12																	53400247		1926	4127	6053	SO:0001623	5_prime_UTR_variant	0			X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.-21G>A	12.37:g.53400247G>A			Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	RNA	SNP	0	NULL	ENST00000262056.9	37	NULL	CCDS41788.1	12																																																																																			0	0		0.637	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4B	protein_coding	OTTHUMT00000404852.2	86	158	0	0.00	0	0	G	NM_001417	0	0		53400247	1	no_errors	ENST00000549645	ensembl	human	known	74_37	rna	59	63	13.04	23.17	9	19	SNP	1	A
NLRC5	84166	genome.wustl.edu	37	16	57095391	57095391	+	Missense_Mutation	SNP	G	G	T	rs199476003		TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr16:57095391G>T	ENST00000262510.6	+	31	4243	c.4018G>T	c.(4018-4020)Gtg>Ttg	p.V1340L	NLRC5_ENST00000308149.7_Missense_Mutation_p.V1311L|RP11-322D14.2_ENST00000562970.1_RNA|NLRC5_ENST00000436936.1_Missense_Mutation_p.V1340L|NLRC5_ENST00000539144.1_Missense_Mutation_p.V1311L	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1340					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.V1340M(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GCCAGAGCACGTGTCCAGGCT	0.657																																							0											1	Substitution - Missense(1)	lung(1)											44.0	40.0	41.0					16																	57095391		2198	4300	6498	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4018G>T	16.37:g.57095391G>T	ENSP00000262510:p.Val1340Leu		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.V1340L	ENST00000262510.6	37	c.4018	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.00|15.00	2.702998|2.702998	0.48412|0.48412	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805;ENST00000399221|ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	.|T;T;T;T;T;T	.|0.50813	.|0.74;5.63;0.74;5.63;0.74;0.73	4.55|4.55	-2.62|-2.62	0.06152|0.06152	.|.	.|.	.|.	.|.	.|.	T|T	0.30262|0.30262	0.0759|0.0759	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.24920	.|0.003;0.01;0.114;0.09;0.014	.|B;B;B;B;B	.|0.22601	.|0.003;0.011;0.028;0.04;0.013	T|T	0.25187|0.25187	-1.0139|-1.0139	5|9	.|0.18276	.|T	.|0.48	.|.	4.9998|4.9998	0.14259|0.14259	0.525:0.1665:0.3084:0.0|0.525:0.1665:0.3084:0.0	.|.	.|1024;1311;1311;1340;1340	.|Q9H6Y0;Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.|.;.;.;.;NLRC5_HUMAN	L|L	1091;91|1340;1311;1340;783;1311;816;551	.|ENSP00000262510:V1340L;ENSP00000308886:V1311L;ENSP00000389739:V1340L;ENSP00000441727:V1311L;ENSP00000441597:V816L;ENSP00000440153:V551L	.|ENSP00000262510:V1340L	R|V	+|+	2|1	0|0	NLRC5|NLRC5	55652892|55652892	0.000000|0.000000	0.05858|0.05858	0.053000|0.053000	0.19242|0.19242	0.536000|0.536000	0.34869|0.34869	-1.556000|-1.556000	0.02168|0.02168	-0.306000|-0.306000	0.08818|0.08818	0.435000|0.435000	0.28638|0.28638	CGT|GTG	0	NULL		0.657	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	protein_coding	OTTHUMT00000257346.1	84	75	0	0.00	0	0	G	NM_032206	0	0		57095391	1	no_errors	ENST00000262510	ensembl	human	known	74_37	missense	35	22	12.5	15.38	5	4	SNP	0.018	T
CNTNAP4	85445	genome.wustl.edu	37	16	76573634	76573634	+	Missense_Mutation	SNP	A	A	G			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr16:76573634A>G	ENST00000476707.1	+	19	3387	c.3248A>G	c.(3247-3249)tAc>tGc	p.Y1083C	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.Y1007C|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.Y1079C|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.Y1031C			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1080	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CAGATCAGGTACAAGTTAAAT	0.333																																							0											0													65.0	65.0	65.0					16																	76573634		1966	4200	6166	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3248A>G	16.37:g.76573634A>G	ENSP00000417628:p.Tyr1083Cys		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.Y1079C	ENST00000476707.1	37	c.3236		16	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969889	0.74246	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29	4.91	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.37809	N	0.001924	D	0.89639	0.6773	.	.	.	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.998;1.0	D	0.91181	0.4976	9	0.87932	D	0	.	15.0055	0.71510	1.0:0.0:0.0:0.0	.	1007;1083;1080	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	C	1079;1031;1007;1083	ENSP00000306893:Y1079C;ENSP00000439733:Y1031C;ENSP00000418741:Y1007C;ENSP00000417628:Y1083C	ENSP00000306893:Y1079C	Y	+	2	0	CNTNAP4	75131135	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.741000	0.74837	2.190000	0.69967	0.528000	0.53228	TAC	0	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.333	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	protein_coding	OTTHUMT00000348216.1	127	480	0	0.00	0	0	A	NM_033401	0	0		76573634	1	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	149	185	10.78	16.29	18	36	SNP	1	G
ATP2C2	9914	genome.wustl.edu	37	16	84493053	84493053	+	Intron	SNP	G	G	A			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr16:84493053G>A	ENST00000262429.4	+	23	2422				ATP2C2_ENST00000416219.2_Intron|ATP2C2_ENST00000420010.2_Intron|RP11-517C16.2_ENST00000565700.1_RNA	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CTTCCTCCAGGGGCTGCTGGC	0.572																																							0											0																																										SO:0001627	intron_variant	0			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.2333+61G>A	16.37:g.84493053G>A			B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	RNA	SNP	0	NULL	ENST00000262429.4	37	NULL	CCDS42207.1	16																																																																																			0	0		0.572	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261286	protein_coding	OTTHUMT00000433404.1	100	114	0	0.00	0	0	G	NM_014861	0	0		84493053	-1	no_errors	ENST00000565700	ensembl	human	known	74_37	rna	46	75	25.81	11.76	16	10	SNP	0	A
FOXF1	2294	genome.wustl.edu	37	16	86544465	86544465	+	Missense_Mutation	SNP	G	G	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr16:86544465G>T	ENST00000262426.4	+	1	333	c.290G>T	c.(289-291)cGc>cTc	p.R97L	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	97			R -> H (in ACDMPV). {ECO:0000269|PubMed:23505205}.		blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						AACTCCGTGCGCCACAACCTC	0.637																																							0											0													75.0	83.0	80.0					16																	86544465		2198	4300	6498	SO:0001583	missense	0			U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.290G>T	16.37:g.86544465G>T	ENSP00000262426:p.Arg97Leu		B2RAF4|Q5FWE5	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R97L	ENST00000262426.4	37	c.290	CCDS10957.2	16	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770008	0.90020	.	.	ENSG00000103241	ENST00000262426	D	0.98090	-4.71	4.21	4.21	0.49690	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98998	0.9658	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99497	1.0952	10	0.87932	D	0	.	15.8897	0.79286	0.0:0.0:1.0:0.0	.	97	Q12946	FOXF1_HUMAN	L	97	ENSP00000262426:R97L	ENSP00000262426:R97L	R	+	2	0	FOXF1	85101966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.334000	0.96470	2.052000	0.61016	0.650000	0.86243	CGC	0	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head		0.637	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FOXF1	protein_coding	OTTHUMT00000269103.2	114	80	0	1.23	0	1	G	NM_001451	0	0		86544465	1	no_errors	ENST00000262426	ensembl	human	known	74_37	missense	62	46	13.89	16.36	10	9	SNP	1	T
LUC7L3	51747	genome.wustl.edu	37	17	48823273	48823273	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr17:48823273C>T	ENST00000505658.1	+	8	1075	c.886C>T	c.(886-888)Cga>Tga	p.R296*	LUC7L3_ENST00000544170.1_Nonsense_Mutation_p.R220*|LUC7L3_ENST00000240304.1_Nonsense_Mutation_p.R296*|LUC7L3_ENST00000393227.2_Nonsense_Mutation_p.R296*			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	296	Arg/Ser-rich.				mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						AAGTCGTTCACGAAGTAGACA	0.453																																							0											0													64.0	63.0	63.0					17																	48823273		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.886C>T	17.37:g.48823273C>T	ENSP00000425092:p.Arg296*		B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Nonsense_Mutation	SNP	pfam_Luc7-rel	p.R296*	ENST00000505658.1	37	c.886	CCDS11573.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.714750	0.96830	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000544170	.	.	.	5.95	1.69	0.24217	.	0.244651	0.40728	N	0.001028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0928	6.1402	0.20255	0.3486:0.4783:0.1123:0.0608	.	.	.	.	X	296;296;296;220	.	ENSP00000240304:R296X	R	+	1	2	LUC7L3	46178272	0.913000	0.31002	0.995000	0.50966	0.952000	0.60782	1.640000	0.37186	0.116000	0.18110	-0.119000	0.15052	CGA	0	NULL		0.453	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LUC7L3	protein_coding	OTTHUMT00000368205.2	26	146	0	0.00	0	0	C	NM_016424	0	0		48823273	1	no_errors	ENST00000240304	ensembl	human	known	74_37	nonsense	47	82	9.62	15.31	5	15	SNP	0.913	T
URI1	8725	genome.wustl.edu	37	19	30476150	30476150	+	Missense_Mutation	SNP	A	A	G			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr19:30476150A>G	ENST00000542441.2	+	3	470	c.173A>G	c.(172-174)tAt>tGt	p.Y58C	URI1_ENST00000360605.4_Missense_Mutation_p.Y40C|URI1_ENST00000312051.6_Missense_Mutation_p.Y18C|URI1_ENST00000392271.1_5'UTR			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	58					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GATAATGACTATAATGCCCTT	0.269																																							0											0													188.0	194.0	192.0					19																	30476150		2203	4300	6503	SO:0001583	missense	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.173A>G	19.37:g.30476150A>G	ENSP00000442436:p.Tyr58Cys		A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin	p.Y58C	ENST00000542441.2	37	c.173	CCDS12420.1	19	.	.	.	.	.	.	.	.	.	.	A	20.4	3.987282	0.74589	.	.	ENSG00000105176	ENST00000360605;ENST00000542441;ENST00000312051	T;T;T	0.77489	-1.1;0.82;0.82	4.8	4.8	0.61643	Prefoldin (1);Prefoldin subunit (1);	0.000000	0.85682	D	0.000000	D	0.88016	0.6324	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.89701	0.3905	10	0.87932	D	0	-17.0656	12.9084	0.58166	1.0:0.0:0.0:0.0	.	18;58;56	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	C	56;58;18	ENSP00000353817:Y56C;ENSP00000442436:Y58C;ENSP00000312530:Y18C	ENSP00000312530:Y18C	Y	+	2	0	C19orf2	35167990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.420000	0.90256	1.809000	0.52856	0.460000	0.39030	TAT	0	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin		0.269	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	protein_coding	OTTHUMT00000439756.1	97	454	0	0.00	0	0	A	NM_134447	0	0		30476150	1	no_errors	ENST00000542441	ensembl	human	known	74_37	missense	144	221	10.56	6.67	17	16	SNP	1	G
BPIFB1	92747	genome.wustl.edu	37	20	31876668	31876668	+	Silent	SNP	C	C	T	rs370901362	byFrequency	TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr20:31876668C>T	ENST00000253354.1	+	3	398	c.237C>T	c.(235-237)acC>acT	p.T79T		NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	79					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										TGGTGAACACCGTCCTGAAGC	0.627													C|||	2	0.000399361	0.0	0.0029	5008	,	,		19382	0.0		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0								C		0,4406		0,0,2203	69.0	51.0	57.0		237	-2.3	0.0	20		57	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BPIFB1	NM_033197.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		79/485	31876668	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.237C>T	20.37:g.31876668C>T			A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_PLUNC_long_form	p.T79	ENST00000253354.1	37	c.237	CCDS13218.1	20																																																																																			0	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_PLUNC_long_form		0.627	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB1	protein_coding	OTTHUMT00000106499.2	63	135	0	0.74	0	1	C	NM_033197	rs370901362	C->T		31876668	1	no_errors	ENST00000253354	ensembl	human	known	74_37	silent	37	107	15.91	9.17	7	11	SNP	0	T
DMXL1	1657	genome.wustl.edu	37	5	118580208	118580209	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr5:118580208_118580209delAG	ENST00000311085.8	+	42	8876_8877	c.8796_8797delAG	c.(8794-8799)aaagccfs	p.KA2932fs	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_Frame_Shift_Del_p.KA2953fs	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2932										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CTCCTGTTAAAGCCGTTGCTGT	0.401																																							0											0																																										SO:0001589	frameshift_variant	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8796_8797delAG	5.37:g.118580208_118580209delAG	ENSP00000309690:p.Lys2932fs			Frame_Shift_Del	DEL	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2953fs	ENST00000311085.8	37	c.8859_8860	CCDS4125.1	5																																																																																			0	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.401	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	112	393	0	0.00	0	0	AG	NM_005509	0	0		118580209	1	no_errors	ENST00000539542	ensembl	human	known	74_37	frame_shift_del	103	245	10.43	11.55	12	32	DEL	1.000:1.000	0
C11orf86	254439	genome.wustl.edu	37	11	66743651	66743652	+	Splice_Site	INS	-	-	T			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr11:66743651_66743652insT	ENST00000308963.4	+	2	363_364	c.277_278insT	c.(277-279)gta>gTta	p.V93fs		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	93										NS(1)|skin(1)	2						CTTCCAGCAGGTAAGAAGAAGG	0.599											OREG0021116	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											0											0																																										SO:0001630	splice_region_variant	0			AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.277-1->T	11.37:g.66743652_66743652dupT		1094		Frame_Shift_Ins	INS	NULL	p.R94fs	ENST00000308963.4	37	c.277_278	CCDS44656.1	11																																																																																			0	NULL		0.599	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf86	protein_coding	OTTHUMT00000332022.2	45	166	0	0.00	0	0	0	NM_001136485	0	0	Frame_Shift_Ins	66743652	1	no_errors	ENST00000308963	ensembl	human	known	74_37	frame_shift_ins	25	97	16.67	5.83	5	6	INS	0.826:0.800	T
MT-ATP6	4508	genome.wustl.edu	37	M	8656	8656	+	Missense_Mutation	SNP	A	A	C			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chrM:8656A>C	ENST00000361899.2	+	1	130	c.130A>C	c.(130-132)Acc>Ccc	p.T44P	MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	44					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						ACCGACTAATCACCACCCAAC	0.428																																							0											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.130A>C	M.37:g.8656A>C	ENSP00000354632:p.Thr44Pro		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.T44P	ENST00000361899.2	37	c.130		MT																																																																																			0	pfam_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu		0.428	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	protein_coding		26	2	0	0.00	0	0	A	YP_003024031	0	0		8656	1	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	4	2	42.86	0.00	3	0	SNP	NULL	C
CEBPA	1050	genome.wustl.edu	37	19	33792575	33792575	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4X-A9FD-01A-11D-A423-09	TCGA-4X-A9FD-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1acf70a5-3f66-4379-83cc-9a7956ed25d5	c34cd5b5-6894-4811-9c58-e41f04811a22	g.chr19:33792575delG	ENST00000498907.2	-	1	895	c.746delC	c.(745-747)cctfs	p.P249fs	CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	249				GPG -> ALA (in Ref. 2; CAA72289). {ECO:0000305}.	acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.H219fs*53(1)|p.G242fs*68(1)|p.H200_K352>Q(1)|p.P247fs*54(1)|p.?(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CGCGCTGCCAgggcccggcag	0.786			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																														0		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	5	Deletion - Frameshift(3)|Unknown(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(5)											2.0	2.0	2.0					19																	33792575		1051	2440	3491	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.746delC	19.37:g.33792575delG	ENSP00000427514:p.Pro249fs		A7LNP2|P78319|Q05CA4	Frame_Shift_Del	DEL	pfam_bZIP,smart_bZIP,pirsf_CCAAT/enhancer-binding,pfscan_bZIP	p.P249fs	ENST00000498907.2	37	c.746	CCDS54243.1	19																																																																																			0	pirsf_CCAAT/enhancer-binding		0.786	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	protein_coding	OTTHUMT00000365012.1	22	0	0	0.00	0	0	G	NM_004364	0	0		33792575	-1	no_errors	ENST00000498907	ensembl	human	known	74_37	frame_shift_del	21	0	8.7	0.00	2	0	DEL	0.546	0
