#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
NHS	4810	genome.wustl.edu	37	X	17745002	17745002	+	Missense_Mutation	SNP	C	C	A			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chrX:17745002C>A	ENST00000380060.3	+	6	3051	c.2713C>A	c.(2713-2715)Cag>Aag	p.Q905K	NHS_ENST00000398097.3_Missense_Mutation_p.Q749K	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	926					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TAAGGAACCTCAGTTAGATGC	0.448																																							0											0													152.0	143.0	146.0					X																	17745002		2203	4300	6503	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2713C>A	X.37:g.17745002C>A	ENSP00000369400:p.Gln905Lys		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.Q905K	ENST00000380060.3	37	c.2713	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	0.493	-0.874455	0.02550	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.41758	0.99;1.0	5.77	5.77	0.91146	.	0.451104	0.23791	N	0.044533	T	0.34716	0.0907	L	0.47716	1.5	0.39960	D	0.974656	B;B;B;B	0.32467	0.152;0.152;0.152;0.372	B;B;B;B	0.33392	0.051;0.037;0.037;0.163	T	0.13899	-1.0492	10	0.09084	T	0.74	-4.9302	13.1786	0.59641	0.0:0.9225:0.0:0.0775	.	926;747;749;905	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	K	905;749;747	ENSP00000369400:Q905K;ENSP00000381170:Q749K	ENSP00000369397:Q747K	Q	+	1	0	NHS	17654923	0.541000	0.26417	0.999000	0.59377	0.277000	0.26821	2.651000	0.46674	2.430000	0.82344	0.415000	0.27848	CAG	0	NULL		0.448	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	protein_coding	OTTHUMT00000059120.1	54	301	0	0.33	0	1	C	NM_198270	0	0		17745002	1	no_errors	ENST00000380060	ensembl	human	known	74_37	missense	45	222	21.05	18.68	12	51	SNP	0.986	A
SYTL5	94122	genome.wustl.edu	37	X	37979640	37979640	+	Silent	SNP	A	A	G			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chrX:37979640A>G	ENST00000357972.5	+	14	2172	c.1626A>G	c.(1624-1626)caA>caG	p.Q542Q	TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000297875.2_Silent_p.Q542Q|SYTL5_ENST00000456733.2_Silent_p.Q564Q			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	542					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TTGGCCTTCAATACAAAGGAG	0.413																																							0											0													185.0	171.0	176.0					X																	37979640		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1626A>G	X.37:g.37979640A>G			A2RRF2	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.Q564	ENST00000357972.5	37	c.1692	CCDS14244.1	X																																																																																			0	NULL		0.413	SYTL5-201	KNOWN	basic|CCDS	protein_coding	SYTL5	protein_coding	OTTHUMT00000080883.1	86	381	0	0.00	0	0	A	NM_138780	0	0		37979640	1	no_errors	ENST00000456733	ensembl	human	known	74_37	silent	67	270	23.86	16.41	21	53	SNP	0.487	G
CNST	163882	genome.wustl.edu	37	1	246810860	246810860	+	Missense_Mutation	SNP	T	T	C			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr1:246810860T>C	ENST00000366513.4	+	9	1626	c.1357T>C	c.(1357-1359)Tca>Cca	p.S453P	CNST_ENST00000366512.3_Missense_Mutation_p.S453P|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	453					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						GGGTAAATATTCACAGGCTCA	0.473											OREG0014367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											0											0													141.0	153.0	149.0					1																	246810860		2203	4300	6503	SO:0001583	missense	0			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1357T>C	1.37:g.246810860T>C	ENSP00000355470:p.Ser453Pro	2468	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.S453P	ENST00000366513.4	37	c.1357	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.398559	0.25205	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.19105	2.17;2.18	5.34	1.3	0.21679	.	0.634163	0.14874	N	0.293359	T	0.18087	0.0434	L	0.56769	1.78	0.09310	N	0.999996	B;B	0.14438	0.01;0.01	B;B	0.13407	0.006;0.009	T	0.21042	-1.0257	10	0.33940	T	0.23	-14.1636	5.5122	0.16886	0.0:0.1818:0.3658:0.4525	.	453;453	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	P	453	ENSP00000355470:S453P;ENSP00000355469:S453P	ENSP00000355469:S453P	S	+	1	0	CNST	244877483	0.041000	0.20044	0.164000	0.22755	0.836000	0.47400	-0.043000	0.12043	0.308000	0.22923	0.338000	0.21704	TCA	0	NULL		0.473	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	protein_coding	OTTHUMT00000096780.1	25	236	0	0.00	0	0	T	NM_152609	0	0		246810860	1	no_errors	ENST00000366513	ensembl	human	known	74_37	missense	37	236	22.92	11.28	11	30	SNP	0.021	C
ZKSCAN8	7745	genome.wustl.edu	37	6	28116370	28116370	+	Missense_Mutation	SNP	C	C	T			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr6:28116370C>T	ENST00000330236.6	+	2	369	c.185C>T	c.(184-186)aCa>aTa	p.T62I	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.T62I	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	62	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TACCAGGAGACACTAGGACCC	0.547																																							0											0													114.0	101.0	106.0					6																	28116370		2203	4300	6503	SO:0001583	missense	0				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.185C>T	6.37:g.28116370C>T	ENSP00000332750:p.Thr62Ile		A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T62I	ENST00000330236.6	37	c.185	CCDS4645.1	6	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874041	0.72180	.	.	ENSG00000198315	ENST00000330236;ENST00000457389;ENST00000536028	T;T;T	0.04317	3.65;3.65;3.65	5.02	5.02	0.67125	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.52532	D	0.000076	T	0.22437	0.0541	M	0.92169	3.28	0.36691	D	0.87959	D	0.76494	0.999	D	0.85130	0.997	T	0.11227	-1.0596	10	0.87932	D	0	.	16.104	0.81205	0.0:1.0:0.0:0.0	.	62	Q15776	ZN192_HUMAN	I	62	ENSP00000332750:T62I;ENSP00000402948:T62I;ENSP00000439117:T62I	ENSP00000332750:T62I	T	+	2	0	ZNF192	28224349	0.992000	0.36948	0.976000	0.42696	0.991000	0.79684	3.390000	0.52523	2.712000	0.92718	0.563000	0.77884	ACA	0	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.547	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN8	protein_coding	OTTHUMT00000040178.2	44	120	0	0.00	0	0	C		0	0		28116370	1	no_errors	ENST00000330236	ensembl	human	known	74_37	missense	15	67	30.43	10.67	7	8	SNP	0.972	T
ZNF311	282890	genome.wustl.edu	37	6	28971674	28971674	+	Intron	SNP	C	C	T			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr6:28971674C>T	ENST00000377179.3	-	2	522				ZNF311_ENST00000483450.1_Splice_Site	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						CTTGGACTCACTTCTCCTTCT	0.463																																							0											0													174.0	145.0	155.0					6																	28971674		1511	2709	4220	SO:0001627	intron_variant	0			AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.9+48G>A	6.37:g.28971674C>T			A2BFK5|B0S7Y4|Q92971	Splice_Site	SNP	0	NULL	ENST00000377179.3	37	c.NULL	CCDS34357.1	6																																																																																			0	0		0.463	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	protein_coding	OTTHUMT00000076631.3	55	341	0	0.00	0	0	C	XM_212581	0	0		28971674	-1	no_errors	ENST00000483450	ensembl	human	known	74_37	splice_site	26	165	21.21	24.31	7	53	SNP	0.127	T
OR4C3	256144	genome.wustl.edu	37	11	48347418	48347418	+	Missense_Mutation	SNP	C	C	T			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr11:48347418C>T	ENST00000319856.4	+	1	947	c.926C>T	c.(925-927)cCa>cTa	p.P309L		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						ATGTTGAATCCACTCATTTAT	0.343																																							0											0													92.0	95.0	94.0					11																	48347418		2201	4298	6499	SO:0001583	missense	0			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.926C>T	11.37:g.48347418C>T	ENSP00000321419:p.Pro309Leu		B2RNF2|Q6IFB3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P309L	ENST00000319856.4	37	c.926	CCDS31489.1	11	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312322	0.60414	.	.	ENSG00000176547	ENST00000319856;ENST00000395239	T	0.63417	-0.04	5.97	5.97	0.96955	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000086	D	0.86602	0.5972	H	0.96604	3.85	0.47737	D	0.999504	D	0.76494	0.999	D	0.79784	0.993	D	0.90327	0.4349	10	0.87932	D	0	.	17.9278	0.88989	0.0:1.0:0.0:0.0	.	282	Q8NH37	OR4C3_HUMAN	L	309;172	ENSP00000321419:P309L	ENSP00000321419:P309L	P	+	2	0	OR4C3	48303994	0.996000	0.38824	0.222000	0.23844	0.587000	0.36485	4.176000	0.58269	2.838000	0.97847	0.561000	0.74099	CCA	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.343	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	protein_coding	OTTHUMT00000390557.1	61	353	0	0.00	0	0	C	NM_001004702	0	0		48347418	1	no_errors	ENST00000319856	ensembl	human	known	74_37	missense	62	401	7.46	4.75	5	20	SNP	0.959	T
NCAPD2	9918	genome.wustl.edu	37	12	6640225	6640225	+	Missense_Mutation	SNP	A	A	G			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr12:6640225A>G	ENST00000315579.5	+	31	4902	c.4103A>G	c.(4102-4104)gAt>gGt	p.D1368G	NCAPD2_ENST00000545962.1_Missense_Mutation_p.D1323G|RP5-940J5.3_ENST00000537921.1_RNA|GAPDH_ENST00000229239.5_5'Flank	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1368					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						TTCTCAAGTGATGAGTCCAGT	0.567																																							0											0													53.0	60.0	58.0					12																	6640225		2203	4300	6503	SO:0001583	missense	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.4103A>G	12.37:g.6640225A>G	ENSP00000325017:p.Asp1368Gly		D3DUR4|Q8N6U3	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.D1368G	ENST00000315579.5	37	c.4103	CCDS8548.1	12	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125076	0.77436	.	.	ENSG00000010292	ENST00000315579;ENST00000545962	T;T	0.27256	1.98;1.68	5.1	5.1	0.69264	.	0.131931	0.51477	D	0.000091	T	0.40347	0.1113	L	0.36672	1.1	0.52501	D	0.999954	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.25433	-1.0132	10	0.72032	D	0.01	-22.0733	12.7724	0.57429	1.0:0.0:0.0:0.0	.	1323;1368	F5GZJ1;Q15021	.;CND1_HUMAN	G	1368;1323	ENSP00000325017:D1368G;ENSP00000444417:D1323G	ENSP00000325017:D1368G	D	+	2	0	NCAPD2	6510486	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	5.613000	0.67688	2.131000	0.65755	0.459000	0.35465	GAT	0	pirsf_Condensin_cplx_su1		0.567	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	protein_coding	OTTHUMT00000399964.1	51	260	0	0.00	0	0	A	NM_014865	0	0		6640225	1	no_errors	ENST00000315579	ensembl	human	known	74_37	missense	39	111	17.02	26.00	8	39	SNP	1	G
CDCA3	83461	genome.wustl.edu	37	12	6959688	6959688	+	Missense_Mutation	SNP	C	C	A			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr12:6959688C>A	ENST00000538862.2	-	3	1094	c.193G>T	c.(193-195)Gat>Tat	p.D65Y	CDCA3_ENST00000535406.1_Missense_Mutation_p.D65Y|CDCA3_ENST00000604599.1_5'Flank|CDCA3_ENST00000229265.6_Missense_Mutation_p.D65Y|CDCA3_ENST00000422785.3_Missense_Mutation_p.D65Y|USP5_ENST00000389231.5_5'Flank|USP5_ENST00000229268.8_5'Flank|CDCA3_ENST00000540683.1_Missense_Mutation_p.D65Y			Q99618	CDCA3_HUMAN	cell division cycle associated 3	65					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|large_intestine(4)|lung(1)|stomach(1)	8						GAGCGGGGATCTGAGTCCTGG	0.547																																							0											0													156.0	142.0	147.0					12																	6959688		2203	4300	6503	SO:0001583	missense	0			BG354576	CCDS8565.1, CCDS73428.1	12p13.31	2010-07-20				ENSG00000111665			14624	protein-coding gene	gene with protein product	"""trigger of mitotic entry 1"""	607749				9074930, 12188893	Standard	XR_242988		Approved	TOME-1, GRCC8	uc001qrg.2	Q99618		ENST00000538862.2:c.193G>T	12.37:g.6959688C>A	ENSP00000442068:p.Asp65Tyr		A8K5V6|D3DUS6	Missense_Mutation	SNP	NULL	p.D65Y	ENST00000538862.2	37	c.193	CCDS8565.1	12	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081743	0.76528	.	.	ENSG00000237240;ENSG00000111665;ENSG00000111665;ENSG00000111665;ENSG00000111665	ENST00000422785;ENST00000229265;ENST00000538862;ENST00000535406;ENST00000540683	.	.	.	5.67	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.75264	2.295	0.53005	D	0.999965	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.975	T	0.79354	-0.1838	9	0.87932	D	0	-29.228	11.8226	0.52247	0.0:0.9183:0.0:0.0817	.	65;65	Q99618;F8WDL1	CDCA3_HUMAN;.	Y	65	.	ENSP00000229265:D65Y	D	-	1	0	U47924.25;CDCA3	6829949	1.000000	0.71417	0.998000	0.56505	0.741000	0.42261	5.600000	0.67599	1.411000	0.46957	-0.136000	0.14681	GAT	0	NULL		0.547	CDCA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA3	protein_coding	OTTHUMT00000401940.2	40	253	0	0.00	0	0	C	NM_031299	0	0		6959688	-1	no_errors	ENST00000538862	ensembl	human	known	74_37	missense	26	172	36.59	16.10	15	33	SNP	0.998	A
PDZRN4	29951	genome.wustl.edu	37	12	41900409	41900409	+	Missense_Mutation	SNP	C	C	G			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr12:41900409C>G	ENST00000402685.2	+	4	1003	c.995C>G	c.(994-996)gCc>gGc	p.A332G	PDZRN4_ENST00000539469.2_Missense_Mutation_p.A74G|PDZRN4_ENST00000298919.7_Missense_Mutation_p.A72G	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	332							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CTTATGAATGCCAGCACTCAG	0.532																																							0											0													169.0	139.0	149.0					12																	41900409		2203	4300	6503	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.995C>G	12.37:g.41900409C>G	ENSP00000384197:p.Ala332Gly		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.A332G	ENST00000402685.2	37	c.995	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576490	0.45902	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72167	-0.63;3.82;3.81	5.08	5.08	0.68730	.	0.082862	0.50627	D	0.000104	T	0.57460	0.2055	L	0.38531	1.155	0.45962	D	0.998786	P;B;B	0.48764	0.915;0.008;0.002	B;B;B	0.39465	0.3;0.013;0.008	T	0.59894	-0.7368	10	0.44086	T	0.13	-25.8891	10.0431	0.42171	0.0:0.8476:0.0:0.1524	.	332;72;74	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	G	332;74;72	ENSP00000384197:A332G;ENSP00000439990:A74G;ENSP00000298919:A72G	ENSP00000298919:A72G	A	+	2	0	PDZRN4	40186676	0.981000	0.34729	1.000000	0.80357	0.977000	0.68977	1.273000	0.33121	2.758000	0.94735	0.563000	0.77884	GCC	0	NULL		0.532	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	protein_coding	OTTHUMT00000403701.1	51	150	0	1.32	0	2	C	NM_013377	0	0		41900409	1	no_errors	ENST00000402685	ensembl	human	known	74_37	missense	45	135	22.41	20.12	13	34	SNP	1	G
ERICH6B	220081	genome.wustl.edu	37	13	46161310	46161310	+	Silent	SNP	G	G	A	rs564144924	byFrequency	TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr13:46161310G>A	ENST00000298738.2	-	5	908	c.744C>T	c.(742-744)ttC>ttT	p.F248F		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		248										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						AAGGGGTAGCGAAAGTCAACG	0.562													G|||	2	0.000399361	0.0	0.0029	5008	,	,		19901	0.0		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0													56.0	55.0	55.0					13																	46161310		692	1591	2283	SO:0001819	synonymous_variant	0																														ENST00000298738.2:c.744C>T	13.37:g.46161310G>A			Q96MB5	Silent	SNP	NULL	p.F248	ENST00000298738.2	37	c.744	CCDS45045.1	13																																																																																			0	NULL		0.562	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	protein_coding	OTTHUMT00000044781.3	31	188	0	0.53	0	1	G		rs564144924	G->A		46161310	-1	no_errors	ENST00000298738	ensembl	human	known	74_37	silent	29	158	9.38	8.67	3	15	SNP	0	A
EVL	51466	genome.wustl.edu	37	14	100563849	100563849	+	Missense_Mutation	SNP	T	T	C			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr14:100563849T>C	ENST00000402714.2	+	3	810	c.206T>C	c.(205-207)cTg>cCg	p.L69P	EVL_ENST00000392920.3_Missense_Mutation_p.L71P|EVL_ENST00000555048.1_3'UTR|EVL_ENST00000544450.2_Missense_Mutation_p.L75P			Q9UI08	EVL_HUMAN	Enah/Vasp-like	69	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				GTGAAAGGGCTGAAGTACAAT	0.478																																							0											0													79.0	75.0	76.0					14																	100563849		2203	4300	6503	SO:0001583	missense	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.206T>C	14.37:g.100563849T>C	ENSP00000384720:p.Leu69Pro		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.L71P	ENST00000402714.2	37	c.212		14	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517118	0.85495	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000555706;ENST00000539470;ENST00000557153	D;D;D;D;D	0.99113	-5.44;-5.44;-5.44;-2.87;-5.44	5.16	5.16	0.70880	EVH1 (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000007	D	0.99217	0.9728	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.99425	1.0934	10	0.87932	D	0	-14.8583	14.9943	0.71418	0.0:0.0:0.0:1.0	.	75;71;69	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	P	69;75;71;56;71;56	ENSP00000384720:L69P;ENSP00000437904:L75P;ENSP00000376652:L71P;ENSP00000450723:L56P;ENSP00000452327:L56P	ENSP00000376652:L71P	L	+	2	0	EVL	99633602	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.902000	0.87389	1.940000	0.56252	0.459000	0.35465	CTG	0	pfam_WH1/EVH1,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1		0.478	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	protein_coding	OTTHUMT00000413958.1	81	232	0	0.00	0	0	T		0	0		100563849	1	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	50	179	18.03	16.36	11	35	SNP	1	C
PSTPIP1	9051	genome.wustl.edu	37	15	77310520	77310520	+	Missense_Mutation	SNP	A	A	T			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr15:77310520A>T	ENST00000558012.1	+	2	557	c.68A>T	c.(67-69)gAg>gTg	p.E23V	PSTPIP1_ENST00000379595.3_Missense_Mutation_p.E23V|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.E23V|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.E22V	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	23	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						ACGGGCTACGAGGTGCTGCTG	0.622																																							0											0													27.0	33.0	31.0					15																	77310520		2149	4239	6388	SO:0001583	missense	0			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.68A>T	15.37:g.77310520A>T	ENSP00000452746:p.Glu23Val		B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	pfam_FCH_dom,superfamily_Prismane-like,smart_FCH_dom,pfscan_FCH_dom	p.E88V	ENST00000558012.1	37	c.263	CCDS45312.1	15	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121202	0.77436	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.49432	0.78;2.37	4.28	4.28	0.50868	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.070932	0.64402	D	0.000016	T	0.68320	0.2988	M	0.80183	2.485	0.58432	D	0.999997	D;D;D;D	0.89917	0.998;0.986;0.999;1.0	D;P;D;D	0.81914	0.975;0.851;0.977;0.995	T	0.73474	-0.3971	10	0.72032	D	0.01	-14.593	12.7064	0.57063	1.0:0.0:0.0:0.0	.	23;22;23;23	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	V	23;22	ENSP00000368914:E23V;ENSP00000267939:E22V	ENSP00000267939:E22V	E	+	2	0	PSTPIP1	75097575	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.098000	0.76974	1.707000	0.51288	0.358000	0.22013	GAG	0	pfam_FCH_dom,superfamily_Prismane-like,smart_FCH_dom,pfscan_FCH_dom		0.622	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTPIP1	protein_coding	OTTHUMT00000419373.2	28	82	0	0.00	0	0	A	NM_003978	0	0		77310520	1	no_errors	ENST00000559785	ensembl	human	known	74_37	missense	27	61	12.9	7.58	4	5	SNP	1	T
AATF	26574	genome.wustl.edu	37	17	35413969	35413969	+	3'UTR	SNP	G	G	A	rs375247205		TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr17:35413969G>A	ENST00000225402.5	+	0	1939				AATF_ENST00000590321.1_3'UTR	NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				GATTGACATCGCCCACCTCCG	0.577																																					NSCLC(49;901 1159 19183 41572 46244)		0											0								G		0,4406		0,0,2203	108.0	92.0	98.0			-11.3	0.0	17		98	1,8599	1.2+/-3.3	0,1,4299	no	utr-3	AATF	NM_012138.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			35413969	1,13005	2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.*5G>A	17.37:g.35413969G>A			A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	RNA	SNP	0	NULL	ENST00000225402.5	37	NULL	CCDS32632.1	17																																																																																			0	0		0.577	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATF	protein_coding	OTTHUMT00000451543.1	41	127	0	1.55	0	2	G	NM_012138	rs375247205	G->A		35413969	1	no_errors	ENST00000587618	ensembl	human	putative	74_37	rna	29	102	23.68	19.69	9	25	SNP	0.003	A
UPF1	5976	genome.wustl.edu	37	19	18968185	18968185	+	Silent	SNP	G	G	A	rs369728050		TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr19:18968185G>A	ENST00000599848.1	+	15	2267	c.2058G>A	c.(2056-2058)gcG>gcA	p.A686A	UPF1_ENST00000262803.5_Silent_p.A675A			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	686					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GCAAGAAGGCGGCCAAGGCCG	0.637																																							0											0								G		0,4404		0,0,2202	39.0	45.0	43.0		2025	-9.4	0.8	19		43	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	UPF1	NM_002911.3		0,2,6500	AA,AG,GG		0.0233,0.0,0.0154		675/1119	18968185	2,13002	2202	4300	6502	SO:0001819	synonymous_variant	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2058G>A	19.37:g.18968185G>A			O00239|O43343|Q86Z25|Q92842	Silent	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.A686	ENST00000599848.1	37	c.2058		19																																																																																			0	superfamily_P-loop_NTPase		0.637	UPF1-002	KNOWN	basic	protein_coding	UPF1	protein_coding	OTTHUMT00000464684.1	22	65	0	0.00	0	0	G	NM_002911	rs369728050	G->A		18968185	1	no_errors	ENST00000599848	ensembl	human	known	74_37	silent	20	29	13.04	6.45	3	2	SNP	0.905	A
NDUFS7	374291	genome.wustl.edu	37	19	1395488	1395490	+	3'UTR	DEL	CGC	CGC	-	rs551418570	byFrequency	TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	CGC	CGC	CGC	-	CGC	CGC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr19:1395488_1395490delCGC	ENST00000233627.9	+	0	939_941				AC005329.7_ENST00000585596.1_RNA|NDUFS7_ENST00000313408.7_3'UTR|NDUFS7_ENST00000540530.1_3'UTR|AC005329.7_ENST00000501448.1_RNA|AC005329.7_ENST00000589734.1_RNA	NM_024407.4	NP_077718.3	O75251	NDUS7_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|synaptic membrane (GO:0097060)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|quinone binding (GO:0048038)			ovary(1)	1		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)|Breast(49;0.00186)|Lung NSC(49;0.00292)|all_lung(49;0.00419)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Doxorubicin(DB00997)	CCGCAGGTAGcgccgccgccgcc	0.685																																							0											0																																										SO:0001624	3_prime_UTR_variant	0			AF115969	CCDS12063.1	19p13	2011-07-04	2002-08-29		ENSG00000115286	ENSG00000115286		"""Mitochondrial respiratory chain complex / Complex I"""	7714	protein-coding gene	gene with protein product	"""complex I 20kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial"""	601825	"""NADH dehydrogenase (ubiquinone) Fe-S protein 7 (20kD) (NADH-coenzyme Q reductase)"""			8938450	Standard	NM_024407		Approved	PSST, FLJ46880, FLJ45860, CI-20	uc002lse.4	O75251	OTTHUMG00000168077	ENST00000233627.9:c.*3CGC>-	19.37:g.1395497_1395499delCGC			B3KRI2|Q2T9H7|Q9BV17	RNA	DEL	0	NULL	ENST00000233627.9	37	NULL	CCDS12063.1	19																																																																																			0	0		0.685	NDUFS7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248015	protein_coding	OTTHUMT00000397984.1	14	30	0	0.00	0	0	CGC	NM_024407	0	0		1395490	-1	no_errors	ENST00000501448	ensembl	human	known	74_37	rna	4	25	33.33	7.41	2	2	DEL	0.006:0.014:0.013	0
IRF3	3661	genome.wustl.edu	37	19	50166738	50166738	+	Missense_Mutation	SNP	C	C	T			TCGA-5G-A9ZZ-01A-31D-A423-09	TCGA-5G-A9ZZ-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	42aead9b-0670-43e8-affb-121e0357816b	a0f552f8-ec94-4296-8ce2-7d902e1d837d	g.chr19:50166738C>T	ENST00000597198.1	-	3	580	c.199G>A	c.(199-201)Ggg>Agg	p.G67R	IRF3_ENST00000596765.1_Intron|IRF3_ENST00000601291.1_Missense_Mutation_p.G67R|IRF3_ENST00000309877.7_Missense_Mutation_p.G67R|IRF3_ENST00000599680.1_5'Flank|BCL2L12_ENST00000441864.2_5'Flank|IRF3_ENST00000593922.1_5'UTR|IRF3_ENST00000442265.2_Intron|IRF3_ENST00000599223.1_Missense_Mutation_p.G67R|IRF3_ENST00000596822.1_5'UTR|BCL2L12_ENST00000246784.3_5'Flank|IRF3_ENST00000377135.4_Missense_Mutation_p.G67R|IRF3_ENST00000598808.1_5'UTR|IRF3_ENST00000599144.1_Intron|IRF3_ENST00000600022.1_5'UTR|IRF3_ENST00000377139.3_Missense_Mutation_p.G67R|BCL2L12_ENST00000246785.3_5'Flank|IRF3_ENST00000600911.1_Missense_Mutation_p.G67R			Q14653	IRF3_HUMAN	interferon regulatory factor 3	67					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTATCCCTCCCGGGAACATAT	0.612																																							0											0													54.0	48.0	50.0					19																	50166738		2203	4300	6503	SO:0001583	missense	0				CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.199G>A	19.37:g.50166738C>T	ENSP00000469113:p.Gly67Arg		A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.G67R	ENST00000597198.1	37	c.199	CCDS12775.1	19	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445238	0.43429	.	.	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135	D;D;D	0.98120	-4.73;-4.73;-4.73	4.75	3.7	0.42460	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.065312	0.64402	D	0.000009	D	0.98074	0.9365	M	0.79258	2.445	0.25394	N	0.988505	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;P	0.91635	0.999;0.991;0.991;0.999;0.886	D	0.93064	0.6477	10	0.87932	D	0	-30.2911	6.6383	0.22895	0.0:0.7988:0.0:0.2012	.	67;67;67;67;67	B2RAZ3;Q96GL3;Q7Z5G6;Q14653;Q5FBY1	.;.;.;IRF3_HUMAN;.	R	67	ENSP00000366344:G67R;ENSP00000310127:G67R;ENSP00000366339:G67R	ENSP00000310127:G67R	G	-	1	0	IRF3	54858550	0.017000	0.18338	0.179000	0.23059	0.060000	0.15804	1.539000	0.36104	2.367000	0.80283	0.655000	0.94253	GGG	0	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom		0.612	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IRF3	protein_coding	OTTHUMT00000465962.1	28	223	0	0.00	0	0	C	NM_001571	0	0		50166738	-1	no_errors	ENST00000309877	ensembl	human	known	74_37	missense	21	150	8.7	18.92	2	35	SNP	0.308	T
