#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
FAM47A	158724	genome.wustl.edu	37	X	34149546	34149546	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:34149546C>T	ENST00000346193.3	-	1	901	c.850G>A	c.(850-852)Gag>Aag	p.E284K		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	284										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GTTGTCTTCTCCCGGCCCTCA	0.577																																							0											0													25.0	27.0	26.0					X																	34149546		2202	4299	6501	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.850G>A	X.37:g.34149546C>T	ENSP00000345029:p.Glu284Lys		A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.E284K	ENST00000346193.3	37	c.850	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	c	1.292	-0.607365	0.03717	.	.	ENSG00000185448	ENST00000346193	T	0.19806	2.12	0.13	0.13	0.14746	.	.	.	.	.	T	0.17577	0.0422	L	0.38175	1.15	0.09310	N	1	P	0.37398	0.593	P	0.45577	0.486	T	0.25606	-1.0127	8	0.08179	T	0.78	.	.	.	.	.	284	Q5JRC9	FA47A_HUMAN	K	284	ENSP00000345029:E284K	ENSP00000345029:E284K	E	-	1	0	FAM47A	34059467	0.073000	0.21202	0.206000	0.23566	0.208000	0.24298	-0.129000	0.10515	0.171000	0.19730	0.173000	0.16961	GAG	0	NULL		0.577	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	125	107	0	0.00	0	0	C	NM_203408	0	0		34149546	-1	no_errors	ENST00000346193	ensembl	human	known	74_37	missense	182	218	15.67	19.85	34	54	SNP	0.061	T
ALAS2	212	genome.wustl.edu	37	X	55042031	55042031	+	Missense_Mutation	SNP	T	T	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:55042031T>A	ENST00000330807.5	-	8	1285	c.1148A>T	c.(1147-1149)gAc>gTc	p.D383V	ALAS2_ENST00000498636.1_5'UTR|ALAS2_ENST00000335854.4_Missense_Mutation_p.D346V|ALAS2_ENST00000396198.3_Missense_Mutation_p.D370V	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	383					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	AGAGATGATGTCAATCTTATG	0.507																																							0											0													104.0	93.0	97.0					X																	55042031		2203	4300	6503	SO:0001583	missense	0				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1148A>T	X.37:g.55042031T>A	ENSP00000332369:p.Asp383Val		A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	p.D383V	ENST00000330807.5	37	c.1148	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243401	0.79912	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.96334	-3.98;-3.98;-3.98	5.75	5.75	0.90469	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.084941	0.85682	D	0.000000	D	0.98406	0.9470	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.998	D	0.99490	1.0950	10	0.87932	D	0	-17.8901	14.1477	0.65360	0.0:0.0:0.0:1.0	.	346;370;383	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	V	383;370;346	ENSP00000332369:D383V;ENSP00000379501:D370V;ENSP00000337131:D346V	ENSP00000332369:D383V	D	-	2	0	ALAS2	55058756	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.054000	0.61138	0.481000	0.45027	GAC	0	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth		0.507	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	protein_coding	OTTHUMT00000056843.3	46	211	0	0.00	0	0	T	NM_000032	0	0		55042031	-1	no_errors	ENST00000330807	ensembl	human	known	74_37	missense	58	275	15.94	16.67	11	55	SNP	1	A
OGT	8473	genome.wustl.edu	37	X	70787885	70787885	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:70787885G>A	ENST00000373719.3	+	21	3102	c.2885G>A	c.(2884-2886)tGc>tAc	p.C962Y	OGT_ENST00000373701.3_Missense_Mutation_p.C952Y	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	962					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					CAGCTCACTTGCTTAGGTTGT	0.393																																							0											0													195.0	162.0	174.0					X																	70787885		2203	4300	6503	SO:0001583	missense	0			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2885G>A	X.37:g.70787885G>A	ENSP00000362824:p.Cys962Tyr		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C962Y	ENST00000373719.3	37	c.2885	CCDS14414.1	X	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037003	0.75617	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.71222	-0.55;-0.55	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.74974	0.3787	N	0.25647	0.755	0.80722	D	1	D;D;P	0.61697	0.979;0.99;0.945	D;P;P	0.63877	0.919;0.907;0.9	T	0.78924	-0.2012	10	0.72032	D	0.01	-2.7914	17.3502	0.87321	0.0:0.0:1.0:0.0	.	836;952;962	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	Y	962;952	ENSP00000362824:C962Y;ENSP00000362805:C952Y	ENSP00000362805:C952Y	C	+	2	0	OGT	70704610	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.639000	0.83342	2.279000	0.76181	0.544000	0.68410	TGC	0	NULL		0.393	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGT	protein_coding	OTTHUMT00000081829.3	84	199	0	0.00	0	0	G	NM_003605, NM_181672	0	0		70787885	1	no_errors	ENST00000373719	ensembl	human	known	74_37	missense	167	291	16.5	12.57	33	42	SNP	1	A
FRMPD3	84443	genome.wustl.edu	37	X	106808130	106808130	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:106808130C>T	ENST00000276185.4	+	13	1229	c.1229C>T	c.(1228-1230)tCg>tTg	p.S410L				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	410	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						GAGAAGCAGTCGGCCACCACG	0.557																																							0											0													200.0	178.0	185.0					X																	106808130		876	1991	2867	SO:0001583	missense	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.1229C>T	X.37:g.106808130C>T	ENSP00000276185:p.Ser410Leu		Q96JK8	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.S410L	ENST00000276185.4	37	c.1229		X	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729482	0.69074	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.10960	2.82;2.82	4.6	4.6	0.57074	.	0.527792	0.19541	N	0.111811	T	0.17280	0.0415	L	0.41824	1.3	0.33071	D	0.535386	.	.	.	.	.	.	T	0.11155	-1.0599	8	0.66056	D	0.02	.	13.7422	0.62855	0.0:1.0:0.0:0.0	.	.	.	.	L	410;358	ENSP00000276185:S410L;ENSP00000398668:S358L	ENSP00000276185:S410L	S	+	2	0	FRMPD3	106694786	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	5.579000	0.67457	1.862000	0.54008	0.513000	0.50165	TCG	0	pfscan_FERM_domain		0.557	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		25	112	0	0.00	0	0	C	XM_042978	0	0		106808130	1	no_errors	ENST00000276185	ensembl	human	known	74_37	missense	21	89	25	29.92	7	38	SNP	0.991	T
HTATSF1	27336	genome.wustl.edu	37	X	135593719	135593719	+	Missense_Mutation	SNP	C	C	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:135593719C>A	ENST00000218364.4	+	9	1989	c.1815C>A	c.(1813-1815)gaC>gaA	p.D605E	HTATSF1_ENST00000535601.1_Missense_Mutation_p.D605E	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	605	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					TTGAAGATGACGGCTCTGAAA	0.378																																							0											0													65.0	70.0	68.0					X																	135593719		2201	4295	6496	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1815C>A	X.37:g.135593719C>A	ENSP00000218364:p.Asp605Glu		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D605E	ENST00000218364.4	37	c.1815	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	C	5.036	0.192320	0.09599	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.04049	3.72;3.72	4.46	-3.78	0.04333	.	0.626483	0.17768	N	0.162691	T	0.01523	0.0049	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.41770	-0.9490	10	0.18276	T	0.48	-4.1809	3.8682	0.09025	0.1334:0.6167:0.116:0.134	.	605	O43719	HTSF1_HUMAN	E	605	ENSP00000442699:D605E;ENSP00000218364:D605E	ENSP00000218364:D605E	D	+	3	2	HTATSF1	135421385	0.000000	0.05858	0.030000	0.17652	0.819000	0.46315	-0.834000	0.04391	-1.013000	0.03383	-0.529000	0.04317	GAC	0	NULL		0.378	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	protein_coding	OTTHUMT00000058497.1	87	210	0	0.00	0	0	C	NM_014500	0	0		135593719	1	no_errors	ENST00000218364	ensembl	human	known	74_37	missense	143	315	15.88	15.69	27	59	SNP	0.184	A
MECP2	4204	genome.wustl.edu	37	X	153297697	153297697	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:153297697G>A	ENST00000303391.6	-	3	587	c.338C>T	c.(337-339)tCt>tTt	p.S113F	MECP2_ENST00000460227.1_5'Flank|MECP2_ENST00000407218.1_Missense_Mutation_p.S113F|MECP2_ENST00000453960.2_Missense_Mutation_p.S125F	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	113	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAGCGGCCAGATTTCCTTTG	0.547																																							0											0													85.0	78.0	80.0					X																	153297697		2203	4300	6503	SO:0001583	missense	0			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.338C>T	X.37:g.153297697G>A	ENSP00000301948:p.Ser113Phe		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,superfamily_Ig_E-set,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	p.S113F	ENST00000303391.6	37	c.338	CCDS14741.1	X	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824008	0.90873	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000453960;ENST00000369964;ENST00000407218	D;D;D	0.99532	-6.1;-6.1;-6.1	5.93	5.93	0.95920	Methyl-CpG DNA binding (4);DNA-binding, integrase-type (1);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	M	0.64170	1.965	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.85130	0.995;0.997	D	0.98813	1.0744	10	0.87932	D	0	-13.2912	17.9775	0.89131	0.0:0.0:1.0:0.0	.	125;113	P51608-2;P51608	.;MECP2_HUMAN	F	113;113;125;113;113	ENSP00000301948:S113F;ENSP00000395535:S125F;ENSP00000384865:S113F	ENSP00000301948:S113F	S	-	2	0	MECP2	152950891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.298000	0.96132	2.521000	0.84997	0.529000	0.55759	TCT	0	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd		0.547	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECP2	protein_coding	OTTHUMT00000061144.1	57	227	0	0.00	0	0	G	NM_004992	0	0		153297697	-1	no_errors	ENST00000303391	ensembl	human	known	74_37	missense	24	162	56.36	46.91	31	144	SNP	1	A
VBP1	7411	genome.wustl.edu	37	X	154448565	154448565	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chrX:154448565C>T	ENST00000286428.5	+	2	316	c.199C>T	c.(199-201)Ctt>Ttt	p.L67F	VBP1_ENST00000535916.1_Missense_Mutation_p.L62F	NM_003372.5	NP_003363.1	P61758	PFD3_HUMAN	von Hippel-Lindau binding protein 1	67					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)				NS(1)|endometrium(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGAACTCAACCTTGCTCAAAA	0.299																																							0											0													33.0	31.0	32.0					X																	154448565		2203	4296	6499	SO:0001583	missense	0			U56833	CCDS14765.1	Xq28	2008-07-07			ENSG00000155959	ENSG00000155959			12662	protein-coding gene	gene with protein product	"""prefoldin 3"""	300133				8674032, 9339366	Standard	NM_003372		Approved	PFD3, PFDN3	uc004fnc.3	P61758	OTTHUMG00000022666	ENST00000286428.5:c.199C>T	X.37:g.154448565C>T	ENSP00000286428:p.Leu67Phe		B2R8L5|O55228|Q15765|Q5JT81|Q86X96	Missense_Mutation	SNP	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin,pirsf_Prefoldin_su-3	p.L67F	ENST00000286428.5	37	c.199	CCDS14765.1	X	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433095	0.62844	.	.	ENSG00000155959	ENST00000535916;ENST00000286428	D;D	0.84146	-1.81;-1.81	4.74	4.74	0.60224	Prefoldin (1);Prefoldin subunit (1);	0.123532	0.56097	D	0.000039	D	0.89220	0.6653	M	0.69463	2.115	0.80722	D	1	D	0.64830	0.994	D	0.64410	0.925	D	0.89532	0.3786	10	0.87932	D	0	-2.7897	8.4962	0.33130	0.0:0.8879:0.0:0.1121	.	67	P61758	PFD3_HUMAN	F	62;67	ENSP00000438694:L62F;ENSP00000286428:L67F	ENSP00000286428:L67F	L	+	1	0	VBP1	154101759	1.000000	0.71417	0.977000	0.42913	0.916000	0.54674	5.748000	0.68697	2.263000	0.75096	0.600000	0.82982	CTT	0	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin,pirsf_Prefoldin_su-3		0.299	VBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VBP1	protein_coding	OTTHUMT00000058806.1	150	247	0	0.00	0	0	C		0	0		154448565	1	no_errors	ENST00000286428	ensembl	human	known	74_37	missense	483	424	15.18	14.14	87	70	SNP	0.999	T
SPOCD1	90853	genome.wustl.edu	37	1	32256617	32256617	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr1:32256617G>A	ENST00000360482.2	-	16	3367	c.3238C>T	c.(3238-3240)Cca>Tca	p.P1080S	SPOCD1_ENST00000257100.3_Missense_Mutation_p.P560S|SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000533231.1_Missense_Mutation_p.P1067S|RP11-84A19.3_ENST00000527035.1_RNA	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	1080					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		ATTCCCCTTGGAGCTATACTG	0.657																																							0											0													22.0	23.0	23.0					1																	32256617		2201	4299	6500	SO:0001583	missense	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.3238C>T	1.37:g.32256617G>A	ENSP00000353670:p.Pro1080Ser		Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.P1080S	ENST00000360482.2	37	c.3238	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.460039	0.26248	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000452755;ENST00000533231	T;T;T;T	0.57107	0.44;0.6;0.42;0.57	4.88	2.99	0.34606	.	.	.	.	.	T	0.41166	0.1147	L	0.27053	0.805	0.80722	D	1	P;B;B	0.35107	0.484;0.141;0.352	B;B;B	0.40256	0.324;0.071;0.173	T	0.33879	-0.9851	9	0.72032	D	0.01	-4.0525	7.545	0.27761	0.0917:0.1666:0.7416:0.0	.	1067;503;1080	Q6ZMY3-2;E9PPM7;Q6ZMY3	.;.;SPOC1_HUMAN	S	560;1080;503;1067	ENSP00000257100:P560S;ENSP00000353670:P1080S;ENSP00000399778:P503S;ENSP00000435851:P1067S	ENSP00000257100:P560S	P	-	1	0	SPOCD1	32029204	0.863000	0.29885	0.414000	0.26521	0.012000	0.07955	2.071000	0.41500	0.726000	0.32339	-0.872000	0.02987	CCA	0	NULL		0.657	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	protein_coding	OTTHUMT00000381912.1	53	51	0	0.00	0	0	G	NM_144569	0	0		32256617	-1	no_errors	ENST00000360482	ensembl	human	known	74_37	missense	15	21	50	27.59	15	8	SNP	0.827	A
NRD1	4898	genome.wustl.edu	37	1	52276077	52276077	+	Splice_Site	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr1:52276077C>T	ENST00000354831.7	-	18	2173		c.e18-1		NRD1_ENST00000544028.1_Splice_Site|NRD1_ENST00000485608.1_Splice_Site|NRD1_ENST00000352171.7_Splice_Site|NRD1_ENST00000539524.1_Splice_Site	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CACCAATGACCTAGTAAAGTG	0.388																																							0											0													74.0	69.0	71.0					1																	52276077		2203	4300	6503	SO:0001630	splice_region_variant	0			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1984-1G>A	1.37:g.52276077C>T			A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Splice_Site	SNP	0	e18-1	ENST00000354831.7	37	c.1984-1	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374499	0.61735	.	.	ENSG00000078618	ENST00000440943;ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.309	0.90192	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRD1	52048665	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	7.045000	0.76585	2.557000	0.86248	0.561000	0.74099	.	0	0		0.388	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	protein_coding	OTTHUMT00000023045.1	50	222	0	0.45	0	1	C	NM_002525	0	0	Intron	52276077	-1	no_errors	ENST00000354831	ensembl	human	known	74_37	splice_site	82	190	28.7	24.51	33	62	SNP	1	T
SNX7	51375	genome.wustl.edu	37	1	99127441	99127441	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr1:99127441G>A	ENST00000306121.3	+	1	163	c.154G>A	c.(154-156)Gag>Aag	p.E52K	SNX7_ENST00000370189.5_5'UTR|SNX7_ENST00000473868.1_3'UTR|SNX7_ENST00000529992.1_Missense_Mutation_p.E52K	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	0	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		GGACGAGGACGAGGACGACCT	0.711																																							0											0													16.0	23.0	21.0					1																	99127441		691	1589	2280	SO:0001583	missense	0			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.154G>A	1.37:g.99127441G>A	ENSP00000304429:p.Glu52Lys		A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E52K	ENST00000306121.3	37	c.154	CCDS755.2	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676708	0.88445	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	T;T	0.35421	1.85;1.31	4.57	3.66	0.41972	.	.	.	.	.	T	0.06962	0.0177	N	0.19112	0.55	0.80722	D	1	P;P	0.36282	0.546;0.507	B;B	0.24155	0.051;0.034	T	0.12993	-1.0526	9	0.12430	T	0.62	.	9.6455	0.39865	0.0985:0.0:0.9015:0.0	.	52;52	E9PNL2;Q9UNH6-3	.;.	K	52	ENSP00000434731:E52K;ENSP00000304429:E52K	ENSP00000304429:E52K	E	+	1	0	SNX7	98900029	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.354000	0.59417	1.138000	0.42230	0.455000	0.32223	GAG	0	NULL		0.711	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	protein_coding	OTTHUMT00000029609.2	36	94	0	0.00	0	0	G		0	0		99127441	1	no_errors	ENST00000306121	ensembl	human	known	74_37	missense	21	89	25	21.93	7	25	SNP	1	A
ADAMTSL4	54507	genome.wustl.edu	37	1	150525906	150525906	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr1:150525906C>T	ENST00000369038.2	+	4	640	c.439C>T	c.(439-441)Cgg>Tgg	p.R147W	RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R147W|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R147W|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R147W			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	147					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TCTCAGGTCCCGGCTTCGAGA	0.587																																							0											0													70.0	69.0	70.0					1																	150525906		2203	4300	6503	SO:0001583	missense	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.439C>T	1.37:g.150525906C>T	ENSP00000358034:p.Arg147Trp		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.R147W	ENST00000369038.2	37	c.439	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378554	0.42207	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.72505	-0.63;-0.66;-0.51;-0.66	4.39	3.44	0.39384	.	.	.	.	.	T	0.51584	0.1683	M	0.63843	1.955	0.53005	D	0.999968	B;B;B;B	0.25007	0.071;0.049;0.071;0.116	B;B;B;B	0.19391	0.011;0.017;0.007;0.025	T	0.57825	-0.7744	9	0.87932	D	0	.	10.0986	0.42491	0.0:0.7951:0.2049:0.0	.	147;147;147;147	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	W	147	ENSP00000358037:R147W;ENSP00000271643:R147W;ENSP00000358035:R147W;ENSP00000358034:R147W	ENSP00000271643:R147W	R	+	1	2	ADAMTSL4	148792530	0.992000	0.36948	1.000000	0.80357	0.995000	0.86356	1.060000	0.30530	0.793000	0.33875	0.542000	0.68232	CGG	0	pfscan_Thrombospondin_1_rpt		0.587	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	protein_coding	OTTHUMT00000084395.4	57	161	0	0.00	0	0	C	NM_019032	0	0		150525906	1	no_errors	ENST00000369039	ensembl	human	known	74_37	missense	31	142	13.89	33.02	5	70	SNP	1	T
OR10Z1	128368	genome.wustl.edu	37	1	158576545	158576545	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr1:158576545C>T	ENST00000361284.1	+	1	317	c.317C>T	c.(316-318)tCa>tTa	p.S106L		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TTTTCTGCCTCATGGGCCTGT	0.547																																							0											0													144.0	150.0	148.0					1																	158576545		2203	4299	6502	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.317C>T	1.37:g.158576545C>T	ENSP00000354707:p.Ser106Leu		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S106L	ENST00000361284.1	37	c.317	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	C	5.558	0.287904	0.10513	.	.	ENSG00000198967	ENST00000361284	T	0.00388	7.59	5.36	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.560257	0.13639	N	0.373121	T	0.00039	0.0001	N	0.05487	-0.04	0.09310	N	1	B	0.27791	0.189	B	0.26202	0.067	T	0.00225	-1.1901	10	0.10902	T	0.67	.	9.6156	0.39690	0.0:0.7784:0.1436:0.0779	.	106	Q8NGY1	O10Z1_HUMAN	L	106	ENSP00000354707:S106L	ENSP00000354707:S106L	S	+	2	0	OR10Z1	156843169	0.000000	0.05858	0.036000	0.18154	0.894000	0.52154	-0.548000	0.06048	0.795000	0.33922	0.655000	0.94253	TCA	0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.547	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	protein_coding	OTTHUMT00000051853.1	34	72	0	0.00	0	0	C	NM_001004478	0	0		158576545	1	no_errors	ENST00000361284	ensembl	human	known	74_37	missense	20	117	16.67	13.24	4	18	SNP	0.002	T
ADAM17	6868	genome.wustl.edu	37	2	9661424	9661424	+	Missense_Mutation	SNP	G	G	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr2:9661424G>C	ENST00000310823.3	-	8	1047	c.865C>G	c.(865-867)Caa>Gaa	p.Q289E		NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	289	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TTTACCTCTTGTGGAGACTTG	0.373																																							0											0													201.0	189.0	193.0					2																	9661424		2203	4300	6503	SO:0001583	missense	0			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.865C>G	2.37:g.9661424G>C	ENSP00000309968:p.Gln289Glu		O60226	Missense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.Q289E	ENST00000310823.3	37	c.865	CCDS1665.1	2	.	.	.	.	.	.	.	.	.	.	G	2.308	-0.358541	0.05138	.	.	ENSG00000151694	ENST00000310823	D	0.86432	-2.12	5.63	2.65	0.31530	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.371554	0.32935	N	0.005462	T	0.62708	0.2450	N	0.01352	-0.895	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.59101	-0.7517	10	0.06099	T	0.92	.	11.6043	0.51022	0.0:0.5348:0.3111:0.1541	.	289;289	B2RNB2;P78536	.;ADA17_HUMAN	E	289	ENSP00000309968:Q289E	ENSP00000309968:Q289E	Q	-	1	0	ADAM17	9578875	0.698000	0.27777	1.000000	0.80357	0.992000	0.81027	0.538000	0.23160	0.820000	0.34516	0.555000	0.69702	CAA	0	pfscan_Peptidase_M12B		0.373	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM17	protein_coding	OTTHUMT00000206857.1	71	234	0	0.42	0	1	G		0	0		9661424	-1	no_errors	ENST00000310823	ensembl	human	known	74_37	missense	139	362	10.32	16.78	16	73	SNP	0.958	C
GMCL1	64395	genome.wustl.edu	37	2	70066635	70066635	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr2:70066635G>T	ENST00000282570.3	+	3	682	c.431G>T	c.(430-432)aGc>aTc	p.S144I	GMCL1_ENST00000468386.2_3'UTR	NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	144	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						AAAGAATCCAGCATGAATATT	0.323																																							0											0													76.0	81.0	80.0					2																	70066635		2203	4294	6497	SO:0001583	missense	0			AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.431G>T	2.37:g.70066635G>T	ENSP00000282570:p.Ser144Ile		Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S144I	ENST00000282570.3	37	c.431	CCDS1895.1	2	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436255	0.43224	.	.	ENSG00000087338	ENST00000282570	T	0.69306	-0.39	4.86	3.97	0.46021	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.042710	0.85682	D	0.000000	T	0.65544	0.2701	L	0.55990	1.75	0.43622	D	0.996007	B	0.24043	0.096	B	0.36134	0.218	T	0.65635	-0.6120	10	0.56958	D	0.05	-5.9904	11.2073	0.48778	0.0905:0.0:0.9095:0.0	.	144	Q96IK5	GMCL1_HUMAN	I	144	ENSP00000282570:S144I	ENSP00000282570:S144I	S	+	2	0	GMCL1	69920139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.656000	0.54467	1.233000	0.43693	0.591000	0.81541	AGC	0	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.323	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMCL1	protein_coding	OTTHUMT00000251841.2	83	107	0	0.00	0	0	G	NM_178439	0	0		70066635	1	no_errors	ENST00000282570	ensembl	human	known	74_37	missense	166	144	33.86	37.23	85	86	SNP	1	T
CHST10	9486	genome.wustl.edu	37	2	101019055	101019055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr2:101019055C>A	ENST00000264249.3	-	4	548	c.163G>T	c.(163-165)Gaa>Taa	p.E55*	CHST10_ENST00000542617.1_Nonsense_Mutation_p.E103*|CHST10_ENST00000409701.1_Nonsense_Mutation_p.E55*	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	55					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						TGCTTCTCTTCTGGCAACTTC	0.542																																							0											0													186.0	153.0	164.0					2																	101019055		2203	4300	6503	SO:0001587	stop_gained	0			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.163G>T	2.37:g.101019055C>A	ENSP00000264249:p.Glu55*		Q53T18	Nonsense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.E103*	ENST00000264249.3	37	c.307	CCDS2047.1	2	.	.	.	.	.	.	.	.	.	.	C	38	6.840572	0.97877	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474;ENST00000418201	.	.	.	5.75	4.87	0.63330	.	0.520879	0.21107	N	0.080046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-7.2084	10.6038	0.45381	0.0:0.8511:0.0:0.1489	.	.	.	.	X	55;103;55;55;55;103;55;55	.	ENSP00000264249:E55X	E	-	1	0	CHST10	100385487	0.098000	0.21812	0.750000	0.31169	0.951000	0.60555	0.721000	0.25911	1.428000	0.47296	0.655000	0.94253	GAA	0	NULL		0.542	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST10	protein_coding	OTTHUMT00000253162.1	30	125	0	0.00	0	0	C	NM_004854	0	0		101019055	-1	no_errors	ENST00000542617	ensembl	human	known	74_37	nonsense	28	73	9.68	22.11	3	21	SNP	0.919	A
ANO7	50636	genome.wustl.edu	37	2	242149889	242149889	+	Missense_Mutation	SNP	C	C	T	rs184837414	byFrequency	TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr2:242149889C>T	ENST00000274979.8	+	15	1730	c.1627C>T	c.(1627-1629)Cgc>Tgc	p.R543C	ANO7_ENST00000402430.3_Missense_Mutation_p.R542C	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	543					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.R543C(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						TTAGGCCTCTCGCATCGCCAG	0.637													C|||	2	0.000399361	0.0	0.0014	5008	,	,		16885	0.0		0.001	False		,,,				2504	0.0						0											1	Substitution - Missense(1)	lung(1)											96.0	83.0	87.0					2																	242149889		2203	4300	6503	SO:0001583	missense	0			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1627C>T	2.37:g.242149889C>T	ENSP00000274979:p.Arg543Cys		Q6IWH6	Missense_Mutation	SNP	pfam_Anoctamin	p.R543C	ENST00000274979.8	37	c.1627	CCDS33423.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.68	2.012072	0.35511	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.64618	-0.11;-0.11	3.49	0.146	0.14833	.	1.252990	0.05724	N	0.598293	T	0.73860	0.3641	L	0.58669	1.825	0.09310	N	0.999999	D	0.76494	0.999	D	0.67725	0.953	T	0.61426	-0.7065	10	0.38643	T	0.18	.	11.0423	0.47838	0.6442:0.3558:0.0:0.0	.	543	Q6IWH7	ANO7_HUMAN	C	543;542	ENSP00000274979:R543C;ENSP00000385418:R542C	ENSP00000274979:R543C	R	+	1	0	ANO7	241798562	0.003000	0.15002	0.000000	0.03702	0.123000	0.20343	-0.039000	0.12124	-0.263000	0.09378	0.313000	0.20887	CGC	0	pfam_Anoctamin		0.637	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	protein_coding	OTTHUMT00000323509.1	26	150	0	0.00	0	0	C	NM_001001891	rs184837414	C->G,T		242149889	1	no_errors	ENST00000274979	ensembl	human	known	74_37	missense	17	103	29.17	20.16	7	26	SNP	0	T
SCAP	22937	genome.wustl.edu	37	3	47455441	47455441	+	Missense_Mutation	SNP	C	C	T	rs185806499		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr3:47455441C>T	ENST00000265565.5	-	23	4155	c.3743G>A	c.(3742-3744)cGc>cAc	p.R1248H	SCAP_ENST00000441517.2_Missense_Mutation_p.R992H|SCAP_ENST00000545718.1_Missense_Mutation_p.R855H	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1248	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CAGGATCTGGCGGGCAGGCTG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19300	0.0		0.001	False		,,,				2504	0.0				Pancreas(149;978 1908 29304 37806 46700)		0.9998,0.0001997											0													153.0	155.0	155.0					3																	47455441		2203	4300	6503	SO:0001583	missense	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3743G>A	3.37:g.47455441C>T	ENSP00000265565:p.Arg1248His		Q8N2E0|Q8WUA1	Missense_Mutation	SNP	pfam_Patched,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_SSD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1248H	ENST00000265565.5	37	c.3743	CCDS2755.2	3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	28.7	4.941794	0.92526	.	.	ENSG00000114650	ENST00000339815;ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.81078	-1.45;-1.39;0.75	5.2	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.975	T	0.79614	-0.1730	10	0.21014	T	0.42	-29.2504	13.387	0.60801	0.0:0.9239:0.0:0.0761	.	992;1248	F8W921;Q12770	.;SCAP_HUMAN	H	740;874;1248;992;855	ENSP00000265565:R1248H;ENSP00000416847:R992H;ENSP00000438956:R855H	ENSP00000265565:R1248H	R	-	2	0	SCAP	47430445	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.296000	0.78790	1.426000	0.47256	0.655000	0.94253	CGC	0	NULL		0.592	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	protein_coding	OTTHUMT00000246872.2	54	118	0	0.00	0	0	C	NM_012235	rs185806499	C->T		47455441	-1	no_errors	ENST00000265565	ensembl	human	known	74_37	missense	22	92	43.9	46.20	18	79	SNP	1	T
MUC4	4585	genome.wustl.edu	37	3	195513493	195513494	+	Missense_Mutation	DNP	CT	CT	TC			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C|T	C|T	C|T	T|C	C|T	C|T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr3:195513493_195513494CT>TC	ENST00000463781.3	-	2	5416_5417	c.4957_4958AG>GA	c.(4957-4959)AGc>GAc	p.S1653D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1653D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1653I(3)|p.N1637_T1652delNASSLSTGHATPLHVT(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGGGCTGGTGACATGA	0.594																																							0											5	Substitution - Missense(3)|Deletion - In frame(2)	stomach(2)|endometrium(2)|kidney(1)																																								SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4957_4958delinsTC	3.37:g.195513493_195513494delinsTC	ENSP00000417498:p.Ser1653Asp		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S1653N|p.S1653G	ENST00000463781.3	37	c.4958|c.4957	CCDS54700.1	3																																																																																			0	NULL		0.594	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	105|109	33|34	0|0.91	0.00	0|1	0	C|T	NM_018406	0	0		195513493|195513494	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	213|222	32|34	8.61|8.54	8.33|10.53	21	3|4	SNP	0|0.014	T|C
EVC2	132884	genome.wustl.edu	37	4	5642519	5642519	+	Missense_Mutation	SNP	A	A	G			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr4:5642519A>G	ENST00000344408.5	-	10	1245	c.1192T>C	c.(1192-1194)Tgt>Cgt	p.C398R	EVC2_ENST00000344938.1_Missense_Mutation_p.C398R|EVC2_ENST00000310917.2_Missense_Mutation_p.C318R	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	398					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						tgtgttcgacaagCCTCCAGA	0.443																																							0											0													84.0	84.0	84.0					4																	5642519		2203	4300	6503	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1192T>C	4.37:g.5642519A>G	ENSP00000342144:p.Cys398Arg		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.C398R	ENST00000344408.5	37	c.1192	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204769	0.38905	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.76839	-1.05;-1.05;-1.05	4.19	2.99	0.34606	.	0.511281	0.19203	N	0.120122	T	0.81128	0.4758	M	0.67953	2.075	0.49483	D	0.999795	D	0.64830	0.994	D	0.63703	0.917	T	0.77183	-0.2681	10	0.23891	T	0.37	-9.9544	5.2774	0.15657	0.7494:0.0:0.0921:0.1585	.	398	Q86UK5	LBN_HUMAN	R	398;318;398	ENSP00000339954:C398R;ENSP00000311683:C318R;ENSP00000342144:C398R	ENSP00000311683:C318R	C	-	1	0	EVC2	5693420	0.948000	0.32251	1.000000	0.80357	0.281000	0.26958	2.240000	0.43088	1.657000	0.50732	0.482000	0.46254	TGT	0	pfam_Limbin		0.443	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	protein_coding	OTTHUMT00000289822.2	33	151	0	0.66	0	1	A	NM_147127	0	0		5642519	-1	no_errors	ENST00000344408	ensembl	human	known	74_37	missense	19	102	54.76	40.00	23	68	SNP	0.991	G
SORCS2	57537	genome.wustl.edu	37	4	7533320	7533320	+	Silent	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr4:7533320C>T	ENST00000507866.2	+	3	721	c.612C>T	c.(610-612)atC>atT	p.I204I	SORCS2_ENST00000511199.1_3'UTR|SORCS2_ENST00000329016.9_Silent_p.I32I	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	204					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						CCACCGTCATCGACAATTTCT	0.607																																							0											0													88.0	100.0	96.0					4																	7533320		2095	4199	6294	SO:0001819	synonymous_variant	0			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.612C>T	4.37:g.7533320C>T			Q9P2L7	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.I204	ENST00000507866.2	37	c.612	CCDS47008.1	4																																																																																			0	smart_VPS10		0.607	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	protein_coding	OTTHUMT00000358685.4	32	181	0	0.00	0	0	C	NM_020777	0	0		7533320	1	no_errors	ENST00000507866	ensembl	human	known	74_37	silent	21	173	27.59	13.07	8	26	SNP	0.983	T
GNPDA2	132789	genome.wustl.edu	37	4	44719295	44719295	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr4:44719295G>T	ENST00000295448.3	-	4	400	c.244C>A	c.(244-246)Cct>Act	p.P82T	GNPDA2_ENST00000509756.1_Missense_Mutation_p.P82T|GNPDA2_ENST00000507534.1_Missense_Mutation_p.P12T|GNPDA2_ENST00000511187.1_Intron|GNPDA2_ENST00000507917.1_Missense_Mutation_p.P48T	NM_138335.2	NP_612208.1	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	82					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(1)|lung(7)|ovary(1)	11						TAGCTTTCAGGATGATTTCTT	0.279																																					Colon(54;743 1010 7604 16453 19544)		0											0													39.0	40.0	40.0					4																	44719295		2201	4295	6496	SO:0001583	missense	0			AF247786	CCDS3469.1, CCDS59472.1, CCDS59473.1	4p13	2006-04-12			ENSG00000163281	ENSG00000163281	3.5.99.6		21526	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate isomerase"""	613222				12965206	Standard	NM_001270880		Approved	SB52	uc003gwy.4	Q8TDQ7	OTTHUMG00000099415	ENST00000295448.3:c.244C>A	4.37:g.44719295G>T	ENSP00000295448:p.Pro82Thr		B4DJF3|Q2VYF1|Q59EA7|Q8NCZ8|Q96BJ4|Q96NC6	Missense_Mutation	SNP	pfam_Glc/Gal-6P_isomerase,tigrfam_Glucosamine6P_isomerase	p.P82T	ENST00000295448.3	37	c.244	CCDS3469.1	4	.	.	.	.	.	.	.	.	.	.	G	11.28	1.590714	0.28357	.	.	ENSG00000163281	ENST00000507917;ENST00000295448;ENST00000507534;ENST00000509756	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.84	4.99	0.66335	Glucosamine/galactosamine-6-phosphate isomerase (1);	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	H	0.96269	3.795	0.80722	D	1	B;B;B	0.25169	0.119;0.044;0.013	B;B;B	0.31337	0.128;0.074;0.034	T	0.72141	-0.4380	10	0.72032	D	0.01	-13.1603	16.0281	0.80558	0.0:0.1345:0.8655:0.0	.	48;82;82	Q2VYF1;Q8TDQ7-3;Q8TDQ7	.;.;GNPI2_HUMAN	T	48;82;12;82	ENSP00000425868:P48T;ENSP00000295448:P82T;ENSP00000427423:P12T;ENSP00000424061:P82T	ENSP00000295448:P82T	P	-	1	0	GNPDA2	44414052	1.000000	0.71417	1.000000	0.80357	0.130000	0.20726	9.476000	0.97823	1.465000	0.48006	0.591000	0.81541	CCT	0	pfam_Glc/Gal-6P_isomerase,tigrfam_Glucosamine6P_isomerase		0.279	GNPDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPDA2	protein_coding	OTTHUMT00000216874.3	70	173	0	0.00	0	0	G	NM_138335	0	0		44719295	-1	no_errors	ENST00000295448	ensembl	human	known	74_37	missense	205	288	18.58	17.48	47	61	SNP	1	T
AFF1	4299	genome.wustl.edu	37	4	88047346	88047346	+	Missense_Mutation	SNP	A	A	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr4:88047346A>C	ENST00000307808.6	+	13	3068	c.2648A>C	c.(2647-2649)aAg>aCg	p.K883T	AFF1_ENST00000395146.4_Missense_Mutation_p.K890T|AFF1_ENST00000544085.1_Missense_Mutation_p.K521T	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	883					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CCTGCACTTAAGAGGTCAAGG	0.592																																							0											0													76.0	74.0	75.0					4																	88047346		2203	4300	6503	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.2648A>C	4.37:g.88047346A>C	ENSP00000305689:p.Lys883Thr		B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.K890T	ENST00000307808.6	37	c.2669	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204611	0.38905	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.70399	-0.48;-0.48;-0.48	5.65	5.65	0.86999	.	0.069047	0.64402	D	0.000017	D	0.83018	0.5163	M	0.80422	2.495	0.51767	D	0.999932	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.68039	0.955;0.955;0.955	T	0.81588	-0.0864	10	0.24483	T	0.36	-25.8797	15.5512	0.76155	1.0:0.0:0.0:0.0	.	890;883;883	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	T	890;883;521	ENSP00000378578:K890T;ENSP00000305689:K883T;ENSP00000440843:K521T	ENSP00000305689:K883T	K	+	2	0	AFF1	88266370	1.000000	0.71417	0.944000	0.38274	0.020000	0.10135	6.178000	0.71968	2.150000	0.67090	0.528000	0.53228	AAG	0	pfam_TF_AF4/FMR2		0.592	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	protein_coding	OTTHUMT00000253053.3	41	119	0	0.00	0	0	A	NM_005935	0	0		88047346	1	no_errors	ENST00000395146	ensembl	human	known	74_37	missense	37	121	9.76	19.87	4	30	SNP	0.997	C
C4orf45	152940	genome.wustl.edu	37	4	159956214	159956214	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr4:159956214G>T	ENST00000434826.2	-	1	119	c.35C>A	c.(34-36)aCt>aAt	p.T12N	C4orf45_ENST00000508011.1_Intron	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	12										large_intestine(2)|lung(3)	5						TCCCACAGTAGTAGATGTTGG	0.353																																							0											0													113.0	107.0	109.0					4																	159956214		1833	4087	5920	SO:0001583	missense	0				CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.35C>A	4.37:g.159956214G>T	ENSP00000412215:p.Thr12Asn		A8MPU3|C9J0T8	Missense_Mutation	SNP	NULL	p.T12N	ENST00000434826.2	37	c.35	CCDS47156.1	4	.	.	.	.	.	.	.	.	.	.	G	6.128	0.391800	0.11581	.	.	ENSG00000164123	ENST00000434826	T	0.13901	2.55	4.86	3.92	0.45320	.	1.480650	0.04006	N	0.297340	T	0.12008	0.0292	N	0.25647	0.755	0.09310	N	1	P	0.36535	0.557	B	0.33521	0.165	T	0.34354	-0.9832	9	.	.	.	0.5257	10.0085	0.41972	0.0:0.0:0.7214:0.2786	.	12	Q96LM5	CD045_HUMAN	N	12	ENSP00000412215:T12N	.	T	-	2	0	C4orf45	160175664	0.000000	0.05858	0.001000	0.08648	0.070000	0.16714	0.557000	0.23454	0.951000	0.37770	0.655000	0.94253	ACT	0	NULL		0.353	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf45	protein_coding	OTTHUMT00000366636.1	38	245	0	0.00	0	0	G	NM_152543	0	0		159956214	-1	no_errors	ENST00000434826	ensembl	human	known	74_37	missense	53	229	40.45	37.67	36	139	SNP	0.002	T
SLC45A2	51151	genome.wustl.edu	37	5	33982460	33982460	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr5:33982460C>T	ENST00000296589.4	-	2	589	c.443G>A	c.(442-444)gGt>gAt	p.G148D	SLC45A2_ENST00000382102.3_Missense_Mutation_p.G148D|SLC45A2_ENST00000342059.3_Intron|SLC45A2_ENST00000345083.5_Missense_Mutation_p.G148D|SLC45A2_ENST00000509381.1_Missense_Mutation_p.G148D	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	148					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						GAGAACGACACCTATCATGGT	0.443																																					Ovarian(31;380 859 8490 22203 49048)		0											0													106.0	100.0	102.0					5																	33982460		2203	4300	6503	SO:0001583	missense	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.443G>A	5.37:g.33982460C>T	ENSP00000296589:p.Gly148Asp		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G148D	ENST00000296589.4	37	c.443	CCDS3901.1	5	.	.	.	.	.	.	.	.	.	.	C	31	5.058744	0.93846	.	.	ENSG00000164175	ENST00000296589;ENST00000382102;ENST00000509381;ENST00000345083	D;D;D;D	0.96992	-4.2;-4.2;-4.2;-4.2	5.33	5.33	0.75918	Major facilitator superfamily domain, general substrate transporter (1);	0.094954	0.85682	D	0.000000	D	0.98635	0.9543	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99461	1.0943	10	0.87932	D	0	-32.5789	19.3847	0.94551	0.0:1.0:0.0:0.0	.	148;148;148	D6RGY6;Q9UMX9-4;Q9UMX9	.;.;S45A2_HUMAN	D	148	ENSP00000296589:G148D;ENSP00000371534:G148D;ENSP00000421100:G148D;ENSP00000340444:G148D	ENSP00000296589:G148D	G	-	2	0	SLC45A2	34018217	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.762000	0.85270	2.670000	0.90874	0.643000	0.83706	GGT	0	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.443	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	protein_coding	OTTHUMT00000207443.2	16	224	0	0.00	0	0	C	NM_016180	0	0		33982460	-1	no_errors	ENST00000296589	ensembl	human	known	74_37	missense	22	305	24.14	13.80	7	49	SNP	1	T
RIOK2	55781	genome.wustl.edu	37	5	96503452	96503452	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr5:96503452G>T	ENST00000283109.3	-	8	1184	c.1116C>A	c.(1114-1116)gaC>gaA	p.D372E	RIOK2_ENST00000508447.1_Missense_Mutation_p.D372E|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	372	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TTTGTTCAGGGTCTCCAGATG	0.413																																							0											0													111.0	108.0	109.0					5																	96503452		2203	4300	6503	SO:0001583	missense	0			AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.1116C>A	5.37:g.96503452G>T	ENSP00000283109:p.Asp372Glu		D6RDI3|Q9NUT0	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_RIO2_kinase_winged_hlx_N,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	p.D372E	ENST00000283109.3	37	c.1116	CCDS4089.1	5	.	.	.	.	.	.	.	.	.	.	G	9.400	1.077705	0.20227	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.20598	2.06;2.06	6.07	2.21	0.28008	.	0.805437	0.11742	N	0.533961	T	0.17195	0.0413	M	0.68952	2.095	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.46205	-0.9208	10	0.05721	T	0.95	-2.195	4.8591	0.13573	0.2398:0.0:0.4999:0.2603	.	372;372	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	E	372	ENSP00000283109:D372E;ENSP00000420932:D372E	ENSP00000283109:D372E	D	-	3	2	RIOK2	96529208	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.350000	0.07721	0.114000	0.18032	0.585000	0.79938	GAC	0	NULL		0.413	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK2	protein_coding	OTTHUMT00000250628.1	39	153	0	0.00	0	0	G	NM_018343	0	0		96503452	-1	no_errors	ENST00000283109	ensembl	human	known	74_37	missense	32	139	38.46	37.67	20	84	SNP	0	T
PCDHA10	56139	genome.wustl.edu	37	5	140237615	140237615	+	Missense_Mutation	SNP	C	C	T	rs534379807		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr5:140237615C>T	ENST00000307360.5	+	1	1982	c.1982C>T	c.(1981-1983)aCg>aTg	p.T661M	PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	661	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACGGCCACGGCCACTGTG	0.682													.|||	1	0.000199681	0.0	0.0	5008	,	,		14417	0.0		0.001	False		,,,				2504	0.0						0.9998,0.0001997											0													14.0	19.0	17.0					5																	140237615		1320	2285	3605	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1982C>T	5.37:g.140237615C>T	ENSP00000304234:p.Thr661Met		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T661M	ENST00000307360.5	37	c.1982	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145363	0.37825	.	.	ENSG00000250120	ENST00000307360	T	0.57107	0.42	3.49	3.49	0.39957	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.77678	0.4166	H	0.94620	3.56	0.25757	N	0.984983	D;D	0.89917	0.999;1.0	P;D	0.83275	0.903;0.996	T	0.67741	-0.5592	9	0.72032	D	0.01	.	9.4094	0.38482	0.0:0.8997:0.0:0.1003	.	661;661	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	M	661	ENSP00000304234:T661M	ENSP00000304234:T661M	T	+	2	0	PCDHA10	140217799	0.960000	0.32886	0.983000	0.44433	0.308000	0.27856	3.214000	0.51161	1.932000	0.55993	0.491000	0.48974	ACG	0	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.682	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	protein_coding	OTTHUMT00000372895.2	50	39	0	0.00	0	0	C	NM_018901	rs534379807	C->T		140237615	1	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	32	38	42.86	39.06	24	25	SNP	0.993	T
PCDHGA5	56110	genome.wustl.edu	37	5	140744606	140744606	+	Missense_Mutation	SNP	G	G	A	rs577848371		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr5:140744606G>A	ENST00000518069.1	+	1	709	c.709G>A	c.(709-711)Gac>Aac	p.D237N	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	237	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACGCAAACGACAATGCGCC	0.582																																							0											0													84.0	84.0	84.0					5																	140744606		2080	4216	6296	SO:0001583	missense	0			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.709G>A	5.37:g.140744606G>A	ENSP00000429834:p.Asp237Asn		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D237N	ENST00000518069.1	37	c.709	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	18.47	3.631228	0.67015	.	.	ENSG00000253485	ENST00000518069	T	0.71579	-0.58	5.4	5.4	0.78164	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.90971	0.7161	H	0.98351	4.21	0.43259	D	0.995192	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94163	0.7416	9	0.87932	D	0	.	19.1425	0.93451	0.0:0.0:1.0:0.0	.	237;237	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	N	237	ENSP00000429834:D237N	ENSP00000429834:D237N	D	+	1	0	PCDHGA5	140724790	1.000000	0.71417	0.930000	0.37139	0.128000	0.20619	9.813000	0.99286	2.692000	0.91855	0.467000	0.42956	GAC	0	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.582	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	protein_coding	OTTHUMT00000374742.1	15	147	0	0.00	0	0	G	NM_018918	0	0		140744606	1	no_errors	ENST00000518069	ensembl	human	known	74_37	missense	25	149	44.44	35.50	20	82	SNP	1	A
SLC17A4	10050	genome.wustl.edu	37	6	25776847	25776847	+	Missense_Mutation	SNP	T	T	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr6:25776847T>C	ENST00000377905.4	+	9	1131	c.1012T>C	c.(1012-1014)Ttt>Ctt	p.F338L	SLC17A4_ENST00000397076.2_Missense_Mutation_p.F108L|SLC17A4_ENST00000439485.2_Missense_Mutation_p.F108L	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	338					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGCCTTGCCGTTTGTTGTTGG	0.507																																							0											0													284.0	265.0	271.0					6																	25776847		2203	4300	6503	SO:0001583	missense	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1012T>C	6.37:g.25776847T>C	ENSP00000367137:p.Phe338Leu		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F338L	ENST00000377905.4	37	c.1012	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	T	20.4	3.981179	0.74474	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.58358	0.35;0.34;0.35	5.63	0.0894	0.14459	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.731744	0.12380	N	0.473990	T	0.22859	0.0552	L	0.48986	1.54	0.09310	N	1	B;B;B	0.26195	0.005;0.144;0.022	B;B;B	0.29598	0.011;0.091;0.104	T	0.30650	-0.9971	10	0.54805	T	0.06	.	4.2313	0.10604	0.1447:0.2768:0.0:0.5785	.	108;108;338	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	L	338;108;108	ENSP00000367137:F338L;ENSP00000391345:F108L;ENSP00000380266:F108L	ENSP00000367137:F338L	F	+	1	0	SLC17A4	25884826	0.001000	0.12720	0.000000	0.03702	0.954000	0.61252	1.050000	0.30404	0.089000	0.17243	0.533000	0.62120	TTT	0	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.507	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	protein_coding	OTTHUMT00000040068.1	45	192	0	0.00	0	0	T		0	0		25776847	1	no_errors	ENST00000377905	ensembl	human	known	74_37	missense	7	52	65	61.31	13	84	SNP	0	C
GPR126	57211	genome.wustl.edu	37	6	142740971	142740971	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr6:142740971G>A	ENST00000230173.6	+	22	3525	c.3049G>A	c.(3049-3051)Gat>Aat	p.D1017N	GPR126_ENST00000296932.8_Missense_Mutation_p.D989N|GPR126_ENST00000367609.3_Missense_Mutation_p.D1017N|GPR126_ENST00000367608.2_Missense_Mutation_p.D989N	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	1017					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TTGGATTCAAGATCCAGTCAT	0.368																																							0											0													130.0	111.0	117.0					6																	142740971		1849	4086	5935	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.3049G>A	6.37:g.142740971G>A	ENSP00000230173:p.Asp1017Asn		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D1017N	ENST00000230173.6	37	c.3049	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	10.05	1.242887	0.22796	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.71	5.71	0.89125	GPCR, family 2-like (1);	0.080746	0.52532	D	0.000061	T	0.08492	0.0211	N	0.05158	-0.105	0.32001	N	0.603403	B;B;B;B;B	0.21225	0.004;0.043;0.043;0.043;0.053	B;B;B;B;B	0.27262	0.013;0.027;0.027;0.047;0.078	T	0.16867	-1.0388	10	0.25751	T	0.34	.	9.9972	0.41907	0.155:0.0:0.845:0.0	.	77;989;1017;989;1017	B4DSK4;Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;.;GP126_HUMAN	N	1017;989;989;1017	ENSP00000230173:D1017N;ENSP00000356580:D989N;ENSP00000296932:D989N;ENSP00000356581:D1017N	ENSP00000230173:D1017N	D	+	1	0	GPR126	142782664	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.946000	0.56644	2.683000	0.91414	0.650000	0.86243	GAT	0	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.368	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	protein_coding	OTTHUMT00000042487.2	61	138	0	0.00	0	0	G		0	0		142740971	1	no_errors	ENST00000367609	ensembl	human	known	74_37	missense	29	80	36.96	28.57	17	32	SNP	0.959	A
ZNF479	90827	genome.wustl.edu	37	7	57194325	57194325	+	Missense_Mutation	SNP	T	T	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr7:57194325T>A	ENST00000331162.4	-	3	410	c.140A>T	c.(139-141)gAg>gTg	p.E47V		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	47	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TCTGTAGTTCTCTAACATCAC	0.388																																							0											0													87.0	89.0	88.0					7																	57194325		2198	4297	6495	SO:0001583	missense	0			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.140A>T	7.37:g.57194325T>A	ENSP00000333776:p.Glu47Val			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E47V	ENST00000331162.4	37	c.140	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	t	14.05	2.419216	0.42918	.	.	ENSG00000185177	ENST00000331162	T	0.04551	3.6	1.25	1.25	0.21368	Krueppel-associated box (4);	.	.	.	.	T	0.36963	0.0986	H	0.99894	4.905	0.27146	N	0.961525	D	0.89917	1.0	D	0.87578	0.998	T	0.30851	-0.9964	9	0.87932	D	0	.	6.2934	0.21073	0.0:0.0:0.0:1.0	.	47	Q96JC4	ZN479_HUMAN	V	47	ENSP00000333776:E47V	ENSP00000333776:E47V	E	-	2	0	ZNF479	57198267	0.578000	0.26717	0.947000	0.38551	0.860000	0.49131	0.387000	0.20718	0.558000	0.29135	0.324000	0.21423	GAG	0	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.388	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	protein_coding	OTTHUMT00000345302.1	74	18	0	0.00	0	0	T	XM_291202	0	0		57194325	-1	no_errors	ENST00000331162	ensembl	human	known	74_37	missense	155	15	36.99	34.78	91	8	SNP	0.996	A
ZNF716	441234	genome.wustl.edu	37	7	57528596	57528596	+	Silent	SNP	T	T	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr7:57528596T>C	ENST00000420713.1	+	4	541	c.429T>C	c.(427-429)aaT>aaC	p.N143N		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						GAGGTTATAATTATGTTAACC	0.343																																							0											0													212.0	201.0	204.0					7																	57528596		692	1591	2283	SO:0001819	synonymous_variant	0			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.429T>C	7.37:g.57528596T>C				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N143	ENST00000420713.1	37	c.429	CCDS55112.1	7																																																																																			0	NULL		0.343	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	protein_coding	OTTHUMT00000345309.1	51	147	0	0.00	0	0	T	NM_001159279	0	0		57528596	1	no_errors	ENST00000420713	ensembl	human	known	74_37	silent	128	147	22.42	23.71	37	46	SNP	0	C
ZNF727	442319	genome.wustl.edu	37	7	63538653	63538653	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr7:63538653C>T	ENST00000550760.3	+	4	1405	c.1226C>T	c.(1225-1227)tCa>tTa	p.S409L	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						ACCTGCTCCTCAAACCTTATT	0.388																																							0											0													28.0	26.0	26.0					7																	63538653		692	1591	2283	SO:0001583	missense	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.1226C>T	7.37:g.63538653C>T	ENSP00000447987:p.Ser409Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S409L	ENST00000550760.3	37	c.1226	CCDS55113.1	7	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453759	0.26161	.	.	ENSG00000257482	ENST00000550760	T	0.36520	1.25	0.926	0.926	0.19430	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50990	0.1648	M	0.83852	2.665	0.09310	N	1	D	0.62365	0.991	P	0.55011	0.766	T	0.39333	-0.9619	8	.	.	.	.	7.382	0.26862	0.0:1.0:0.0:0.0	.	409	A8MUV8	ZN727_HUMAN	L	409	ENSP00000447987:S409L	.	S	+	2	0	ZNF727	63176088	0.000000	0.05858	0.011000	0.14972	0.009000	0.06853	-0.937000	0.03942	0.420000	0.25954	0.420000	0.28162	TCA	0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	protein_coding		27	42	0	0.00	0	0	C	NM_001159522	0	0		63538653	1	no_errors	ENST00000550760	ensembl	human	known	74_37	missense	66	74	24.14	11.90	21	10	SNP	0.001	T
PRUNE2	158471	genome.wustl.edu	37	9	79325399	79325399	+	Silent	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:79325399G>A	ENST00000376718.3	-	8	1914	c.1791C>T	c.(1789-1791)tcC>tcT	p.S597S	PRUNE2_ENST00000428286.1_Silent_p.S238S	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	597					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GCCTTTCTGGGGAAGGGGATT	0.443																																							0											0													76.0	68.0	71.0					9																	79325399		1568	3582	5150	SO:0001819	synonymous_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1791C>T	9.37:g.79325399G>A			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.S238	ENST00000376718.3	37	c.714	CCDS47982.1	9																																																																																			0	NULL		0.443	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	protein_coding	OTTHUMT00000052730.2	56	216	0	0.46	0	1	G	NM_138818	0	0		79325399	-1	no_errors	ENST00000428286	ensembl	human	known	74_37	silent	40	225	32.2	36.69	19	131	SNP	0.001	A
XXyac-YM21GA2.7	0	genome.wustl.edu	37	9	90474230	90474230	+	RNA	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:90474230C>T	ENST00000399186.2	-	0	84																											TGCGGCGGAACCAGGAACAAA	0.562																																							0											0																																												0																															9.37:g.90474230C>T				RNA	SNP	0	NULL	ENST00000399186.2	37	NULL		9																																																																																			0	0		0.562	XXyac-YM21GA2.7-001	KNOWN	basic	antisense	ENSG00000214888	antisense	OTTHUMT00000397578.1	49	164	0	0.61	0	1	C		0	0		90474230	-1	no_errors	ENST00000399186	ensembl	human	known	74_37	rna	48	109	39.24	40.96	31	77	SNP	0.003	T
ZNF189	7743	genome.wustl.edu	37	9	104170453	104170453	+	Missense_Mutation	SNP	A	A	G			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:104170453A>G	ENST00000339664.2	+	3	532	c.403A>G	c.(403-405)Aac>Gac	p.N135D	ZNF189_ENST00000374861.3_Missense_Mutation_p.N121D|ZNF189_ENST00000259395.4_Missense_Mutation_p.N93D	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	135					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AGAAAACACTAACATTATCCG	0.393																																							0											0													66.0	65.0	65.0					9																	104170453		2203	4300	6503	SO:0001583	missense	0			AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.403A>G	9.37:g.104170453A>G	ENSP00000342019:p.Asn135Asp		O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N135D	ENST00000339664.2	37	c.403	CCDS6754.1	9	.	.	.	.	.	.	.	.	.	.	A	7.723	0.697500	0.15106	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.05382	3.52;3.53;3.45	4.66	4.66	0.58398	.	0.119463	0.38217	N	0.001776	T	0.04770	0.0129	N	0.21097	0.63	0.27545	N	0.950685	B;B;P	0.42409	0.002;0.031;0.779	B;B;B	0.34873	0.006;0.008;0.191	T	0.28839	-1.0031	10	0.59425	D	0.04	.	12.7134	0.57102	1.0:0.0:0.0:0.0	.	120;121;135	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	D	121;135;93	ENSP00000363995:N121D;ENSP00000342019:N135D;ENSP00000259395:N93D	ENSP00000259395:N93D	N	+	1	0	ZNF189	103210274	0.000000	0.05858	0.994000	0.49952	0.942000	0.58702	1.057000	0.30492	2.317000	0.78254	0.460000	0.39030	AAC	0	NULL		0.393	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF189	protein_coding	OTTHUMT00000053447.1	31	179	0	0.00	0	0	A	NM_003452	0	0		104170453	1	no_errors	ENST00000339664	ensembl	human	known	74_37	missense	56	209	48.62	40.29	53	141	SNP	0.92	G
TMEM38B	55151	genome.wustl.edu	37	9	108483845	108483845	+	Missense_Mutation	SNP	C	C	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:108483845C>A	ENST00000374692.3	+	3	414	c.297C>A	c.(295-297)gaC>gaA	p.D99E	TMEM38B_ENST00000374688.1_Missense_Mutation_p.D45E	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	99						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						GCCCGCATGACCTAGTTTCCC	0.358																																							0											0													84.0	78.0	80.0					9																	108483845		2202	4300	6502	SO:0001583	missense	0			BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.297C>A	9.37:g.108483845C>A	ENSP00000363824:p.Asp99Glu		Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	pfam_TRIC_channel	p.D99E	ENST00000374692.3	37	c.297	CCDS6768.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.29|16.29	3.081120|3.081120	0.55753|0.55753	.|.	.|.	ENSG00000095209|ENSG00000095209	ENST00000374692;ENST00000374688|ENST00000435034	T;T|.	0.67171|.	-0.25;-0.02|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75221|0.75221	0.3820|0.3820	M|M	0.80982|0.80982	2.52|2.52	0.58432|0.58432	D|D	0.999998|0.999998	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.76154|0.76154	-0.3063|-0.3063	10|5	0.52906|.	T|.	0.07|.	-11.6845|-11.6845	12.2492|12.2492	0.54589|0.54589	0.0:0.9228:0.0:0.0772|0.0:0.9228:0.0:0.0772	.|.	99|.	Q9NVV0|.	TM38B_HUMAN|.	E|N	99;45|36	ENSP00000363824:D99E;ENSP00000363820:D45E|.	ENSP00000363820:D45E|.	D|T	+|+	3|2	2|0	TMEM38B|TMEM38B	107523666|107523666	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.138000|0.138000	0.21146|0.21146	2.284000|2.284000	0.43478|0.43478	2.709000|2.709000	0.92574|0.92574	0.655000|0.655000	0.94253|0.94253	GAC|ACC	0	pfam_TRIC_channel		0.358	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38B	protein_coding	OTTHUMT00000053517.1	60	187	0	0.53	0	1	C	NM_018112	0	0		108483845	1	no_errors	ENST00000374692	ensembl	human	known	74_37	missense	60	248	25.93	16.78	21	50	SNP	1	A
BSPRY	54836	genome.wustl.edu	37	9	116122940	116122940	+	Missense_Mutation	SNP	G	G	A	rs570967595		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:116122940G>A	ENST00000374183.4	+	3	493	c.454G>A	c.(454-456)Gag>Aag	p.E152K	BSPRY_ENST00000462085.1_3'UTR	NM_017688.2	NP_060158.2	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	152					calcium ion transport (GO:0006816)	cell leading edge (GO:0031252)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						GCACTGGGCCGAGGCGCTGCA	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		17783	0.001		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0													37.0	44.0	42.0					9																	116122940		2161	4267	6428	SO:0001583	missense	0			AJ276691	CCDS43868.1	9q33.1	2008-02-05			ENSG00000119411	ENSG00000119411			18232	protein-coding gene	gene with protein product						10978534, 11099500	Standard	NM_017688		Approved	FLJ20150	uc004bhg.4	Q5W0U4	OTTHUMG00000021006	ENST00000374183.4:c.454G>A	9.37:g.116122940G>A	ENSP00000363298:p.Glu152Lys		B3KS19|Q96DJ2|Q9H4E4|Q9NXN0	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.E152K	ENST00000374183.4	37	c.454	CCDS43868.1	9	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862586	0.71949	.	.	ENSG00000119411	ENST00000374183	T	0.04502	3.61	5.84	5.84	0.93424	.	0.225061	0.46442	D	0.000289	T	0.05227	0.0139	N	0.24115	0.695	0.41741	D	0.989613	P;P	0.51791	0.948;0.847	B;B	0.40285	0.325;0.081	T	0.50021	-0.8876	10	0.38643	T	0.18	-19.2919	19.1242	0.93375	0.0:0.0:1.0:0.0	.	152;152	Q5W0U4-2;Q5W0U4	.;BSPRY_HUMAN	K	152	ENSP00000363298:E152K	ENSP00000363298:E152K	E	+	1	0	BSPRY	115162761	1.000000	0.71417	0.120000	0.21714	0.909000	0.53808	4.894000	0.63206	2.763000	0.94921	0.650000	0.86243	GAG	0	NULL		0.612	BSPRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSPRY	protein_coding	OTTHUMT00000055399.1	18	78	0	0.00	0	0	G	NM_017688	rs570967595	G->A		116122940	1	no_errors	ENST00000374183	ensembl	human	known	74_37	missense	11	78	26.67	21.21	4	21	SNP	0.994	A
PTGES	9536	genome.wustl.edu	37	9	132502127	132502127	+	Silent	SNP	G	G	A	rs200924207		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr9:132502127G>A	ENST00000340607.4	-	3	256	c.222C>T	c.(220-222)aaC>aaT	p.N74N	PTGES_ENST00000481476.1_5'UTR	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase	74	Glutathione binding.				acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				TCTCCATGTCGTTCCGGTGGG	0.572																																							0											0								G		0,4384		0,0,2192	58.0	38.0	45.0		222	-1.6	1.0	9		45	1,8577		0,1,4288	no	coding-synonymous	PTGES	NM_004878.4		0,1,6480	AA,AG,GG		0.0117,0.0,0.0077		74/153	132502127	1,12961	2192	4289	6481	SO:0001819	synonymous_variant	0			AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.222C>T	9.37:g.132502127G>A			O14900|Q5SZC0	Silent	SNP	pfam_Membr-assoc_MAPEG	p.N74	ENST00000340607.4	37	c.222	CCDS6927.1	9																																																																																			0	pfam_Membr-assoc_MAPEG		0.572	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES	protein_coding	OTTHUMT00000054599.2	81	210	0	0.00	0	0	G	NM_004878	rs200924207	G->A		132502127	-1	no_errors	ENST00000340607	ensembl	human	known	74_37	silent	67	178	17.28	16.82	14	36	SNP	0.977	A
TAF3	83860	genome.wustl.edu	37	10	8019222	8019222	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr10:8019222G>A	ENST00000344293.5	+	4	2457	c.2251G>A	c.(2251-2253)Gct>Act	p.A751T		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	751					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						GGAACCAGTCGCTCTGGCCCC	0.438																																							0											0													81.0	81.0	81.0					10																	8019222		1849	4109	5958	SO:0001583	missense	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2251G>A	10.37:g.8019222G>A	ENSP00000340271:p.Ala751Thr		Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A751T	ENST00000344293.5	37	c.2251	CCDS41487.1	10	.	.	.	.	.	.	.	.	.	.	G	8.559	0.877269	0.17395	.	.	ENSG00000165632	ENST00000344293	T	0.17370	2.28	6.05	3.18	0.36537	.	0.660669	0.14191	N	0.335343	T	0.09024	0.0223	N	0.19112	0.55	0.28015	N	0.934732	B	0.24426	0.103	B	0.14023	0.01	T	0.37709	-0.9694	10	0.13853	T	0.58	-5.8353	6.6217	0.22806	0.2064:0.1292:0.6644:0.0	.	751	Q5VWG9	TAF3_HUMAN	T	751	ENSP00000340271:A751T	ENSP00000340271:A751T	A	+	1	0	TAF3	8059228	1.000000	0.71417	0.033000	0.17914	0.012000	0.07955	2.562000	0.45914	0.420000	0.25954	-0.157000	0.13467	GCT	0	NULL		0.438	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	protein_coding	OTTHUMT00000046725.1	60	225	0	0.00	0	0	G	NM_031923	0	0		8019222	1	no_errors	ENST00000344293	ensembl	human	known	74_37	missense	28	124	50.88	47.90	29	114	SNP	0.953	A
SEC31B	25956	genome.wustl.edu	37	10	102247373	102247373	+	Silent	SNP	T	T	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr10:102247373T>C	ENST00000370345.3	-	26	3637	c.3540A>G	c.(3538-3540)taA>taG	p.*1180*		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	0					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GCTGCCTGGTTTAGACCAGCA	0.537																																							0											0													33.0	28.0	30.0					10																	102247373		2203	4300	6503	SO:0001819	synonymous_variant	0			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.3540A>G	10.37:g.102247373T>C			B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.*1180	ENST00000370345.3	37	c.3540	CCDS7495.1	10																																																																																			0	NULL		0.537	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	protein_coding	OTTHUMT00000051198.1	29	79	0	0.00	0	0	T	NM_015490	0	0		102247373	-1	no_errors	ENST00000370345	ensembl	human	known	74_37	silent	14	68	22.22	23.60	4	21	SNP	0.659	C
CALY	50632	genome.wustl.edu	37	10	135142515	135142515	+	Splice_Site	SNP	T	T	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr10:135142515T>A	ENST00000252939.4	-	2	74		c.e2-2		CALY_ENST00000368556.2_Splice_Site|CALY_ENST00000368558.1_Intron|CALY_ENST00000467611.1_5'Flank|ZNF511_ENST00000368554.4_Intron|CALY_ENST00000368555.3_Splice_Site	NM_015722.3	NP_056537.1	Q9NYX4	CALY_HUMAN	calcyon neuron-specific vesicular protein						clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)|endocytosis (GO:0006897)|positive regulation of endocytosis (GO:0045807)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)	clathrin light chain binding (GO:0032051)			kidney(1)|lung(2)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)	Apomorphine(DB00714)|Clozapine(DB00363)|Trifluoperazine(DB00831)	GTCCTTGTCCTGTCCAAAGAC	0.617																																							0											0													42.0	36.0	38.0					10																	135142515		2195	4277	6472	SO:0001630	splice_region_variant	0			AF225903	CCDS7678.1	10q26.3	2008-07-02	2008-01-16	2008-01-16	ENSG00000130643	ENSG00000130643			17938	protein-coding gene	gene with protein product		604647	"""dopamine receptor D1 interacting protein"""	DRD1IP		10698743, 17623072	Standard	NM_015722		Approved	CALCYON, NSG3	uc001lmo.2	Q9NYX4	OTTHUMG00000019310	ENST00000252939.4:c.20-2A>T	10.37:g.135142515T>A			Q5VWX3|Q5VWY5|Q5VWY6	Splice_Site	SNP	0	e1-2	ENST00000252939.4	37	c.1-2	CCDS7678.1	10																																																																																			0	0		0.617	CALY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALY	protein_coding	OTTHUMT00000051122.1	32	51	0	0.00	0	0	T	NM_015722	0	0	Intron	135142515	-1	no_errors	ENST00000252939	ensembl	human	known	74_37	splice_site	13	36	43.48	36.84	10	21	SNP	0.029	A
TRIM6	117854	genome.wustl.edu	37	11	5624749	5624749	+	Silent	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr11:5624749G>A	ENST00000278302.5	+	2	347	c.207G>A	c.(205-207)cgG>cgA	p.R69R	TRIM6_ENST00000380107.1_Silent_p.R69R|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000506134.1_Intron|TRIM6_ENST00000515022.1_Intron|TRIM6-TRIM34_ENST00000354852.5_Silent_p.R97R|TRIM6_ENST00000507320.1_Intron|TRIM6_ENST00000445329.1_Intron|HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000380097.3_Silent_p.R97R	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	69				LR -> FG (in Ref. 6; BAB17050). {ECO:0000305}.	protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGAACCTGCGGCCTAATCGGC	0.552																																							0											0													82.0	80.0	81.0					11																	5624749		2201	4297	6498	SO:0001819	synonymous_variant	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.207G>A	11.37:g.5624749G>A			A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R97	ENST00000278302.5	37	c.291	CCDS31390.1	11																																																																																			0	NULL		0.552	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6-TRIM34	protein_coding	OTTHUMT00000143376.2	9	66	0	0.00	0	0	G	NM_001003818	0	0		5624749	1	no_errors	ENST00000354852	ensembl	human	known	74_37	silent	14	37	51.72	46.38	15	32	SNP	0.314	A
TSPAN18	90139	genome.wustl.edu	37	11	44931421	44931421	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr11:44931421G>A	ENST00000520358.2	+	5	644	c.229G>A	c.(229-231)Gtc>Atc	p.V77I	TSPAN18_ENST00000340160.3_Missense_Mutation_p.V77I			Q96SJ8	TSN18_HUMAN	tetraspanin 18	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						CTGCGGGGCCGTCCGTGAGAA	0.637																																							0											0													41.0	45.0	44.0					11																	44931421		2203	4299	6502	SO:0001583	missense	0			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.229G>A	11.37:g.44931421G>A	ENSP00000429993:p.Val77Ile		Q6UY44|Q8NBI9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V77I	ENST00000520358.2	37	c.229	CCDS7910.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.609|7.609	0.674409|0.674409	0.14841|0.14841	.|.	.|.	ENSG00000157570|ENSG00000157570	ENST00000518429|ENST00000533786;ENST00000533202;ENST00000520358;ENST00000520999;ENST00000340160	.|T;T;T;T;T	.|0.79141	.|-1.24;-1.24;-1.24;-1.24;-1.24	5.41|5.41	2.13|2.13	0.27403|0.27403	.|Tetraspanin, conserved site (1);	.|0.195145	.|0.52532	.|N	.|0.000077	T|T	0.39655|0.39655	0.1086|0.1086	N|N	0.00926|0.00926	-1.1|-1.1	0.80722|0.80722	D|D	1|1	.|B;B	.|0.10296	.|0.002;0.003	.|B;B	.|0.10450	.|0.005;0.003	T|T	0.42832|0.42832	-0.9428|-0.9428	5|10	.|0.02654	.|T	.|1	.|.	5.4137|5.4137	0.16361|0.16361	0.5684:0.0:0.4316:0.0|0.5684:0.0:0.4316:0.0	.|.	.|77;77	.|Q8WUV1;Q96SJ8	.|.;TSN18_HUMAN	H|I	80|77;77;77;87;77	.|ENSP00000433592:V77I;ENSP00000434625:V77I;ENSP00000429993:V77I;ENSP00000427942:V87I;ENSP00000339820:V77I	.|ENSP00000339820:V77I	R|V	+|+	2|1	0|0	TSPAN18|TSPAN18	44887997|44887997	1.000000|1.000000	0.71417|0.71417	0.912000|0.912000	0.35992|0.35992	0.958000|0.958000	0.62258|0.62258	3.145000|3.145000	0.50623|0.50623	0.659000|0.659000	0.30945|0.30945	0.555000|0.555000	0.69702|0.69702	CGT|GTC	0	pfam_Tetraspanin/Peripherin,prints_Tetraspanin		0.637	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN18	protein_coding	OTTHUMT00000376197.3	71	101	0	0.00	0	0	G	NM_130783	0	0		44931421	1	no_errors	ENST00000340160	ensembl	human	known	74_37	missense	27	41	50.91	52.81	28	47	SNP	1	A
ACP2	53	genome.wustl.edu	37	11	47266389	47266389	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr11:47266389C>T	ENST00000256997.3	-	7	785	c.669G>A	c.(667-669)tgG>tgA	p.W223*	ACP2_ENST00000527256.1_Nonsense_Mutation_p.W191*|ACP2_ENST00000533929.1_Nonsense_Mutation_p.W195*|ACP2_ENST00000537863.1_Nonsense_Mutation_p.W36*|ACP2_ENST00000525230.1_5'UTR|ACP2_ENST00000529444.1_Nonsense_Mutation_p.W160*	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	223					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						GGGGTGAGGCCCAGGGCGGCA	0.652																																					Melanoma(90;262 1440 11488 44828 48531)		0											0													47.0	45.0	45.0					11																	47266389		2201	4298	6499	SO:0001587	stop_gained	0			X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.669G>A	11.37:g.47266389C>T	ENSP00000256997:p.Trp223*		E9PCI1|Q561W5|Q9BTU7	Nonsense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.W223*	ENST00000256997.3	37	c.669	CCDS7928.1	11	.	.	.	.	.	.	.	.	.	.	c	25.6	4.651401	0.88056	.	.	ENSG00000134575	ENST00000256997;ENST00000529444;ENST00000527256;ENST00000537863;ENST00000540414;ENST00000533929;ENST00000529663	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.3325	0.90274	0.0:1.0:0.0:0.0	.	.	.	.	X	223;160;191;36;213;195;190	.	ENSP00000256997:W223X	W	-	3	0	ACP2	47222965	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.828000	0.62730	2.352000	0.79861	0.306000	0.20318	TGG	0	pfam_His_Pase_superF_clade-2		0.652	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACP2	protein_coding	OTTHUMT00000392022.2	75	73	0	0.00	0	0	C	NM_001610	0	0		47266389	-1	no_errors	ENST00000256997	ensembl	human	known	74_37	nonsense	40	27	27.27	34.15	15	14	SNP	1	T
PC	5091	genome.wustl.edu	37	11	66620063	66620063	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr11:66620063G>A	ENST00000393958.2	-	14	1765	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W	PC_ENST00000529047.1_5'Flank|PC_ENST00000393960.1_Missense_Mutation_p.R558W|PC_ENST00000528224.1_5'Flank|PC_ENST00000393955.2_Missense_Mutation_p.R558W	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	558					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GGGTGGTTCCGCACAGCTCGA	0.642																																							0											0													55.0	58.0	57.0					11																	66620063		2200	4295	6495	SO:0001583	missense	0			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1672C>T	11.37:g.66620063G>A	ENSP00000377530:p.Arg558Trp		B4DN00|Q16705	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.R558W	ENST00000393958.2	37	c.1672	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975104	0.53720	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.98313	-4.86;-4.86;-4.86	5.53	0.128	0.14733	.	0.056610	0.64402	D	0.000001	D	0.99143	0.9704	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99875	1.1102	10	0.87932	D	0	-30.5771	14.9395	0.70983	0.0:0.0:0.3858:0.6142	.	558	P11498	PYC_HUMAN	W	558	ENSP00000377527:R558W;ENSP00000377530:R558W;ENSP00000377532:R558W	ENSP00000377527:R558W	R	-	1	2	PC	66376639	0.991000	0.36638	0.952000	0.39060	0.115000	0.19883	1.552000	0.36244	-0.234000	0.09782	0.655000	0.94253	CGG	0	pirsf_Pyruv_COase,tigrfam_Pyruv_COase		0.642	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	protein_coding	OTTHUMT00000393115.1	38	147	0	0.68	0	1	G	NM_001040716	0	0		66620063	-1	no_errors	ENST00000393958	ensembl	human	known	74_37	missense	13	106	27.78	36.90	5	62	SNP	1	A
SYTL2	54843	genome.wustl.edu	37	11	85418542	85418542	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr11:85418542C>T	ENST00000528231.1	-	13	2310	c.2033G>A	c.(2032-2034)gGc>gAc	p.G678D	SYTL2_ENST00000316356.4_Missense_Mutation_p.G679D|SYTL2_ENST00000359152.5_Missense_Mutation_p.G1524D|SYTL2_ENST00000524452.1_Missense_Mutation_p.G654D|SYTL2_ENST00000389960.4_Missense_Mutation_p.G654D|SYTL2_ENST00000533892.1_Missense_Mutation_p.G80D|SYTL2_ENST00000525423.1_Missense_Mutation_p.G1000D|SYTL2_ENST00000354566.3_Missense_Mutation_p.G1016D|SYTL2_ENST00000529581.1_Missense_Mutation_p.G120D|SYTL2_ENST00000525702.1_Missense_Mutation_p.G120D|SYTL2_ENST00000389958.3_Missense_Mutation_p.G109D|SYTL2_ENST00000527523.1_Missense_Mutation_p.G646D	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	678	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GCCCATTTTGCCTTTGTCTGG	0.353																																							0											0													230.0	206.0	214.0					11																	85418542		2203	4299	6502	SO:0001583	missense	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.2033G>A	11.37:g.85418542C>T	ENSP00000431701:p.Gly678Asp		B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.G1524D	ENST00000528231.1	37	c.4571	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672345	0.67928	.	.	ENSG00000137501	ENST00000389960;ENST00000359152;ENST00000354566;ENST00000316356;ENST00000525702;ENST00000525423;ENST00000529581;ENST00000389958;ENST00000530351;ENST00000528231;ENST00000533892;ENST00000527523;ENST00000524452;ENST00000533057;ENST00000527794;ENST00000529534	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11;3.11	5.46	5.46	0.80206	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.210076	0.47455	D	0.000234	T	0.12050	0.0293	N	0.22421	0.69	0.32939	D	0.518162	P;P;P;P;P;D;P;D;B;B	0.58970	0.928;0.937;0.902;0.763;0.93;0.964;0.826;0.984;0.129;0.38	P;P;P;B;P;P;P;D;B;B	0.63488	0.563;0.731;0.716;0.408;0.66;0.885;0.598;0.915;0.098;0.205	T	0.13415	-1.0510	9	.	.	.	-12.0285	6.3168	0.21194	0.0:0.6972:0.1846:0.1182	.	646;654;678;679;496;976;1000;1016;109;80	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15;Q9HCH5-11;Q9HCH5-7;Q9HCH5-8;Q9HCH5-9;Q9HCH5-4	.;.;SYTL2_HUMAN;.;.;.;.;.;.;.	D	654;1524;1016;679;120;1000;120;109;395;678;80;646;654;44;80;120	ENSP00000374610:G654D;ENSP00000352065:G1524D;ENSP00000346576:G1016D;ENSP00000318803:G679D;ENSP00000432996:G120D;ENSP00000432694:G1000D;ENSP00000435855:G120D;ENSP00000374608:G109D;ENSP00000435009:G395D;ENSP00000431701:G678D;ENSP00000432144:G80D;ENSP00000434010:G646D;ENSP00000435238:G654D;ENSP00000436164:G44D;ENSP00000437005:G80D;ENSP00000432137:G120D	.	G	-	2	0	SYTL2	85096190	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.449000	0.44935	2.569000	0.86673	0.557000	0.71058	GGC	0	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.353	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	protein_coding	OTTHUMT00000392192.1	70	210	0	0.00	0	0	C	NM_206927	0	0		85418542	-1	no_errors	ENST00000359152	ensembl	human	known	74_37	missense	79	259	36.29	36.05	45	146	SNP	1	T
LRCOL1	100507055	genome.wustl.edu	37	12	133181337	133181337	+	lincRNA	SNP	G	G	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr12:133181337G>C	ENST00000545517.1	-	0	385							A6NCL2	LRCL1_HUMAN	leucine rich colipase-like 1						digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										TAGGGGTGCAGAGCGTGTGTG	0.647																																							0											0																																												0				CCDS73547.1	12q24.33	2012-07-02			ENSG00000204583	ENSG00000204583			44160	protein-coding gene	gene with protein product							Standard	NM_001195520		Approved		uc021rgr.1	A6NCL2	OTTHUMG00000168043		12.37:g.133181337G>C			H9BFB1	RNA	SNP	0	NULL	ENST00000545517.1	37	NULL		12																																																																																			0	0		0.647	LRCOL1-003	KNOWN	basic	lincRNA	LRCOL1	lincRNA	OTTHUMT00000397683.1	36	72	0	0.00	0	0	G	NM_001195520	0	0		133181337	-1	no_errors	ENST00000376608	ensembl	human	known	74_37	rna	14	42	46.15	48.15	12	39	SNP	0.885	C
UBR1	197131	genome.wustl.edu	37	15	43281144	43281144	+	Silent	SNP	G	G	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr15:43281144G>T	ENST00000290650.4	-	35	3948	c.3870C>A	c.(3868-3870)atC>atA	p.I1290I	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1290					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CCATTTCCTTGATGCTATTTG	0.353																																							0											0													59.0	57.0	57.0					15																	43281144		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3870C>A	15.37:g.43281144G>T			O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Silent	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.I1290	ENST00000290650.4	37	c.3870	CCDS10091.1	15																																																																																			0	NULL		0.353	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	protein_coding	OTTHUMT00000253202.1	29	237	0	0.00	0	0	G	NM_174916	0	0		43281144	-1	no_errors	ENST00000290650	ensembl	human	known	74_37	silent	79	191	18.56	22.98	18	57	SNP	0.999	T
POLR3K	51728	genome.wustl.edu	37	16	97504	97504	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr16:97504G>A	ENST00000293860.5	-	3	294	c.253C>T	c.(253-255)Cgc>Tgc	p.R85C		NM_016310.3	NP_057394.2	Q9Y2Y1	RPC10_HUMAN	polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa	85					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				TCTGCAGAGCGGGTCTGAAGC	0.512																																							0											0													94.0	81.0	85.0					16																	97504		2203	4300	6503	SO:0001583	missense	0			AF051316	CCDS10395.1	16p13.3	2013-01-21	2002-08-29		ENSG00000161980	ENSG00000161980		"""RNA polymerase subunits"""	14121	protein-coding gene	gene with protein product		606007	"""polymerase (RNA) III (DNA directed) polypeptide K (12.3 kDa)"""			9869639, 10079944	Standard	NM_016310		Approved	RPC11	uc002cfi.2	Q9Y2Y1	OTTHUMG00000060722	ENST00000293860.5:c.253C>T	16.37:g.97504G>A	ENSP00000293860:p.Arg85Cys		Q1W6H4|Q96S35	Missense_Mutation	SNP	pfam_Znf_TFIIS,pfam_DNA-dir_RNA_pol_M/15kDasu,smart_DNA-dir_RNA_pol_M/15kDasu,smart_Znf_TFIIS,pfscan_Znf_TFIIS	p.R85C	ENST00000293860.5	37	c.253	CCDS10395.1	16	.	.	.	.	.	.	.	.	.	.	.	19.76	3.886597	0.72410	.	.	ENSG00000161980	ENST00000293860	T	0.61158	0.13	4.59	3.63	0.41609	Zinc finger, TFIIS-type (4);	0.000000	0.85682	D	0.000000	T	0.81969	0.4935	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83306	-0.0025	10	0.87932	D	0	-37.4668	7.2098	0.25927	0.0891:0.0:0.7435:0.1674	.	85	Q9Y2Y1	RPC10_HUMAN	C	85	ENSP00000293860:R85C	ENSP00000293860:R85C	R	-	1	0	POLR3K	37504	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.588000	0.53964	1.085000	0.41206	0.449000	0.29647	CGC	0	pfam_Znf_TFIIS,smart_Znf_TFIIS,pfscan_Znf_TFIIS		0.512	POLR3K-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	POLR3K	protein_coding	OTTHUMT00000134192.1	36	130	0	0.00	0	0	G	NM_016310	0	0		97504	-1	no_errors	ENST00000293860	ensembl	human	known	74_37	missense	40	94	23.08	45.66	12	79	SNP	1	A
ITGAL	3683	genome.wustl.edu	37	16	30531237	30531237	+	Missense_Mutation	SNP	C	C	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr16:30531237C>A	ENST00000356798.6	+	30	3468	c.3288C>A	c.(3286-3288)agC>agA	p.S1096R	ITGAL_ENST00000358164.5_Missense_Mutation_p.S1012R|ITGAL_ENST00000433423.2_Missense_Mutation_p.S330R	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1096					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	ACGTGCTGAGCGGCATCGGGG	0.592																																					NSCLC(110;1462 1641 3311 33990 49495)		0											0													161.0	145.0	150.0					16																	30531237		2197	4300	6497	SO:0001583	missense	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3288C>A	16.37:g.30531237C>A	ENSP00000349252:p.Ser1096Arg		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.S1096R	ENST00000356798.6	37	c.3288	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309636	0.40895	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.58210	0.35;0.35;0.35	5.35	-2.08	0.07254	.	0.000000	0.64402	D	0.000003	T	0.68128	0.2967	M	0.80847	2.515	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.68292	-0.5447	10	0.87932	D	0	.	11.0532	0.47903	0.0:0.3478:0.0:0.6522	.	330;1012;1096	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	R	1096;1012;330	ENSP00000349252:S1096R;ENSP00000350886:S1012R;ENSP00000409377:S330R	ENSP00000349252:S1096R	S	+	3	2	ITGAL	30438738	0.000000	0.05858	0.009000	0.14445	0.482000	0.33219	-1.177000	0.03096	-0.600000	0.05790	-0.448000	0.05591	AGC	0	NULL		0.592	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	protein_coding	OTTHUMT00000434508.2	16	55	0	0.00	0	0	C		0	0		30531237	1	no_errors	ENST00000356798	ensembl	human	known	74_37	missense	12	31	53.85	52.31	14	34	SNP	0.009	A
NF1	4763	genome.wustl.edu	37	17	29685589	29685589	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:29685589G>A	ENST00000358273.4	+	55	8445	c.8062G>A	c.(8062-8064)Gtg>Atg	p.V2688M	NF1_ENST00000356175.3_Missense_Mutation_p.V2667M|NF1_ENST00000417592.2_3'UTR|NF1_ENST00000444181.2_Missense_Mutation_p.V481M	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2688					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGTGCAGAGTGTGGTGTACCA	0.383			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													0	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											136.0	120.0	125.0					17																	29685589		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.8062G>A	17.37:g.29685589G>A	ENSP00000351015:p.Val2688Met		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.V2688M	ENST00000358273.4	37	c.8062	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378540	0.24944	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181	T;T;T;T	0.41065	3.37;3.51;3.21;1.01	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.43166	0.1235	N	0.11154	0.105	0.80722	D	1	P;D;B	0.64830	0.746;0.994;0.184	P;D;B	0.78314	0.464;0.991;0.068	T	0.15780	-1.0425	10	0.02654	T	1	.	19.412	0.94677	0.0:0.0:1.0:0.0	.	481;2667;2688	B4DXH1;P21359-2;P21359	.;.;NF1_HUMAN	M	2688;2667;2333;481	ENSP00000351015:V2688M;ENSP00000348498:V2667M;ENSP00000389907:V2333M;ENSP00000396481:V481M	ENSP00000348498:V2667M	V	+	1	0	NF1	26709715	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.292000	0.96076	2.834000	0.97654	0.650000	0.86243	GTG	0	NULL		0.383	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	46	242	0	0.00	0	0	G	NM_000267	0	0		29685589	1	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	41	222	56.84	59.12	54	321	SNP	1	A
ASIC2	40	genome.wustl.edu	37	17	31618944	31618944	+	Intron	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:31618944C>T	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.A64T	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	TGCAGTTTAGCGCGGCTCAGC	0.766																																							0											0													9.0	11.0	10.0					17																	31618944		2134	4176	6310	SO:0001627	intron_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179859G>A	17.37:g.31618944C>T			E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.A64T	ENST00000359872.6	37	c.190	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	6.551	0.469862	0.12461	.	.	ENSG00000108684	ENST00000225823	T	0.57595	0.39	4.26	3.27	0.37495	.	0.564167	0.16818	N	0.198280	T	0.14013	0.0339	N	0.00317	-1.655	0.80722	D	1	B	0.15719	0.014	B	0.16722	0.016	T	0.25606	-1.0127	10	0.02654	T	1	-0.483	6.1737	0.20431	0.0:0.757:0.0:0.243	.	64	E9PBX2	.	T	64	ENSP00000225823:A64T	ENSP00000225823:A64T	A	-	1	0	ACCN1	28643057	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.032000	0.30178	0.725000	0.32318	0.306000	0.20318	GCT	0	pfam_Na+channel_ASC		0.766	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	protein_coding	OTTHUMT00000447552.1	50	14	0	0.00	0	0	C	NM_183377, NM_001094	0	0		31618944	-1	no_errors	ENST00000225823	ensembl	human	known	74_37	missense	37	6	30.91	25.00	17	2	SNP	1	T
FZD2	2535	genome.wustl.edu	37	17	42636535	42636535	+	Silent	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:42636535G>A	ENST00000315323.3	+	1	1611	c.1479G>A	c.(1477-1479)tcG>tcA	p.S493S		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	493					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GGGAGCGCTCGTGGGTGAGCC	0.627																																							0											0													45.0	40.0	42.0					17																	42636535		2203	4300	6503	SO:0001819	synonymous_variant	0			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1479G>A	17.37:g.42636535G>A			Q0VG82	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S493	ENST00000315323.3	37	c.1479	CCDS11484.1	17																																																																																			0	pfam_Frizzled,pfscan_GPCR_2-like		0.627	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	protein_coding	OTTHUMT00000457806.1	28	25	0	0.00	0	0	G	NM_001466	0	0		42636535	1	no_errors	ENST00000315323	ensembl	human	known	74_37	silent	17	12	29.17	14.29	7	2	SNP	0.922	A
KIAA0195	9772	genome.wustl.edu	37	17	73485730	73485730	+	Missense_Mutation	SNP	T	T	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:73485730T>C	ENST00000314256.7	+	9	1335	c.941T>C	c.(940-942)cTc>cCc	p.L314P	KIAA0195_ENST00000375248.5_Missense_Mutation_p.L324P|KIAA0195_ENST00000583795.1_Intron|KIAA0195_ENST00000579208.1_Intron	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	314						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGTACACCCTCCTCCAGCTC	0.627																																							0											0													93.0	65.0	74.0					17																	73485730		2203	4300	6503	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.941T>C	17.37:g.73485730T>C	ENSP00000313885:p.Leu314Pro		O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.L314P	ENST00000314256.7	37	c.941	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	T	18.44	3.623915	0.66901	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.54279	0.58;0.58	5.11	5.11	0.69529	.	0.065539	0.64402	D	0.000018	T	0.62901	0.2466	L	0.52573	1.65	0.80722	D	1	D;D	0.60575	0.988;0.97	P;P	0.58331	0.837;0.754	T	0.64905	-0.6297	10	0.52906	T	0.07	-23.8555	15.1995	0.73122	0.0:0.0:0.0:1.0	.	324;314	C9JL75;Q12767	.;K0195_HUMAN	P	314;324	ENSP00000313885:L314P;ENSP00000364397:L324P	ENSP00000313885:L314P	L	+	2	0	KIAA0195	70997325	1.000000	0.71417	0.886000	0.34754	0.659000	0.38960	6.099000	0.71466	2.049000	0.60858	0.260000	0.18958	CTC	0	NULL		0.627	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	protein_coding	OTTHUMT00000447303.1	43	121	0	0.00	0	0	T	NM_014738	0	0		73485730	1	no_errors	ENST00000314256	ensembl	human	known	74_37	missense	30	56	23.08	37.78	9	34	SNP	0.811	C
ANKRD30B	374860	genome.wustl.edu	37	18	14791487	14791487	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr18:14791487G>A	ENST00000358984.4	+	16	2002	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.E608K	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	608										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TGGAAAATTAGAAGGTAAGAA	0.323																																							0											0													57.0	45.0	49.0					18																	14791487		692	1582	2274	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1822G>A	18.37:g.14791487G>A	ENSP00000351875:p.Glu608Lys		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E608K	ENST00000358984.4	37	c.1822	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	13.60	2.285579	0.40394	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.09630	2.96;2.96	0.749	0.749	0.18381	.	.	.	.	.	T	0.18173	0.0436	L	0.52126	1.63	0.19300	N	0.999977	D	0.60575	0.988	P	0.62885	0.908	T	0.16305	-1.0407	9	0.30078	T	0.28	.	4.8317	0.13443	0.0:0.0:1.0:0.0	.	608	F8WAG3	.	K	608	ENSP00000351875:E608K;ENSP00000399031:E608K	ENSP00000351875:E608K	E	+	1	0	ANKRD30B	14781487	1.000000	0.71417	0.425000	0.26659	0.115000	0.19883	1.786000	0.38694	0.683000	0.31428	0.289000	0.19496	GAA	0	NULL		0.323	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	protein_coding	OTTHUMT00000443557.1	40	105	0	0.94	0	1	G	NM_001145029	0	0		14791487	1	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	60	96	42.31	45.20	44	80	SNP	0.558	A
KIAA1328	57536	genome.wustl.edu	37	18	34647336	34647336	+	Missense_Mutation	SNP	C	C	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr18:34647336C>A	ENST00000280020.5	+	7	1082	c.1060C>A	c.(1060-1062)Ccc>Acc	p.P354T	KIAA1328_ENST00000586501.1_Missense_Mutation_p.P70T|KIAA1328_ENST00000435985.2_Missense_Mutation_p.P70T|KIAA1328_ENST00000543923.1_Missense_Mutation_p.P246T|KIAA1328_ENST00000586135.1_Missense_Mutation_p.P70T|KIAA1328_ENST00000591619.1_Missense_Mutation_p.P350T	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	354										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		GGCACTGCAACCCATTGAAAC	0.448																																							0											0													65.0	62.0	63.0					18																	34647336		1984	4182	6166	SO:0001583	missense	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.1060C>A	18.37:g.34647336C>A	ENSP00000280020:p.Pro354Thr		Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.P354T	ENST00000280020.5	37	c.1060	CCDS45855.1	18	.	.	.	.	.	.	.	.	.	.	C	8.590	0.884258	0.17467	.	.	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055;ENST00000435985	T;T;T	0.50548	0.74;0.74;0.74	6.03	0.848	0.18966	.	0.603595	0.16687	N	0.203712	T	0.41858	0.1177	L	0.57536	1.79	0.09310	N	1	B;B;P;B	0.45531	0.176;0.328;0.86;0.176	B;B;P;B	0.47075	0.054;0.104;0.536;0.067	T	0.24440	-1.0160	10	0.31617	T	0.26	.	1.8471	0.03161	0.2147:0.4407:0.1048:0.2399	.	70;354;70;354	Q86T90-4;A8K8C3;Q86T90-3;Q86T90	.;.;.;K1328_HUMAN	T	246;354;354;70	ENSP00000441359:P246T;ENSP00000280020:P354T;ENSP00000390515:P70T	ENSP00000280020:P354T	P	+	1	0	KIAA1328	32901334	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.275000	0.18698	-0.132000	0.11557	0.655000	0.94253	CCC	0	NULL		0.448	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	protein_coding	OTTHUMT00000440455.1	36	150	0	0.66	0	1	C	NM_020776	0	0		34647336	1	no_errors	ENST00000280020	ensembl	human	known	74_37	missense	32	123	15.79	29.71	6	52	SNP	0	A
FBXO15	201456	genome.wustl.edu	37	18	71740898	71740898	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr18:71740898G>A	ENST00000419743.2	-	10	1410	c.1331C>T	c.(1330-1332)cCg>cTg	p.P444L	FBXO15_ENST00000269500.5_Missense_Mutation_p.P368L|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	444						SCF ubiquitin ligase complex (GO:0019005)		p.P368L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		CAGGCACACCGGGGAACTGAA	0.478																																							0											1	Substitution - Missense(1)	large_intestine(1)											183.0	172.0	175.0					18																	71740898		2203	4300	6503	SO:0001583	missense	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1331C>T	18.37:g.71740898G>A	ENSP00000393154:p.Pro444Leu		B3KST3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.P444L	ENST00000419743.2	37	c.1331	CCDS45884.1	18	.	.	.	.	.	.	.	.	.	.	g	24.2	4.509540	0.85282	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.42131	0.98;0.98	5.9	5.9	0.94986	.	0.049509	0.85682	D	0.000000	T	0.64338	0.2589	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.58172	0.834;0.834	T	0.66909	-0.5804	10	0.87932	D	0	-11.1147	20.2814	0.98513	0.0:0.0:1.0:0.0	.	444;368	B3KST3;Q8NCQ5	.;FBX15_HUMAN	L	368;444	ENSP00000269500:P368L;ENSP00000393154:P444L	ENSP00000269500:P368L	P	-	2	0	FBXO15	69891878	1.000000	0.71417	0.958000	0.39756	0.650000	0.38633	7.058000	0.76676	2.809000	0.96659	0.651000	0.88453	CCG	0	NULL		0.478	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	protein_coding	OTTHUMT00000444223.1	33	177	0	0.00	0	0	G	NM_152676	0	0		71740898	-1	no_errors	ENST00000419743	ensembl	human	known	74_37	missense	27	149	30.77	24.62	12	49	SNP	0.996	A
CTB-133G6.1	0	genome.wustl.edu	37	19	7440748	7440748	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:7440748C>T	ENST00000576789.1	+	4	827	c.418C>T	c.(418-420)Cca>Tca	p.P140S																								CGCAGAGAGCCCAGGCAAGGT	0.592																																							0											0																																										SO:0001583	missense	0																														ENST00000576789.1:c.418C>T	19.37:g.7440748C>T	ENSP00000458866:p.Pro140Ser			Missense_Mutation	SNP	NULL	p.P140S	ENST00000576789.1	37	c.418		19																																																																																			0	NULL		0.592	CTB-133G6.1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	ENSG00000263264	protein_coding	OTTHUMT00000436334.1	21	156	0	0.64	0	1	C		0	0		7440748	1	no_errors	ENST00000576789	ensembl	human	novel	74_37	missense	10	98	37.5	24.03	6	31	SNP	0	T
BCKDHA	593	genome.wustl.edu	37	19	41931576	41931576	+	IGR	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:41931576G>A	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000321702.2_Missense_Mutation_p.R370C|B3GNT8_ENST00000601379.1_5'Flank|CTC-435M10.6_ENST00000598887.1_RNA	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						AGCAGGTTGCGGAAAGCACAG	0.657																																							0											0													36.0	39.0	38.0					19																	41931576		2203	4300	6503	SO:0001628	intergenic_variant	0			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41931576G>A			B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.R370C	ENST00000269980.2	37	c.1108	CCDS12581.1	19	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268943	0.23221	.	.	ENSG00000177191	ENST00000321702	T	0.38560	1.13	3.81	2.75	0.32379	.	0.403761	0.23250	N	0.050257	T	0.50820	0.1638	M	0.82323	2.585	0.09310	N	0.999998	D	0.61697	0.99	P	0.47744	0.556	T	0.51284	-0.8725	10	0.87932	D	0	.	10.5206	0.44916	0.0:0.0:0.6523:0.3477	.	370	Q7Z7M8	B3GN8_HUMAN	C	370	ENSP00000312700:R370C	ENSP00000312700:R370C	R	-	1	0	B3GNT8	46623416	0.985000	0.35326	0.004000	0.12327	0.223000	0.24884	3.706000	0.54830	0.935000	0.37341	0.655000	0.94253	CGC	0	NULL		0.657	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT8	protein_coding	OTTHUMT00000398313.3	61	54	0	0.00	0	0	G	NM_000709	0	0		41931576	-1	no_errors	ENST00000321702	ensembl	human	known	74_37	missense	23	45	8	29.69	2	19	SNP	0.011	A
PLA2G4C	8605	genome.wustl.edu	37	19	48593629	48593629	+	Missense_Mutation	SNP	T	T	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:48593629T>C	ENST00000599921.1	-	8	1112	c.755A>G	c.(754-756)tAc>tGc	p.Y252C	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.Y252C|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.Y252C|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.Y262C			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	252	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		ACCAAAAATGTATTCCCTAAT	0.398																																							0											0													153.0	144.0	147.0					19																	48593629		2203	4300	6503	SO:0001583	missense	0			AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.755A>G	19.37:g.48593629T>C	ENSP00000469473:p.Tyr252Cys		B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	p.Y262C	ENST00000599921.1	37	c.785	CCDS12710.1	19	.	.	.	.	.	.	.	.	.	.	T	2.300	-0.360386	0.05103	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.04454	3.62;3.62	2.51	-5.01	0.02991	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	2.309290	0.02486	N	0.089026	T	0.04634	0.0126	L	0.40543	1.245	0.09310	N	1	B;B	0.18013	0.025;0.01	B;B	0.13407	0.009;0.003	T	0.33954	-0.9848	10	0.39692	T	0.17	-0.5531	4.318	0.11002	0.6257:0.1334:0.0:0.2409	.	262;252	B4DI40;Q9UP65	.;PA24C_HUMAN	C	252	ENSP00000346228:Y252C;ENSP00000400036:Y252C	ENSP00000346228:Y252C	Y	-	2	0	PLA2G4C	53285441	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.055000	0.03493	-1.912000	0.01081	0.164000	0.16699	TAC	0	superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom		0.398	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4C	protein_coding	OTTHUMT00000465551.1	83	221	0	0.00	0	0	T		0	0		48593629	-1	no_errors	ENST00000599111	ensembl	human	known	74_37	missense	107	170	21.32	20.93	29	45	SNP	0	C
KCNA7	3743	genome.wustl.edu	37	19	49573389	49573389	+	Silent	SNP	G	G	A	rs145070146		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:49573389G>A	ENST00000221444.1	-	2	1657	c.1302C>T	c.(1300-1302)gaC>gaT	p.D434D		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	434					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GTACCTCCCCGTCCACCAGCC	0.622																																					Colon(74;686 1235 3793 23366 48562)		0											0								G		0,4406		0,0,2203	75.0	71.0	72.0		1302	-0.8	0.0	19	dbSNP_134	72	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KCNA7	NM_031886.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		434/457	49573389	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.1302C>T	19.37:g.49573389G>A			A1KYX7|Q9BYS4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.D434	ENST00000221444.1	37	c.1302	CCDS12755.1	19																																																																																			0	NULL		0.622	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	protein_coding	OTTHUMT00000466263.1	74	214	0	0.00	0	0	G	NM_031886	rs145070146	G->A		49573389	-1	no_errors	ENST00000221444	ensembl	human	known	74_37	silent	43	109	18.87	20.29	10	28	SNP	0.041	A
ZNF432	9668	genome.wustl.edu	37	19	52537807	52537807	+	Silent	SNP	G	G	A			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:52537807G>A	ENST00000594154.1	-	5	1337	c.1125C>T	c.(1123-1125)tgC>tgT	p.C375C	ZNF432_ENST00000221315.5_Silent_p.C375C			O94892	ZN432_HUMAN	zinc finger protein 432	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CACATTCATTGCATATATATG	0.413																																							0											0													118.0	115.0	116.0					19																	52537807		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.1125C>T	19.37:g.52537807G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C375	ENST00000594154.1	37	c.1125	CCDS12848.1	19																																																																																			0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF432	protein_coding	OTTHUMT00000462410.1	47	136	0	0.00	0	0	G	NM_014650	0	0		52537807	-1	no_errors	ENST00000221315	ensembl	human	known	74_37	silent	32	89	49.21	50.28	31	90	SNP	0.798	A
RBCK1	10616	genome.wustl.edu	37	20	391181	391181	+	Intron	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr20:391181C>T	ENST00000356286.5	+	2	872				RBCK1_ENST00000382181.2_Intron|RBCK1_ENST00000400247.3_Missense_Mutation_p.P56L|RBCK1_ENST00000400245.3_3'UTR|RBCK1_ENST00000475269.1_Missense_Mutation_p.P98L|RBCK1_ENST00000353660.3_Intron	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1						negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				acacttcttccgttaattcct	0.473																																							0											0													74.0	69.0	70.0					20																	391181		876	1991	2867	SO:0001627	intron_variant	0			U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.167+512C>T	20.37:g.391181C>T			O95623|Q86SL2|Q96BS3|Q9BYM9	Missense_Mutation	SNP	NULL	p.P98L	ENST00000356286.5	37	c.293	CCDS13000.2	20	.	.	.	.	.	.	.	.	.	.	C	2.703	-0.270607	0.05716	.	.	ENSG00000125826	ENST00000475269;ENST00000400247	.	.	.	1.45	0.486	0.16836	.	.	.	.	.	T	0.35828	0.0945	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36504	-0.9745	5	0.87932	D	0	.	3.6507	0.08202	0.0:0.751:0.0:0.249	.	.	.	.	L	98;56	.	ENSP00000383106:P56L	P	+	2	0	RBCK1	339181	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	0.200000	0.17257	0.186000	0.20125	0.561000	0.74099	CCG	0	NULL		0.473	RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	RBCK1	protein_coding	OTTHUMT00000077461.3	38	262	0	0.00	0	0	C	NM_031229	0	0		391181	1	no_errors	ENST00000475269	ensembl	human	putative	74_37	missense	55	380	12.7	15.33	8	69	SNP	0	T
CDC25B	994	genome.wustl.edu	37	20	3783595	3783595	+	Silent	SNP	C	C	T			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr20:3783595C>T	ENST00000245960.5	+	12	1930	c.1233C>T	c.(1231-1233)gaC>gaT	p.D411D	CDC25B_ENST00000439880.2_Silent_p.D397D|CDC25B_ENST00000379598.5_Silent_p.D320D|CDC25B_ENST00000340833.4_Silent_p.D370D|CDC25B_ENST00000344256.6_Silent_p.D347D|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	411					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						AGCACCAAGACCTCAAGTACA	0.507																																							0											0													149.0	105.0	120.0					20																	3783595		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1233C>T	20.37:g.3783595C>T			D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Silent	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.D411	ENST00000245960.5	37	c.1233	CCDS13067.1	20																																																																																			0	superfamily_Rhodanese-like_dom,prints_MPI_Phosphatase		0.507	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	protein_coding	OTTHUMT00000077779.2	41	252	0	0.00	0	0	C	NM_021874	0	0		3783595	1	no_errors	ENST00000245960	ensembl	human	known	74_37	silent	58	261	28.4	33.42	23	131	SNP	1	T
AC011718.2	0	genome.wustl.edu	37	22	20640787	20640787	+	lincRNA	SNP	T	T	A	rs563451620		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr22:20640787T>A	ENST00000577456.1	-	0	773																											CTGGGCGGCGTCCTCGTTGGC	0.706																																							0											0																																												0																															22.37:g.20640787T>A				RNA	SNP	0	NULL	ENST00000577456.1	37	NULL		22																																																																																			0	0		0.706	AC011718.2-004	KNOWN	basic	lincRNA	ENSG00000223579	lincRNA	OTTHUMT00000444810.1	85	9	0	0.00	0	0	T		rs563451620	T->A		20640787	-1	no_errors	ENST00000577456	ensembl	human	known	74_37	rna	111	17	7.5	10.53	9	2	SNP	0.155	A
FAM230A	653203	genome.wustl.edu	37	22	20708697	20708697	+	Silent	SNP	C	C	T	rs566822381	byFrequency	TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr22:20708697C>T	ENST00000434783.3	+	8	613	c.429C>T	c.(427-429)gaC>gaT	p.D143D	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		CTACTGAGGACGCCATATATG	0.547													t|||	2	0.000399361	0.0	0.0	5008	,	,		23111	0.002		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0																																										SO:0001819	synonymous_variant	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.429C>T	22.37:g.20708697C>T				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.D143	ENST00000434783.3	37	c.429		22																																																																																			0	superfamily_Kinase-like_dom		0.547	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	45	26	2.17	0.00	1	0	C		rs566822381	C->T		20708697	1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	41	10	50	54.55	41	12	SNP	0.162	T
SOX4	6659	genome.wustl.edu	37	6	21595973	21595974	+	Frame_Shift_Ins	INS	-	-	CGAC			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	-	-	-	CGAC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr6:21595973_21595974insCGAC	ENST00000244745.1	+	1	2002_2003	c.1208_1209insCGAC	c.(1207-1212)gacgacfs	p.-404fs	SOX4_ENST00000543472.1_Frame_Shift_Ins_p.-404fs	NM_003107.2	NP_003098.1	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4						ascending aorta morphogenesis (GO:0035910)|atrial septum primum morphogenesis (GO:0003289)|canonical Wnt signaling pathway (GO:0060070)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle formation (GO:0003211)|cellular response to glucose stimulus (GO:0071333)|DNA damage response, detection of DNA damage (GO:0042769)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endocrine pancreas development (GO:0031018)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|kidney morphogenesis (GO:0060993)|limb bud formation (GO:0060174)|mitral valve morphogenesis (GO:0003183)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|noradrenergic neuron differentiation (GO:0003357)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin secretion (GO:0032024)|positive regulation of N-terminal peptidyl-lysine acetylation (GO:2000761)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of Wnt signaling pathway (GO:0030177)|pro-B cell differentiation (GO:0002328)|protein stabilization (GO:0050821)|regulation of protein stability (GO:0031647)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spinal cord development (GO:0021510)|spinal cord motor neuron differentiation (GO:0021522)|sympathetic nervous system development (GO:0048485)|T cell differentiation (GO:0030217)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			kidney(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	6	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GAGTTCGAAGACGACCTGCTCG	0.644																																							0											0																																										SO:0001589	frameshift_variant	0			AF070669	CCDS4547.1	6p22.3	2008-02-05			ENSG00000124766	ENSG00000124766		"""SRY (sex determining region Y)-boxes"""	11200	protein-coding gene	gene with protein product		184430				8268656, 9730625	Standard	NM_003107		Approved		uc003ndi.3	Q06945	OTTHUMG00000016101	ENST00000244745.1:c.1209_1212dupCGAC	6.37:g.21595974_21595977dupCGAC	ENSP00000244745:p.Asp404fs			Frame_Shift_Ins	INS	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.L405fs	ENST00000244745.1	37	c.1208_1209	CCDS4547.1	6																																																																																			0	pirsf_SOX-12/11/4a		0.644	SOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX4	protein_coding	OTTHUMT00000043301.1	70	90	0	0.00	0	0	0	NM_003107	0	0		21595974	1	no_errors	ENST00000244745	ensembl	human	known	74_37	frame_shift_ins	6	29	76	54.69	19	35	INS	1.000:1.000	CGAC
PHF10	55274	genome.wustl.edu	37	6	170121100	170121100	+	Splice_Site	DEL	C	C	-			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr6:170121100delC	ENST00000339209.4	-	2	318		c.e2+1		PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Splice_Site	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10						nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		AATGACAGTACCCAAGATCTT	0.403																																							0											0													126.0	111.0	115.0					6																	170121100		692	1591	2283	SO:0001630	splice_region_variant	0			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.194+1G>-	6.37:g.170121100delC			Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Splice_Site	DEL	0	e2+1	ENST00000339209.4	37	c.194+1	CCDS5308.2	6																																																																																			0	0		0.403	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF10	protein_coding	OTTHUMT00000346732.1	36	213	0	0.00	0	0	C	NM_018288	0	0	Intron	170121100	-1	no_errors	ENST00000339209	ensembl	human	known	74_37	splice_site_del	17	82	61.36	66.67	27	164	DEL	1	0
SCRN2	90507	genome.wustl.edu	37	17	45918216	45918234	+	Intron	DEL	AGAGGCGGGCCTCTCCATA	AGAGGCGGGCCTCTCCATA	-			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	AGAGGCGGGCCTCTCCATA	AGAGGCGGGCCTCTCCATA	AGAGGCGGGCCTCTCCATA	-	AGAGGCGGGCCTCTCCATA	AGAGGCGGGCCTCTCCATA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:45918216_45918234delAGAGGCGGGCCTCTCCATA	ENST00000290216.9	-	2	126				SCRN2_ENST00000584123.1_Start_Codon_Del|SCRN2_ENST00000407215.3_Intron	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2							extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CCATCTGGGGAGAGGCGGGCCTCTCCATAACCCTGGCCA	0.658											OREG0024502	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											0											0																																										SO:0001627	intron_variant	0			BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1-7TATGGAGAGGCCCGCCTCT>-	17.37:g.45918216_45918234delAGAGGCGGGCCTCTCCATA		935	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	In_Frame_Del	DEL	pfam_Peptidase_C69,pfam_Pept_C45_AAT	p.MERPAS1in_frame_del	ENST00000290216.9	37	c.18_1	CCDS11519.1	17																																																																																			0	NULL		0.658	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN2	protein_coding	OTTHUMT00000441383.1	79	78	0	0.00	0	0	AGAGGCGGGCCTCTCCATA	NM_138355	0	0		45918234	-1	no_errors	ENST00000584123	ensembl	human	putative	74_37	in_frame_del	45	51	19.64	10.53	11	6	DEL	0.103:0.105:0.107:0.060:0.011:0.000:0.001:0.012:0.000:0.271:0.299:0.217:0.147:0.050:0.002:0.004:0.001:0.001	0
GLTSCR1	29998	genome.wustl.edu	37	19	48197890	48197891	+	Frame_Shift_Ins	INS	-	-	C			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:48197890_48197891insC	ENST00000396720.3	+	8	2996_2997	c.2802_2803insC	c.(2803-2805)cccfs	p.P935fs	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	935	Poly-Pro.									breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		AGCCGGCAGCACCCCCCCCACC	0.673																																							0											0																																										SO:0001589	frameshift_variant	0			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2810dupC	19.37:g.48197898_48197898dupC	ENSP00000379946:p.Pro935fs		A8MW01	Frame_Shift_Ins	INS	NULL	p.P937fs	ENST00000396720.3	37	c.2802_2803	CCDS46134.1	19																																																																																			0	NULL		0.673	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1	protein_coding	OTTHUMT00000465846.1	28	95	0	1.04	0	1	0	NM_015711	0	0		48197891	1	no_errors	ENST00000396720	ensembl	human	known	74_37	frame_shift_ins	18	82	18.18	9.89	4	9	INS	0.044:0.226	C
DNM1P47	100216544	genome.wustl.edu	37	15	102303979	102303979	+	RNA	SNP	C	C	G			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr15:102303979C>G	ENST00000561463.1	+	0	12025									DNM1 pseudogene 47																		GTCGGCCGAGCAGGCACAGCG	0.592																																							0											0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102303979C>G				RNA	SNP	0	NULL	ENST00000561463.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	0.087	-1.173125	0.01646	.	.	ENSG00000223778	ENST00000455423	.	.	.	1.39	1.39	0.22231	.	.	.	.	.	T	0.54398	0.1856	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65594	-0.6130	4	0.62326	D	0.03	.	8.847	0.35177	0.0:1.0:0.0:0.0	.	.	.	.	G	29	.	ENSP00000387556:A29G	A	+	2	0	AC107977.1	100121502	1.000000	0.71417	0.994000	0.49952	0.026000	0.11368	4.908000	0.63307	1.113000	0.41760	0.064000	0.15345	GCA	0	0		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	12	1	0	0.00	0	0	C	NG_009149	0	0		102303979	1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	10	0	47.37	0.00	9	0	SNP	1	G
RPS2	6187	genome.wustl.edu	37	16	2012130	2012130	+	Missense_Mutation	SNP	C	C	T	rs367578393		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr16:2012130C>T	ENST00000343262.4	-	7	907	c.851G>A	c.(850-852)cGg>cAg	p.R284Q	SNORA10_ENST00000384084.1_RNA|RPS2_ENST00000529806.1_3'UTR|SNORA64_ENST00000384674.1_RNA|RPS2_ENST00000526522.1_Missense_Mutation_p.R226Q|RPS2_ENST00000530225.1_3'UTR	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	284					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						AGCCTGAGTCCGCTGCACGGA	0.488																																							0											0								C	GLN/ARG	0,4384		0,0,2192	24.0	28.0	27.0		851	5.1	1.0	16		27	1,8575		0,1,4287	no	missense	RPS2	NM_002952.3	43	0,1,6479	TT,TC,CC		0.0117,0.0,0.0077	benign	284/294	2012130	1,12959	2192	4288	6480	SO:0001583	missense	0			AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.851G>A	16.37:g.2012130C>T	ENSP00000341885:p.Arg284Gln		B2R5G0|D3DU82|Q3MIB1	Missense_Mutation	SNP	pfam_Ribosomal_S5_N,pfam_Ribosomal_S5_C,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N,tigrfam_Ribosomal_S5_euk/arc	p.R284Q	ENST00000343262.4	37	c.851	CCDS10452.1	16	.	.	.	.	.	.	.	.	.	.	c	21.2	4.116920	0.77323	0.0	1.17E-4	ENSG00000140988	ENST00000526522;ENST00000533186;ENST00000343262	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	U	0.000000	T	0.62780	0.2456	M	0.80746	2.51	0.80722	D	1	B;B	0.33379	0.41;0.107	B;B	0.17098	0.017;0.014	T	0.67241	-0.5720	9	0.46703	T	0.11	.	17.626	0.88095	0.0:1.0:0.0:0.0	.	284;226	P15880;E9PQD7	RS2_HUMAN;.	Q	226;186;284	.	ENSP00000341885:R284Q	R	-	2	0	RPS2	1952131	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.394000	0.79862	2.397000	0.81536	0.603000	0.83216	CGG	0	NULL		0.488	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS2	protein_coding	OTTHUMT00000250613.2	120	0	0	0.00	0	0	C	NM_002952	rs367578393	C->T		2012130	-1	no_errors	ENST00000343262	ensembl	human	known	74_37	missense	129	0	20.86	0.00	34	0	SNP	1	T
ZNF208	7757	genome.wustl.edu	37	19	22154452	22154452	+	Silent	SNP	A	A	G			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:22154452A>G	ENST00000397126.4	-	4	3532	c.3384T>C	c.(3382-3384)ctT>ctC	p.L1128L	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L1000L(2)|p.L1128L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGTTTAGTAAGGATTGAGA	0.373																																							0											3	Substitution - coding silent(3)	lung(3)											57.0	61.0	60.0					19																	22154452		2123	4245	6368	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3384T>C	19.37:g.22154452A>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L1128	ENST00000397126.4	37	c.3384	CCDS54240.1	19																																																																																			0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	21	2	0	0.00	0	0	A	NM_007153	0	0		22154452	-1	no_errors	ENST00000397126	ensembl	human	novel	74_37	silent	35	2	7.89	0.00	3	0	SNP	0	G
ZNF208	7757	genome.wustl.edu	37	19	22156863	22156863	+	Missense_Mutation	SNP	C	C	A	rs202200782		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr19:22156863C>A	ENST00000397126.4	-	4	1121	c.973G>T	c.(973-975)Gtc>Ttc	p.V325F	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V325F(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGGGTTGAGACCTTACTGAAG	0.403																																							0											1	Substitution - Missense(1)	NS(1)											66.0	68.0	67.0					19																	22156863		1946	3920	5866	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.973G>T	19.37:g.22156863C>A	ENSP00000380315:p.Val325Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V325F	ENST00000397126.4	37	c.973	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	0.040	-1.286883	0.01387	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.38560	1.13	2.93	-5.86	0.02304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21962	0.0529	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10428	-1.0630	8	0.39692	T	0.17	.	0.9385	0.01350	0.2555:0.1041:0.2969:0.3435	.	325	O43345	ZN208_HUMAN	F	325	ENSP00000380315:V325F	ENSP00000380315:V325F	V	-	1	0	ZNF208	21948703	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.688000	0.00392	-2.968000	0.00287	-2.283000	0.00269	GTC	0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	22	22	0	0.00	0	0	C	NM_007153	rs202200782	C->A		22156863	-1	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	22	5	31.25	0.00	10	0	SNP	0	A
GGT1	2678	genome.wustl.edu	37	22	25023394	25023394	+	Intron	SNP	G	G	A	rs200388418		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr22:25023394G>A	ENST00000400382.1	+	12	1775				GGT1_ENST00000403838.1_5'UTR|GGT1_ENST00000406383.2_Intron|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000400380.1_Intron|GGT1_ENST00000404920.1_5'Flank|GGT1_ENST00000400383.1_Intron|GGT1_ENST00000401885.1_5'UTR|GGT1_ENST00000248923.4_Intron|GGT1_ENST00000404532.1_Intron|GGT1_ENST00000404223.1_5'UTR			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1						arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	CTGGGGTCTCGGCAGGTGGTC	0.647																																							0											0																																										SO:0001627	intron_variant	0			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1021-5G>A	22.37:g.25023394G>A			Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.S346	ENST00000400382.1	37	c.1038	CCDS42992.1	22																																																																																			0	NULL		0.647	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GGT1	protein_coding	OTTHUMT00000250797.1	58	0	1.69	0.00	1	0	G	NM_013430	rs200388418	G->A		25023394	1	no_errors	ENST00000425895	ensembl	human	known	74_37	silent	48	0	15.79	0.00	9	0	SNP	0.722	A
WNT7B	7477	genome.wustl.edu	37	22	46318762	46318762	+	Missense_Mutation	SNP	G	G	A	rs567863801		TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr22:46318762G>A	ENST00000339464.4	-	4	1398	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	WNT7B_ENST00000410089.1_Missense_Mutation_p.R326C|WNT7B_ENST00000409496.3_Missense_Mutation_p.R346C	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	342					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		ACCTCGGTGCGCTCGCTGCAG	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		13724	0.0		0.0	False		,,,				2504	0.001						0.9998,0.0001997											0													81.0	65.0	70.0					22																	46318762		2203	4300	6503	SO:0001583	missense	0			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.1024C>T	22.37:g.46318762G>A	ENSP00000341032:p.Arg342Cys		B8A596|Q96Q12	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.R342C	ENST00000339464.4	37	c.1024	CCDS33667.1	22	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308202	0.60305	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	T;T;T	0.77098	-1.07;-1.07;-1.07	4.36	1.96	0.26148	.	0.000000	0.85682	U	0.000000	D	0.87354	0.6156	M	0.90082	3.085	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.65987	0.94;0.94	D	0.88063	0.2795	10	0.48119	T	0.1	.	11.2686	0.49124	0.0:0.0:0.6123:0.3877	.	346;342	A8K0G1;P56706	.;WNT7B_HUMAN	C	342;326;346	ENSP00000341032:R342C;ENSP00000386781:R326C;ENSP00000386546:R346C	ENSP00000341032:R342C	R	-	1	0	WNT7B	44697426	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.628000	0.54259	1.974000	0.57490	0.655000	0.94253	CGC	0	pfam_Wnt,smart_Wnt		0.632	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	protein_coding	OTTHUMT00000336418.1	45	29	0	0.00	0	0	G	NM_058238	rs567863801	G->A		46318762	-1	no_errors	ENST00000339464	ensembl	human	known	74_37	missense	43	10	8.33	0.00	4	0	SNP	1	A
UTS2R	2837	genome.wustl.edu	37	17	80332689	80332689	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5U-AB0D-01A-11D-A423-09	TCGA-5U-AB0D-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	65797cd5-d594-4b25-ba60-bf64c52bffbe	bd0b90dc-78fd-4951-8c1f-ac242acf62d3	g.chr17:80332689delG	ENST00000313135.2	+	1	537	c.489delG	c.(487-489)aagfs	p.K163fs		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	163					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			AGCGCCCCAAGGGCTACCGCA	0.692																																							0											0													9.0	9.0	9.0					17																	80332689		2179	4256	6435	SO:0001589	frameshift_variant	0			AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.489delG	17.37:g.80332689delG	ENSP00000323516:p.Lys163fs		B2RMV8	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Urot_II_rcpt,prints_GPCR_Rhodpsn	p.G164fs	ENST00000313135.2	37	c.489	CCDS11810.1	17																																																																																			0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Urot_II_rcpt		0.692	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTS2R	protein_coding	OTTHUMT00000443506.1	9	15	0	0.00	0	0	G	NM_018949	0	0		80332689	1	no_errors	ENST00000313135	ensembl	human	known	74_37	frame_shift_del	4	8	33.33	0.00	2	0	DEL	1	0
