#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
CERKL	375298	genome.wustl.edu	37	2	182413585	182413585	+	Splice_Site	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr2:182413585C>T	ENST00000339098.5	-	8	973		c.e8-1		CERKL_ENST00000410087.3_Splice_Site|CERKL_ENST00000374970.2_Splice_Site|CERKL_ENST00000374969.2_Splice_Site|CERKL_ENST00000479558.1_Splice_Site|CERKL_ENST00000409440.3_Splice_Site			Q49MI3	CERKL_HUMAN	ceramide kinase-like						negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTACATGCCCTTGAATATTA	0.418																																							0											0													47.0	51.0	50.0					2																	182413585		2203	4300	6503	SO:0001630	splice_region_variant	0			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.974-1G>A	2.37:g.182413585C>T			B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Splice_Site	SNP	0	e8-1	ENST00000339098.5	37	c.974-1	CCDS42789.1	2	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218457	0.58560	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4529	0.94875	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CERKL	182121830	1.000000	0.71417	0.996000	0.52242	0.309000	0.27889	7.629000	0.83207	2.595000	0.87683	0.655000	0.94253	.	0	0		0.418	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	protein_coding	OTTHUMT00000334811.1	55	224	0	0.44	0	1	C		0	0	Intron	182413585	-1	no_errors	ENST00000339098	ensembl	human	known	74_37	splice_site	24	139	17.24	11.46	5	18	SNP	1	T
ANKMY1	51281	genome.wustl.edu	37	2	241463443	241463443	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr2:241463443C>T	ENST00000272972.3	-	7	1638	c.1424G>A	c.(1423-1425)tGc>tAc	p.C475Y	ANKMY1_ENST00000405523.3_Missense_Mutation_p.C334Y|ANKMY1_ENST00000405002.1_Missense_Mutation_p.C245Y|ANKMY1_ENST00000361678.4_Missense_Mutation_p.C334Y|ANKMY1_ENST00000373318.2_Missense_Mutation_p.C334Y|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000403283.1_Missense_Mutation_p.C413Y|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000536462.1_Missense_Mutation_p.C287Y|ANKMY1_ENST00000401804.1_Missense_Mutation_p.C564Y|ANKMY1_ENST00000391987.1_Missense_Mutation_p.C475Y|ANKMY1_ENST00000373320.4_Missense_Mutation_p.C245Y	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	475							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGAGAAGTCGCACACACACAC	0.592																																							0											0													136.0	119.0	125.0					2																	241463443		2203	4300	6503	SO:0001583	missense	0			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1424G>A	2.37:g.241463443C>T	ENSP00000272972:p.Cys475Tyr		B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.C475Y	ENST00000272972.3	37	c.1424	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.471892	0.01044	.	.	ENSG00000144504	ENST00000373318;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T	0.54866	2.98;0.57;2.31;0.57;4.45;2.54;0.55;2.3;2.29;2.55	4.06	-6.9	0.01655	Ankyrin repeat-containing domain (1);	2.406280	0.01487	N	0.016917	T	0.29158	0.0725	L	0.27053	0.805	0.09310	N	1	B;B;B;B;P;B	0.38020	0.005;0.035;0.063;0.021;0.615;0.005	B;B;B;B;B;B	0.34038	0.003;0.006;0.014;0.005;0.174;0.003	T	0.37842	-0.9688	10	0.02654	T	1	-33.9051	6.9227	0.24397	0.1167:0.3437:0.0:0.5396	.	475;287;245;334;334;475	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;Q9P2S6-2;Q9P2S6	.;.;.;.;.;ANKY1_HUMAN	Y	334;475;334;475;245;413;564;287;334;245	ENSP00000362415:C334Y;ENSP00000272972:C475Y;ENSP00000355097:C334Y;ENSP00000375847:C475Y;ENSP00000362417:C245Y;ENSP00000383968:C413Y;ENSP00000385887:C564Y;ENSP00000444707:C287Y;ENSP00000385635:C334Y;ENSP00000385145:C245Y	ENSP00000272972:C475Y	C	-	2	0	ANKMY1	241112116	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.156000	0.01283	-1.770000	0.01295	0.491000	0.48974	TGC	0	superfamily_Ankyrin_rpt-contain_dom		0.592	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	protein_coding	OTTHUMT00000257187.2	53	133	0	0.00	0	0	C	NM_017844	0	0		241463443	-1	no_errors	ENST00000272972	ensembl	human	known	74_37	missense	26	74	15.15	17.78	5	16	SNP	0	T
NR1I2	8856	genome.wustl.edu	37	3	119534575	119534575	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr3:119534575C>T	ENST00000337940.4	+	8	1222	c.1174C>T	c.(1174-1176)Cgc>Tgc	p.R392C	NR1I2_ENST00000393716.2_Missense_Mutation_p.R353C|NR1I2_ENST00000466380.1_Missense_Mutation_p.R316C	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	353	Ligand-binding.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	CCCTCCAGACCGCCCAGGTGT	0.602																																							0											0													40.0	33.0	35.0					3																	119534575		2203	4300	6503	SO:0001583	missense	0			AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.1174C>T	3.37:g.119534575C>T	ENSP00000336528:p.Arg392Cys		Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.R392C	ENST00000337940.4	37	c.1174	CCDS2995.1	3	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845477	0.71603	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.96940	-4.18;-4.18;-4.18	5.04	4.14	0.48551	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	M	0.90252	3.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	D	0.98956	1.0796	10	0.87932	D	0	.	13.0135	0.58743	0.0:0.8366:0.1634:0.0	.	353;392;339	O75469;F1D8P9;O75469-6	NR1I2_HUMAN;.;.	C	353;316;392	ENSP00000377319:R353C;ENSP00000420297:R316C;ENSP00000336528:R392C	ENSP00000336528:R392C	R	+	1	0	NR1I2	121017265	1.000000	0.71417	0.990000	0.47175	0.725000	0.41563	4.115000	0.57865	1.299000	0.44798	0.561000	0.74099	CGC	0	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.602	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1I2	protein_coding	OTTHUMT00000355126.1	30	176	0	0.00	0	0	C		0	0		119534575	1	no_errors	ENST00000337940	ensembl	human	known	74_37	missense	9	111	25	13.95	3	18	SNP	1	T
COL6A5	256076	genome.wustl.edu	37	3	130113830	130113830	+	Missense_Mutation	SNP	C	C	G			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr3:130113830C>G	ENST00000432398.2	+	8	3584	c.3090C>G	c.(3088-3090)gaC>gaG	p.D1030E	COL6A5_ENST00000265379.6_Missense_Mutation_p.D1030E	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1030	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TCTTGTCAGACTTAATCGATA	0.373																																							0											0													93.0	80.0	84.0					3																	130113830		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3090C>G	3.37:g.130113830C>G	ENSP00000390895:p.Asp1030Glu		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D1030E	ENST00000432398.2	37	c.3090		3	.	.	.	.	.	.	.	.	.	.	C	11.23	1.578333	0.28180	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82803	-1.65;-1.65	5.63	1.54	0.23209	.	.	.	.	.	T	0.69223	0.3087	L	0.43152	1.355	0.21147	N	0.999776	B	0.14012	0.009	B	0.21708	0.036	T	0.52689	-0.8542	9	0.02654	T	1	.	3.2248	0.06728	0.3187:0.4263:0.0:0.255	.	1030	A8TX70-2	.	E	1030	ENSP00000390895:D1030E;ENSP00000265379:D1030E	ENSP00000265379:D1030E	D	+	3	2	COL6A5	131596520	0.000000	0.05858	0.998000	0.56505	0.992000	0.81027	-1.254000	0.02874	0.302000	0.22762	0.491000	0.48974	GAC	0	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.373	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	protein_coding		70	380	0	0.00	0	0	C	NM_153264	0	0		130113830	1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	47	204	9.62	11.30	5	26	SNP	0.868	G
GAK	2580	genome.wustl.edu	37	4	870324	870324	+	Missense_Mutation	SNP	A	A	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr4:870324A>T	ENST00000314167.4	-	18	2158	c.2048T>A	c.(2047-2049)tTt>tAt	p.F683Y	GAK_ENST00000511163.1_Missense_Mutation_p.F604Y	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	683	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		GTACTTGGCAAATTTCACAGT	0.597																																							0											0													151.0	125.0	134.0					4																	870324		2203	4300	6503	SO:0001583	missense	0			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.2048T>A	4.37:g.870324A>T	ENSP00000314499:p.Phe683Tyr		Q5U4P5|Q9BVY6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.F683Y	ENST00000314167.4	37	c.2048	CCDS3340.1	4	.	.	.	.	.	.	.	.	.	.	A	22.5	4.296578	0.81025	.	.	ENSG00000178950	ENST00000314167;ENST00000511163	D;D	0.89196	-2.48;-2.48	5.26	5.26	0.73747	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92378	0.7581	L	0.60957	1.885	0.80722	D	1	D;D;D;D	0.71674	0.998;0.994;0.998;0.998	D;D;D;D	0.70227	0.968;0.934;0.962;0.962	D	0.92239	0.5799	10	0.48119	T	0.1	-9.3552	13.1095	0.59265	1.0:0.0:0.0:0.0	.	604;604;683;579	Q5U4P5;E9PGR2;O14976;Q59HA5	.;.;GAK_HUMAN;.	Y	683;604	ENSP00000314499:F683Y;ENSP00000421361:F604Y	ENSP00000314499:F683Y	F	-	2	0	GAK	860324	1.000000	0.71417	0.783000	0.31826	0.556000	0.35491	9.013000	0.93629	1.979000	0.57680	0.459000	0.35465	TTT	0	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom		0.597	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	protein_coding	OTTHUMT00000239188.1	42	206	0	0.00	0	0	A	NM_005255	0	0		870324	-1	no_errors	ENST00000314167	ensembl	human	known	74_37	missense	22	155	18.52	15.30	5	28	SNP	1	T
OTUD4	54726	genome.wustl.edu	37	4	146085314	146085314	+	Missense_Mutation	SNP	G	G	C			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr4:146085314G>C	ENST00000447906.2	-	5	593	c.406C>G	c.(406-408)Cct>Gct	p.P136A	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000454497.2_Missense_Mutation_p.P71A|OTUD4_ENST00000296579.6_Missense_Mutation_p.P71A|OTUD4_ENST00000509620.2_Missense_Mutation_p.P71A			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	136	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					ACCTTTTCAGGAAAATTATTT	0.264																																							0											0													13.0	13.0	13.0					4																	146085314		2103	4195	6298	SO:0001583	missense	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.406C>G	4.37:g.146085314G>C	ENSP00000395487:p.Pro136Ala		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.P136A	ENST00000447906.2	37	c.406		4	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433661	0.25813	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973;ENST00000509620;ENST00000296579;ENST00000504501	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.45	5.45	0.79879	Ovarian tumour, otubain (2);	0.129316	0.35040	N	0.003486	T	0.23451	0.0567	L	0.45698	1.435	0.31980	N	0.60607	B;B	0.32324	0.314;0.364	B;B	0.31686	0.075;0.134	T	0.15723	-1.0427	10	0.10111	T	0.7	-15.7005	9.9531	0.41651	0.1531:0.0:0.8469:0.0	.	136;136	G3V0I6;Q01804	.;OTUD4_HUMAN	A	71;136;71;71;71;71	ENSP00000409279:P71A;ENSP00000395487:P136A;ENSP00000425972:P71A;ENSP00000424192:P71A;ENSP00000296579:P71A;ENSP00000423453:P71A	ENSP00000296579:P71A	P	-	1	0	OTUD4	146304764	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.020000	0.49643	2.550000	0.86006	0.591000	0.81541	CCT	0	pfam_OTU,pfscan_OTU		0.264	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	protein_coding	OTTHUMT00000365117.2	134	464	0	0.22	0	1	G	NM_017493	0	0		146085314	-1	no_errors	ENST00000447906	ensembl	human	known	74_37	missense	158	280	9.2	13.54	16	44	SNP	1	C
NLN	57486	genome.wustl.edu	37	5	65118617	65118617	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr5:65118617G>T	ENST00000380985.5	+	13	2167	c.1989G>T	c.(1987-1989)atG>atT	p.M663I	NLN_ENST00000515595.1_3'UTR|NLN_ENST00000502464.1_Missense_Mutation_p.M559I	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	663						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		AGGTTGGAATGAAATACAGAA	0.403																																							0											0													90.0	92.0	91.0					5																	65118617		2203	4300	6503	SO:0001583	missense	0			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1989G>T	5.37:g.65118617G>T	ENSP00000370372:p.Met663Ile		Q9ULJ4	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.M663I	ENST00000380985.5	37	c.1989	CCDS3989.1	5	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080383	0.55753	.	.	ENSG00000123213	ENST00000380985;ENST00000502464;ENST00000511299	T;T;T	0.07688	3.17;3.17;3.17	5.75	5.75	0.90469	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.112813	0.85682	D	0.000000	T	0.12518	0.0304	L	0.45228	1.405	0.48040	D	0.999575	P;P	0.36086	0.536;0.536	B;B	0.38020	0.263;0.263	T	0.01578	-1.1320	10	0.62326	D	0.03	-20.7172	19.9598	0.97242	0.0:0.0:1.0:0.0	.	340;663	Q96K48;Q9BYT8	.;NEUL_HUMAN	I	663;559;373	ENSP00000370372:M663I;ENSP00000423214:M559I;ENSP00000427417:M373I	ENSP00000370372:M663I	M	+	3	0	NLN	65154373	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.018000	0.70811	2.716000	0.92895	0.655000	0.94253	ATG	0	pfam_Pept_M3A_M3B		0.403	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLN	protein_coding	OTTHUMT00000215060.1	79	355	0	0.00	0	0	G		0	0		65118617	1	no_errors	ENST00000380985	ensembl	human	known	74_37	missense	53	254	8.62	4.87	5	13	SNP	1	T
DAAM2	23500	genome.wustl.edu	37	6	39864707	39864707	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr6:39864707C>T	ENST00000398904.2	+	20	2643	c.2461C>T	c.(2461-2463)Cgg>Tgg	p.R821W	RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|DAAM2_ENST00000274867.4_Missense_Mutation_p.R821W|DAAM2_ENST00000538976.1_Missense_Mutation_p.R821W|RP11-61I13.3_ENST00000437947.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	821	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTACGGGTTCCGGGTGGCCAG	0.597																																							0											0													37.0	43.0	41.0					6																	39864707		2025	4162	6187	SO:0001583	missense	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2461C>T	6.37:g.39864707C>T	ENSP00000381876:p.Arg821Trp		G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.R821W	ENST00000398904.2	37	c.2461	CCDS56426.1	6	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112975	0.77210	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.65549	-0.16;-0.16;-0.16	4.66	4.66	0.58398	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.170378	0.35040	N	0.003487	T	0.73536	0.3599	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.982;0.99	T	0.77603	-0.2526	10	0.87932	D	0	.	10.1959	0.43054	0.3124:0.6876:0.0:0.0	.	821;821	G5EA45;Q86T65	.;DAAM2_HUMAN	W	821	ENSP00000274867:R821W;ENSP00000381876:R821W;ENSP00000437808:R821W	ENSP00000274867:R821W	R	+	1	2	DAAM2	39972685	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.390000	0.59646	2.433000	0.82419	0.561000	0.74099	CGG	0	pfam_FH2_Formin,smart_FH2_Formin		0.597	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	protein_coding	OTTHUMT00000280648.1	36	178	0	0.00	0	0	C		0	0		39864707	1	no_errors	ENST00000274867	ensembl	human	known	74_37	missense	16	81	20	17.35	4	17	SNP	1	T
HOXA1	3198	genome.wustl.edu	37	7	27134902	27134902	+	Silent	SNP	G	G	A			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr7:27134902G>A	ENST00000343060.4	-	1	691	c.630C>T	c.(628-630)gtC>gtT	p.V210V	HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	210					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGTTTCTTTTGACTTTCATCC	0.493																																							0											0													49.0	56.0	54.0					7																	27134902		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.630C>T	7.37:g.27134902G>A			A4D184|B2R8U7|O43363	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.V210	ENST00000343060.4	37	c.630	CCDS5401.1	7																																																																																			0	NULL		0.493	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	protein_coding	OTTHUMT00000358454.1	50	189	0	0.00	0	0	G		0	0		27134902	-1	no_errors	ENST00000343060	ensembl	human	known	74_37	silent	38	184	9.52	11.11	4	23	SNP	0.997	A
SLC13A1	6561	genome.wustl.edu	37	7	122768933	122768933	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr7:122768933C>T	ENST00000194130.2	-	10	1138	c.1099G>A	c.(1099-1101)Gga>Aga	p.G367R	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	367					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	GGAACAAATCCGGGGTCTCGA	0.423																																							0											0													92.0	79.0	83.0					7																	122768933		2203	4300	6503	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1099G>A	7.37:g.122768933C>T	ENSP00000194130:p.Gly367Arg		Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.G367R	ENST00000194130.2	37	c.1099	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638879	0.47153	.	.	ENSG00000081800	ENST00000194130	T	0.69040	-0.37	5.89	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.83362	0.5238	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86244	0.1645	10	0.66056	D	0.02	-31.8333	15.4962	0.75653	0.1395:0.8605:0.0:0.0	.	367;367	A4D0X1;Q9BZW2	.;S13A1_HUMAN	R	367	ENSP00000194130:G367R	ENSP00000194130:G367R	G	-	1	0	SLC13A1	122556169	1.000000	0.71417	0.179000	0.23059	0.013000	0.08279	6.481000	0.73608	1.483000	0.48342	-0.311000	0.09066	GGA	0	pfam_Na/sul_symport		0.423	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	protein_coding	OTTHUMT00000347404.1	45	321	0	0.00	0	0	C	NM_022444	0	0		122768933	-1	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	35	258	16.28	13.71	7	41	SNP	0.996	T
SYTL2	54843	genome.wustl.edu	37	11	85437514	85437514	+	Intron	SNP	A	A	G			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr11:85437514A>G	ENST00000528231.1	-	7	1737				SYTL2_ENST00000525423.1_5'UTR|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000354566.3_5'Flank|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000359152.5_Missense_Mutation_p.S520P|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TCTTTTAGGGACATAACTTTA	0.408																																							0											0													42.0	42.0	42.0					11																	85437514		2203	4287	6490	SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+1424T>C	11.37:g.85437514A>G			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S520P	ENST00000528231.1	37	c.1558	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	A	13.61	2.287847	0.40494	.	.	ENSG00000137501	ENST00000359152	T	0.44881	0.91	5.91	0.816	0.18768	.	0.699256	0.14148	N	0.338198	T	0.27900	0.0687	.	.	.	0.24705	N	0.993234	.	.	.	.	.	.	T	0.16778	-1.0391	6	.	.	.	-2.7412	4.168	0.10315	0.6054:0.0:0.1403:0.2543	.	.	.	.	P	520	ENSP00000352065:S520P	.	S	-	1	0	SYTL2	85115162	0.272000	0.24172	0.996000	0.52242	0.977000	0.68977	0.730000	0.26043	0.476000	0.27440	-0.301000	0.09380	TCC	0	NULL		0.408	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	protein_coding	OTTHUMT00000392192.1	58	414	0	0.00	0	0	A	NM_206927	0	0		85437514	-1	no_errors	ENST00000359152	ensembl	human	known	74_37	missense	28	215	20	14.68	7	37	SNP	0.479	G
ANP32BP1	646791	genome.wustl.edu	37	15	75614044	75614044	+	RNA	SNP	A	A	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr15:75614044A>T	ENST00000564205.1	-	0	990									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		TTTTTTTTTTAACAGCTACCA	0.428																																							0											0																																												0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614044A>T				RNA	SNP	0	NULL	ENST00000564205.1	37	NULL		15																																																																																			0	0		0.428	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	pseudogene	OTTHUMT00000419801.1	38	55	2.5	0.00	1	0	A		0	0		75614044	-1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	48	43	12.73	4.35	7	2	SNP	0.73	T
CHD2	1106	genome.wustl.edu	37	15	93528867	93528867	+	Missense_Mutation	SNP	A	A	G			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr15:93528867A>G	ENST00000394196.4	+	26	4445	c.3377A>G	c.(3376-3378)gAc>gGc	p.D1126G	CHD2_ENST00000557381.1_Missense_Mutation_p.D1126G	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1126					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GTGCGGAAGGACCTCGTGGAG	0.532																																							0											0													147.0	128.0	134.0					15																	93528867		2197	4298	6495	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3377A>G	15.37:g.93528867A>G	ENSP00000377747:p.Asp1126Gly		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D1126G	ENST00000394196.4	37	c.3377	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660541	0.67586	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	T;T	0.80214	-1.35;-1.35	5.18	5.18	0.71444	.	0.000000	0.35466	U	0.003191	T	0.77425	0.4128	L	0.56769	1.78	0.80722	D	1	B;P	0.35139	0.39;0.486	B;B	0.31946	0.079;0.138	T	0.79797	-0.1652	10	0.72032	D	0.01	-24.5992	15.0364	0.71751	1.0:0.0:0.0:0.0	.	1126;1126	O14647;O14647-2	CHD2_HUMAN;.	G	1126	ENSP00000377747:D1126G;ENSP00000451366:D1126G	ENSP00000377747:D1126G	D	+	2	0	CHD2	91329871	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	8.923000	0.92808	1.958000	0.56883	0.528000	0.53228	GAC	0	NULL		0.532	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	protein_coding	OTTHUMT00000313528.3	78	166	0	0.00	0	0	A	NM_001271	0	0		93528867	1	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	61	164	10.29	5.71	7	10	SNP	1	G
FAM169B	283777	genome.wustl.edu	37	15	99023847	99023847	+	Missense_Mutation	SNP	A	A	G			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr15:99023847A>G	ENST00000558256.1	-	4	415	c.166T>C	c.(166-168)Tac>Cac	p.Y56H	FAM169B_ENST00000332908.4_Missense_Mutation_p.Y56H	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	56										large_intestine(3)|lung(3)|urinary_tract(1)	7						TTGGTTGTGTAAAACCCAACA	0.512																																							0											0													94.0	94.0	94.0					15																	99023847		1943	4159	6102	SO:0001583	missense	0				CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.166T>C	15.37:g.99023847A>G	ENSP00000453554:p.Tyr56His		B5MDL8	Missense_Mutation	SNP	NULL	p.Y56H	ENST00000558256.1	37	c.166	CCDS45360.1	15	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781014	0.70222	.	.	ENSG00000185087	ENST00000332908	T	0.36878	1.23	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	T	0.56877	0.2015	M	0.62723	1.935	0.38315	D	0.943373	D	0.89917	1.0	D	0.87578	0.998	T	0.64592	-0.6371	10	0.87932	D	0	-16.402	13.6652	0.62391	1.0:0.0:0.0:0.0	.	56	Q8N8A8	F169B_HUMAN	H	56	ENSP00000332615:Y56H	ENSP00000332615:Y56H	Y	-	1	0	FAM169B	96841370	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	6.977000	0.76141	1.894000	0.54839	0.533000	0.62120	TAC	0	NULL		0.512	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169B	protein_coding	OTTHUMT00000415488.1	49	218	0	0.00	0	0	A	NM_182562	0	0		99023847	-1	no_errors	ENST00000332908	ensembl	human	known	74_37	missense	57	149	8.06	15.82	5	28	SNP	1	G
SDK2	54549	genome.wustl.edu	37	17	71382583	71382583	+	Splice_Site	SNP	C	C	A			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr17:71382583C>A	ENST00000392650.3	-	31	4499		c.e31+1		SDK2_ENST00000388726.3_Splice_Site	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GGGGTACTGACCAGCCTGCAG	0.592																																							0											0													46.0	39.0	41.0					17																	71382583		2175	4238	6413	SO:0001630	splice_region_variant	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4498+1G>T	17.37:g.71382583C>A			A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Splice_Site	SNP	0	e31+1	ENST00000392650.3	37	c.4498+1	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071819	0.55646	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0783	0.89435	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SDK2	68894178	1.000000	0.71417	0.999000	0.59377	0.317000	0.28152	6.021000	0.70832	2.374000	0.81015	0.609000	0.83330	.	0	0		0.592	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	97	84	0	0.00	0	0	C	NM_019064	0	0	Intron	71382583	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	splice_site	55	40	32.93	36.51	27	23	SNP	1	A
SLC16A3	9123	genome.wustl.edu	37	17	80195443	80195443	+	Missense_Mutation	SNP	T	T	A	rs201989214		TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr17:80195443T>A	ENST00000581287.1	+	3	3119	c.797T>A	c.(796-798)cTg>cAg	p.L266Q	SLC16A3_ENST00000392341.1_Missense_Mutation_p.L266Q|SLC16A3_ENST00000582743.1_Missense_Mutation_p.L266Q|SLC16A3_ENST00000392339.1_Missense_Mutation_p.L266Q	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	266					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	GCCGCCTTCCTGCTCACCATC	0.682																																					Pancreas(52;652 1135 19190 37282 52456)		0											0													47.0	54.0	52.0					17																	80195443		2201	4299	6500	SO:0001583	missense	0			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.797T>A	17.37:g.80195443T>A	ENSP00000463978:p.Leu266Gln		B3KXG8|Q2M1P8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.L266Q	ENST00000581287.1	37	c.797	CCDS11804.1	17	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451838	0.43531	.	.	ENSG00000141526	ENST00000392341;ENST00000392339	T;T	0.61158	0.13;0.13	5.72	5.72	0.89469	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81550	0.4846	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86199	0.1617	10	0.87932	D	0	.	15.1765	0.72916	0.0:0.0:0.0:1.0	.	266;266	Q53G91;O15427	.;MOT4_HUMAN	Q	266	ENSP00000376152:L266Q;ENSP00000376150:L266Q	ENSP00000376150:L266Q	L	+	2	0	SLC16A3	77788732	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	7.961000	0.87903	2.184000	0.69523	0.455000	0.32223	CTG	0	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.682	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	protein_coding	OTTHUMT00000443498.1	138	96	0	0.00	0	0	T	NM_004207	0	0		80195443	1	no_errors	ENST00000392339	ensembl	human	known	74_37	missense	46	45	29.23	36.62	19	26	SNP	1	A
OR7C2	26658	genome.wustl.edu	37	19	15053237	15053237	+	Missense_Mutation	SNP	G	G	A			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr19:15053237G>A	ENST00000248072.3	+	1	937	c.937G>A	c.(937-939)Ggg>Agg	p.G313R		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					TCTCAAAGAGGGGACCATTGC	0.488																																							0											0													50.0	50.0	50.0					19																	15053237		2203	4300	6503	SO:0001583	missense	0			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.937G>A	19.37:g.15053237G>A	ENSP00000248072:p.Gly313Arg		O43881|Q6IFP9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G313R	ENST00000248072.3	37	c.937	CCDS12320.1	19	.	.	.	.	.	.	.	.	.	.	g	4.815	0.151606	0.09185	.	.	ENSG00000127529	ENST00000248072	T	0.06294	3.32	3.11	-5.92	0.02261	.	0.310946	0.22630	N	0.057599	T	0.02610	0.0079	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.42783	-0.9431	10	0.13853	T	0.58	.	1.0502	0.01578	0.4341:0.1472:0.2494:0.1693	.	313	O60412	OR7C2_HUMAN	R	313	ENSP00000248072:G313R	ENSP00000248072:G313R	G	+	1	0	OR7C2	14914237	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.989000	0.03736	-1.117000	0.02965	-0.603000	0.04100	GGG	0	NULL		0.488	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C2	protein_coding	OTTHUMT00000466281.1	27	170	0	0.00	0	0	G		0	0		15053237	1	no_errors	ENST00000248072	ensembl	human	known	74_37	missense	26	115	16.13	9.45	5	12	SNP	0	A
TSHZ3	57616	genome.wustl.edu	37	19	31768987	31768987	+	Missense_Mutation	SNP	G	G	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr19:31768987G>T	ENST00000240587.4	-	2	2039	c.1712C>A	c.(1711-1713)aCg>aAg	p.T571K		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	571					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TTTCAGGGGCGTGCTCTTCCC	0.597																																							0											0													107.0	108.0	107.0					19																	31768987		2203	4300	6503	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1712C>A	19.37:g.31768987G>T	ENSP00000240587:p.Thr571Lys		Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.T571K	ENST00000240587.4	37	c.1712	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	G	9.736	1.163674	0.21538	.	.	ENSG00000121297	ENST00000240587	T	0.33216	1.42	5.2	4.17	0.49024	.	0.330798	0.36200	N	0.002739	T	0.20455	0.0492	N	0.22421	0.69	0.42521	D	0.993001	B	0.23650	0.089	B	0.17433	0.018	T	0.04153	-1.0973	10	0.20519	T	0.43	-1.4917	13.8323	0.63389	0.0741:0.0:0.9259:0.0	.	571	Q63HK5	TSH3_HUMAN	K	571	ENSP00000240587:T571K	ENSP00000240587:T571K	T	-	2	0	TSHZ3	36460827	1.000000	0.71417	0.001000	0.08648	0.265000	0.26407	5.411000	0.66386	1.182000	0.42928	0.655000	0.94253	ACG	0	NULL		0.597	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	protein_coding	OTTHUMT00000316743.2	47	157	0	0.00	0	0	G	NM_020856	0	0		31768987	-1	no_errors	ENST00000240587	ensembl	human	known	74_37	missense	34	142	10.53	17.82	4	31	SNP	0.794	T
SARS2	54938	genome.wustl.edu	37	19	39409099	39409099	+	Missense_Mutation	SNP	A	A	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr19:39409099A>T	ENST00000221431.6	-	9	1038	c.879T>A	c.(877-879)gaT>gaA	p.D293E	SARS2_ENST00000430193.3_Missense_Mutation_p.D293E|CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.S363T|SARS2_ENST00000448145.2_Missense_Mutation_p.D293E|SARS2_ENST00000600042.1_Missense_Mutation_p.D295E|SARS2_ENST00000598831.1_5'Flank|SARS2_ENST00000594171.1_Missense_Mutation_p.D103E	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	293					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCAGGTTGAGATCTTTGAAGC	0.597																																							0											0													145.0	127.0	133.0					19																	39409099		2203	4300	6503	SO:0001583	missense	0			AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.879T>A	19.37:g.39409099A>T	ENSP00000221431:p.Asp293Glu		A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	pirsf_Ser-tRNA-ligase_type_1,pfam_aa-tRNA-synt_IIb_cons-dom,superfamily_tRNA-bd_arm,prints_Ser-tRNA-ligase_type_1,pfscan_aa-tRNA-synth_II,tigrfam_Ser-tRNA-ligase_type_1	p.D295E	ENST00000221431.6	37	c.885	CCDS33017.1	19	.	.	.	.	.	.	.	.	.	.	A	11.42	1.632460	0.29068	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000448145	T;T	0.77229	-1.08;-1.08	4.47	2.32	0.28847	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.128179	0.49916	D	0.000133	T	0.80221	0.4583	L	0.49455	1.56	.	.	.	P;D;B;B	0.65815	0.546;0.995;0.303;0.154	B;P;B;B	0.60789	0.112;0.879;0.073;0.053	T	0.82436	-0.0458	9	0.49607	T	0.09	.	9.0602	0.36429	0.1888:0.0:0.8112:0.0	.	293;295;293;293	E7EX87;B4DE10;B4DXB9;Q9NP81	.;.;.;SYSM_HUMAN	E	295;293;293	ENSP00000221431:D293E;ENSP00000399330:D293E	ENSP00000221431:D293E	D	-	3	2	FBXO17	44100939	1.000000	0.71417	1.000000	0.80357	0.271000	0.26615	1.768000	0.38511	0.328000	0.23435	0.254000	0.18369	GAT	0	pirsf_Ser-tRNA-ligase_type_1,pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Ser-tRNA-ligase_type_1		0.597	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SARS2	protein_coding	OTTHUMT00000463139.1	51	201	0	0.00	0	0	A	NM_017827	0	0		39409099	-1	no_errors	ENST00000600042	ensembl	human	known	74_37	missense	31	159	18.42	11.67	7	21	SNP	1	T
ADCK4	79934	genome.wustl.edu	37	19	41198227	41198227	+	Missense_Mutation	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr19:41198227C>T	ENST00000324464.3	-	15	1649	c.1348G>A	c.(1348-1350)Gcc>Acc	p.A450T	NUMBL_ENST00000598779.1_5'Flank|NUMBL_ENST00000599594.1_5'Flank|ADCK4_ENST00000450541.1_Missense_Mutation_p.A409T|NUMBL_ENST00000252891.4_5'Flank|NUMBL_ENST00000540131.1_5'Flank|ADCK4_ENST00000243583.6_Missense_Mutation_p.A409T	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	450						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			CCCTGGGTGGCGAAAGGCTCC	0.662																																							0											0													28.0	27.0	27.0					19																	41198227		2203	4299	6502	SO:0001583	missense	0			AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.1348G>A	19.37:g.41198227C>T	ENSP00000315118:p.Ala450Thr		Q8TAJ1|Q9HA52	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.A450T	ENST00000324464.3	37	c.1348	CCDS12562.1	19	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713494	0.68730	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.75704	-0.96;-0.49;-0.49	5.43	5.43	0.79202	.	0.051648	0.85682	D	0.000000	T	0.76990	0.4065	M	0.64080	1.96	0.48341	D	0.999636	D;P	0.53462	0.96;0.952	B;P	0.49361	0.326;0.608	T	0.77918	-0.2408	10	0.46703	T	0.11	-14.9399	13.6297	0.62188	0.1556:0.8444:0.0:0.0	.	450;409	Q96D53;Q96D53-2	ADCK4_HUMAN;.	T	450;409;409	ENSP00000315118:A450T;ENSP00000412839:A409T;ENSP00000243583:A409T	ENSP00000243583:A409T	A	-	1	0	ADCK4	45890067	0.992000	0.36948	0.969000	0.41365	0.946000	0.59487	2.984000	0.49353	2.560000	0.86352	0.561000	0.74099	GCC	0	NULL		0.662	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADCK4	protein_coding	OTTHUMT00000462731.1	130	136	0	0.00	0	0	C	NM_024876	0	0		41198227	-1	no_errors	ENST00000324464	ensembl	human	known	74_37	missense	72	103	10	13.45	8	16	SNP	0.978	T
KLK8	11202	genome.wustl.edu	37	19	51503886	51503886	+	Intron	SNP	C	C	T			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr19:51503886C>T	ENST00000600767.1	-	4	560				KLK8_ENST00000391806.2_Silent_p.S53S|KLK8_ENST00000598195.1_5'Flank|KLK8_ENST00000320838.5_Intron|KLK8_ENST00000593490.1_Intron|KLK9_ENST00000250366.6_Intron|KLK9_ENST00000376832.4_Intron|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000291726.7_Intron|KLK8_ENST00000347619.4_Intron			O60259	KLK8_HUMAN	kallikrein-related peptidase 8						cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		TGGGGCAGTGCGAGGGCTGGG	0.627																																							0											0													70.0	68.0	68.0					19																	51503886		2203	4300	6503	SO:0001627	intron_variant	0			AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.71-47G>A	19.37:g.51503886C>T			Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S53	ENST00000600767.1	37	c.159	CCDS12813.1	19																																																																																			0	NULL		0.627	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	protein_coding	OTTHUMT00000465032.2	41	205	0	0.00	0	0	C	NM_007196	0	0		51503886	-1	no_errors	ENST00000391806	ensembl	human	known	74_37	silent	28	126	17.65	8.03	6	11	SNP	0	T
GRM4	2914	genome.wustl.edu	37	6	34101191	34101191	+	Frame_Shift_Del	DEL	G	G	-			TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr6:34101191delG	ENST00000538487.2	-	2	526	c.83delC	c.(82-84)cctfs	p.P28fs	GRM4_ENST00000374181.4_Frame_Shift_Del_p.P28fs|GRM4_ENST00000374177.3_Intron	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	28					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAGGGAGGAAGGCATCCAGGG	0.627																																							0											0													32.0	33.0	32.0					6																	34101191		2201	4300	6501	SO:0001589	frameshift_variant	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.83delC	6.37:g.34101191delG	ENSP00000440556:p.Pro28fs		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Frame_Shift_Del	DEL	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.P28fs	ENST00000538487.2	37	c.83	CCDS4787.1	6																																																																																			0	prints_GPCR_3_mtglu_rcpt_4		0.627	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	protein_coding	OTTHUMT00000040213.2	62	164	0	0.00	0	0	G		0	0		34101191	-1	no_errors	ENST00000374181	ensembl	human	known	74_37	frame_shift_del	42	105	12.5	16.00	6	20	DEL	0.793	0
AC079610.2	0	genome.wustl.edu	37	2	214142631	214142631	+	lincRNA	SNP	G	G	C	rs13000409	byFrequency	TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr2:214142631G>C	ENST00000360083.3	-	0	371				RP11-105N14.2_ENST00000606960.1_lincRNA																							cagggcatgtgagaggtcttc	0.488													C|||	2460	0.491214	0.652	0.536	5008	,	,		20602	0.2996		0.6233	False		,,,				2504	0.3037						0											0																																												0																															2.37:g.214142631G>C				RNA	SNP	0	NULL	ENST00000360083.3	37	NULL		2																																																																																			0	0		0.488	AC079610.2-001	KNOWN	basic	lincRNA	ENSG00000196096	lincRNA	OTTHUMT00000337357.1	9	0	0	0.00	0	0	G		rs13000409	G->C		214142631	-1	no_errors	ENST00000360083	ensembl	human	known	74_37	rna	5	0	58.33	0.00	7	0	SNP	0	C
MUC21	394263	genome.wustl.edu	37	6	30954863	30954863	+	Missense_Mutation	SNP	A	A	G	rs201896109		TCGA-5U-AB0E-01A-11D-A423-09	TCGA-5U-AB0E-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40ef6685-feb5-4e37-97b1-96160aa3aaa7	5b9af8ea-c527-4e80-9c81-402d8c37bf4f	g.chr6:30954863A>G	ENST00000376296.3	+	2	1152	c.911A>G	c.(910-912)gAg>gGg	p.E304G	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	304	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACCAACTCTGAGTCCAGTACG	0.592																																							0											0													179.0	171.0	174.0					6																	30954863		2203	4300	6503	SO:0001583	missense	0			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.911A>G	6.37:g.30954863A>G	ENSP00000365473:p.Glu304Gly		B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	NULL	p.E304G	ENST00000376296.3	37	c.911	CCDS34388.1	6	.	.	.	.	.	.	.	.	.	.	a	9.955	1.221199	0.22457	.	.	ENSG00000204544	ENST00000376296	T	0.01388	4.95	4.34	-8.68	0.00859	.	.	.	.	.	T	0.00271	0.0008	N	0.17082	0.46	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.46843	-0.9162	8	.	.	.	0.4247	3.691	0.08346	0.3484:0.4214:0.1287:0.1016	.	304	Q5SSG8	MUC21_HUMAN	G	304	ENSP00000365473:E304G	.	E	+	2	0	MUC21	31062842	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-7.586000	0.00033	-1.510000	0.01796	0.482000	0.46254	GAG	0	NULL		0.592	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	protein_coding	OTTHUMT00000128579.3	60	0	0	0.00	0	0	A	NM_001010909	rs201896109	A->G		30954863	1	no_errors	ENST00000376296	ensembl	human	known	74_37	missense	51	2	8.93	0.00	5	0	SNP	0	G
