#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
TNN	63923	genome.wustl.edu	37	1	175046945	175046945	+	Missense_Mutation	SNP	T	T	A			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr1:175046945T>A	ENST00000239462.4	+	2	504	c.391T>A	c.(391-393)Tgc>Agc	p.C131S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	131					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGCCCAGCGCTGCTGCCAGGG	0.552																																							0											0													43.0	47.0	45.0					1																	175046945		2203	4300	6503	SO:0001583	missense	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.391T>A	1.37:g.175046945T>A	ENSP00000239462:p.Cys131Ser		B9EGP3|Q5R360	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.C131S	ENST00000239462.4	37	c.391	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682554	0.68157	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.33865	1.39	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.86097	2.795	0.49798	D	0.999824	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	T	0.70436	-0.4872	10	0.87932	D	0	.	13.8698	0.63612	0.0:0.0:0.0:1.0	.	131;131	B3KXB6;Q9UQP3	.;TENN_HUMAN	S	131	ENSP00000239462:C131S	ENSP00000239462:C131S	C	+	1	0	TNN	173313568	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	5.108000	0.64609	2.103000	0.63969	0.533000	0.62120	TGC	0	NULL		0.552	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	protein_coding	OTTHUMT00000084422.1	24	121	0	0.00	0	0	T	XM_040527	0	0		175046945	1	no_errors	ENST00000239462	ensembl	human	known	74_37	missense	15	71	25	8.97	5	7	SNP	1	A
NBAS	51594	genome.wustl.edu	37	2	15542383	15542383	+	Missense_Mutation	SNP	T	T	C	rs538790933		TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr2:15542383T>C	ENST00000281513.5	-	26	3005	c.2980A>G	c.(2980-2982)Ata>Gta	p.I994V	NBAS_ENST00000441750.1_Missense_Mutation_p.I874V	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	994					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TCTAGTGCTATTGCCATCAGT	0.363																																							0											0													149.0	142.0	144.0					2																	15542383		2203	4300	6503	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2980A>G	2.37:g.15542383T>C	ENSP00000281513:p.Ile994Val		O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.I994V	ENST00000281513.5	37	c.2980	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.145|8.145	0.785989|0.785989	0.16189|0.16189	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755|ENST00000429842	T;T;T|.	0.17213|.	2.29;2.29;2.29|.	5.65|5.65	-2.22|-2.22	0.06952|0.06952	Secretory pathway Sec39 (1);|.	0.444927|.	0.25845|.	N|.	0.027935|.	T|T	0.27027|0.27027	0.0662|0.0662	N|N	0.17474|0.17474	0.49|0.49	0.09310|0.09310	N|N	1|1	B;B|.	0.23591|.	0.088;0.0|.	B;B|.	0.25140|.	0.058;0.003|.	T|T	0.30534|0.30534	-0.9975|-0.9975	10|5	0.87932|.	D|.	0|.	.|.	11.7757|11.7757	0.51985|0.51985	0.0:0.1873:0.0:0.8127|0.0:0.1873:0.0:0.8127	.|.	874;994|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	V|S	874;994;41|91	ENSP00000413201:I874V;ENSP00000281513:I994V;ENSP00000396501:I41V|.	ENSP00000281513:I994V|.	I|N	-|-	1|2	0|0	NBAS|NBAS	15459834|15459834	0.001000|0.001000	0.12720|0.12720	0.012000|0.012000	0.15200|0.15200	0.980000|0.980000	0.70556|0.70556	-0.091000|-0.091000	0.11146|0.11146	-0.374000|-0.374000	0.07967|0.07967	0.533000|0.533000	0.62120|0.62120	ATA|AAT	0	pfam_Sec39		0.363	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	76	271	0	0.00	0	0	T	NM_015909	rs538790933	T->C		15542383	-1	no_errors	ENST00000281513	ensembl	human	known	74_37	missense	80	159	9.09	5.88	8	10	SNP	0.001	C
GRM7	2917	genome.wustl.edu	37	3	7782044	7782044	+	Splice_Site	SNP	G	G	C			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr3:7782044G>C	ENST00000357716.4	+	10	2973	c.2699G>C	c.(2698-2700)aGc>aCc	p.S900T	GRM7_ENST00000486284.1_3'UTR	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	900					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TTTCTTTCAGGCCCTGCTGCA	0.378																																							0											0													98.0	93.0	95.0					3																	7782044		1850	4087	5937	SO:0001630	splice_region_variant	0			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2699-1G>C	3.37:g.7782044G>C			Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.S900T	ENST00000357716.4	37	c.2699	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	G	4.408	0.075343	0.08485	.	.	ENSG00000196277	ENST00000357716	D	0.88896	-2.44	5.65	5.65	0.86999	.	.	.	.	.	D	0.82788	0.5113	L	0.27053	0.805	0.80722	D	1	B	0.18741	0.03	B	0.06405	0.002	T	0.76833	-0.2813	8	.	.	.	.	18.298	0.90153	0.0:0.0:1.0:0.0	.	900	Q14831	GRM7_HUMAN	T	900	ENSP00000350348:S900T	.	S	+	2	0	GRM7	7757044	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.907000	0.87430	2.686000	0.91538	0.650000	0.86243	AGC	0	prints_GPCR_3_mtglu_rcpt_4		0.378	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	protein_coding	OTTHUMT00000246895.3	44	340	0	0.00	0	0	G	NM_000844	0	0	Missense_Mutation	7782044	1	no_errors	ENST00000357716	ensembl	human	known	74_37	missense	36	258	16.28	7.19	7	20	SNP	1	C
NR2C2	7182	genome.wustl.edu	37	3	15084513	15084513	+	Nonstop_Mutation	SNP	T	T	C			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr3:15084513T>C	ENST00000425241.1	+	14	2151	c.1789T>C	c.(1789-1791)Tag>Cag	p.*597Q	NR2C2_ENST00000393102.3_Nonstop_Mutation_p.*597Q|NR2C2_ENST00000323373.6_Nonstop_Mutation_p.*616Q|MRPS25_ENST00000496484.1_5'UTR|NR2C2_ENST00000406272.2_Nonstop_Mutation_p.*597Q|NR2C2_ENST00000478572.1_3'UTR			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	0					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGCCAGTCTATAGCGCAAACC	0.448																																							0											0													80.0	69.0	73.0					3																	15084513		2203	4300	6503	SO:0001578	stop_lost	0			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.1789T>C	3.37:g.15084513T>C	ENSP00000388387:p.*597Glnext*35		A8K3H5|B6ZGT8|P55092	Nonstop_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.*616Q	ENST00000425241.1	37	c.1846		3	.	.	.	.	.	.	.	.	.	.	T	13.90	2.374075	0.42105	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000406272	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1297	0.81418	0.0:0.0:0.0:1.0	.	.	.	.	Q	597;616;597;597	.	.	X	+	1	0	NR2C2	15059517	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	5.204000	0.65180	2.270000	0.75569	0.460000	0.39030	TAG	0	NULL		0.448	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	NR2C2	protein_coding	OTTHUMT00000340729.1	27	252	0	0.00	0	0	T	NM_003298	0	0		15084513	1	no_errors	ENST00000323373	ensembl	human	known	74_37	nonstop	29	182	9.38	7.11	3	14	SNP	1	C
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	302	141	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	307	102	10.66	6.42	37	7	SNP	1	A
TRIM3	10612	genome.wustl.edu	37	11	6477334	6477334	+	Missense_Mutation	SNP	C	C	T			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr11:6477334C>T	ENST00000525074.1	-	7	1895	c.1501G>A	c.(1501-1503)Gtg>Atg	p.V501M	TRIM3_ENST00000529058.1_5'Flank|TRIM3_ENST00000345851.3_Missense_Mutation_p.V501M|TRIM3_ENST00000537602.1_Missense_Mutation_p.V423M|TRIM3_ENST00000536344.1_Missense_Mutation_p.V382M|TRIM3_ENST00000359518.3_Missense_Mutation_p.V501M	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	501					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGCTACCACGATGCGGCCG	0.502																																					Melanoma(6;5 510 1540 25169 29084)		0											0													114.0	104.0	108.0					11																	6477334		2201	4296	6497	SO:0001583	missense	0			AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1501G>A	11.37:g.6477334C>T	ENSP00000433102:p.Val501Met		B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.V501M	ENST00000525074.1	37	c.1501	CCDS7764.1	11	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589732	0.86851	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79	5.66	5.66	0.87406	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.81559	0.4848	M	0.62016	1.91	0.53005	D	0.999967	D;D	0.63046	0.99;0.992	P;P	0.58660	0.674;0.843	T	0.82833	-0.0262	10	0.66056	D	0.02	-18.4722	13.9946	0.64388	0.0:0.8483:0.1517:0.0	.	382;501	F5H2Q8;O75382	.;TRIM3_HUMAN	M	501;501;501;501;490;423;501;382	ENSP00000433102:V501M;ENSP00000340797:V501M;ENSP00000441091:V423M;ENSP00000352508:V501M;ENSP00000445460:V382M	ENSP00000337094:V490M	V	-	1	0	TRIM3	6433910	0.817000	0.29147	1.000000	0.80357	0.988000	0.76386	1.668000	0.37481	2.667000	0.90743	0.563000	0.77884	GTG	0	pfam_NHL_repeat,pfscan_NHL_repeat_subgr		0.502	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM3	protein_coding	OTTHUMT00000384224.2	54	265	0	0.00	0	0	C	NM_006458	0	0		6477334	-1	no_errors	ENST00000345851	ensembl	human	known	74_37	missense	47	147	9.62	13.02	5	22	SNP	1	T
OR8B3	390271	genome.wustl.edu	37	11	124266673	124266673	+	Missense_Mutation	SNP	G	G	C			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr11:124266673G>C	ENST00000354597.3	-	1	591	c.575C>G	c.(574-576)aCc>aGc	p.T192S		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GTTGACATAGGTGCTGGTGCA	0.448																																							0											0													73.0	76.0	75.0					11																	124266673		2201	4299	6500	SO:0001583	missense	0			AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.575C>G	11.37:g.124266673G>C	ENSP00000346611:p.Thr192Ser		Q6IFQ8|Q8NGH1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T192S	ENST00000354597.3	37	c.575	CCDS31709.1	11	.	.	.	.	.	.	.	.	.	.	N	16.09	3.024803	0.54683	.	.	ENSG00000196661	ENST00000354597	T	0.00207	8.55	3.62	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.00384	0.0012	M	0.73598	2.24	0.25555	N	0.98705	P	0.44044	0.825	P	0.53102	0.718	T	0.39121	-0.9629	10	0.62326	D	0.03	.	10.9176	0.47146	0.0962:0.0:0.9038:0.0	.	192	Q8NGG8	OR8B3_HUMAN	S	192	ENSP00000346611:T192S	ENSP00000346611:T192S	T	-	2	0	OR8B3	123771883	0.130000	0.22417	1.000000	0.80357	0.915000	0.54546	2.966000	0.49208	2.316000	0.78162	0.555000	0.69702	ACC	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.448	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B3	protein_coding	OTTHUMT00000387291.1	63	114	0	0.87	0	1	G	NM_001005467	0	0		124266673	-1	no_errors	ENST00000354597	ensembl	human	known	74_37	missense	53	65	8.62	13.33	5	10	SNP	0.696	C
RBM42	79171	genome.wustl.edu	37	19	36124015	36124015	+	Missense_Mutation	SNP	C	C	T			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr19:36124015C>T	ENST00000262633.4	+	6	650	c.545C>T	c.(544-546)cCt>cTt	p.P182L	RBM42_ENST00000592202.1_Missense_Mutation_p.P128L|RBM42_ENST00000589871.1_Missense_Mutation_p.P160L|RBM42_ENST00000586618.1_Intron|RBM42_ENST00000360475.4_Missense_Mutation_p.P153L|RBM42_ENST00000589559.1_Missense_Mutation_p.P153L|RBM42_ENST00000588161.1_Missense_Mutation_p.P152L	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	182	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GGCCCCCGCCCTATGGCCCTA	0.687																																							0											0													69.0	88.0	81.0					19																	36124015		2202	4300	6502	SO:0001583	missense	0			BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.545C>T	19.37:g.36124015C>T	ENSP00000262633:p.Pro182Leu		O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P182L	ENST00000262633.4	37	c.545	CCDS12468.1	19	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319863	0.81469	.	.	ENSG00000126254	ENST00000262633;ENST00000360475	T;T	0.06608	3.29;3.28	5.05	5.05	0.67936	.	0.199807	0.44902	D	0.000416	T	0.14960	0.0361	L	0.36672	1.1	0.58432	D	0.999999	D;D;D;D	0.71674	0.997;0.997;0.997;0.998	D;D;D;D	0.78314	0.991;0.991;0.991;0.987	T	0.04650	-1.0936	10	0.26408	T	0.33	-6.7556	13.7681	0.63008	0.0:1.0:0.0:0.0	.	148;153;152;182	Q9BTD8-4;Q9BTD8-3;Q9BTD8-2;Q9BTD8	.;.;.;RBM42_HUMAN	L	182;153	ENSP00000262633:P182L;ENSP00000353663:P153L	ENSP00000262633:P182L	P	+	2	0	RBM42	40815855	0.935000	0.31712	1.000000	0.80357	0.994000	0.84299	2.760000	0.47581	2.628000	0.89032	0.561000	0.74099	CCT	0	NULL		0.687	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM42	protein_coding	OTTHUMT00000459057.2	66	77	0	0.00	0	0	C	NM_024321	0	0		36124015	1	no_errors	ENST00000262633	ensembl	human	known	74_37	missense	42	49	12.5	9.26	6	5	SNP	1	T
WASH6P	653440	genome.wustl.edu	37	X	155250722	155250722	+	RNA	SNP	T	T	C			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chrX:155250722T>C	ENST00000461007.1	+	0	0				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ttccatgagatgcaagcacac	0.577																																							0											0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155250722T>C			A6NGF1|Q8N305	RNA	SNP	0	NULL	ENST00000461007.1	37	NULL		X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	0.006|0.006	-2.039651|-2.039651	0.00402|0.00402	.|.	.|.	ENSG00000182484|ENSG00000182484	ENST00000359512|ENST00000285718	.|.	.|.	.|.	0.379|0.379	0.379|0.379	0.16213|0.16213	.|.	0.228496|.	0.35936|.	U|.	0.002898|.	T|T	0.12050|0.12050	0.0293|0.0293	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.33650|0.33650	-0.9860|-0.9860	5|4	0.66056|0.02654	D|T	0.02|1	-2.2966|-2.2966	.|.	.|.	.|.	.|.	.|.	.|.	.|.	R|T	33|6	.|.	ENSP00000352498:C33R|ENSP00000285718:M6T	C|M	+|+	1|2	0|0	WASH6P|WASH6P	154903916|154903916	0.083000|0.083000	0.21467|0.21467	0.018000|0.018000	0.16275|0.16275	0.063000|0.063000	0.16089|0.16089	0.660000|0.660000	0.25009|0.25009	0.350000|0.350000	0.24002|0.24002	0.143000|0.143000	0.16000|0.16000	TGC|ATG	0	0		0.577	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	pseudogene	OTTHUMT00000058840.1	47	0	0	0.00	0	0	T	NG_008380	0	0		155250722	1	no_errors	ENST00000285718	ensembl	human	known	74_37	rna	63	0	12.5	0.00	9	0	SNP	0.019	C
SPDYE2B	100310812	genome.wustl.edu	37	7	102294074	102294074	+	Missense_Mutation	SNP	T	T	C			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr7:102294074T>C	ENST00000507450.1	+	3	811	c.337T>C	c.(337-339)Tcc>Ccc	p.S113P	SPDYE2B_ENST00000455020.2_5'Flank|POLR2J2_ENST00000591000.1_Intron|POLR2J2_ENST00000333432.6_Intron|SPDYE2B_ENST00000436228.2_Missense_Mutation_p.S113P|POLR2J2_ENST00000476151.1_Intron	NM_001166339.1	NP_001159811.1	A6NHP3	SPE2B_HUMAN	speedy/RINGO cell cycle regulator family member E2B	113																	GCGAGTGTCATCCATCCTCCC	0.542																																							0											0																																										SO:0001583	missense	0				CCDS59507.1	7q22.1	2013-05-08			ENSG00000173678	ENSG00000173678		"""Speedy homologs"""	48334	protein-coding gene	gene with protein product							Standard	NM_001166339		Approved			A6NHP3	OTTHUMG00000158393	ENST00000507450.1:c.337T>C	7.37:g.102294074T>C	ENSP00000424058:p.Ser113Pro		D6RBN0	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S113P	ENST00000507450.1	37	c.337	CCDS59507.1	7	.	.	.	.	.	.	.	.	.	.	c	0	-2.811089	0.00074	.	.	ENSG00000173678	ENST00000540965;ENST00000507450;ENST00000436228	.	.	.	.	.	.	.	.	.	.	.	T	0.12732	0.0309	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	6	0.27082	T	0.32	.	.	.	.	.	113	A6NHP3	SPE2L_HUMAN	P	113	.	ENSP00000440393:S113P	S	+	1	0	RP11-577H5.4	102081310	0.724000	0.28038	0.002000	0.10522	0.002000	0.02628	-0.913000	0.04042	-1.655000	0.01497	-1.635000	0.00777	TCC	0	NULL		0.542	SPDYE2B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE2B	protein_coding	OTTHUMT00000350899.3	16	0	0	0.00	0	0	T		0	0		102294074	1	no_errors	ENST00000436228	ensembl	human	known	74_37	missense	21	0	27.59	0.00	8	0	SNP	0.002	C
AL353763.2	0	genome.wustl.edu	37	9	68997433	68997433	+	RNA	SNP	C	C	T	rs77309871	byFrequency	TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr9:68997433C>T	ENST00000583495.1	-	0	51																											ttccagaatgctgctatgagg	0.478																																							0											0																																												0																															9.37:g.68997433C>T				RNA	SNP	0	NULL	ENST00000583495.1	37	NULL		9																																																																																			0	0		0.478	AL353763.2-201	NOVEL	basic	miRNA	ENSG00000266021	miRNA		30	0	3.23	0.00	1	0	C		rs77309871	C->T		68997433	-1	no_errors	ENST00000583495	ensembl	human	novel	74_37	rna	10	0	26.67	0.00	4	0	SNP	0	T
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																							0											1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	0	NULL		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	protein_coding		23	0	0	0.00	0	0	C	NM_030930	rs4014596	C->T		67759316	-1	no_errors	ENST00000227471	ensembl	human	known	74_37	missense	21	0	19.23	0.00	5	0	SNP	0.997	T
SP5	389058	genome.wustl.edu	37	2	171572868	171572868	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X7-A8DJ-01A-11D-A423-09	TCGA-X7-A8DJ-10B-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	71043725-cf77-4331-8fdf-d52b86ad1cb8	69c7c375-191a-4a66-9211-22806cd9bdc1	g.chr2:171572868delC	ENST00000375281.3	+	2	313	c.151delC	c.(151-153)cccfs	p.P52fs	SP5_ENST00000487037.1_3'UTR|AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	52					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						cgcggcggcgcccccggACTT	0.761																																							0											0													9.0	12.0	11.0					2																	171572868		1837	3799	5636	SO:0001589	frameshift_variant	0				CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.151delC	2.37:g.171572868delC	ENSP00000364430:p.Pro52fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P52fs	ENST00000375281.3	37	c.151	CCDS33322.1	2																																																																																			0	NULL		0.761	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP5	protein_coding	OTTHUMT00000333670.1	18	11	0	0.00	0	0	C	XM_371581	0	0		171572868	1	no_errors	ENST00000375281	ensembl	human	known	74_37	frame_shift_del	4	10	42.86	0.00	3	0	DEL	0.993	0
