#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MAGEB16	139604	genome.wustl.edu	37	X	35820519	35820519	+	Missense_Mutation	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chrX:35820519G>T	ENST00000399989.1	+	2	485	c.206G>T	c.(205-207)tGc>tTc	p.C69F	MAGEB16_ENST00000399988.1_Missense_Mutation_p.C69F|MAGEB16_ENST00000399985.1_Missense_Mutation_p.C69F|MAGEB16_ENST00000399987.1_Missense_Mutation_p.C69F|MAGEB16_ENST00000399992.1_Missense_Mutation_p.C101F	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	69										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CAGAGTTTCTGCTCCTCTTCC	0.512																																							0											0													50.0	47.0	48.0					X																	35820519		1939	4114	6053	SO:0001583	missense	0				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.206G>T	X.37:g.35820519G>T	ENSP00000382871:p.Cys69Phe		A8MU30	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.C101F	ENST00000399989.1	37	c.302	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	G	0.919	-0.716449	0.03206	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04454	3.62;3.62;3.62;3.62;3.62	1.91	-2.47	0.06442	Melanoma associated antigen, MAGE, N-terminal (1);	2.562580	0.01193	N	0.007392	T	0.12987	0.0315	M	0.72118	2.19	0.09310	N	1	D	0.55172	0.97	P	0.62649	0.905	T	0.46289	-0.9202	10	0.10636	T	0.68	.	2.6985	0.05141	0.4773:0.0:0.3027:0.22	.	69	A2A368	MAGBG_HUMAN	F	69;101;69;69;69	ENSP00000382870:C69F;ENSP00000382874:C101F;ENSP00000382869:C69F;ENSP00000382871:C69F;ENSP00000382867:C69F	ENSP00000382867:C69F	C	+	2	0	MAGEB16	35730440	0.000000	0.05858	0.000000	0.03702	0.551000	0.35334	-2.523000	0.00949	-0.935000	0.03728	0.521000	0.50471	TGC	0	pfam_Melanoma_ass_antigen_N		0.512	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	protein_coding	OTTHUMT00000251034.1	65	106	0	0.00	0	0	G		0	0		35820519	1	no_errors	ENST00000399992	ensembl	human	known	74_37	missense	23	76	39.47	53.66	15	88	SNP	0	T
RPS6KA6	27330	genome.wustl.edu	37	X	83359602	83359602	+	Missense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chrX:83359602C>A	ENST00000262752.2	-	17	1526	c.1519G>T	c.(1519-1521)Gac>Tac	p.D507Y	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.D507Y|RPS6KA6_ENST00000495332.1_5'UTR	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	507	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						AGAATACGGTCAAGTAACTCT	0.333																																							0											0													85.0	75.0	78.0					X																	83359602		2202	4296	6498	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1519G>T	X.37:g.83359602C>A	ENSP00000262752:p.Asp507Tyr		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	p.D507Y	ENST00000262752.2	37	c.1519	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491439	0.84962	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.47528	0.84;0.84	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	T	0.73398	-0.3995	10	0.87932	D	0	.	18.0835	0.89451	0.0:1.0:0.0:0.0	.	507;507	B7ZL90;Q9UK32	.;KS6A6_HUMAN	Y	507	ENSP00000262752:D507Y;ENSP00000440830:D507Y	ENSP00000262752:D507Y	D	-	1	0	RPS6KA6	83246258	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.642000	0.83385	2.205000	0.71048	0.600000	0.82982	GAC	0	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom		0.333	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	protein_coding	OTTHUMT00000057372.1	189	322	0	0.00	0	0	C	NM_014496	0	0		83359602	-1	no_errors	ENST00000262752	ensembl	human	known	74_37	missense	122	228	49.79	46.73	121	200	SNP	1	A
NXF2	56001	genome.wustl.edu	37	X	101581401	101581401	+	Silent	SNP	C	C	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chrX:101581401C>T	ENST00000372758.1	+	27	2704	c.1854C>T	c.(1852-1854)ccC>ccT	p.P618P	NXF2_ENST00000372763.1_3'UTR|NXF2_ENST00000330252.5_Silent_p.P618P|NXF2_ENST00000372757.1_Silent_p.P618P|NXF2_ENST00000395088.2_Silent_p.P618P			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2	618	TAP-C. {ECO:0000255|PROSITE- ProRule:PRU00611}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|lung(2)	4						GCAAGATCCCCGCAGAGGCCT	0.507																																							0											0													142.0	155.0	151.0					X																	101581401		1220	2916	4136	SO:0001819	synonymous_variant	0			AJ277526	CCDS14497.1	Xq22.1	2011-05-25			ENSG00000185554				8072	protein-coding gene	gene with protein product	"""cancer/testis antigen 39"", ""TAP like protein 2"""	300315				11073998, 11279525	Standard	NM_022053		Approved	CT39, TAPL-2	uc004eix.4	Q9GZY0		ENST00000372758.1:c.1854C>T	X.37:g.101581401C>T			Q9BXU4|Q9NSS1|Q9NX66	Silent	SNP	pfam_Tap_RNA-bd,pfam_TAP_C_dom,pfam_NTF2,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.P618	ENST00000372758.1	37	c.1854	CCDS14497.1	X																																																																																			0	pfam_TAP_C_dom,superfamily_UBA-like,smart_TAP_C_dom		0.507	NXF2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2	protein_coding	OTTHUMT00000057618.1	460	219	0	0.00	0	0	C	NM_017809	0	0		101581401	1	no_errors	ENST00000330252	ensembl	human	known	74_37	silent	417	278	19.81	19.88	103	69	SNP	0.078	T
TDGF1P3	6998	genome.wustl.edu	37	X	109764188	109764188	+	RNA	SNP	A	A	G			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chrX:109764188A>G	ENST00000602699.1	+	0	649					NR_002718.2		P51864	TDGF3_HUMAN	teratocarcinoma-derived growth factor 1 pseudogene 3						signal transduction (GO:0007165)	cell outer membrane (GO:0009279)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)										TTTCCCCTGGACACCTTGCTC	0.483																																							0											0																																												0			M96956		Xq23	2011-06-24	2011-06-24	2011-06-24	ENSG00000225366	ENSG00000225366			11703	pseudogene	pseudogene			"""teratocarcinoma-derived growth factor 3, pseudogene"""	TDGF3		1882841	Standard	NR_002718		Approved	TDGF2, CR-3, CRIPTO-3, CRIPTO3	uc004eos.1	P51864	OTTHUMG00000022195		X.37:g.109764188A>G				RNA	SNP	0	NULL	ENST00000602699.1	37	NULL		X																																																																																			0	0		0.483	TDGF1P3-002	KNOWN	basic	processed_transcript	TDGF1P3	pseudogene	OTTHUMT00000467333.2	13	228	0	0.00	0	0	A	NR_002718	0	0		109764188	1	no_errors	ENST00000602699	ensembl	human	known	74_37	rna	25	369	34.21	31.86	13	173	SNP	0.013	G
PLXNA3	55558	genome.wustl.edu	37	X	153696250	153696250	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chrX:153696250C>A	ENST00000369682.3	+	21	3901	c.3726C>A	c.(3724-3726)taC>taA	p.Y1242*		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1242					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGGTGGCGTACAAGCGCAAGA	0.667																																							0											0													47.0	48.0	48.0					X																	153696250		2202	4300	6502	SO:0001587	stop_gained	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3726C>A	X.37:g.153696250C>A	ENSP00000358696:p.Tyr1242*		Q5HY36	Nonsense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Y1242*	ENST00000369682.3	37	c.3726	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	C	42	9.292668	0.99127	.	.	ENSG00000130827	ENST00000369682	.	.	.	4.79	0.755	0.18415	.	0.000000	0.48767	U	0.000177	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0571	0.36412	0.0:0.5271:0.0:0.4729	.	.	.	.	X	1242	.	ENSP00000358696:Y1242X	Y	+	3	2	PLXNA3	153349444	1.000000	0.71417	0.997000	0.53966	0.703000	0.40648	1.218000	0.32467	0.036000	0.15547	0.436000	0.28706	TAC	0	NULL		0.667	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	53	39	0	0.00	0	0	C	NM_017514	0	0		153696250	1	no_errors	ENST00000369682	ensembl	human	known	74_37	nonsense	26	45	21.21	40.79	7	31	SNP	1	A
CFAP57	149465	genome.wustl.edu	37	1	43685092	43685092	+	Missense_Mutation	SNP	T	T	G			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr1:43685092T>G	ENST00000372492.4	+	13	2455	c.2131T>G	c.(2131-2133)Tta>Gta	p.L711V		NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		711										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTGGAGGAATTAAAAATGGA	0.408																																							0											0																																										SO:0001583	missense	0																														ENST00000372492.4:c.2131T>G	1.37:g.43685092T>G	ENSP00000361570:p.Leu711Val		A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L711V	ENST00000372492.4	37	c.2131		1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.900844	0.72754	.	.	ENSG00000243710	ENST00000372492	T	0.33438	1.41	5.5	0.155	0.14906	.	.	.	.	.	T	0.35364	0.0929	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.11012	-1.0605	6	0.35671	T	0.21	.	9.7696	0.40580	0.0:0.7075:0.0:0.2925	.	.	.	.	V	711	ENSP00000361570:L711V	ENSP00000361570:L711V	L	+	1	2	WDR65	43457679	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	1.227000	0.32576	0.144000	0.18951	0.460000	0.39030	TTA	0	superfamily_Quinonprotein_ADH-like_supfam		0.408	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	protein_coding	OTTHUMT00000384325.1	50	265	0	0.37	0	1	T		0	0		43685092	1	no_errors	ENST00000372492	ensembl	human	novel	74_37	missense	7	28	81.08	85.92	30	183	SNP	1	G
LTBP1	4052	genome.wustl.edu	37	2	33488415	33488415	+	Missense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr2:33488415C>A	ENST00000404816.2	+	15	2926	c.2573C>A	c.(2572-2574)tCt>tAt	p.S858Y	LTBP1_ENST00000404525.1_Missense_Mutation_p.S479Y|LTBP1_ENST00000390003.4_Missense_Mutation_p.S533Y|LTBP1_ENST00000407925.1_Missense_Mutation_p.S532Y|LTBP1_ENST00000354476.3_Missense_Mutation_p.S859Y|LTBP1_ENST00000418533.2_Missense_Mutation_p.S532Y|LTBP1_ENST00000402934.1_Missense_Mutation_p.S479Y			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	858					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CCTGAAGCTTCTACGTCTAGT	0.428																																							0											0													144.0	140.0	141.0					2																	33488415		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2573C>A	2.37:g.33488415C>A	ENSP00000386043:p.Ser858Tyr		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.S859Y	ENST00000404816.2	37	c.2576	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039753	0.75732	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000413303;ENST00000468091	T;T;T;T;T;T;T;T;T	0.81330	-1.48;-1.46;-1.41;-1.38;-1.41;-1.4;-1.38;1.64;0.22	5.38	5.38	0.77491	.	.	.	.	.	D	0.88157	0.6361	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.979;1.0;1.0;1.0	D;D;P;D;D;D	0.91635	0.998;0.999;0.896;0.999;0.999;0.999	D	0.86560	0.1840	9	0.37606	T	0.19	.	19.1503	0.93485	0.0:1.0:0.0:0.0	.	858;532;479;532;533;859	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	Y	858;859;533;532;479;479;532;186;176	ENSP00000386043:S858Y;ENSP00000346467:S859Y;ENSP00000374653:S533Y;ENSP00000393057:S532Y;ENSP00000384373:S479Y;ENSP00000385359:S479Y;ENSP00000384091:S532Y;ENSP00000415412:S186Y;ENSP00000417591:S176Y	ENSP00000346467:S859Y	S	+	2	0	LTBP1	33341919	1.000000	0.71417	0.988000	0.46212	0.841000	0.47740	5.677000	0.68142	2.528000	0.85240	0.561000	0.74099	TCT	0	NULL		0.428	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	protein_coding	OTTHUMT00000326227.2	64	219	0	0.00	0	0	C	NM_206943	0	0		33488415	1	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	0	14	100	89.23	20	116	SNP	1	A
MCFD2	90411	genome.wustl.edu	37	2	47132657	47132657	+	Missense_Mutation	SNP	T	T	C			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr2:47132657T>C	ENST00000409105.1	-	5	565	c.386A>G	c.(385-387)gAc>gGc	p.D129G	MCFD2_ENST00000319466.4_Missense_Mutation_p.D129G|MCFD2_ENST00000409800.1_Missense_Mutation_p.D77G|MCFD2_ENST00000409207.1_Missense_Mutation_p.D129G|MCFD2_ENST00000409147.1_Missense_Mutation_p.D77G|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409973.1_Missense_Mutation_p.D129G|MCFD2_ENST00000409913.1_Missense_Mutation_p.D77G|MCFD2_ENST00000409218.1_Missense_Mutation_p.D129G|MCFD2_ENST00000493804.1_5'UTR|MCFD2_ENST00000444761.2_Missense_Mutation_p.D110G	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2	129	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		D -> E (in F5F8D2; interferes with protein folding; dbSNP:rs28942113). {ECO:0000269|PubMed:12717434}.		cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	ATTGTTCTTGTCATCATCTCT	0.368																																							0											0													257.0	195.0	216.0					2																	47132657		2203	4300	6503	SO:0001583	missense	0			AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.386A>G	2.37:g.47132657T>C	ENSP00000386651:p.Asp129Gly		A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.D129G	ENST00000409105.1	37	c.386	CCDS33192.1	2	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772629	0.90108	.	.	ENSG00000180398	ENST00000444761;ENST00000409105;ENST00000409913;ENST00000319466;ENST00000409800;ENST00000409207;ENST00000409973;ENST00000409147;ENST00000409218;ENST00000412438	D;D;D;D;D;D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4;-4.4;-4.4;-4.4;-4.4;-4.4	5.52	5.52	0.82312	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.99089	0.9687	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99170	1.0864	10	0.87932	D	0	-23.9983	15.4649	0.75390	0.0:0.0:0.0:1.0	.	110;129	E9PD95;Q8NI22	.;MCFD2_HUMAN	G	110;129;77;129;77;129;129;77;129;129	ENSP00000394647:D110G;ENSP00000386651:D129G;ENSP00000386941:D77G;ENSP00000317271:D129G;ENSP00000387202:D77G;ENSP00000386386:D129G;ENSP00000386279:D129G;ENSP00000387082:D77G;ENSP00000386261:D129G;ENSP00000402717:D129G	ENSP00000317271:D129G	D	-	2	0	MCFD2	46986161	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.478000	0.81082	2.317000	0.78254	0.460000	0.39030	GAC	0	pfscan_EF_hand_dom		0.368	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MCFD2	protein_coding	OTTHUMT00000329518.1	55	223	0	0.00	0	0	T	NM_139279	0	0		47132657	-1	no_errors	ENST00000319466	ensembl	human	known	74_37	missense	4	26	80	82.19	16	120	SNP	1	C
DIS3L2	129563	genome.wustl.edu	37	2	232952373	232952373	+	Silent	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr2:232952373C>A	ENST00000409307.1	+	5	543	c.543C>A	c.(541-543)atC>atA	p.I181I	DIS3L2_ENST00000409401.3_Silent_p.I181I|DIS3L2_ENST00000325385.7_Silent_p.I181I|DIS3L2_ENST00000273009.6_Silent_p.I181I|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000360410.4_Silent_p.I181I					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GACATGGCATCACACAAAATG	0.413																																							0											0													76.0	78.0	77.0					2																	232952373		2031	4192	6223	SO:0001819	synonymous_variant	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.543C>A	2.37:g.232952373C>A				Silent	SNP	NULL	p.I181	ENST00000409307.1	37	c.543	CCDS42834.1	2																																																																																			0	NULL		0.413	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330988.1	38	216	0	0.00	0	0	C	NM_152383	0	0		232952373	1	no_errors	ENST00000325385	ensembl	human	known	74_37	silent	2	32	93.1	78.67	27	118	SNP	0	A
POGLUT1	56983	genome.wustl.edu	37	3	119204216	119204216	+	Missense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr3:119204216C>A	ENST00000295588.4	+	6	704	c.620C>A	c.(619-621)gCa>gAa	p.A207E		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	207					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						AACTCTACAGCATATTTCCGA	0.318																																							0											0													109.0	119.0	115.0					3																	119204216		2203	4300	6503	SO:0001583	missense	0			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.620C>A	3.37:g.119204216C>A	ENSP00000295588:p.Ala207Glu		B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying,smart_LipoPS_modifying	p.A207E	ENST00000295588.4	37	c.620	CCDS2988.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254278	0.80135	.	.	ENSG00000163389	ENST00000295588	T	0.38401	1.14	5.32	4.39	0.52855	.	0.057051	0.64402	D	0.000001	T	0.57770	0.2076	M	0.83774	2.66	0.35661	D	0.8125	D	0.57899	0.981	D	0.63033	0.91	T	0.70182	-0.4942	10	0.72032	D	0.01	-15.5433	10.8883	0.46981	0.0:0.757:0.243:0.0	.	207	Q8NBL1	PGLT1_HUMAN	E	207	ENSP00000295588:A207E	ENSP00000295588:A207E	A	+	2	0	POGLUT1	120686906	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.663000	0.61532	2.634000	0.89283	0.655000	0.94253	GCA	0	pfam_LipoPS_modifying,smart_LipoPS_modifying		0.318	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	protein_coding	OTTHUMT00000355034.2	98	271	0	0.00	0	0	C	NM_152305	0	0		119204216	1	no_errors	ENST00000295588	ensembl	human	known	74_37	missense	6	18	95.86	94.41	139	321	SNP	1	A
TET2	54790	genome.wustl.edu	37	4	106190854	106190854	+	Missense_Mutation	SNP	T	T	C			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr4:106190854T>C	ENST00000540549.1	+	9	4992	c.4132T>C	c.(4132-4134)Tgt>Cgt	p.C1378R	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000380013.4_Missense_Mutation_p.C1378R|TET2_ENST00000513237.1_Missense_Mutation_p.C1399R			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1378					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTTGGACTTCTGTGCTCATGC	0.488			"""Mis N, F"""		MDS																																		0		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													110.0	95.0	100.0					4																	106190854		692	1591	2283	SO:0001583	missense	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.4132T>C	4.37:g.106190854T>C	ENSP00000442788:p.Cys1378Arg		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.C1378R	ENST00000540549.1	37	c.4132	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	T	24.3	4.519760	0.85495	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.11821	2.74;2.74;2.74	5.62	5.62	0.85841	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.42040	0.1185	M	0.83483	2.645	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.44081	-0.9351	9	0.87932	D	0	-5.0547	15.8317	0.78757	0.0:0.0:0.0:1.0	.	1399;1378	E7EQS8;Q6N021	.;TET2_HUMAN	R	1378;1399;1378	ENSP00000442788:C1378R;ENSP00000425443:C1399R;ENSP00000369351:C1378R	ENSP00000369351:C1378R	C	+	1	0	TET2	106410303	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.891000	0.87319	2.152000	0.67230	0.533000	0.62120	TGT	0	NULL		0.488	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	24	73	0	0.00	0	0	T	NM_017628	0	0		106190854	1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	1	7	95.24	88.14	20	52	SNP	1	C
CEP120	153241	genome.wustl.edu	37	5	122729053	122729053	+	Missense_Mutation	SNP	G	G	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr5:122729053G>A	ENST00000306467.5	-	6	1055	c.751C>T	c.(751-753)Cgc>Tgc	p.R251C	CEP120_ENST00000395431.2_Missense_Mutation_p.R251C|CEP120_ENST00000328236.5_Missense_Mutation_p.R251C|CEP120_ENST00000306481.6_Missense_Mutation_p.R225C			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	251					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						CTACGGATGCGAACTGATGCT	0.403																																							0											0													133.0	131.0	131.0					5																	122729053		1889	4137	6026	SO:0001583	missense	0			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.751C>T	5.37:g.122729053G>A	ENSP00000303058:p.Arg251Cys		Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	pfam_DUF3668,superfamily_C2_dom	p.R251C	ENST00000306467.5	37	c.751	CCDS4134.2	5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984590	0.74474	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442;ENST00000395431	T;T;T;T	0.56103	1.8;1.8;1.79;0.48	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75175	-0.3410	10	0.87932	D	0	-4.5163	13.2982	0.60309	0.0:0.0:0.7234:0.2766	.	251	Q8N960	CE120_HUMAN	C	251;251;225;225;251	ENSP00000303058:R251C;ENSP00000327504:R251C;ENSP00000307419:R225C;ENSP00000421620:R225C	ENSP00000303058:R251C	R	-	1	0	CEP120	122756952	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.965000	0.63708	2.702000	0.92279	0.591000	0.81541	CGC	0	NULL		0.403	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP120	protein_coding	OTTHUMT00000250899.2	147	221	0.68	0.00	1	0	G	NM_153223	0	0		122729053	-1	no_errors	ENST00000306467	ensembl	human	known	74_37	missense	116	149	47.27	52.24	104	163	SNP	1	A
PCDHB11	56125	genome.wustl.edu	37	5	140580692	140580692	+	Missense_Mutation	SNP	C	C	A	rs116689702	byFrequency	TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr5:140580692C>A	ENST00000354757.3	+	1	1345	c.1345C>A	c.(1345-1347)Ccc>Acc	p.P449T	PCDHB11_ENST00000536699.1_Missense_Mutation_p.P84T	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	449	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGACAACGCCCCCACCTTCAC	0.567																																							0											0													147.0	131.0	137.0					5																	140580692		2203	4300	6503	SO:0001583	missense	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1345C>A	5.37:g.140580692C>A	ENSP00000346802:p.Pro449Thr		B4DSF7|Q2M223	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P449T	ENST00000354757.3	37	c.1345	CCDS4253.1	5	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740185	0.69304	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	D;D	0.84730	-1.89;-1.89	2.52	2.52	0.30459	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.95818	0.8639	H	0.99842	4.835	0.45261	D	0.998267	D	0.89917	1.0	D	0.97110	1.0	D	0.96715	0.9528	9	0.87932	D	0	.	13.0768	0.59091	0.0:1.0:0.0:0.0	.	449	Q9Y5F2	PCDBB_HUMAN	T	84;449	ENSP00000440344:P84T;ENSP00000346802:P449T	ENSP00000346802:P449T	P	+	1	0	PCDHB11	140560876	1.000000	0.71417	0.604000	0.28916	0.016000	0.09150	7.540000	0.82074	1.417000	0.47077	0.306000	0.20318	CCC	0	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.567	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	protein_coding	OTTHUMT00000251813.1	124	15	0	0.00	0	0	C	NM_018931	0	0		140580692	1	no_errors	ENST00000354757	ensembl	human	known	74_37	missense	60	15	55.56	48.28	75	14	SNP	0.993	A
EBF1	1879	genome.wustl.edu	37	5	158523987	158523987	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr5:158523987C>A	ENST00000313708.6	-	2	568	c.286G>T	c.(286-288)Gaa>Taa	p.E96*	EBF1_ENST00000380654.4_Nonsense_Mutation_p.E96*|EBF1_ENST00000517373.1_Nonsense_Mutation_p.E96*|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	96					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTACTTTTTCCTTCTCCACG	0.642			T	HMGA2	lipoma																																		0		Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													62.0	51.0	55.0					5																	158523987		2203	4300	6503	SO:0001587	stop_gained	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.286G>T	5.37:g.158523987C>A	ENSP00000322898:p.Glu96*		Q8IW11	Nonsense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.E96*	ENST00000313708.6	37	c.286	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	C	41	8.741490	0.98935	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.2458	19.6909	0.96000	0.0:1.0:0.0:0.0	.	.	.	.	X	96	.	ENSP00000322898:E96X	E	-	1	0	EBF1	158456565	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.797000	0.85911	2.643000	0.89663	0.561000	0.74099	GAA	0	NULL		0.642	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	protein_coding	OTTHUMT00000252649.1	73	141	0	0.00	0	0	C	NM_024007	0	0		158523987	-1	no_errors	ENST00000313708	ensembl	human	known	74_37	nonsense	35	135	37.93	38.64	22	85	SNP	1	A
B4GALT7	11285	genome.wustl.edu	37	5	177036622	177036622	+	Missense_Mutation	SNP	G	G	A	rs145082497	byFrequency	TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr5:177036622G>A	ENST00000029410.5	+	6	1021	c.910G>A	c.(910-912)Ggg>Agg	p.G304R	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	304					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCTGTGGGCGGGGCCCCCTG	0.592																																							0											0								G	ARG/GLY	5,4401		0,5,2198	77.0	74.0	75.0		910	5.2	1.0	5	dbSNP_134	75	0,8600		0,0,4300	yes	missense	B4GALT7	NM_007255.2	125	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	possibly-damaging	304/328	177036622	5,13001	2203	4300	6503	SO:0001583	missense	0			AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.910G>A	5.37:g.177036622G>A	ENSP00000029410:p.Gly304Arg		B3KN39|Q9UHN2	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.G304R	ENST00000029410.5	37	c.910	CCDS4429.1	5	.	.	.	.	.	.	.	.	.	.	.	25.7	4.661961	0.88251	0.001135	0.0	ENSG00000027847	ENST00000029410;ENST00000541139	T	0.72282	-0.64	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	M	0.88031	2.925	0.80722	D	1	D	0.57571	0.98	P	0.44422	0.449	T	0.78398	-0.2219	10	0.24483	T	0.36	-36.738	16.596	0.84796	0.0:0.0:1.0:0.0	.	304	Q9UBV7	B4GT7_HUMAN	R	304;190	ENSP00000029410:G304R	ENSP00000029410:G304R	G	+	1	0	B4GALT7	176969228	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	5.905000	0.69893	2.586000	0.87340	0.561000	0.74099	GGG	0	NULL		0.592	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT7	protein_coding	OTTHUMT00000253421.1	64	125	0	0.00	0	0	G	NM_007255	rs145082497	G->A		177036622	1	no_errors	ENST00000029410	ensembl	human	known	74_37	missense	24	61	33.33	55.07	12	76	SNP	1	A
TDRG1	732253	genome.wustl.edu	37	6	40347300	40347300	+	RNA	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr6:40347300G>T	ENST00000373170.2	+	0	841				TDRG1_ENST00000448559.1_RNA|TDRG1_ENST00000451810.1_RNA|TDRG1_ENST00000448433.1_RNA	NR_024015.1		Q3Y452	TDRG1_HUMAN	testis development related 1 (non-protein coding)						multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GATTCGTCTGGTTCCTTAGTA	0.493																																							0											0																																												0			DQ168992		6p21.2	2014-07-18	2011-12-13		ENSG00000204091	ENSG00000204091		"""-"""	43642	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 532"""	615676				19403381, 22123530, 24595048	Standard	NR_024015		Approved	LINC00532	uc003opg.2		OTTHUMG00000014660		6.37:g.40347300G>T				RNA	SNP	0	NULL	ENST00000373170.2	37	NULL		6																																																																																			0	0		0.493	TDRG1-002	KNOWN	basic	antisense	TDRG1	antisense	OTTHUMT00000040484.1	76	217	0	0.46	0	1	G	NR_024015	0	0		40347300	1	no_errors	ENST00000373170	ensembl	human	known	74_37	rna	6	41	75	69.57	18	96	SNP	0	T
BAG2	9532	genome.wustl.edu	37	6	57048769	57048769	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr6:57048769C>G	ENST00000370693.5	+	3	789	c.417C>G	c.(415-417)taC>taG	p.Y139*	BAG2_ENST00000545080.1_Nonsense_Mutation_p.Y106*	NM_004282.3	NP_004273.1	O95816	BAG2_HUMAN	BCL2-associated athanogene 2	139	BAG. {ECO:0000255|PROSITE- ProRule:PRU00369}.				protein folding (GO:0006457)|protein metabolic process (GO:0019538)		identical protein binding (GO:0042802)			endometrium(1)|large_intestine(1)	2	Lung NSC(77;0.126)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TGTCGCTCTACAGTGCATGTT	0.408																																							0											0													139.0	134.0	136.0					6																	57048769		2203	4300	6503	SO:0001587	stop_gained	0			AF095192	CCDS4961.1	6p12.3-p11.2	2008-02-05			ENSG00000112208	ENSG00000112208			938	protein-coding gene	gene with protein product		603882				9873016	Standard	NM_004282		Approved		uc003pdr.3	O95816	OTTHUMG00000014919	ENST00000370693.5:c.417C>G	6.37:g.57048769C>G	ENSP00000359727:p.Tyr139*		B4DXE2|Q08AS9|Q6FID0	Nonsense_Mutation	SNP	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.Y139*	ENST00000370693.5	37	c.417	CCDS4961.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.736456	0.96865	.	.	ENSG00000112208	ENST00000370693;ENST00000438730;ENST00000545080	.	.	.	6.06	5.09	0.68999	.	0.096387	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-15.8498	6.8269	0.23889	0.0:0.7364:0.0:0.2636	.	.	.	.	X	139;88;106	.	ENSP00000359727:Y139X	Y	+	3	2	BAG2	57156728	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	0.516000	0.22817	2.879000	0.98667	0.650000	0.86243	TAC	0	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain		0.408	BAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG2	protein_coding	OTTHUMT00000041044.2	64	196	0	0.51	0	1	C		0	0		57048769	1	no_errors	ENST00000370693	ensembl	human	known	74_37	nonsense	40	113	9.09	8.80	4	11	SNP	1	G
L3MBTL3	84456	genome.wustl.edu	37	6	130425690	130425690	+	Missense_Mutation	SNP	C	C	G			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr6:130425690C>G	ENST00000529410.1	+	21	2335	c.1856C>G	c.(1855-1857)gCa>gGa	p.A619G	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.A594G|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.A594G|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.A594G|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.A619G|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.A619G			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	619					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		AGGACAGATGCAAATGAAAGC	0.348																																							0											0													102.0	105.0	104.0					6																	130425690		2203	4300	6503	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1856C>G	6.37:g.130425690C>G	ENSP00000431962:p.Ala619Gly		Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.A619G	ENST00000529410.1	37	c.1856	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	C	7.175	0.588461	0.13812	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.15017	2.47;2.46;2.47;2.46;2.46;2.47	6.17	5.14	0.70334	.	0.432061	0.28414	N	0.015437	T	0.03263	0.0095	N	0.14661	0.345	0.28378	N	0.919691	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37174	-0.9717	10	0.20519	T	0.43	.	8.8575	0.35236	0.0:0.7575:0.1552:0.0873	.	594;619	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	G	619;594;619;594;594;619	ENSP00000431962:A619G;ENSP00000437185:A594G;ENSP00000354526:A619G;ENSP00000357121:A594G;ENSP00000436706:A594G;ENSP00000357118:A619G	ENSP00000354526:A619G	A	+	2	0	L3MBTL3	130467383	0.078000	0.21339	0.999000	0.59377	0.320000	0.28249	0.430000	0.21428	2.941000	0.99782	0.655000	0.94253	GCA	0	NULL		0.348	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	protein_coding	OTTHUMT00000042195.2	93	279	0	0.00	0	0	C	XM_027074	0	0		130425690	1	no_errors	ENST00000361794	ensembl	human	known	74_37	missense	6	17	91.18	91.50	62	183	SNP	0.975	G
TOPORS	10210	genome.wustl.edu	37	9	32543745	32543745	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr9:32543745G>A	ENST00000360538.2	-	3	894	c.778C>T	c.(778-780)Cga>Tga	p.R260*	TOPORS_ENST00000379858.1_Nonsense_Mutation_p.R195*	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	260	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TAAAGAGTTCGTCTAAAATTA	0.398																																							0											0													82.0	89.0	87.0					9																	32543745		2203	4300	6503	SO:0001587	stop_gained	0			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.778C>T	9.37:g.32543745G>A	ENSP00000353735:p.Arg260*		O43273|Q6P987|Q9NS55|Q9UNR9	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R260*	ENST00000360538.2	37	c.778	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651449	0.88056	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	.	.	.	5.93	1.5	0.22942	.	0.000000	0.40908	D	0.000995	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.9253	8.3159	0.32100	0.0809:0.0:0.3066:0.6125	.	.	.	.	X	260;195	.	ENSP00000353735:R260X	R	-	1	2	TOPORS	32533745	0.989000	0.36119	0.942000	0.38095	0.974000	0.67602	1.845000	0.39279	0.364000	0.24374	-0.150000	0.13652	CGA	0	NULL		0.398	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	protein_coding	OTTHUMT00000052007.1	51	226	0	0.00	0	0	G	NM_005802	0	0		32543745	-1	no_errors	ENST00000360538	ensembl	human	known	74_37	nonsense	9	109	47.06	20.86	8	29	SNP	0.971	A
SIRT3	23410	genome.wustl.edu	37	11	218806	218806	+	Intron	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr11:218806G>T	ENST00000382743.4	-	6	1282				SIRT3_ENST00000525319.1_Intron|SIRT3_ENST00000532956.1_Intron|SIRT3_ENST00000524564.1_Missense_Mutation_p.P338Q|SIRT3_ENST00000529382.1_Intron	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3						aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		GCAGCCCCTTGGATGGTCCTC	0.547																																							0											0													87.0	72.0	77.0					11																	218806		2203	4300	6503	SO:0001627	intron_variant	0			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.1179+25C>A	11.37:g.218806G>T			B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.P338Q	ENST00000382743.4	37	c.1013	CCDS7691.1	11	.	.	.	.	.	.	.	.	.	.	G	1.669	-0.509575	0.04231	.	.	ENSG00000142082	ENST00000524564	T	0.21543	2.0	2.2	-4.4	0.03600	.	.	.	.	.	T	0.08313	0.0207	.	.	.	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.22765	-1.0207	8	0.14656	T	0.56	.	1.5879	0.02648	0.2746:0.12:0.4254:0.18	.	402;338	B7Z7G4;E9PN58	.;.	Q	338	ENSP00000432937:P338Q	ENSP00000432937:P338Q	P	-	2	0	SIRT3	208806	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.554000	0.06006	-3.360000	0.00179	-0.752000	0.03492	CCA	0	pirsf_NAD-dep_deAcase_SIR2_class_I		0.547	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	protein_coding	OTTHUMT00000239288.3	23	144	0	0.00	0	0	G		0	0		218806	-1	no_errors	ENST00000524564	ensembl	human	novel	74_37	missense	1	15	80	86.36	4	95	SNP	0	T
INCENP	3619	genome.wustl.edu	37	11	61897414	61897414	+	Missense_Mutation	SNP	G	G	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr11:61897414G>A	ENST00000394818.3	+	4	617	c.415G>A	c.(415-417)Gct>Act	p.A139T	INCENP_ENST00000278849.4_Missense_Mutation_p.A139T	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	139					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CATGGCATTGGCTGCACCTTC	0.632																																							0											0													63.0	63.0	63.0					11																	61897414		2202	4299	6501	SO:0001583	missense	0			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.415G>A	11.37:g.61897414G>A	ENSP00000378295:p.Ala139Thr		A8MQD2|Q5Y192	Missense_Mutation	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.A139T	ENST00000394818.3	37	c.415	CCDS44624.1	11	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745388	0.30955	.	.	ENSG00000149503	ENST00000394818;ENST00000533896;ENST00000278849	T;T;T	0.23950	2.42;1.88;2.43	3.39	0.505	0.16953	.	2.122320	0.02951	N	0.141729	T	0.25457	0.0619	N	0.08118	0	0.09310	N	1	D;B;B	0.67145	0.996;0.06;0.036	P;B;B	0.62740	0.906;0.019;0.008	T	0.33420	-0.9869	10	0.20519	T	0.43	.	5.8721	0.18809	0.3317:0.0:0.6683:0.0	.	139;139;139	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	T	139	ENSP00000378295:A139T;ENSP00000433100:A139T;ENSP00000278849:A139T	ENSP00000278849:A139T	A	+	1	0	INCENP	61653990	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	0.141000	0.16076	0.111000	0.17947	0.561000	0.74099	GCT	0	NULL		0.632	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	protein_coding	OTTHUMT00000394723.2	55	71	0	0.00	0	0	G	NM_020238	0	0		61897414	1	no_errors	ENST00000394818	ensembl	human	known	74_37	missense	23	47	14.81	6.00	4	3	SNP	0.001	A
SLC22A25	387601	genome.wustl.edu	37	11	62931391	62931391	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr11:62931391C>A	ENST00000306494.6	-	9	1548	c.1549G>T	c.(1549-1551)Gaa>Taa	p.E517*	SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						TTCCTGGTTTCAGGAAGGAGG	0.507																																							0											0													125.0	125.0	125.0					11																	62931391		2201	4298	6499	SO:0001587	stop_gained	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.1549G>T	11.37:g.62931391C>A	ENSP00000307443:p.Glu517*			Nonsense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.E517*	ENST00000306494.6	37	c.1549	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996559	0.74818	.	.	ENSG00000196600	ENST00000306494	.	.	.	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.6056	0.62046	0.0:1.0:0.0:0.0	.	.	.	.	X	517	.	ENSP00000307443:E517X	E	-	1	0	SLC22A25	62687967	0.998000	0.40836	0.998000	0.56505	0.480000	0.33159	3.540000	0.53611	2.341000	0.79615	0.586000	0.80456	GAA	0	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.507	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	protein_coding	OTTHUMT00000383519.3	66	142	0	0.00	0	0	C	NM_199352	0	0		62931391	-1	no_errors	ENST00000306494	ensembl	human	known	74_37	nonsense	4	15	89.19	83.52	33	76	SNP	1	A
MAP6	4135	genome.wustl.edu	37	11	75298357	75298357	+	Missense_Mutation	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr11:75298357G>T	ENST00000304771.3	-	4	2939	c.2189C>A	c.(2188-2190)aCa>aAa	p.T730K	CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526740.1_Missense_Mutation_p.T401K|MAP6_ENST00000526689.1_5'Flank	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	730	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					CTGTAGGACTGTGGGGCCTTG	0.498																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)		0											0													155.0	157.0	156.0					11																	75298357		2200	4293	6493	SO:0001583	missense	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.2189C>A	11.37:g.75298357G>T	ENSP00000307093:p.Thr730Lys		A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	pfam_MAP6/FAM154	p.T730K	ENST00000304771.3	37	c.2189	CCDS31641.1	11	.	.	.	.	.	.	.	.	.	.	G	4.135	0.023451	0.08006	.	.	ENSG00000171533	ENST00000304771;ENST00000526740;ENST00000545476	T	0.46063	0.88	4.55	-0.908	0.10517	.	2.055920	0.01889	N	0.038404	T	0.19366	0.0465	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20174	-1.0283	10	0.05721	T	0.95	2.204	4.8152	0.13363	0.4684:0.1682:0.3634:0.0	.	730	Q96JE9	MAP6_HUMAN	K	730;401;401	ENSP00000307093:T730K	ENSP00000307093:T730K	T	-	2	0	MAP6	74976005	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.275000	0.08525	0.034000	0.15491	-0.238000	0.12139	ACA	0	NULL		0.498	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	protein_coding	OTTHUMT00000383527.1	116	242	0	0.00	0	0	G	NM_033063	0	0		75298357	-1	no_errors	ENST00000304771	ensembl	human	known	74_37	missense	2	29	94.87	87.34	37	200	SNP	0.001	T
PZP	5858	genome.wustl.edu	37	12	9353546	9353546	+	Silent	SNP	C	C	A	rs138554768		TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr12:9353546C>A	ENST00000261336.2	-	6	640	c.612G>T	c.(610-612)gtG>gtT	p.V204V	PZP_ENST00000381997.2_Silent_p.V73V	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	204					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TCTGTACCACCACCCTGTAGG	0.473																																					Melanoma(125;1402 1695 4685 34487 38571)		0											0													144.0	139.0	141.0					12																	9353546		2203	4300	6503	SO:0001819	synonymous_variant	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.612G>T	12.37:g.9353546C>A			A6ND27|Q15273|Q2NKL2|Q7M4N7	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V204	ENST00000261336.2	37	c.612	CCDS8600.1	12																																																																																			0	pfam_A2M_N		0.473	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	protein_coding	OTTHUMT00000337624.1	48	118	0	0.84	0	1	C	NM_002864	0	0		9353546	-1	no_errors	ENST00000261336	ensembl	human	known	74_37	silent	0	11	100	88.78	20	87	SNP	0.635	A
RFXAP	5994	genome.wustl.edu	37	13	37393923	37393923	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr13:37393923C>G	ENST00000255476.2	+	1	563	c.429C>G	c.(427-429)taC>taG	p.Y143*		NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	143					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		CCTGCACCTACGAAGGCTGCA	0.617																																							0											0													33.0	28.0	30.0					13																	37393923		2196	4294	6490	SO:0001587	stop_gained	0			Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.429C>G	13.37:g.37393923C>G	ENSP00000255476:p.Tyr143*		B2R9T8|Q5VZM6|Q8TC40	Nonsense_Mutation	SNP	NULL	p.Y143*	ENST00000255476.2	37	c.429	CCDS9359.1	13	.	.	.	.	.	.	.	.	.	.	c	26.6	4.748972	0.89753	.	.	ENSG00000133111	ENST00000255476	.	.	.	4.62	2.87	0.33458	.	0.205103	0.43416	D	0.000575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.9664	10.0815	0.42393	0.0:0.8313:0.0:0.1687	.	.	.	.	X	143	.	ENSP00000255476:Y143X	Y	+	3	2	RFXAP	36291923	0.999000	0.42202	0.986000	0.45419	0.192000	0.23643	0.596000	0.24044	0.552000	0.29026	0.645000	0.84053	TAC	0	NULL		0.617	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFXAP	protein_coding	OTTHUMT00000044521.1	38	30	0	0.00	0	0	C	NM_000538	0	0		37393923	1	no_errors	ENST00000255476	ensembl	human	known	74_37	nonsense	0	1	100	96.77	26	30	SNP	1	G
SHC4	399694	genome.wustl.edu	37	15	49135615	49135615	+	Missense_Mutation	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr15:49135615G>T	ENST00000332408.4	-	10	1902	c.1474C>A	c.(1474-1476)Cac>Aac	p.H492N	SHC4_ENST00000537958.1_Missense_Mutation_p.H206N|SHC4_ENST00000396535.3_Missense_Mutation_p.H249N	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	492	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CTTCCGCAGTGCCATGGGCTC	0.443																																							0											0													150.0	147.0	148.0					15																	49135615		2197	4295	6492	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1474C>A	15.37:g.49135615G>T	ENSP00000329668:p.His492Asn		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.H492N	ENST00000332408.4	37	c.1474	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	G	10.43	1.346738	0.24426	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.29142	3.59;1.58;1.59	5.0	3.13	0.36017	.	0.918572	0.09276	N	0.824418	T	0.21062	0.0507	L	0.29908	0.895	0.09310	N	1	B;B	0.25904	0.137;0.017	B;B	0.29077	0.098;0.028	T	0.35822	-0.9773	10	0.15499	T	0.54	-4.4269	6.0199	0.19623	0.1633:0.0:0.6861:0.1506	.	249;492	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	N	492;249;206	ENSP00000329668:H492N;ENSP00000379786:H249N;ENSP00000443300:H206N	ENSP00000329668:H492N	H	-	1	0	SHC4	46922907	0.912000	0.30974	0.802000	0.32245	0.681000	0.39784	1.414000	0.34736	0.698000	0.31739	-0.142000	0.14014	CAC	0	NULL		0.443	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	protein_coding	OTTHUMT00000254371.1	53	191	0	0.00	0	0	G	NM_203349	0	0		49135615	-1	no_errors	ENST00000332408	ensembl	human	known	74_37	missense	3	11	88	89.00	22	89	SNP	0.095	T
HSD11B2	3291	genome.wustl.edu	37	16	67470564	67470564	+	Silent	SNP	G	G	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr16:67470564G>A	ENST00000326152.5	+	5	1008	c.876G>A	c.(874-876)ctG>ctA	p.L292L	ATP6V0D1_ENST00000567694.1_5'Flank	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2	292					female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		AAGAGCTGCTGCAGGCCTACG	0.577																																							0											0													85.0	74.0	78.0					16																	67470564		2198	4300	6498	SO:0001819	synonymous_variant	0			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.876G>A	16.37:g.67470564G>A			A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	p.L292	ENST00000326152.5	37	c.876	CCDS10837.1	16																																																																																			0	NULL		0.577	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD11B2	protein_coding	OTTHUMT00000268826.3	68	52	0	0.00	0	0	G	NM_000196	0	0		67470564	1	no_errors	ENST00000326152	ensembl	human	known	74_37	silent	3	4	87.5	88.57	21	31	SNP	0.987	A
EMC8	10328	genome.wustl.edu	37	16	85832706	85832706	+	Missense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr16:85832706C>A	ENST00000253457.3	-	1	440	c.196G>T	c.(196-198)Gcc>Tcc	p.A66S	COX4I1_ENST00000562336.1_5'Flank|COX4I1_ENST00000561569.1_5'Flank|COX4I1_ENST00000253452.2_5'Flank|COX4I1_ENST00000564903.1_5'Flank|EMC8_ENST00000435200.2_Missense_Mutation_p.A66S|COX4I1_ENST00000568794.1_5'Flank	NM_006067.4	NP_006058.1	O43402	EMC8_HUMAN	ER membrane protein complex subunit 8	66						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GGGGCGAGGGCCAGGGTGCCG	0.692																																							0											0													9.0	10.0	10.0					16																	85832706		2175	4268	6443	SO:0001583	missense	0			AF005888	CCDS10954.1, CCDS45541.1	16q24	2012-05-30	2012-05-30	2012-05-30	ENSG00000131148	ENSG00000131148			7864	protein-coding gene	gene with protein product	"""family with sequence similarity 158, member B"""	604886	"""chromosome 16 open reading frame 4"", ""neighbor of COX4"", ""chromosome 16 open reading frame 2"", ""COX4 neighbor"""	C16orf4, NOC4, C16orf2, COX4NB		10337626, 22119785	Standard	NM_006067		Approved	FAM158B	uc002fjd.3	O43402	OTTHUMG00000137647	ENST00000253457.3:c.196G>T	16.37:g.85832706C>A	ENSP00000253457:p.Ala66Ser		C9JB21	Missense_Mutation	SNP	pfam_UPF0172	p.A66S	ENST00000253457.3	37	c.196	CCDS10954.1	16	.	.	.	.	.	.	.	.	.	.	C	14.06	2.422600	0.43020	.	.	ENSG00000131148	ENST00000253457;ENST00000435200	T;T	0.47528	0.84;0.84	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.32941	0.0846	L	0.27053	0.805	0.80722	D	1	B	0.16166	0.016	B	0.15870	0.014	T	0.12734	-1.0536	10	0.08381	T	0.77	-12.4928	14.6775	0.68993	0.1459:0.8541:0.0:0.0	.	66	O43402	CX4NB_HUMAN	S	66	ENSP00000253457:A66S;ENSP00000391730:A66S	ENSP00000253457:A66S	A	-	1	0	COX4NB	84390207	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.116000	0.57871	2.469000	0.83416	0.650000	0.86243	GCC	0	pfam_UPF0172		0.692	EMC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC8	protein_coding	OTTHUMT00000269099.1	23	5	0	0.00	0	0	C	NM_006067	0	0		85832706	-1	no_errors	ENST00000253457	ensembl	human	known	74_37	missense	1	6	80	81.82	4	27	SNP	1	A
LOC100996291	100996291	genome.wustl.edu	37	17	76267476	76267476	+	lincRNA	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr17:76267476C>A	ENST00000374945.1	-	0	621					NR_073178.1																						GGGCAAGAGGCAAACAGTCAT	0.617																																							0											0																																												0																															17.37:g.76267476C>A				RNA	SNP	0	NULL	ENST00000374945.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	C	1.929	-0.446453	0.04604	.	.	ENSG00000204277	ENST00000374945	.	.	.	1.66	-0.891	0.10573	.	.	.	.	.	T	0.36358	0.0964	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46105	-0.9215	4	0.87932	D	0	.	3.0534	0.06176	0.0:0.4246:0.3634:0.212	.	.	.	.	F	180	.	ENSP00000364083:C180F	C	-	2	0	AC087645.1	73779071	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.403000	0.20982	-0.184000	0.10567	0.491000	0.48974	TGC	0	0		0.617	RP11-219G17.4-001	KNOWN	basic	lincRNA	LOC100996291	lincRNA	OTTHUMT00000437286.1	39	63	0	0.00	0	0	C		0	0		76267476	-1	no_errors	ENST00000374945	ensembl	human	known	74_37	rna	0	8	100	86.21	8	50	SNP	0	A
ZNF492	57615	genome.wustl.edu	37	19	22847765	22847765	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr19:22847765C>T	ENST00000456783.2	+	4	1538	c.1294C>T	c.(1294-1296)Cag>Tag	p.Q432*	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AGCTTTTAACCAGTCCTCAAC	0.378																																							0											0													20.0	24.0	23.0					19																	22847765		1794	3878	5672	SO:0001587	stop_gained	0			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1294C>T	19.37:g.22847765C>T	ENSP00000413660:p.Gln432*		Q08EI7|Q08EI8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q432*	ENST00000456783.2	37	c.1294	CCDS46032.1	19	.	.	.	.	.	.	.	.	.	.	.	16.57	3.158973	0.57368	.	.	ENSG00000229676	ENST00000456783	.	.	.	1.12	-2.25	0.06888	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	0.1765	0.00119	0.2145:0.2077:0.214:0.3639	.	.	.	.	X	432	.	ENSP00000413660:Q432X	Q	+	1	0	ZNF492	22639605	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.527000	0.06200	-0.812000	0.04363	-0.798000	0.03219	CAG	0	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	protein_coding	OTTHUMT00000464581.1	45	6	0	0.00	0	0	C	NM_020855	0	0		22847765	1	no_errors	ENST00000456783	ensembl	human	known	74_37	nonsense	60	1	41.9	66.67	44	2	SNP	0	T
AXL	558	genome.wustl.edu	37	19	41743942	41743942	+	Missense_Mutation	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr19:41743942C>A	ENST00000301178.4	+	7	1067	c.877C>A	c.(877-879)Cag>Aag	p.Q293K	AXL_ENST00000359092.3_Missense_Mutation_p.Q293K|AXL_ENST00000593513.1_Missense_Mutation_p.Q25K	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	293	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GCCCCCCCATCAGCTTCGGCT	0.642																																							0											0													104.0	106.0	106.0					19																	41743942		2203	4300	6503	SO:0001583	missense	0			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.877C>A	19.37:g.41743942C>A	ENSP00000301178:p.Gln293Lys		Q8N5L2|Q9UD27	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q293K	ENST00000301178.4	37	c.877	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	c	0.233	-1.019721	0.02078	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.56941	0.43;0.43	4.26	1.87	0.25490	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.950152	0.08675	U	0.910290	T	0.38931	0.1059	L	0.44542	1.39	0.25579	N	0.986816	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.32348	-0.9910	10	0.06099	T	0.92	-0.9035	8.3703	0.32410	0.1731:0.6582:0.1687:0.0	.	293;293	P30530-2;P30530	.;UFO_HUMAN	K	293	ENSP00000301178:Q293K;ENSP00000351995:Q293K	ENSP00000301178:Q293K	Q	+	1	0	AXL	46435782	0.822000	0.29219	0.474000	0.27266	0.345000	0.29048	1.540000	0.36115	1.089000	0.41292	0.448000	0.29417	CAG	0	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	protein_coding	OTTHUMT00000463323.2	33	99	0	0.00	0	0	C		0	0		41743942	1	no_errors	ENST00000301178	ensembl	human	known	74_37	missense	11	98	47.62	43.02	10	74	SNP	0.772	A
RIMBP3	85376	genome.wustl.edu	37	22	20458238	20458238	+	Missense_Mutation	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr22:20458238G>T	ENST00000426804.1	-	1	3548	c.3064C>A	c.(3064-3066)Cat>Aat	p.H1022N	SCARNA18_ENST00000516215.1_RNA|RN7SKP131_ENST00000363006.1_RNA|SCARNA17_ENST00000516762.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	1022	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TATACCACATGGGGGTGGCGG	0.627																																							0											0													6.0	10.0	9.0					22																	20458238		1711	3883	5594	SO:0001583	missense	0			AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.3064C>A	22.37:g.20458238G>T	ENSP00000391564:p.His1022Asn		Q8IYP7|Q9BY94|Q9UFQ5	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,pfscan_SH3_domain	p.H1022N	ENST00000426804.1	37	c.3064	CCDS46665.1	22	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655292	0.29425	.	.	ENSG00000196622	ENST00000355186;ENST00000426804	T	0.53640	0.61	3.56	3.56	0.40772	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.80422	2.495	0.42816	D	0.993976	D	0.89917	1.0	D	0.87578	0.998	T	0.69793	-0.5049	10	0.87932	D	0	-18.1162	8.5	0.33152	0.0:0.0:0.7683:0.2317	.	928	Q9UFD9	RIM3A_HUMAN	N	928;1022	ENSP00000391564:H1022N	ENSP00000347318:H928N	H	-	1	0	RIMBP3	18838238	1.000000	0.71417	0.038000	0.18304	0.039000	0.13416	8.568000	0.90741	1.999000	0.58509	0.398000	0.26397	CAT	0	superfamily_Fibronectin_type3		0.627	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP3	protein_coding	OTTHUMT00000318945.2	108	156	0	0.00	0	0	G	NM_015672	0	0		20458238	-1	no_errors	ENST00000426804	ensembl	human	known	74_37	missense	84	187	20	16.07	21	36	SNP	0.697	T
GATSL3	652968	genome.wustl.edu	37	22	30681675	30681675	+	Silent	SNP	C	C	A			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr22:30681675C>A	ENST00000407689.3	-	9	1053	c.924G>T	c.(922-924)gtG>gtT	p.V308V	GATSL3_ENST00000404953.3_Silent_p.V270V|RP1-130H16.18_ENST00000447976.1_3'UTR|GATSL3_ENST00000459785.1_Intron	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	308										breast(1)|endometrium(1)|lung(1)	3						CGTCCTCGGGCACCTGAGGGC	0.682																																							0											0													10.0	13.0	12.0					22																	30681675		2018	4146	6164	SO:0001819	synonymous_variant	0				CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.924G>T	22.37:g.30681675C>A			O76052|Q96ND9|Q9UIE8	Silent	SNP	NULL	p.V308	ENST00000407689.3	37	c.924	CCDS43001.1	22																																																																																			0	NULL		0.682	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATSL3	protein_coding	OTTHUMT00000320581.2	79	40	0	0.00	0	0	C	NM_001037666	0	0		30681675	-1	no_errors	ENST00000407689	ensembl	human	known	74_37	silent	44	28	42.86	49.09	33	27	SNP	1	A
CBY1	25776	genome.wustl.edu	37	22	39069240	39069240	+	Nonstop_Mutation	SNP	G	G	T			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr22:39069240G>T	ENST00000216029.3	+	5	514	c.380G>T	c.(379-381)tGa>tTa	p.*127L	RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA|RP3-508I15.9_ENST00000412067.1_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	0					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					AAGAGAAAATGAAGACCCCAG	0.458																																							0											0													78.0	70.0	73.0					22																	39069240		2203	4300	6503	SO:0001578	stop_lost	0			BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.380G>T	22.37:g.39069240G>T	ENSP00000216029:p.*127Leuext*32		B2R4S2|Q66GT6|Q9UIK9	Nonstop_Mutation	SNP	NULL	p.*127L	ENST00000216029.3	37	c.380	CCDS13974.1	22	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530147	0.45073	.	.	ENSG00000100211	ENST00000396811;ENST00000216029	.	.	.	5.48	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3975	0.55393	0.0771:0.0:0.9229:0.0	.	.	.	.	L	127	.	.	X	+	2	2	CBY1	37399186	1.000000	0.71417	0.998000	0.56505	0.569000	0.35902	4.392000	0.59659	1.317000	0.45149	0.655000	0.94253	TGA	0	NULL		0.458	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBY1	protein_coding	OTTHUMT00000320832.1	95	193	0	0.00	0	0	G	NM_015373	0	0		39069240	1	no_errors	ENST00000216029	ensembl	human	known	74_37	nonstop	69	186	34.29	34.51	36	98	SNP	1	T
PPWD1	23398	genome.wustl.edu	37	5	64868114	64868114	+	Splice_Site	DEL	G	G	-			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr5:64868114delG	ENST00000261308.5	+	5	1041		c.e5+1		PPWD1_ENST00000535264.1_Splice_Site|PPWD1_ENST00000538977.1_Splice_Site	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1						mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		ATCACTAAGCGTAAGTGTAAT	0.284																																							0											0													33.0	38.0	36.0					5																	64868114		2196	4290	6486	SO:0001630	splice_region_variant	0			AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.969+1G>-	5.37:g.64868114delG			B4DWR9|Q15002|Q7KZ89	Splice_Site	DEL	0	e5+1	ENST00000261308.5	37	c.969+1	CCDS3985.1	5																																																																																			0	0		0.284	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPWD1	protein_coding	OTTHUMT00000253970.2	72	344	0	0.00	0	0	G	NM_015342	0	0	Intron	64868114	1	no_errors	ENST00000261308	ensembl	human	known	74_37	splice_site_del	74	269	45.59	42.89	62	202	DEL	1	0
APOA5	116519	genome.wustl.edu	37	11	116661131	116661132	+	In_Frame_Ins	INS	-	-	GCC			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	-	-	-	GCC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr11:116661131_116661132insGCC	ENST00000227665.4	-	3	847_848	c.813_814insGGC	c.(811-816)ggcccg>ggcGGCccg	p.271_272insG	APOA5_ENST00000542499.1_In_Frame_Ins_p.271_272insG|ZNF259_ENST00000227322.3_5'Flank			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	271					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		TGGGGGTCCGGGCCGGCCCCTT	0.653																																							0											0																																										SO:0001652	inframe_insertion	0			AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.811_813dupGGC	11.37:g.116661132_116661134dupGCC	ENSP00000227665:p.Gly271_Gly271dup		B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	In_Frame_Ins	INS	pfam_ApoA1_A4_E	p.271in_frame_insG	ENST00000227665.4	37	c.814_813	CCDS8376.2	11																																																																																			0	pfam_ApoA1_A4_E		0.653	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA5	protein_coding	OTTHUMT00000106285.2	37	42	0	0.00	0	0	0		0	0		116661132	-1	no_errors	ENST00000227665	ensembl	human	known	74_37	in_frame_ins	1	9	92.31	72.73	12	24	INS	0.005:0.000	GCC
FAM86B3P	286042	genome.wustl.edu	37	8	8095962	8095962	+	RNA	SNP	G	G	T	rs4082991		TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr8:8095962G>T	ENST00000310542.3	+	0	0				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		GCCCCATCTGGGCCCTTCCAG	0.667																																							0											0																																												0					8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8095962G>T				RNA	SNP	0	NULL	ENST00000310542.3	37	NULL		8																																																																																			0	0		0.667	FAM86B3P-005	KNOWN	basic	processed_transcript	FAM86B3P	pseudogene	OTTHUMT00000448496.1	59	0	1.67	0.00	1	0	G		rs4082991	G->T		8095962	1	no_errors	ENST00000590591	ensembl	human	known	74_37	rna	40	0	13.04	0.00	6	0	SNP	0.006	T
HELZ2	85441	genome.wustl.edu	37	20	62202620	62202620	+	Intron	SNP	A	A	C			TCGA-X7-A8M3-01A-11D-A423-09	TCGA-X7-A8M3-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	56f6fe27-c3d9-446f-a87c-901a9fa2970b	24a66c07-b335-4bc0-91ba-29f682fb82db	g.chr20:62202620A>C	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCCCCGCTCCAAGCTCCTGGG	0.701																																							0											0																																										SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-399T>G	20.37:g.62202620A>C			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	0	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			0	0		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	25	1	0	0.00	0	0	A	NM_001037335	0	0		62202620	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	35	0	18.6	0.00	8	0	SNP	0.503	C
