#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
CTPS2	56474	genome.wustl.edu	37	X	16711302	16711302	+	Missense_Mutation	SNP	C	C	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chrX:16711302C>T	ENST00000443824.1	-	6	1344	c.601G>A	c.(601-603)Gtc>Atc	p.V201I	CTPS2_ENST00000380241.3_Missense_Mutation_p.V201I|CTPS2_ENST00000359276.4_Missense_Mutation_p.V201I	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	201					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					AGTGCGCGGACGCTGTTTTGG	0.517																																							0											0													97.0	83.0	88.0					X																	16711302		2203	4300	6503	SO:0001583	missense	0			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.601G>A	X.37:g.16711302C>T	ENSP00000401264:p.Val201Ile		B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Missense_Mutation	SNP	pfam_CTP_synthase_N,pfam_GATASE,pfam_Peptidase_C26,superfamily_P-loop_NTPase,tigrfam_CTP_synthase	p.V201I	ENST00000443824.1	37	c.601	CCDS14175.1	X	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631394	0.46944	.	.	ENSG00000047230	ENST00000443824;ENST00000380241;ENST00000359276	T;T;T	0.54866	0.55;0.55;0.55	4.73	4.73	0.59995	CTP synthase, N-terminal (1);	0.000000	0.56097	D	0.000024	T	0.56140	0.1965	M	0.64404	1.975	0.80722	D	1	P	0.36222	0.544	B	0.40199	0.322	T	0.59888	-0.7369	10	0.45353	T	0.12	-18.4262	17.2578	0.87062	0.0:1.0:0.0:0.0	.	201	Q9NRF8	PYRG2_HUMAN	I	201	ENSP00000401264:V201I;ENSP00000369590:V201I;ENSP00000352222:V201I	ENSP00000352222:V201I	V	-	1	0	CTPS2	16621223	1.000000	0.71417	0.995000	0.50966	0.572000	0.35998	5.722000	0.68485	2.085000	0.62840	0.600000	0.82982	GTC	0	pfam_CTP_synthase_N,superfamily_P-loop_NTPase,tigrfam_CTP_synthase		0.517	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	protein_coding	OTTHUMT00000055906.1	67	230	0	0.00	0	0	C	NM_019857	0	0		16711302	-1	no_errors	ENST00000359276	ensembl	human	known	74_37	missense	69	124	19.77	20.00	17	31	SNP	1	T
DMD	1756	genome.wustl.edu	37	X	32482815	32482815	+	Splice_Site	SNP	T	T	G			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chrX:32482815T>G	ENST00000357033.4	-	24	3370	c.3164A>C	c.(3163-3165)aAt>aCt	p.N1055T	DMD_ENST00000378677.2_Splice_Site_p.N1051T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1055					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGTATGTGATTCTGAAACGA	0.403																																							0											0													111.0	85.0	94.0					X																	32482815		2202	4300	6502	SO:0001630	splice_region_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3163-1A>C	X.37:g.32482815T>G			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.N1055T	ENST00000357033.4	37	c.3164	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	11.11	1.541206	0.27563	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.49720	0.77;0.77	4.58	4.58	0.56647	.	0.000000	0.33309	U	0.005043	T	0.60104	0.2243	M	0.68317	2.08	0.80722	D	1	P;D;P	0.56968	0.906;0.978;0.924	P;P;P	0.61275	0.677;0.886;0.784	T	0.57619	-0.7780	10	0.15952	T	0.53	.	13.4366	0.61088	0.0:0.0:0.0:1.0	.	1047;1055;1051	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	T	1047;1051;1055;1055;932	ENSP00000367948:N1051T;ENSP00000354923:N1055T	ENSP00000354923:N1055T	N	-	2	0	DMD	32392736	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.647000	0.83462	1.613000	0.50231	0.376000	0.23039	AAT	0	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.403	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	69	364	0	0.00	0	0	T	NM_004006	0	0	Missense_Mutation	32482815	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	57	147	44.66	37.18	46	87	SNP	1	G
CCDC22	28952	genome.wustl.edu	37	X	49106160	49106160	+	Missense_Mutation	SNP	C	C	T	rs201021614		TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chrX:49106160C>T	ENST00000376227.3	+	16	1914	c.1744C>T	c.(1744-1746)Cgg>Tgg	p.R582W		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	582										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						CACCATCATGCGGGAGGTTCG	0.642																																							0											0													43.0	35.0	38.0					X																	49106160		2203	4299	6502	SO:0001583	missense	0			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1744C>T	X.37:g.49106160C>T	ENSP00000365401:p.Arg582Trp		A8K7G1	Missense_Mutation	SNP	pfam_DUF812	p.R582W	ENST00000376227.3	37	c.1744	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887291	0.52014	.	.	ENSG00000101997	ENST00000376227	.	.	.	5.38	-0.277	0.12898	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	L	0.54323	1.7	0.52099	D	0.999943	P	0.39624	0.681	B	0.33690	0.168	T	0.30534	-0.9975	9	0.59425	D	0.04	-15.5126	10.282	0.43545	0.5791:0.3091:0.1118:0.0	.	582	O60826	CCD22_HUMAN	W	582	.	ENSP00000365401:R582W	R	+	1	2	CCDC22	48993104	0.988000	0.35896	0.973000	0.42090	0.987000	0.75469	0.238000	0.18004	-0.184000	0.10567	0.429000	0.28392	CGG	0	pfam_DUF812		0.642	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	protein_coding	OTTHUMT00000060822.1	121	63	0	0.00	0	0	C	NM_014008	rs201021614	C->A,T		49106160	1	no_errors	ENST00000376227	ensembl	human	known	74_37	missense	24	31	38.46	21.95	15	9	SNP	0.998	T
PAX7	5081	genome.wustl.edu	37	1	19027246	19027246	+	Missense_Mutation	SNP	G	G	A	rs370742910		TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr1:19027246G>A	ENST00000375375.3	+	6	1484	c.886G>A	c.(886-888)Ggc>Agc	p.G296S	PAX7_ENST00000400661.3_Missense_Mutation_p.G294S|PAX7_ENST00000420770.2_Missense_Mutation_p.G296S	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	296					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CCCACCCACCGGCATGCCCAC	0.662			T	FOXO1A	alveolar rhabdomyosarcoma																																		0		Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	0								G	SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	42.0	35.0	38.0		886,886,880	4.8	0.9	1		38	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PAX7	NM_001135254.1,NM_002584.2,NM_013945.2	56,56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	296/506,296/521,294/519	19027246	1,13005	2203	4300	6503	SO:0001583	missense	0			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.886G>A	1.37:g.19027246G>A	ENSP00000364524:p.Gly296Ser		E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,pfam_Pax7,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,prints_Paired_dom,pfscan_Homeobox_dom,pfscan_Paired_dom	p.G296S	ENST00000375375.3	37	c.886	CCDS186.1	1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.798527	0.31777	0.0	1.16E-4	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.95001	-3.58;-3.56;-3.58	4.82	4.82	0.62117	.	0.055335	0.64402	D	0.000001	D	0.92642	0.7662	N	0.16478	0.41	0.80722	D	1	D;D;B	0.67145	0.979;0.996;0.184	P;P;B	0.59221	0.634;0.854;0.014	D	0.90163	0.4229	10	0.14252	T	0.57	.	16.6357	0.85059	0.0:0.0:1.0:0.0	.	296;294;296	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	S	296;296;294	ENSP00000364524:G296S;ENSP00000403389:G296S;ENSP00000383502:G294S	ENSP00000364524:G296S	G	+	1	0	PAX7	18899833	1.000000	0.71417	0.931000	0.37212	0.457000	0.32468	9.163000	0.94750	2.475000	0.83589	0.561000	0.74099	GGC	0	NULL		0.662	PAX7-001	KNOWN	basic|CCDS	protein_coding	PAX7	protein_coding	OTTHUMT00000006928.1	32	83	0	0.00	0	0	G	NM_002584	rs370742910	G->A		19027246	1	no_errors	ENST00000375375	ensembl	human	known	74_37	missense	21	40	36.36	33.33	12	20	SNP	0.999	A
UBR4	23352	genome.wustl.edu	37	1	19470510	19470510	+	Missense_Mutation	SNP	T	T	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr1:19470510T>C	ENST00000375254.3	-	55	8170	c.8143A>G	c.(8143-8145)Act>Gct	p.T2715A	UBR4_ENST00000375226.2_Missense_Mutation_p.T2726A|UBR4_ENST00000375217.2_Missense_Mutation_p.T2743A|UBR4_ENST00000375267.2_Missense_Mutation_p.T2715A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2715					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAGGGTAAAGTCACATGTCTC	0.488																																							0											0													253.0	218.0	230.0					1																	19470510		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8143A>G	1.37:g.19470510T>C	ENSP00000364403:p.Thr2715Ala		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.T2715A	ENST00000375254.3	37	c.8143	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.146144	0.37923	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.22134	1.97;1.97;1.99;1.98	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.24431	0.0592	N	0.11427	0.14	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.14062	-1.0486	10	0.15952	T	0.53	.	15.5593	0.76229	0.0:0.0:0.0:1.0	.	2715	Q5T4S7	UBR4_HUMAN	A	2715;2715;2743;2726;358;1436	ENSP00000364403:T2715A;ENSP00000364416:T2715A;ENSP00000364365:T2743A;ENSP00000364374:T2726A	ENSP00000364365:T2743A	T	-	1	0	UBR4	19343097	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.490000	0.81461	2.258000	0.74832	0.533000	0.62120	ACT	0	superfamily_ARM-type_fold		0.488	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	71	232	1.37	0.00	1	0	T	NM_020765	0	0		19470510	-1	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	94	135	29.85	28.57	40	54	SNP	1	C
NPHS2	7827	genome.wustl.edu	37	1	179528897	179528897	+	Splice_Site	SNP	C	C	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr1:179528897C>A	ENST00000367615.4	-	4	520		c.e4-1		NPHS2_ENST00000367616.4_Splice_Site	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)						actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						AAGAAAAGACCTAAAAGAGAG	0.438																																							0											0													32.0	28.0	30.0					1																	179528897		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.452-1G>T	1.37:g.179528897C>A			B1AM32|B1AM33|Q8N6Q5	Splice_Site	SNP	0	e4-1	ENST00000367615.4	37	c.452-1	CCDS1331.1	1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.858795	0.71834	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.477	0.87661	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NPHS2	177795520	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.184000	0.58323	2.475000	0.83589	0.561000	0.74099	.	0	0		0.438	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	protein_coding	OTTHUMT00000085283.1	24	204	0	0.00	0	0	C		0	0	Intron	179528897	-1	no_errors	ENST00000367615	ensembl	human	known	74_37	splice_site	20	107	25.93	6.14	7	7	SNP	1	A
RYR2	6262	genome.wustl.edu	37	1	237777980	237777980	+	Missense_Mutation	SNP	T	T	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr1:237777980T>A	ENST00000366574.2	+	37	5869	c.5552T>A	c.(5551-5553)tTt>tAt	p.F1851Y	RYR2_ENST00000360064.6_Missense_Mutation_p.F1849Y|RYR2_ENST00000542537.1_Missense_Mutation_p.F1835Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1851	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCCAGTGTGTTTAAAGAAGCT	0.498																																							0											0													58.0	61.0	60.0					1																	237777980		1994	4182	6176	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5552T>A	1.37:g.237777980T>A	ENSP00000355533:p.Phe1851Tyr		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.F1849Y	ENST00000366574.2	37	c.5546	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249136	0.80024	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73681	-0.77;-0.77;-0.77	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000005	D	0.85173	0.5636	M	0.72479	2.2	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.86109	0.1561	10	0.54805	T	0.06	.	15.8259	0.78706	0.0:0.0:0.0:1.0	.	1851	Q92736	RYR2_HUMAN	Y	1851;1849;1835	ENSP00000355533:F1851Y;ENSP00000353174:F1849Y;ENSP00000443798:F1835Y	ENSP00000353174:F1849Y	F	+	2	0	RYR2	235844603	1.000000	0.71417	0.984000	0.44739	0.899000	0.52679	7.997000	0.88414	2.153000	0.67306	0.528000	0.53228	TTT	0	NULL		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	28	129	0	0.00	0	0	T	NM_001035	0	0		237777980	1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	15	59	58.33	34.78	21	32	SNP	1	A
ADAM23	8745	genome.wustl.edu	37	2	207459556	207459556	+	Missense_Mutation	SNP	G	G	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr2:207459556G>A	ENST00000264377.3	+	23	2502	c.2174G>A	c.(2173-2175)tGc>tAc	p.C725Y	ADAM23_ENST00000374416.1_Missense_Mutation_p.C725Y|ADAM23_ENST00000374415.3_Missense_Mutation_p.C725Y	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	725					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GATCGGAAGTGCCTACAAATT	0.468																																					Melanoma(194;1127 2130 19620 24042 27855)		0											0													201.0	185.0	191.0					2																	207459556		2203	4300	6503	SO:0001583	missense	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.2174G>A	2.37:g.207459556G>A	ENSP00000264377:p.Cys725Tyr		A2RU59	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.C725Y	ENST00000264377.3	37	c.2174	CCDS2369.1	2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724679	0.89298	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.16743	2.32;2.34;2.35	5.91	5.91	0.95273	ADAM, cysteine-rich (1);	0.000000	0.64402	D	0.000001	T	0.59824	0.2222	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73260	-0.4039	10	0.87932	D	0	.	19.2892	0.94092	0.0:0.0:1.0:0.0	.	725	O75077	ADA23_HUMAN	Y	725;725;619;725	ENSP00000264377:C725Y;ENSP00000363537:C725Y;ENSP00000363536:C725Y	ENSP00000264377:C725Y	C	+	2	0	ADAM23	207167801	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.804000	0.96469	0.650000	0.86243	TGC	0	smart_ADAM_Cys-rich		0.468	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	protein_coding	OTTHUMT00000256431.2	70	232	0	0.00	0	0	G	NM_003812	0	0		207459556	1	no_errors	ENST00000264377	ensembl	human	known	74_37	missense	51	81	39.29	40.58	33	56	SNP	1	A
SCARB2	950	genome.wustl.edu	37	4	77100714	77100714	+	Missense_Mutation	SNP	C	C	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr4:77100714C>A	ENST00000264896.2	-	4	917	c.568G>T	c.(568-570)Gtt>Ttt	p.V190F	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	190	Important for interaction with GBA.				cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			GGCCTGAAAACATGGATAAGG	0.438																																							0											0													149.0	147.0	148.0					4																	77100714		2203	4300	6503	SO:0001583	missense	0			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.568G>T	4.37:g.77100714C>A	ENSP00000264896:p.Val190Phe		B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	pfam_CD36,superfamily_NA-bd_OB-fold,prints_LimpII,prints_CD36,prints_CD36_antigen	p.V190F	ENST00000264896.2	37	c.568	CCDS3577.1	4	.	.	.	.	.	.	.	.	.	.	C	1.343	-0.593641	0.03771	.	.	ENSG00000138760	ENST00000264896	T	0.71817	-0.6	5.77	-11.5	0.00074	.	1.613560	0.02822	N	0.125715	T	0.55465	0.1922	L	0.43152	1.355	0.09310	N	1	B	0.30193	0.272	B	0.36766	0.232	T	0.37753	-0.9692	10	0.10111	T	0.7	.	6.1746	0.20437	0.0715:0.163:0.2137:0.5518	.	190	Q14108	SCRB2_HUMAN	F	190	ENSP00000264896:V190F	ENSP00000264896:V190F	V	-	1	0	SCARB2	77319738	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.849000	0.00178	-2.821000	0.00343	-1.113000	0.02065	GTT	0	pfam_CD36,prints_LimpII		0.438	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARB2	protein_coding	OTTHUMT00000252403.1	53	345	0	0.00	0	0	C	NM_005506	0	0		77100714	-1	no_errors	ENST00000264896	ensembl	human	known	74_37	missense	83	126	34.38	39.13	44	81	SNP	0	A
TAF9	6880	genome.wustl.edu	37	5	68665316	68665316	+	5'UTR	SNP	A	A	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr5:68665316A>C	ENST00000217893.5	-	0	153				RAD17_ENST00000380774.3_5'Flank|RAD17_ENST00000354868.5_5'Flank|RAD17_ENST00000509734.1_5'Flank|TAF9_ENST00000502819.1_5'UTR|RAD17_ENST00000354312.3_5'Flank|TAF9_ENST00000380818.3_Intron|TAF9_ENST00000512561.1_Start_Codon_SNP_p.M1R|RAD17_ENST00000361732.2_Intron|RAD17_ENST00000282891.6_5'Flank|RAD17_ENST00000358030.2_5'Flank|RAD17_ENST00000305138.4_5'Flank|TAF9_ENST00000380822.4_Start_Codon_SNP_p.M1R|TAF9_ENST00000328663.4_Intron|RAD17_ENST00000345306.6_5'Flank|RAD17_ENST00000521422.1_5'Flank|TAF9_ENST00000506736.1_5'Flank	NM_003187.4	NP_003178.1	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa						cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cell growth (GO:0030307)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|response to interleukin-1 (GO:0070555)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|pre-snoRNP complex (GO:0070761)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	activating transcription factor binding (GO:0033613)|C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|urinary_tract(1)	8		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		CGGAAGCAACATGGTCCCCGC	0.731																																							0											0													19.0	25.0	23.0					5																	68665316		2180	4276	6456	SO:0001623	5_prime_UTR_variant	0			U21858	CCDS4001.1, CCDS4002.1, CCDS43324.1	5q13.2	2013-09-26	2002-08-29	2001-12-07	ENSG00000085231	ENSG00000085231			11542	protein-coding gene	gene with protein product		600822	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, G, 32kD"""	TAF2G		10191103, 15630091, 16079131	Standard	NM_001015892		Approved	TAFII31, TAFII32, TAFIID32, MGC5067, CGI-137, MGC1603, MGC3647, AD-004	uc003jwa.3	Q16594	OTTHUMG00000099359	ENST00000217893.5:c.-137T>G	5.37:g.68665316A>C			D3DWA3|Q5U0D1|Q9BTS1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase	p.M1R	ENST00000217893.5	37	c.2	CCDS4002.1	5	.	.	.	.	.	.	.	.	.	.	A	24.1	4.489249	0.84962	.	.	ENSG00000085231	ENST00000380822;ENST00000512561	.	.	.	4.61	4.61	0.57282	.	0.157731	0.52532	U	0.000068	T	0.68265	0.2982	.	.	.	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	T	0.72388	-0.4309	8	0.87932	D	0	-24.2839	10.3055	0.43678	1.0:0.0:0.0:0.0	.	1	Q9Y3D8	KAD6_HUMAN	R	1	.	ENSP00000370201:M1R	M	-	2	0	TAF9	68701072	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	2.655000	0.46707	1.933000	0.56026	0.459000	0.35465	ATG	0	NULL		0.731	TAF9-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TAF9	protein_coding	OTTHUMT00000216803.1	17	54	0	0.00	0	0	A	NM_003187	0	0		68665316	-1	no_errors	ENST00000380822	ensembl	human	known	74_37	missense	11	33	31.25	32.65	5	16	SNP	1	C
LOC202181	202181	genome.wustl.edu	37	5	177059218	177059218	+	RNA	SNP	G	G	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr5:177059218G>A	ENST00000515045.1	-	0	710					NR_026921.1																						CAGTGGGCAAGGCAAGGCTTG	0.522																																							0											0																																												0																															5.37:g.177059218G>A				RNA	SNP	0	NULL	ENST00000515045.1	37	NULL		5																																																																																			0	0		0.522	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	pseudogene	OTTHUMT00000373167.1	61	69	0	0.00	0	0	G		0	0		177059218	-1	no_errors	ENST00000515045	ensembl	human	known	74_37	rna	40	39	21.57	18.75	11	9	SNP	0.513	A
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	442	197	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	637	116	28.02	29.27	248	48	SNP	1	A
KHDRBS3	10656	genome.wustl.edu	37	8	136554927	136554927	+	Missense_Mutation	SNP	C	C	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr8:136554927C>T	ENST00000355849.5	+	3	648	c.238C>T	c.(238-240)Cgt>Tgt	p.R80C	KHDRBS3_ENST00000520981.1_Intron	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	80	KH.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			TTTGGGTCCACGTGGCAATTC	0.353																																							0											0													134.0	140.0	138.0					8																	136554927		2203	4300	6503	SO:0001583	missense	0			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.238C>T	8.37:g.136554927C>T	ENSP00000348108:p.Arg80Cys		Q6NUL8|Q9UPA8	Missense_Mutation	SNP	smart_KH_dom	p.R80C	ENST00000355849.5	37	c.238	CCDS6374.1	8	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845718	0.71603	.	.	ENSG00000131773	ENST00000355849;ENST00000524199;ENST00000517394	T;T;T	0.48836	0.8;0.8;0.8	5.82	3.05	0.35203	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.975;0.983	T	0.70536	-0.4845	10	0.87932	D	0	-10.3465	7.7439	0.28858	0.1331:0.7276:0.0:0.1393	.	80;80	O75525-2;O75525	.;KHDR3_HUMAN	C	80;52;53	ENSP00000348108:R80C;ENSP00000431022:R52C;ENSP00000430284:R53C	ENSP00000348108:R80C	R	+	1	0	KHDRBS3	136624109	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.802000	0.85969	0.373000	0.24621	0.655000	0.94253	CGT	0	smart_KH_dom		0.353	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	protein_coding	OTTHUMT00000377529.1	69	355	0	0.00	0	0	C		0	0		136554927	1	no_errors	ENST00000355849	ensembl	human	known	74_37	missense	72	124	41.46	42.66	51	93	SNP	0.998	T
RALGPS1	9649	genome.wustl.edu	37	9	129815132	129815132	+	Silent	SNP	C	C	T	rs150464808		TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr9:129815132C>T	ENST00000259351.5	+	7	664	c.397C>T	c.(397-399)Cta>Tta	p.L133L	RALGPS1_ENST00000373434.1_Silent_p.L133L|RALGPS1_ENST00000373436.1_Silent_p.L133L|RALGPS1_ENST00000394022.3_Silent_p.L133L|RALGPS1_ENST00000424082.2_Silent_p.L133L	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	133	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TCAGAAACTTCTAGAACTCAA	0.353																																							0											0								C	,,,	1,4405	2.1+/-5.4	0,1,2202	130.0	129.0	129.0		397,397,397,397	5.9	1.0	9	dbSNP_134	129	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RALGPS1	NM_001190728.1,NM_001190729.1,NM_001190730.1,NM_014636.2	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	133/530,133/538,133/306,133/558	129815132	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.397C>T	9.37:g.129815132C>T			B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Silent	SNP	pfam_RasGRF_CDC25,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.L133	ENST00000259351.5	37	c.397	CCDS35143.1	9																																																																																			0	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.353	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS1	protein_coding	OTTHUMT00000054133.1	78	330	0	0.60	0	2	C	NM_014636	rs150464808	C->T		129815132	1	no_errors	ENST00000259351	ensembl	human	known	74_37	silent	77	130	39.53	42.79	51	98	SNP	1	T
ZNF438	220929	genome.wustl.edu	37	10	31138511	31138511	+	Missense_Mutation	SNP	T	T	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr10:31138511T>C	ENST00000361310.3	-	6	1152	c.823A>G	c.(823-825)Acc>Gcc	p.T275A	ZNF438_ENST00000538351.2_Missense_Mutation_p.T226A|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000436087.2_Missense_Mutation_p.T275A|ZNF438_ENST00000331737.6_Missense_Mutation_p.T265A|ZNF438_ENST00000442986.1_Missense_Mutation_p.T275A|ZNF438_ENST00000444692.2_Missense_Mutation_p.T265A|ZNF438_ENST00000452305.1_Missense_Mutation_p.T265A|ZNF438_ENST00000413025.1_Missense_Mutation_p.T275A			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	275					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CCAAGAATGGTTGGTGATAAA	0.388																																							0											0													197.0	184.0	188.0					10																	31138511		2203	4300	6503	SO:0001583	missense	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.823A>G	10.37:g.31138511T>C	ENSP00000354663:p.Thr275Ala		A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T275A	ENST00000361310.3	37	c.823	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	T	0.439	-0.899354	0.02472	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	T;T;T;T;T;T;T;T	0.04917	3.53;3.53;3.53;3.53;3.53;3.53;3.53;3.53	5.44	-0.717	0.11208	.	0.395339	0.30311	N	0.009916	T	0.01627	0.0052	N	0.02225	-0.63	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.43310	-0.9399	10	0.02654	T	1	-0.9289	4.3665	0.11227	0.2343:0.4307:0.0:0.335	.	275;265	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	A	265;275;275;275;275;265;265;226	ENSP00000333571:T265A;ENSP00000354663:T275A;ENSP00000406934:T275A;ENSP00000412363:T275A;ENSP00000387546:T275A;ENSP00000413060:T265A;ENSP00000410898:T265A;ENSP00000445461:T226A	ENSP00000333571:T265A	T	-	1	0	ZNF438	31178517	0.005000	0.15991	0.000000	0.03702	0.011000	0.07611	0.400000	0.20932	-0.447000	0.07138	-0.242000	0.12053	ACC	0	NULL		0.388	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	protein_coding	OTTHUMT00000277006.1	79	325	0	0.00	0	0	T	NM_182755	0	0		31138511	-1	no_errors	ENST00000361310	ensembl	human	known	74_37	missense	87	105	34.09	44.15	45	83	SNP	0.001	C
PPFIBP1	8496	genome.wustl.edu	37	12	27835371	27835371	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr12:27835371C>T	ENST00000318304.8	+	22	2399	c.2116C>T	c.(2116-2118)Caa>Taa	p.Q706*	PPFIBP1_ENST00000542629.1_Nonsense_Mutation_p.Q675*|PPFIBP1_ENST00000228425.6_Nonsense_Mutation_p.Q700*|PPFIBP1_ENST00000537927.1_Nonsense_Mutation_p.Q553*	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	706	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					GCTAGCACTCCAAGCCCTGGG	0.363																																							0											0													99.0	113.0	108.0					12																	27835371		2203	4300	6503	SO:0001587	stop_gained	0			AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.2116C>T	12.37:g.27835371C>T	ENSP00000314724:p.Gln706*		O75336|Q86X70|Q9NY03|Q9ULJ0	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.Q706*	ENST00000318304.8	37	c.2116	CCDS55812.1	12	.	.	.	.	.	.	.	.	.	.	C	39	7.364536	0.98238	.	.	ENSG00000110841	ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425	.	.	.	5.29	5.29	0.74685	.	0.000000	0.32901	U	0.005513	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-19.0623	18.5591	0.91094	0.0:1.0:0.0:0.0	.	.	.	.	X	537;553;706;675;700	.	ENSP00000228425:Q700X	Q	+	1	0	PPFIBP1	27726638	1.000000	0.71417	0.962000	0.40283	0.123000	0.20343	5.879000	0.69690	2.480000	0.83734	0.655000	0.94253	CAA	0	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.363	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	PPFIBP1	protein_coding	OTTHUMT00000402877.1	67	344	0	0.00	0	0	C	NM_003622	0	0		27835371	1	no_errors	ENST00000318304	ensembl	human	known	74_37	nonsense	100	122	39.76	44.04	66	96	SNP	1	T
SLC22A17	51310	genome.wustl.edu	37	14	23816667	23816667	+	Splice_Site	SNP	A	A	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr14:23816667A>C	ENST00000206544.8	-	7	1553		c.e7+1		SLC22A17_ENST00000354772.3_Intron|SLC22A17_ENST00000474057.1_Intron|SLC22A17_ENST00000397267.1_Splice_Site|SLC22A17_ENST00000397260.3_Intron	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17						ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGTCTGAAGCACCTCTGTTGG	0.612																																							0											0													44.0	38.0	40.0					14																	23816667		2203	4299	6502	SO:0001630	splice_region_variant	0			AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1216+1T>G	14.37:g.23816667A>C			A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Splice_Site	SNP	0	e7+2	ENST00000206544.8	37	c.1216+2	CCDS9593.1	14	.	.	.	.	.	.	.	.	.	.	A	10.90	1.480659	0.26598	.	.	ENSG00000092096	ENST00000206544;ENST00000397267	.	.	.	3.94	1.54	0.23209	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3043	0.06994	0.6886:0.0:0.1099:0.2016	.	.	.	.	.	-1	.	.	.	-	.	.	SLC22A17	22886507	0.536000	0.26378	0.921000	0.36526	0.854000	0.48673	0.936000	0.28938	0.332000	0.23536	0.529000	0.55759	.	0	0		0.612	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC22A17	protein_coding	OTTHUMT00000157223.3	41	129	0	0.00	0	0	A	NM_020372	0	0	Intron	23816667	-1	no_errors	ENST00000206544	ensembl	human	known	74_37	splice_site	18	69	35.71	31.37	10	32	SNP	0.988	C
MAP2K1	5604	genome.wustl.edu	37	15	66727443	66727443	+	Missense_Mutation	SNP	T	T	G			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr15:66727443T>G	ENST00000307102.5	+	2	690	c.159T>G	c.(157-159)ttT>ttG	p.F53L		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	TTGAGGCCTTTCTTACCCAGA	0.552																																							0											0													156.0	147.0	150.0					15																	66727443		2201	4299	6500	SO:0001583	missense	0			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.159T>G	15.37:g.66727443T>G	ENSP00000302486:p.Phe53Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F53L	ENST00000307102.5	37	c.159	CCDS10216.1	15	.	.	.	.	.	.	.	.	.	.	T	25.7	4.663745	0.88251	.	.	ENSG00000169032	ENST00000307102	D	0.93019	-3.15	5.07	-1.21	0.09524	.	0.000000	0.85682	D	0.000000	D	0.93851	0.8033	M	0.76170	2.325	0.80722	D	1	D;D	0.61080	0.989;0.98	P;P	0.59115	0.852;0.805	D	0.90510	0.4480	10	0.26408	T	0.33	-14.6287	9.9388	0.41567	0.0:0.4644:0.0:0.5356	.	31;53	B4DFY5;Q02750	.;MP2K1_HUMAN	L	53	ENSP00000302486:F53L	ENSP00000302486:F53L	F	+	3	2	MAP2K1	64514497	0.837000	0.29446	0.994000	0.49952	0.969000	0.65631	-0.021000	0.12504	-0.016000	0.14127	0.383000	0.25322	TTT	0	NULL		0.552	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K1	protein_coding	OTTHUMT00000256906.4	41	182	0	0.00	0	0	T		0	0		66727443	1	no_errors	ENST00000307102	ensembl	human	known	74_37	missense	22	56	63.33	59.71	38	83	SNP	0.995	G
AMDHD2	51005	genome.wustl.edu	37	16	2577812	2577812	+	Missense_Mutation	SNP	C	C	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr16:2577812C>T	ENST00000293971.6	+	5	548	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W	ATP6C_ENST00000569317.1_Missense_Mutation_p.R105W|AMDHD2_ENST00000302956.4_Missense_Mutation_p.R152W|CEMP1_ENST00000382350.1_Intron|AMDHD2_ENST00000413459.3_Missense_Mutation_p.R152W|AMDHD2_ENST00000565570.1_Intron	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	152					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						CCGGGAGAAGCGGGGCGCGCA	0.692																																							0											0													12.0	15.0	14.0					16																	2577812		2185	4288	6473	SO:0001583	missense	0			AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.454C>T	16.37:g.2577812C>T	ENSP00000293971:p.Arg152Trp		B4DL77|Q8WV54	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite	p.R152W	ENST00000293971.6	37	c.454		16	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466186	0.84425	.	.	ENSG00000162066	ENST00000413459;ENST00000302956;ENST00000293971	D;D;D	0.99933	-8.26;-8.26;-8.26	5.62	5.62	0.85841	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.198417	0.44902	D	0.000414	D	0.99932	0.9969	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.71870	0.975;0.953;0.921	D	0.95702	0.8750	10	0.87932	D	0	-11.2436	12.0392	0.53444	0.2689:0.7311:0.0:0.0	.	152;152;152	Q9Y303-3;Q9Y303;Q9Y303-2	.;NAGA_HUMAN;.	W	152	ENSP00000391596:R152W;ENSP00000307481:R152W;ENSP00000293971:R152W	ENSP00000293971:R152W	R	+	1	2	AMDHD2	2517813	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.108000	0.50337	2.651000	0.90000	0.561000	0.74099	CGG	0	superfamily_Metal-dep_hydrolase_composite		0.692	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	AMDHD2	protein_coding	OTTHUMT00000435652.1	14	70	0	0.00	0	0	C	NM_015944	0	0		2577812	1	no_errors	ENST00000413459	ensembl	human	known	74_37	missense	2	26	81.82	33.33	9	13	SNP	1	T
FAM65A	79567	genome.wustl.edu	37	16	67575618	67575618	+	Missense_Mutation	SNP	C	C	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr16:67575618C>T	ENST00000379312.3	+	12	1146	c.1025C>T	c.(1024-1026)aCc>aTc	p.T342I	FAM65A_ENST00000428437.2_Missense_Mutation_p.T352I|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.T358I|FAM65A_ENST00000042381.4_Missense_Mutation_p.T338I|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.T358I	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	342						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.T338S(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TCCACAGTCACCAAGCGCTTC	0.592																																							0											1	Substitution - Missense(1)	ovary(1)											107.0	103.0	104.0					16																	67575618		2198	4300	6498	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1025C>T	16.37:g.67575618C>T	ENSP00000368614:p.Thr342Ile		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.T358I	ENST00000379312.3	37	c.1073	CCDS54028.1	16	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723030	0.68959	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.02050	4.48;4.48;4.48	4.8	3.82	0.43975	.	0.217050	0.50627	D	0.000112	T	0.01835	0.0058	N	0.08118	0	0.31620	N	0.650379	D;D;D;D	0.56035	0.974;0.974;0.974;0.974	B;P;B;P	0.49140	0.36;0.497;0.36;0.601	T	0.46582	-0.9181	10	0.37606	T	0.19	-20.8064	6.3094	0.21156	0.3355:0.466:0.1985:0.0	.	352;358;342;358	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.;.;FA65A_HUMAN;.	I	342;338;358;352	ENSP00000368614:T342I;ENSP00000042381:T338I;ENSP00000400099:T358I	ENSP00000042381:T338I	T	+	2	0	FAM65A	66133119	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.731000	0.38135	2.212000	0.71576	0.561000	0.74099	ACC	0	NULL		0.592	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	protein_coding	OTTHUMT00000268866.3	33	175	0	0.00	0	0	C	NM_024519	0	0		67575618	1	no_errors	ENST00000422602	ensembl	human	known	74_37	missense	20	84	35.48	34.38	11	44	SNP	1	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965422	18965422	+	lincRNA	SNP	G	G	A	rs200752056		TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr17:18965422G>A	ENST00000363359.1	+	0	198				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		gtgagagggagagaacgcggt	0.547																																							0											0								G		0,1728		0,0,864	45.0	20.0	29.0				0.1	17		29	3,3397		0,3,1697	no	intergenic				0,3,2561	AA,AG,GG		0.0882,0.0,0.0585			18965422	3,5125	864	1700	2564			0			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965422G>A				RNA	SNP	0	NULL	ENST00000363359.1	37	NULL		17																																																																																			0	0		0.547	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	lincRNA		41	32	0	0.00	0	0	G	NR_003271	rs200752056	G->A		18965422	1	no_errors	ENST00000363359	ensembl	human	known	74_37	rna	27	22	18.18	24.14	6	7	SNP	0.075	A
KRT26	353288	genome.wustl.edu	37	17	38927440	38927440	+	Missense_Mutation	SNP	T	T	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr17:38927440T>C	ENST00000335552.4	-	2	538	c.490A>G	c.(490-492)Aat>Gat	p.N164D		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				AGTCTGGCATTGTCATTTTGT	0.333																																							0											0													45.0	44.0	45.0					17																	38927440		2203	4300	6503	SO:0001583	missense	0			AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.490A>G	17.37:g.38927440T>C	ENSP00000334798:p.Asn164Asp			Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.N164D	ENST00000335552.4	37	c.490	CCDS11374.1	17	.	.	.	.	.	.	.	.	.	.	T	22.8	4.333988	0.81801	.	.	ENSG00000186393	ENST00000335552	D	0.89939	-2.59	5.52	4.41	0.53225	Filament (1);	0.000000	0.64402	D	0.000005	D	0.95959	0.8684	H	0.96720	3.87	0.38139	D	0.938381	D	0.69078	0.997	D	0.70016	0.967	D	0.97186	0.9854	10	0.87932	D	0	.	12.0416	0.53456	0.0:0.0:0.1444:0.8555	.	164	Q7Z3Y9	K1C26_HUMAN	D	164	ENSP00000334798:N164D	ENSP00000334798:N164D	N	-	1	0	KRT26	36180966	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.891000	0.69782	0.996000	0.38943	0.533000	0.62120	AAT	0	pfam_IF		0.333	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT26	protein_coding	OTTHUMT00000257215.1	127	191	0	0.00	0	0	T	NM_181539	0	0		38927440	-1	no_errors	ENST00000335552	ensembl	human	known	74_37	missense	119	96	39.29	34.25	77	50	SNP	1	C
RLN3	117579	genome.wustl.edu	37	19	14141521	14141521	+	Splice_Site	SNP	G	G	A			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr19:14141521G>A	ENST00000431365.2	+	2	247		c.e2-1		IL27RA_ENST00000263379.2_5'Flank|RLN3_ENST00000585987.1_Splice_Site|CTB-55O6.4_ENST00000590528.1_RNA	NM_080864.2	NP_543140.1	Q8WXF3	REL3_HUMAN	relaxin 3							extracellular region (GO:0005576)				endometrium(1)|lung(4)	5						ATCTTTTGCAGGAGATACCTT	0.562																																							0											0													78.0	80.0	79.0					19																	14141521		2203	4300	6503	SO:0001630	splice_region_variant	0			AF447451	CCDS12302.1	19p13.2	2013-02-26	2004-11-15					"""Endogenous ligands"""	17135	protein-coding gene	gene with protein product	"""prorelaxin H3"""	606855	"""relaxin 3 (H3)"""				Standard	NM_080864		Approved	ZINS4, RXN3, H3	uc002mxw.1	Q8WXF3		ENST00000431365.2:c.191-1G>A	19.37:g.14141521G>A			Q6UXW5	Splice_Site	SNP	0	e2-1	ENST00000431365.2	37	c.191-1	CCDS12302.1	19	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289324	0.23478	.	.	ENSG00000171136	ENST00000431365	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7852	0.69796	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RLN3	14002521	1.000000	0.71417	0.763000	0.31416	0.113000	0.19764	4.951000	0.63610	2.223000	0.72356	0.491000	0.48974	.	0	0		0.562	RLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN3	protein_coding	OTTHUMT00000458529.1	43	92	0	0.00	0	0	G		0	0	Intron	14141521	1	no_errors	ENST00000431365	ensembl	human	known	74_37	splice_site	21	44	30	19.64	9	11	SNP	0.987	A
PINLYP	390940	genome.wustl.edu	37	19	44085496	44085496	+	Missense_Mutation	SNP	G	G	C			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr19:44085496G>C	ENST00000599207.1	+	3	320	c.320G>C	c.(319-321)tGc>tCc	p.C107S	PINLYP_ENST00000562365.2_Missense_Mutation_p.C19S|PINLYP_ENST00000562255.1_Missense_Mutation_p.C19S|PINLYP_ENST00000569031.2_Missense_Mutation_p.C19S|L34079.2_ENST00000594374.1_Intron	NM_001193621.1	NP_001180550.1	A6NC86	PINLY_HUMAN	phospholipase A2 inhibitor and LY6/PLAUR domain containing	107	UPAR/Ly6.					extracellular region (GO:0005576)	phospholipase inhibitor activity (GO:0004859)										AGCGACGGCTGCAACAGTGCC	0.582																																							0											0																																										SO:0001583	missense	0				CCDS58667.1, CCDS74385.1	19q13.31	2012-07-20			ENSG00000234465	ENSG00000234465			44206	protein-coding gene	gene with protein product							Standard	NM_001193621		Approved		uc021uvg.1	A6NC86	OTTHUMG00000175560	ENST00000599207.1:c.320G>C	19.37:g.44085496G>C	ENSP00000469886:p.Cys107Ser		B7Z457|O95053	Missense_Mutation	SNP	pfam_LY6_UPAR	p.C19S	ENST00000599207.1	37	c.56		19																																																																																			0	NULL		0.582	PINLYP-005	NOVEL	basic|appris_principal	protein_coding	PINLYP	protein_coding	OTTHUMT00000463346.2	47	189	0	0.00	0	0	G	NM_001193621	0	0		44085496	1	no_errors	ENST00000562255	ensembl	human	known	74_37	missense	28	98	31.71	29.58	13	42	SNP	1	C
BDNF	627	genome.wustl.edu	37	11	27681170	27681171	+	5'UTR	INS	-	-	TC	rs11267088	byFrequency	TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	-	-	-	TC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr11:27681170_27681171insTC	ENST00000525528.1	-	0	34_35				BDNF_ENST00000438929.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000395978.3_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000584049.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000314915.6_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000395981.3_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000356660.4_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000533246.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						ACTAGAGATGTTCTCTCtgtgt	0.431																																							0											0																																										SO:0001623	5_prime_UTR_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1060->GA	11.37:g.27681175_27681176dupTC			A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	INS	0	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			0	0		0.431	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF-AS	protein_coding	OTTHUMT00000388135.1	57	145	0	0.00	0	0	0	NM_170735	0	0		27681171	1	no_errors	ENST00000530313	ensembl	human	known	74_37	rna	67	95	12.99	16.67	10	19	INS	0.000:0.000	TC
ABCD4	5826	genome.wustl.edu	37	14	74759934	74759935	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	-	-	-	GC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr14:74759934_74759935insGC	ENST00000356924.4	-	8	879_880	c.736_737insGC	c.(736-738)cacfs	p.H246fs	ABCD4_ENST00000298816.7_Frame_Shift_Ins_p.H142fs|ABCD4_ENST00000557588.1_Intron|AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000557554.1_Intron	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	246	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		TGTCCTCATGTGCTCCACATGC	0.619																																							0											0																																										SO:0001589	frameshift_variant	0			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.735_736dupGC	14.37:g.74759935_74759936dupGC	ENSP00000349396:p.His246fs		A8K5L7|Q6IAQ0|Q96E75	Frame_Shift_Ins	INS	pfam_ABC_Peroxi_TM,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.H246fs	ENST00000356924.4	37	c.737_736	CCDS9828.1	14																																																																																			0	pfam_ABC_Peroxi_TM,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.619	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD4	protein_coding	OTTHUMT00000314382.1	34	125	0	0.00	0	0	0	NM_005050	0	0		74759935	-1	no_errors	ENST00000356924	ensembl	human	known	74_37	frame_shift_ins	23	64	32.35	24.71	11	21	INS	1.000:1.000	GC
SETMAR	6419	genome.wustl.edu	37	3	4358878	4358878	+	Missense_Mutation	SNP	T	T	G			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr3:4358878T>G	ENST00000358065.4	+	3	2070	c.2003T>G	c.(2002-2004)cTt>cGt	p.L668R	SUMF1_ENST00000534863.1_Intron|SETMAR_ENST00000425863.1_Missense_Mutation_p.L529R	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	668	Mariner transposase Hsmar1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		ataaaccaacttatttctcgt	0.373								Chromatin Structure																															0											0													6.0	6.0	6.0					3																	4358878		1512	2632	4144	SO:0001583	missense	0			U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.2003T>G	3.37:g.4358878T>G	ENSP00000373354:p.Leu668Arg		B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	pfam_Transposase_1,pfam_SET_dom,pfam_Pre-SET_dom,pfam_Transposase_Tc1-like,pfam_Transposase_14,superfamily_Homeodomain-like,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.L668R	ENST00000358065.4	37	c.2003	CCDS2563.2	3	.	.	.	.	.	.	.	.	.	.	T	13.27	2.186059	0.38609	.	.	ENSG00000170364	ENST00000358065;ENST00000425863	D;D	0.86497	-2.13;-2.13	0.235	0.235	0.15431	.	6.675710	0.01239	U	0.008570	D	0.92564	0.7638	M	0.89163	3.01	0.24562	N	0.993961	P;D;P;P	0.59767	0.9;0.986;0.943;0.876	B;P;P;B	0.55011	0.366;0.632;0.766;0.275	T	0.75255	-0.3382	9	0.87932	D	0	.	.	.	.	rs34245352	412;529;655;413	B4DND2;E7EN68;Q53H47;Q96H41	.;.;SETMR_HUMAN;.	R	668;529	ENSP00000373354:L668R;ENSP00000403145:L529R	ENSP00000373354:L668R	L	+	2	0	SETMAR	4333878	0.845000	0.29573	0.914000	0.36105	0.913000	0.54294	0.310000	0.19356	0.263000	0.21812	0.260000	0.18958	CTT	0	NULL		0.373	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETMAR	protein_coding	OTTHUMT00000206587.4	30	0	0	0.00	0	0	T	NM_006515	0	0		4358878	1	no_errors	ENST00000358065	ensembl	human	known	74_37	missense	35	0	39.66	0.00	23	0	SNP	0.939	G
DSPP	1834	genome.wustl.edu	37	4	88537216	88537216	+	Silent	SNP	T	T	C	rs200679221		TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr4:88537216T>C	ENST00000282478.7	+	4	3435	c.3402T>C	c.(3400-3402)gaT>gaC	p.D1134D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1134D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1134	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgaca	0.562																																							0											0													18.0	27.0	24.0					4																	88537216		1318	2533	3851	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3402T>C	4.37:g.88537216T>C			A8MUI0|O95815	Silent	SNP	NULL	p.D1134	ENST00000282478.7	37	c.3402	CCDS43248.1	4																																																																																			0	NULL		0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	protein_coding	OTTHUMT00000363616.3	17	5	0	0.00	0	0	T	NM_014208	0	0		88537216	1	no_errors	ENST00000282478	ensembl	human	known	74_37	silent	40	1	19.61	0.00	10	0	SNP	0.798	C
DNAH5	1767	genome.wustl.edu	37	5	13810293	13810293	+	Missense_Mutation	SNP	G	G	T			TCGA-XM-A8RF-01A-11D-A423-09	TCGA-XM-A8RF-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2671e3eb-3719-4b12-9cda-fd4f03999e93	87fd64b3-7a52-4876-ab3d-ca465f60355b	g.chr5:13810293G>T	ENST00000265104.4	-	45	7588	c.7484C>A	c.(7483-7485)gCg>gAg	p.A2495E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2495					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGCTCCAGCGCCGCCCCCGC	0.716									Kartagener syndrome																														0											0													3.0	4.0	4.0					5																	13810293		1865	3724	5589	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7484C>A	5.37:g.13810293G>T	ENSP00000265104:p.Ala2495Glu		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2495E	ENST00000265104.4	37	c.7484	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227940	0.39399	.	.	ENSG00000039139	ENST00000265104	T	0.24151	1.87	5.4	0.813	0.18749	.	0.764896	0.12382	N	0.473768	T	0.21427	0.0516	L	0.40543	1.245	0.09310	N	1	B	0.20164	0.042	B	0.25140	0.058	T	0.25502	-1.0130	10	0.46703	T	0.11	.	9.4807	0.38900	0.7919:0.0:0.2081:0.0	.	2495	Q8TE73	DYH5_HUMAN	E	2495	ENSP00000265104:A2495E	ENSP00000265104:A2495E	A	-	2	0	DNAH5	13863293	0.108000	0.22018	0.038000	0.18304	0.439000	0.31926	3.051000	0.49885	-0.075000	0.12798	0.655000	0.94253	GCG	0	NULL		0.716	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	37	11	0	0.00	0	0	G	NM_001369	0	0		13810293	-1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	46	10	7.84	0.00	4	0	SNP	0.309	T
