#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
CAPN6	827	genome.wustl.edu	37	X	110494930	110494930	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chrX:110494930C>T	ENST00000324068.1	-	6	907	c.740G>A	c.(739-741)gGt>gAt	p.G247D	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	247	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CTTCAGCAGACCCCAATCAGT	0.453																																							0											0													265.0	256.0	259.0					X																	110494930		2203	4300	6503	SO:0001583	missense	0			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.740G>A	X.37:g.110494930C>T	ENSP00000317214:p.Gly247Asp		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_dom,superfamily_Calpain_domain_III,superfamily_C2_dom,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.G247D	ENST00000324068.1	37	c.740	CCDS14555.1	X	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822108	0.90873	.	.	ENSG00000077274	ENST00000324068	T	0.60171	0.21	6.17	6.17	0.99709	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.86243	0.5886	H	0.98133	4.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90671	0.4598	10	0.72032	D	0.01	.	19.7362	0.96205	0.0:1.0:0.0:0.0	.	247	Q9Y6Q1	CAN6_HUMAN	D	247	ENSP00000317214:G247D	ENSP00000317214:G247D	G	-	2	0	CAPN6	110381586	1.000000	0.71417	0.978000	0.43139	0.918000	0.54935	7.486000	0.81215	2.618000	0.88619	0.600000	0.82982	GGT	0	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.453	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	protein_coding	OTTHUMT00000057922.1	25	70	0	0.00	0	0	C		0	0		110494930	-1	no_errors	ENST00000324068	ensembl	human	known	74_37	missense	4	15	84	78.87	21	56	SNP	1	T
HRNR	388697	genome.wustl.edu	37	1	152189038	152189038	+	Silent	SNP	A	A	G	rs145118416	byFrequency	TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr1:152189038A>G	ENST00000368801.2	-	3	5142	c.5067T>C	c.(5065-5067)taT>taC	p.Y1689Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1689					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGCTGACCATAGCGGGAAG	0.617																																							0											0								A		321,2979		2,317,1331	67.0	73.0	71.0		5067	-0.7	0.0	1	dbSNP_134	71	363,6063		1,361,2851	no	coding-synonymous	HRNR	NM_001009931.1		3,678,4182	GG,GA,AA		5.6489,9.7273,7.0327		1689/2851	152189038	684,9042	1650	3213	4863	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5067T>C	1.37:g.152189038A>G			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Y1689	ENST00000368801.2	37	c.5067	CCDS30859.1	1																																																																																			0	NULL		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	34	32	0	0.00	0	0	A	XM_373868	rs145118416	A->G		152189038	-1	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	39	21	23.53	8.70	12	2	SNP	0	G
C1orf61	10485	genome.wustl.edu	37	1	156390207	156390207	+	Intron	SNP	T	T	C			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr1:156390207T>C	ENST00000368243.1	-	3	92				MIR9-1_ENST00000385198.2_RNA	NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61							nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TAACCAAAGATAACAACCAAC	0.602																																							0											0													21.0	23.0	23.0					1																	156390207		1520	3494	5014	SO:0001627	intron_variant	0				CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.25-3551A>G	1.37:g.156390207T>C			B1ALL5|B1ALL8	RNA	SNP	0	NULL	ENST00000368243.1	37	NULL	CCDS1142.1	1																																																																																			0	0		0.602	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR9-1	protein_coding	OTTHUMT00000075988.1	21	108	0	0.00	0	0	T	NM_006365	0	0		156390207	1	no_errors	ENST00000385198	ensembl	human	known	74_37	rna	9	36	43.75	46.27	7	31	SNP	1	C
ACTR2	10097	genome.wustl.edu	37	2	65495807	65495807	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr2:65495807G>A	ENST00000260641.5	+	9	1281	c.1124G>A	c.(1123-1125)cGa>cAa	p.R375Q	ACTR2_ENST00000377982.4_Missense_Mutation_p.R380Q	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	375					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)	p.R375Q(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						TGGATGACCCGACAAGAGTAC	0.473																																							0											1	Substitution - Missense(1)	endometrium(1)											106.0	99.0	101.0					2																	65495807		2203	4300	6503	SO:0001583	missense	0			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.1124G>A	2.37:g.65495807G>A	ENSP00000260641:p.Arg375Gln		B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R380Q	ENST00000260641.5	37	c.1139	CCDS1881.1	2	.	.	.	.	.	.	.	.	.	.	G	30	5.057144	0.93846	.	.	ENSG00000138071	ENST00000260641;ENST00000377982;ENST00000535303	D;D	0.95412	-3.7;-3.7	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.96204	0.8762	M	0.78344	2.41	0.80722	D	1	P;P	0.49185	0.92;0.862	P;P	0.46026	0.501;0.501	D	0.96351	0.9258	10	0.87932	D	0	-7.3709	20.3789	0.98926	0.0:0.0:1.0:0.0	.	375;380	P61160;E9PF41	ARP2_HUMAN;.	Q	375;380;320	ENSP00000260641:R375Q;ENSP00000367220:R380Q	ENSP00000260641:R375Q	R	+	2	0	ACTR2	65349311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.826000	0.97356	0.563000	0.77884	CGA	0	pfam_Actin-related,smart_Actin-related		0.473	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR2	protein_coding	OTTHUMT00000251730.1	137	103	0	0.00	0	0	G	NM_001005386	0	0		65495807	1	no_errors	ENST00000377982	ensembl	human	known	74_37	missense	89	53	44.03	48.04	70	49	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179437644	179437644	+	Missense_Mutation	SNP	T	T	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr2:179437644T>A	ENST00000591111.1	-	276	68516	c.68292A>T	c.(68290-68292)gaA>gaT	p.E22764D	TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E15465D|TTN_ENST00000460472.2_Missense_Mutation_p.E15340D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E15532D|TTN_ENST00000589042.1_Missense_Mutation_p.E24405D|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E21837D			Q8WZ42	TITIN_HUMAN	titin	22764	Fibronectin type-III 65. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCCAAGTCCTTCGGAATTCA	0.483																																							0											0													85.0	86.0	86.0					2																	179437644		1948	4143	6091	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68292A>T	2.37:g.179437644T>A	ENSP00000465570:p.Glu22764Asp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E21837D	ENST00000591111.1	37	c.65511		2	.	.	.	.	.	.	.	.	.	.	T	11.34	1.608501	0.28623	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.91	4.55	0.56014	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55081	0.1898	L	0.41961	1.31	0.51233	D	0.999914	D;D;D;D	0.61697	0.99;0.99;0.99;0.981	P;P;P;P	0.59012	0.85;0.85;0.85;0.793	T	0.57382	-0.7821	9	0.87932	D	0	.	4.4627	0.11673	0.1373:0.1852:0.0:0.6775	.	15340;15465;15532;22764	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	21837;15340;15532;15465;15338	ENSP00000343764:E21837D;ENSP00000434586:E15340D;ENSP00000340554:E15532D;ENSP00000352154:E15465D	ENSP00000340554:E15532D	E	-	3	2	TTN	179145890	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.432000	0.34936	0.865000	0.35603	0.533000	0.62120	GAA	0	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	32	203	0	0.00	0	0	T	NM_133378	0	0		179437644	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	13	104	64.86	44.39	24	83	SNP	1	A
MECOM	2122	genome.wustl.edu	37	3	169099264	169099264	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr3:169099264A>G	ENST00000494292.1	-	2	183	c.86T>C	c.(85-87)aTg>aCg	p.M29T	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	29					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						TGCATCTGGCATTTCTTCCAA	0.423																																							0											0													49.0	50.0	49.0					3																	169099264		1920	4128	6048	SO:0001583	missense	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.86T>C	3.37:g.169099264A>G	ENSP00000417899:p.Met29Thr		Q13466|Q6FH90	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.M29T	ENST00000494292.1	37	c.86		3	.	.	.	.	.	.	.	.	.	.	A	9.658	1.143479	0.21205	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	T	0.05081	3.5	5.83	5.83	0.93111	.	0.071601	0.64402	D	0.000014	T	0.07234	0.0183	L	0.57536	1.79	0.80722	D	1	B;B	0.24721	0.11;0.0	B;B	0.21151	0.033;0.0	T	0.28650	-1.0037	10	0.21540	T	0.41	.	7.3289	0.26571	0.7821:0.1458:0.0721:0.0	.	29;29	Q13465;Q03112-3	MDS1_HUMAN;.	T	29;53	ENSP00000417899:M29T	ENSP00000419537:M53T	M	-	2	0	MECOM	170581958	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	1.733000	0.38156	2.240000	0.73641	0.528000	0.53228	ATG	0	NULL		0.423	MECOM-004	KNOWN	basic|appris_principal	protein_coding	MECOM	protein_coding	OTTHUMT00000351517.3	82	189	0	0.00	0	0	A	NM_005241, NM_004991	0	0		169099264	-1	no_errors	ENST00000494292	ensembl	human	known	74_37	missense	26	143	50.94	35.14	27	78	SNP	0.998	G
KIF13A	63971	genome.wustl.edu	37	6	17764739	17764739	+	Missense_Mutation	SNP	C	C	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr6:17764739C>A	ENST00000259711.6	-	39	5125	c.5020G>T	c.(5020-5022)Gcc>Tcc	p.A1674S	KIF13A_ENST00000378826.2_Missense_Mutation_p.A1639S|KIF13A_ENST00000378843.2_Missense_Mutation_p.A1626S|KIF13A_ENST00000378816.5_Missense_Mutation_p.A1639S|KIF13A_ENST00000378814.5_Missense_Mutation_p.A1626S	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1674					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TTGGCTAAGGCACTGTTTTCC	0.483																																							0											0													114.0	110.0	111.0					6																	17764739		2008	4176	6184	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.5020G>T	6.37:g.17764739C>A	ENSP00000259711:p.Ala1674Ser		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A1674S	ENST00000259711.6	37	c.5020	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306221	0.81247	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T;T	0.76186	-0.98;1.56;-0.85;-1.0;-0.99;-1.0	5.95	5.95	0.96441	.	0.200046	0.40385	N	0.001102	T	0.58906	0.2155	L	0.32530	0.975	0.39283	D	0.964597	B;P;P;P	0.39665	0.417;0.59;0.682;0.59	B;B;B;B	0.40444	0.124;0.329;0.24;0.329	T	0.58504	-0.7625	10	0.22706	T	0.39	.	20.3719	0.98893	0.0:1.0:0.0:0.0	.	1626;1639;1674;1626	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	S	1626;678;1674;1639;1626;1639	ENSP00000368091:A1626S;ENSP00000425616:A678S;ENSP00000259711:A1674S;ENSP00000368103:A1639S;ENSP00000368120:A1626S;ENSP00000368093:A1639S	ENSP00000259711:A1674S	A	-	1	0	KIF13A	17872718	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	5.359000	0.66074	2.826000	0.97356	0.491000	0.48974	GCC	0	NULL		0.483	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	protein_coding	OTTHUMT00000039954.4	60	188	0	0.53	0	1	C		0	0		17764739	-1	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	41	124	34.92	39.22	22	80	SNP	1	A
BVES	11149	genome.wustl.edu	37	6	105563600	105563600	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr6:105563600G>A	ENST00000314641.5	-	7	1135	c.919C>T	c.(919-921)Cac>Tac	p.H307Y	BVES_ENST00000336775.5_Missense_Mutation_p.H307Y|BVES_ENST00000446408.2_Missense_Mutation_p.H307Y	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	307					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				AGAAACTGGTGCAAGCCGTCG	0.488																																							0											0													188.0	160.0	169.0					6																	105563600		2203	4300	6503	SO:0001583	missense	0			AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.919C>T	6.37:g.105563600G>A	ENSP00000313172:p.His307Tyr		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.H307Y	ENST00000314641.5	37	c.919	CCDS5051.1	6	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386243	0.42308	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.18502	2.21;2.21;2.21	5.95	5.95	0.96441	.	0.200919	0.52532	D	0.000069	T	0.09158	0.0226	L	0.36672	1.1	0.35773	D	0.821059	B	0.28208	0.203	B	0.28638	0.092	T	0.14559	-1.0468	10	0.25106	T	0.35	-26.1962	20.3802	0.98930	0.0:0.0:1.0:0.0	.	307	Q8NE79	POPD1_HUMAN	Y	307	ENSP00000313172:H307Y;ENSP00000337259:H307Y;ENSP00000397310:H307Y	ENSP00000313172:H307Y	H	-	1	0	BVES	105670293	1.000000	0.71417	0.979000	0.43373	0.891000	0.51852	5.022000	0.64078	2.822000	0.97130	0.563000	0.77884	CAC	0	NULL		0.488	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BVES	protein_coding	OTTHUMT00000406075.1	72	143	0	0.00	0	0	G	NM_147147	0	0		105563600	-1	no_errors	ENST00000314641	ensembl	human	known	74_37	missense	32	110	41.82	37.50	23	66	SNP	0.998	A
LINC00957	255031	genome.wustl.edu	37	7	44080550	44080550	+	lincRNA	SNP	C	C	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr7:44080550C>A	ENST00000441052.1	+	0	1235				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		CGCCCCGCACCCCCCCGGAGT	0.617																																							0											0																																												0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44080550C>A				RNA	SNP	0	NULL	ENST00000441052.1	37	NULL		7																																																																																			0	0		0.617	LINC00957-001	KNOWN	basic	lincRNA	LINC00957	lincRNA	OTTHUMT00000339589.1	71	18	1.39	0.00	1	0	C		0	0		44080550	1	no_errors	ENST00000416824	ensembl	human	known	74_37	rna	52	17	11.86	10.53	7	2	SNP	0.01	A
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	293	102	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	182	70	41.53	48.91	130	67	SNP	1	A
AHCYL2	23382	genome.wustl.edu	37	7	129049331	129049331	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr7:129049331G>A	ENST00000325006.3	+	11	1364	c.1310G>A	c.(1309-1311)cGa>cAa	p.R437Q	AHCYL2_ENST00000446544.2_Missense_Mutation_p.R436Q|AHCYL2_ENST00000490911.1_Missense_Mutation_p.R334Q|AHCYL2_ENST00000474594.1_Missense_Mutation_p.R334Q|AHCYL2_ENST00000446212.1_Missense_Mutation_p.R335Q|AHCYL2_ENST00000531335.2_Missense_Mutation_p.R356Q	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	437					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GATGGATTTCGACTGGTGAAA	0.393																																					Pancreas(160;1736 1964 29875 40941 45605)		0											0													124.0	113.0	116.0					7																	129049331		2203	4300	6503	SO:0001583	missense	0			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.1310G>A	7.37:g.129049331G>A	ENSP00000315931:p.Arg437Gln		B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,tigrfam_Adenosylhomocysteinase	p.R437Q	ENST00000325006.3	37	c.1310	CCDS5812.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.269993|4.269993	0.80469|0.80469	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000466924|ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	.|T;T;T;T;T;T	.|0.76578	.|-1.03;-1.03;-1.01;-1.0;-1.01;-1.0	5.68|5.68	5.68|5.68	0.88126|0.88126	.|S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71031|0.71031	0.3292|0.3292	L|L	0.47016|0.47016	1.485|1.485	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;P;P;P	.|0.51791	.|0.487;0.487;0.948;0.487;0.936	.|B;B;B;B;B	.|0.38296	.|0.184;0.184;0.27;0.184;0.176	T|T	0.72609|0.72609	-0.4241|-0.4241	5|10	.|0.35671	.|T	.|0.21	-8.0719|-8.0719	17.2855|17.2855	0.87140|0.87140	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|334;335;437;334;436	.|B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.|.;.;SAHH3_HUMAN;.;.	N|Q	344|437;436;356;334;335;334	.|ENSP00000315931:R437Q;ENSP00000413639:R436Q;ENSP00000431787:R356Q;ENSP00000420459:R334Q;ENSP00000405267:R335Q;ENSP00000420801:R334Q	.|ENSP00000315931:R437Q	D|R	+|+	1|2	0|0	AHCYL2|AHCYL2	128836567|128836567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.105000|9.105000	0.94246|0.94246	2.685000|2.685000	0.91497|0.91497	0.650000|0.650000	0.86243|0.86243	GAC|CGA	0	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,tigrfam_Adenosylhomocysteinase		0.393	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHCYL2	protein_coding	OTTHUMT00000354065.1	77	266	0	0.00	0	0	G		0	0		129049331	1	no_errors	ENST00000325006	ensembl	human	known	74_37	missense	62	204	35.42	36.73	34	119	SNP	1	A
NOL6	65083	genome.wustl.edu	37	9	33472349	33472349	+	Missense_Mutation	SNP	C	C	T	rs369599517		TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr9:33472349C>T	ENST00000379471.2	-	2	203	c.116G>A	c.(115-117)cGt>cAt	p.R39H	NOL6_ENST00000464829.1_5'UTR|NOL6_ENST00000455041.2_Missense_Mutation_p.R39H			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	39					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R39H(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGCCAATGTACGCTTCCTGGA	0.552																																							0											1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	126.0	102.0	110.0		116,116	1.1	0.0	9		110	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	NOL6	NM_022917.4,NM_139235.3	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	39/1147,39/700	33472349	2,13004	2203	4300	6503	SO:0001583	missense	0			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.116G>A	9.37:g.33472349C>T	ENSP00000368784:p.Arg39His		Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	pfam_Nrap	p.R39H	ENST00000379471.2	37	c.116		9	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093956	0.36952	0.0	2.33E-4	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.48836	0.8;1.4;1.39;1.34	5.04	1.07	0.20283	.	0.385127	0.30556	N	0.009368	T	0.32071	0.0817	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.20368	0.004;0.009;0.019;0.044;0.011	B;B;B;B;B	0.16289	0.002;0.002;0.009;0.015;0.002	T	0.23940	-1.0174	10	0.51188	T	0.08	.	9.3956	0.38401	0.0:0.6088:0.0:0.3912	.	39;39;39;39;39	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	H	39	ENSP00000313978:R39H;ENSP00000297990:R39H;ENSP00000368784:R39H;ENSP00000395915:R39H	ENSP00000297990:R39H	R	-	2	0	NOL6	33462349	0.002000	0.14202	0.003000	0.11579	0.036000	0.12997	0.184000	0.16939	0.255000	0.21593	0.655000	0.94253	CGT	0	NULL		0.552	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	NOL6	protein_coding	OTTHUMT00000001019.2	28	167	0	0.58	0	1	C	NM_022917	rs369599517	C->T		33472349	-1	no_errors	ENST00000297990	ensembl	human	known	74_37	missense	13	98	53.57	35.95	15	55	SNP	0.003	T
CNTRL	11064	genome.wustl.edu	37	9	123906272	123906272	+	Missense_Mutation	SNP	A	A	T			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr9:123906272A>T	ENST00000373855.1	+	20	3223	c.2963A>T	c.(2962-2964)aAg>aTg	p.K988M	CNTRL_ENST00000373847.1_Missense_Mutation_p.K436M|CNTRL_ENST00000238341.5_Missense_Mutation_p.K988M|CNTRL_ENST00000373850.1_Missense_Mutation_p.K436M			Q7Z7A1	CNTRL_HUMAN	centriolin	988					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						ACCTCTGATAAGCTAGCCACA	0.423																																							0											0													49.0	47.0	48.0					9																	123906272		2203	4300	6503	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.2963A>T	9.37:g.123906272A>T	ENSP00000362962:p.Lys988Met		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.K988M	ENST00000373855.1	37	c.2963	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	A	23.1	4.374257	0.82573	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.39787	1.41;1.41;1.41;1.06	5.96	5.96	0.96718	.	.	.	.	.	T	0.53965	0.1829	L	0.29908	0.895	0.42524	D	0.993013	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.57837	-0.7742	9	0.72032	D	0.01	.	15.6089	0.76699	1.0:0.0:0.0:0.0	.	988;988	F5GZN0;Q7Z7A1	.;CNTRL_HUMAN	M	988;988;988;470;436;436	ENSP00000362962:K988M;ENSP00000238341:K988M;ENSP00000362956:K436M;ENSP00000362953:K436M	ENSP00000238341:K988M	K	+	2	0	CNTRL	122946093	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.131000	0.64751	2.279000	0.76181	0.533000	0.62120	AAG	0	NULL		0.423	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	protein_coding	OTTHUMT00000250216.1	53	211	0	0.00	0	0	A	NM_007018	0	0		123906272	1	no_errors	ENST00000238341	ensembl	human	known	74_37	missense	38	176	29.63	33.08	16	87	SNP	1	T
LRSAM1	90678	genome.wustl.edu	37	9	130236179	130236179	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr9:130236179A>G	ENST00000323301.4	+	10	1323	c.719A>G	c.(718-720)gAc>gGc	p.D240G	LRSAM1_ENST00000373324.4_Missense_Mutation_p.D240G|LRSAM1_ENST00000373322.1_Missense_Mutation_p.D240G|Y_RNA_ENST00000363918.1_RNA|LRSAM1_ENST00000300417.6_Missense_Mutation_p.D240G	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	240					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GGGCCCACGGACAGATTCTCA	0.542																																							0											0													113.0	82.0	93.0					9																	130236179		2203	4300	6503	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.719A>G	9.37:g.130236179A>G	ENSP00000322937:p.Asp240Gly		Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.D240G	ENST00000323301.4	37	c.719	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	A	3.328	-0.137196	0.06711	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.34859	1.37;1.34;1.37;1.37	5.38	-0.179	0.13299	Insulin-like (1);	1.262380	0.04972	N	0.464050	T	0.23289	0.0563	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17379	-1.0371	10	0.18276	T	0.48	-1.2892	4.0057	0.09600	0.4274:0.2012:0.3714:0.0	.	240;240	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	G	240	ENSP00000300417:D240G;ENSP00000362421:D240G;ENSP00000322937:D240G;ENSP00000362419:D240G	ENSP00000300417:D240G	D	+	2	0	LRSAM1	129276000	0.106000	0.21978	0.006000	0.13384	0.197000	0.23852	0.515000	0.22801	0.100000	0.17581	0.454000	0.30748	GAC	0	NULL		0.542	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	protein_coding	OTTHUMT00000054164.1	32	148	0	0.00	0	0	A	NM_138361	0	0		130236179	1	no_errors	ENST00000300417	ensembl	human	known	74_37	missense	17	67	39.29	41.23	11	47	SNP	0.008	G
SURF4	6836	genome.wustl.edu	37	9	136230397	136230397	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr9:136230397G>A	ENST00000371989.3	-	6	911	c.782C>T	c.(781-783)tCc>tTc	p.S261F	SURF4_ENST00000485435.2_Intron|SURF4_ENST00000467910.1_5'Flank|SURF4_ENST00000545297.1_3'UTR	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	261					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		CTCATCCATGGAGACACCCCC	0.557																																							0											0													83.0	82.0	82.0					9																	136230397		2203	4300	6503	SO:0001583	missense	0				CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.782C>T	9.37:g.136230397G>A	ENSP00000361057:p.Ser261Phe		B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Missense_Mutation	SNP	pfam_Surf4	p.S261F	ENST00000371989.3	37	c.782	CCDS6968.1	9	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421837	0.83559	.	.	ENSG00000148248	ENST00000371989;ENST00000541390	.	.	.	5.45	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.86464	0.5939	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90419	0.4415	9	0.87932	D	0	-16.544	15.3524	0.74399	0.0:0.1402:0.8598:0.0	.	252;261	B7Z7A8;O15260	.;SURF4_HUMAN	F	261;252	.	ENSP00000361057:S261F	S	-	2	0	SURF4	135220218	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.345000	0.97053	1.283000	0.44513	0.591000	0.81541	TCC	0	pfam_Surf4		0.557	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF4	protein_coding	OTTHUMT00000054886.1	40	207	0	0.00	0	0	G	NM_033161	0	0		136230397	-1	no_errors	ENST00000371989	ensembl	human	known	74_37	missense	39	113	30.36	37.91	17	69	SNP	1	A
HRAS	3265	genome.wustl.edu	37	11	533544	533544	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr11:533544A>G	ENST00000451590.1	-	4	546	c.359T>C	c.(358-360)cTg>cCg	p.L120P	HRAS_ENST00000311189.7_Missense_Mutation_p.L120P|HRAS_ENST00000397594.1_Missense_Mutation_p.L120P|HRAS_ENST00000417302.1_Missense_Mutation_p.L120P|HRAS_ENST00000468682.2_5'Flank|HRAS_ENST00000397596.2_Missense_Mutation_p.L120P	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	120					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)			adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGTGCAGCCAGGTCACACTT	0.627		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																													0	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	0													194.0	173.0	180.0					11																	533544		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.359T>C	11.37:g.533544A>G	ENSP00000407586:p.Leu120Pro		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L120P	ENST00000451590.1	37	c.359	CCDS7698.1	11	.	.	.	.	.	.	.	.	.	.	A	20.2	3.955307	0.73902	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08	4.08	2.94	0.34122	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.92286	0.7553	H	0.99794	4.785	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.70016	0.965;0.967	D	0.92243	0.5802	10	0.87932	D	0	.	8.3156	0.32097	0.9029:0.0:0.0971:0.0	.	120;120	P01112-2;P01112	.;RASH_HUMAN	P	120	ENSP00000380722:L120P;ENSP00000380723:L120P;ENSP00000407586:L120P;ENSP00000388246:L120P;ENSP00000309845:L120P	ENSP00000309845:L120P	L	-	2	0	HRAS	523544	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	7.344000	0.79328	1.624000	0.50355	0.459000	0.35465	CTG	0	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.627	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HRAS	protein_coding	OTTHUMT00000259403.2	54	193	0	0.00	0	0	A	NM_176795	0	0		533544	-1	no_errors	ENST00000311189	ensembl	human	known	74_37	missense	37	61	43.08	44.55	28	49	SNP	1	G
IGF2	3481	genome.wustl.edu	37	11	2167564	2167564	+	Intron	SNP	G	G	A	rs377188989	byFrequency	TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr11:2167564G>A	ENST00000300632.5	-	2	720				IGF2-AS_ENST00000381363.4_RNA|IGF2-AS_ENST00000445504.2_RNA|INS-IGF2_ENST00000481781.1_5'Flank|IGF2-AS_ENST00000381361.3_RNA	NM_001007139.4	NP_001007140.2	P01344	IGF2_HUMAN	insulin-like growth factor 2						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)	p.A132T(1)		central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TCCTCAGAGCGCCCCTCCGTC	0.677													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15949	0.0		0.0	False		,,,				2504	0.0						0.9996,0.0003994											1	Substitution - Missense(1)	endometrium(1)						G		4,3828		0,4,1912	70.0	76.0	74.0			0.0	0.0	11		74	0,8238		0,0,4119	no	intron	IGF2	NM_001007139.4		0,4,6031	AA,AG,GG		0.0,0.1044,0.0331			2167564	4,12066	1916	4119	6035	SO:0001627	intron_variant	0			M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000300632.5:c.5+1231C>T	11.37:g.2167564G>A			B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	RNA	SNP	0	NULL	ENST00000300632.5	37	NULL	CCDS7728.1	11	.	.	.	.	.	.	.	.	.	.	G	5.420	0.262690	0.10294	0.001044	0.0	ENSG00000099869	ENST00000381363	.	.	.	2.01	0.0417	0.14214	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.09310	N	1	P	0.49862	0.929	P	0.44623	0.455	T	0.18555	-1.0333	7	0.87932	D	0	.	4.3172	0.10998	0.3704:0.0:0.6296:0.0	.	132	Q6U949	IG2AS_HUMAN	T	132	.	ENSP00000370766:A132T	A	+	1	0	IGF2AS	2124140	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.380000	0.07427	0.013000	0.14918	-0.379000	0.06801	GCC	0	0		0.677	IGF2-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2-AS	protein_coding		47	214	0	0.47	0	1	G	NM_000612	rs377188989	G->A		2167564	1	no_errors	ENST00000381361	ensembl	human	known	74_37	rna	35	94	27.08	37.25	13	57	SNP	0.001	A
KCNMB4	27345	genome.wustl.edu	37	12	70760622	70760622	+	Silent	SNP	C	C	G			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr12:70760622C>G	ENST00000258111.4	+	1	567	c.108C>G	c.(106-108)ggC>ggG	p.G36G		NM_014505.5	NP_055320.4	Q86W47	KCMB4_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 4	36					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of neurotransmitter secretion (GO:0046928)|regulation of vasoconstriction (GO:0019229)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)			kidney(1)|large_intestine(4)|lung(5)	10	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)		Miconazole(DB01110)|Procaine(DB00721)	TCATCTTCGGCTTCTGCTGGC	0.612																																							0											0													54.0	44.0	48.0					12																	70760622		2203	4300	6503	SO:0001819	synonymous_variant	0			AF207992	CCDS8997.1	12q15	2006-06-10			ENSG00000135643	ENSG00000135643		"""Potassium channels"""	6289	protein-coding gene	gene with protein product		605223				10692449, 10828459	Standard	NM_014505		Approved		uc001svx.3	Q86W47	OTTHUMG00000167586	ENST00000258111.4:c.108C>G	12.37:g.70760622C>G			Q8IVR3|Q9NPA4|Q9P0G5	Silent	SNP	pfam_K_chnl_Ca-activ_BK_bsu	p.G36	ENST00000258111.4	37	c.108	CCDS8997.1	12																																																																																			0	pfam_K_chnl_Ca-activ_BK_bsu		0.612	KCNMB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB4	protein_coding	OTTHUMT00000395208.1	31	29	0	0.00	0	0	C	NM_014505	0	0		70760622	1	no_errors	ENST00000258111	ensembl	human	known	74_37	silent	23	18	45.24	43.75	19	14	SNP	1	G
UTP20	27340	genome.wustl.edu	37	12	101776972	101776972	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr12:101776972G>A	ENST00000261637.4	+	59	7984	c.7810G>A	c.(7810-7812)Gaa>Aaa	p.E2604K		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2604					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GTCTGACGGAGAAGAGAAGGA	0.502																																							0											0													65.0	73.0	70.0					12																	101776972		2203	4300	6503	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7810G>A	12.37:g.101776972G>A	ENSP00000261637:p.Glu2604Lys		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.E2604K	ENST00000261637.4	37	c.7810	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408837	0.25378	.	.	ENSG00000120800	ENST00000261637	T	0.09073	3.02	3.95	0.924	0.19418	.	0.593188	0.19219	N	0.119729	T	0.04679	0.0127	N	0.21583	0.68	0.20196	N	0.999926	B	0.10296	0.003	B	0.09377	0.004	T	0.45527	-0.9255	10	0.15952	T	0.53	0.0037	6.6068	0.22729	0.1696:0.1473:0.6831:0.0	.	2604	O75691	UTP20_HUMAN	K	2604	ENSP00000261637:E2604K	ENSP00000261637:E2604K	E	+	1	0	UTP20	100301103	0.657000	0.27393	0.001000	0.08648	0.070000	0.16714	3.018000	0.49625	-0.122000	0.11766	-0.148000	0.13756	GAA	0	NULL		0.502	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	protein_coding	OTTHUMT00000408242.1	23	70	0	0.00	0	0	G	NM_014503	0	0		101776972	1	no_errors	ENST00000261637	ensembl	human	known	74_37	missense	21	48	40	44.83	14	39	SNP	0.052	A
CHGA	1113	genome.wustl.edu	37	14	93397798	93397798	+	Missense_Mutation	SNP	G	G	T			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr14:93397798G>T	ENST00000216492.5	+	6	839	c.559G>T	c.(559-561)Gcc>Tcc	p.A187S	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Intron	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	187	O-glycosylated at one site only in cerebrospinal fluid.				regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		CCACCCTCCAGCCAGCCTCCC	0.657																																					Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)		0											0													23.0	27.0	26.0					14																	93397798		2201	4298	6499	SO:0001583	missense	0				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.559G>T	14.37:g.93397798G>T	ENSP00000216492:p.Ala187Ser		B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.A187S	ENST00000216492.5	37	c.559	CCDS9906.1	14	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756152	0.31137	.	.	ENSG00000100604	ENST00000216492	T	0.01613	4.73	4.94	-0.571	0.11749	.	0.806157	0.11871	N	0.521477	T	0.01387	0.0045	L	0.41236	1.265	0.09310	N	0.999999	B	0.21606	0.058	B	0.17098	0.017	T	0.49041	-0.8980	10	0.06236	T	0.91	-4.5298	5.4497	0.16556	0.2642:0.295:0.4408:0.0	.	187	P10645	CMGA_HUMAN	S	187	ENSP00000216492:A187S	ENSP00000216492:A187S	A	+	1	0	CHGA	92467551	0.031000	0.19500	0.445000	0.26908	0.833000	0.47200	0.798000	0.27014	-0.060000	0.13132	0.555000	0.69702	GCC	0	pfam_Granin		0.657	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGA	protein_coding	OTTHUMT00000412411.1	39	101	0	0.00	0	0	G	NM_001275	0	0		93397798	1	no_errors	ENST00000216492	ensembl	human	known	74_37	missense	28	56	40.43	37.36	19	34	SNP	0.07	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299928	102299929	+	RNA	DNP	AG	AG	CA			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A|G	A|G	A|G	C|A	A|G	A|G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr15:102299928_102299929AG>CA	ENST00000561463.1	+	0	7974_7975									DNM1 pseudogene 47																		TCGGCAGAGCAGGCAGACCAAG	0.599																																							0											0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265	Exception_encountered	15.37:g.102299928_102299929delinsCA				RNA	SNP	0	NULL	ENST00000561463.1	37	NULL		15																																																																																			0	0		0.599	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	65	9	0	0.00	0	0	A|G	NG_009149	0	0		102299928|102299929	1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	81	14	11.96	17.65	11	3	SNP	0.996|1	C|A
LIG3	3980	genome.wustl.edu	37	17	33319039	33319039	+	Missense_Mutation	SNP	C	C	T	rs143109771		TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr17:33319039C>T	ENST00000378526.4	+	7	1404	c.1271C>T	c.(1270-1272)tCa>tTa	p.S424L	LIG3_ENST00000262327.5_Missense_Mutation_p.S424L	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	424					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)	p.S424*(1)|p.S337*(1)		endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AAGATGAACTCAGGTGCAAAA	0.448								Other BER factors																															0											2	Substitution - Nonsense(2)	skin(2)											136.0	119.0	125.0					17																	33319039		2203	4300	6503	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1271C>T	17.37:g.33319039C>T	ENSP00000367787:p.Ser424Leu		Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.S424L	ENST00000378526.4	37	c.1271	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235690	0.79800	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.13778	2.56;2.56	5.5	5.5	0.81552	DNA ligase, ATP-dependent, N-terminal (3);	0.243620	0.42821	D	0.000657	T	0.12347	0.0300	L	0.34521	1.04	0.58432	D	0.999996	B;B;B	0.19073	0.013;0.013;0.033	B;B;B	0.23018	0.043;0.043;0.043	T	0.10613	-1.0622	10	0.08837	T	0.75	-3.4811	18.5685	0.91126	0.0:1.0:0.0:0.0	.	424;424;424	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	L	424	ENSP00000367787:S424L;ENSP00000262327:S424L	ENSP00000262327:S424L	S	+	2	0	LIG3	30343152	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	5.706000	0.68362	2.861000	0.98227	0.655000	0.94253	TCA	0	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep		0.448	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	protein_coding	OTTHUMT00000250330.3	34	139	0	0.00	0	0	C	NM_013975	0	0		33319039	1	no_errors	ENST00000378526	ensembl	human	known	74_37	missense	23	83	36.11	34.65	13	44	SNP	0.934	T
MUC16	94025	genome.wustl.edu	37	19	9005592	9005592	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr19:9005592A>G	ENST00000397910.4	-	46	40017	c.39814T>C	c.(39814-39816)Tac>Cac	p.Y13272H	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13274	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCAGGGTGTAGGGTCCCAGC	0.552																																							0											0													179.0	161.0	167.0					19																	9005592		2045	4189	6234	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39814T>C	19.37:g.9005592A>G	ENSP00000381008:p.Tyr13272His		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.Y13272H	ENST00000397910.4	37	c.39814	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	12.70	2.015478	0.35511	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.25250	1.81	3.51	3.51	0.40186	.	.	.	.	.	T	0.53318	0.1789	M	0.88640	2.97	.	.	.	D;D	0.76494	0.999;0.96	D;P	0.87578	0.998;0.887	T	0.68637	-0.5356	8	0.87932	D	0	-5.6225	8.9719	0.35912	1.0:0.0:0.0:0.0	.	20917;13272	Q8WXI7;B5ME49	MUC16_HUMAN;.	H	13272;403	ENSP00000381008:Y13272H	ENSP00000381008:Y13272H	Y	-	1	0	MUC16	8866592	0.998000	0.40836	0.800000	0.32199	0.127000	0.20565	2.891000	0.48617	1.536000	0.49237	0.374000	0.22700	TAC	0	NULL		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	60	33	0	0.00	0	0	A	NM_024690	0	0		9005592	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	22	26	45	29.73	18	11	SNP	0.959	G
CLPTM1	1209	genome.wustl.edu	37	19	45495976	45495976	+	Missense_Mutation	SNP	G	G	A	rs199735762		TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr19:45495976G>A	ENST00000337392.5	+	14	1981	c.1831G>A	c.(1831-1833)Gtg>Atg	p.V611M	CLPTM1_ENST00000541297.2_Missense_Mutation_p.V597M|CLPTM1_ENST00000546079.1_Missense_Mutation_p.V509M	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	611					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TGCCGCCCCCGTGGCCGAGGT	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14570	0.0		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0								G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	68.0	73.0	71.0		1831	2.1	0.2	19		71	0,8600		0,0,4300	no	missense	CLPTM1	NM_001294.2	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	611/670	45495976	1,13005	2203	4300	6503	SO:0001583	missense	0			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1831G>A	19.37:g.45495976G>A	ENSP00000336994:p.Val611Met		B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	pfam_CLPTM1	p.V611M	ENST00000337392.5	37	c.1831	CCDS12651.1	19	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	G	8.906	0.957600	0.18507	2.27E-4	0.0	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	3.17	2.08	0.27032	.	1.659760	0.03423	N	0.206674	T	0.18923	0.0454	N	0.14661	0.345	0.09310	N	0.999992	B;P	0.40360	0.199;0.714	B;B	0.34590	0.186;0.065	T	0.21895	-1.0232	9	0.48119	T	0.1	-2.5126	6.802	0.23756	0.1337:0.0:0.8663:0.0	.	597;611	F5H8J3;O96005	.;CLPT1_HUMAN	M	509;597;611;611	.	ENSP00000336994:V611M	V	+	1	0	CLPTM1	50187816	0.002000	0.14202	0.184000	0.23157	0.031000	0.12232	1.073000	0.30691	0.868000	0.35678	0.558000	0.71614	GTG	0	NULL		0.652	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	protein_coding	OTTHUMT00000453267.1	38	154	0	0.00	0	0	G	NM_001294	rs199735762	G->A		45495976	1	no_errors	ENST00000337392	ensembl	human	known	74_37	missense	24	79	36.84	31.62	14	37	SNP	0.332	A
FAM83D	81610	genome.wustl.edu	37	20	37576538	37576538	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr20:37576538T>C	ENST00000217429.4	+	3	802	c.761T>C	c.(760-762)aTc>aCc	p.I254T		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	224					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				GTTCGGACTATCACAGGAAAT	0.433																																							0											0													138.0	130.0	132.0					20																	37576538		1927	4129	6056	SO:0001583	missense	0			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.761T>C	20.37:g.37576538T>C	ENSP00000217429:p.Ile254Thr		B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	pfam_DUF1669	p.I254T	ENST00000217429.4	37	c.761	CCDS42872.1	20	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062246	0.76187	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.12255	2.7	6.16	6.16	0.99307	.	0.157938	0.53938	D	0.000055	T	0.32194	0.0821	L	0.52126	1.63	0.49915	D	0.999834	D	0.89917	1.0	D	0.72075	0.976	T	0.00615	-1.1643	10	0.38643	T	0.18	.	16.4795	0.84153	0.0:0.0:0.0:1.0	.	224	Q9H4H8	FA83D_HUMAN	T	254;208	ENSP00000217429:I254T	ENSP00000217429:I254T	I	+	2	0	FAM83D	37009952	0.998000	0.40836	0.998000	0.56505	0.828000	0.46876	7.671000	0.83941	2.367000	0.80283	0.528000	0.53228	ATC	0	pfam_DUF1669		0.433	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83D	protein_coding	OTTHUMT00000079211.1	102	193	0	0.00	0	0	T		0	0		37576538	1	no_errors	ENST00000217429	ensembl	human	known	74_37	missense	61	123	42.99	39.71	46	81	SNP	1	C
ZNF462	58499	genome.wustl.edu	37	9	109690685	109690685	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr9:109690685delG	ENST00000277225.5	+	3	4781	c.4492delG	c.(4492-4494)gtgfs	p.V1498fs	ZNF462_ENST00000441147.2_Frame_Shift_Del_p.V343fs|ZNF462_ENST00000457913.1_Frame_Shift_Del_p.V1498fs			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1498					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TGGCATGAAAGTGAAGGCTGC	0.517																																							0											0													98.0	86.0	90.0					9																	109690685		2203	4300	6503	SO:0001589	frameshift_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.4492delG	9.37:g.109690685delG	ENSP00000277225:p.Val1498fs		Q5T0T4|Q8N408	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V1498fs	ENST00000277225.5	37	c.4492	CCDS35096.1	9																																																																																			0	pfscan_Znf_C2H2		0.517	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	24	111	0	0.00	0	0	G	NM_021224	0	0		109690685	1	no_errors	ENST00000457913	ensembl	human	known	74_37	frame_shift_del	26	69	39.53	40.00	17	46	DEL	1	0
SNX29P2	440352	genome.wustl.edu	37	16	29496768	29496768	+	Silent	SNP	G	G	C			TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr16:29496768G>C	ENST00000354563.5	-	3	917	c.507C>G	c.(505-507)ccC>ccG	p.P169P	SNX29P2_ENST00000398878.3_lincRNA																endometrium(1)|kidney(1)	2						GCAGACACTCGGGAGGTGTCT	0.582																																							0											0																																										SO:0001819	synonymous_variant	0																														ENST00000354563.5:c.507C>G	16.37:g.29496768G>C				Silent	SNP	NULL	p.P169	ENST00000354563.5	37	c.507		16																																																																																			0	NULL		0.582	RP11-231C14.4-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000169203	protein_coding		17	0	5.56	0.00	1	0	G		0	0		29496768	-1	no_errors	ENST00000354563	ensembl	human	known	74_37	silent	18	0	30.77	0.00	8	0	SNP	0.031	C
ANKRD30BL	554226	genome.wustl.edu	37	2	133015515	133015516	+	5'UTR	INS	-	-	GGCG	rs372477900		TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr2:133015515_133015516insGGCG	ENST00000470729.1	-	0	26_27				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGTAGCCCCTCGGCGGCCGGCC	0.688																																							0											0										574,2536		16,542,997						0.4	0.0		dbSNP_119	29	1099,4297		42,1015,1641	no	intergenic				58,1557,2638	A1A1,A1R,RR		20.3669,18.4566,19.6685				1673,6833				SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1399->CGCC	2.37:g.133015516_133015519dupGGCG			B8ZZL7	RNA	INS	0	NULL	ENST00000470729.1	37	NULL		2																																																																																			0	0		0.688	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	protein_coding	OTTHUMT00000331354.1	44	2	2.22	0.00	1	0	0	NR_027019	rs372477900	C->CGGCG		133015516	-1	no_errors	ENST00000470729	ensembl	human	known	74_37	rna	47	0	21.67	0.00	13	0	INS	0.021:0.015	GGCG
RP11-43F13.4	0	genome.wustl.edu	37	5	1004308	1004309	+	lincRNA	INS	-	-	GG	rs146202216|rs201642892		TCGA-XU-A92Q-01A-11D-A423-09	TCGA-XU-A92Q-10A-01D-A426-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	268c3e39-3acb-45d8-9c61-c13c46d1e906	aa5d7f36-ebc8-4ea0-80f6-5b82c96aa61f	g.chr5:1004308_1004309insGG	ENST00000606540.1	+	0	0				AC116351.2_ENST00000408317.1_RNA																							GAAGGGGACgtgggtgtgtgtg	0.594																																							0											0																																												0																															5.37:g.1004309_1004310dupGG				RNA	INS	0	NULL	ENST00000606540.1	37	NULL		5																																																																																			0	0		0.594	RP11-43F13.4-001	KNOWN	basic	lincRNA	ENSG00000221244	lincRNA	OTTHUMT00000470457.1	31	10	3.12	0.00	1	0	0		0	0		1004309	1	no_errors	ENST00000408317	ensembl	human	novel	74_37	rna	25	4	16.67	0.00	5	0	INS	0.020:0.028	GG
