#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
TRO	7216	genome.wustl.edu	37	X	54956354	54956354	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chrX:54956354A>G	ENST00000173898.7	+	12	3309	c.3197A>G	c.(3196-3198)aAt>aGt	p.N1066S	TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.N669S|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000420798.2_Missense_Mutation_p.N597S|TRO_ENST00000319167.8_Intron|TRO_ENST00000375022.4_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1066	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CTCAACACCAATGCCAGCTTT	0.562													A|||	1	0.000264901	0.0008	0.0	3775	,	,		18230	0.0		0.0	False		,,,				2504	0.0						0											0													31.0	29.0	30.0					X																	54956354		2022	4168	6190	SO:0001583	missense	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3197A>G	X.37:g.54956354A>G	ENSP00000173898:p.Asn1066Ser		B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.N1066S	ENST00000173898.7	37	c.3197	CCDS43959.1	X	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.946905	0.00475	.	.	ENSG00000067445	ENST00000173898;ENST00000420798;ENST00000375041	T;T;T	0.03745	3.82;3.82;3.82	2.81	-0.0372	0.13885	.	.	.	.	.	T	0.01189	0.0039	N	0.01505	-0.83	0.09310	N	1	B;B	0.18013	0.025;0.025	B;B	0.18263	0.021;0.008	T	0.46911	-0.9157	9	0.02654	T	1	.	6.5227	0.22285	0.4057:0.0:0.5943:0.0	.	669;1066	B1AKE9;Q12816	.;TROP_HUMAN	S	1066;597;669	ENSP00000173898:N1066S;ENSP00000405126:N597S;ENSP00000364181:N669S	ENSP00000173898:N1066S	N	+	2	0	TRO	54973079	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.399000	0.07250	-0.120000	0.11809	-0.537000	0.04273	AAT	0	NULL		0.562	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	protein_coding	OTTHUMT00000056837.3	22	29	0	0.00	0	0	A	NM_016157	0	0		54956354	1	no_errors	ENST00000173898	ensembl	human	known	74_37	missense	11	23	47.62	54.00	10	27	SNP	0	G
RGAG4	340526	genome.wustl.edu	37	X	71351032	71351032	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chrX:71351032G>C	ENST00000545866.1	-	1	726	c.359C>G	c.(358-360)cCc>cGc	p.P120R	RGAG4_ENST00000609883.1_Missense_Mutation_p.P120R|NHSL2_ENST00000535692.1_5'Flank|NHSL2_ENST00000373677.1_5'Flank|NHSL2_ENST00000540800.1_Intron|NHSL2_ENST00000510661.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	120										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CAGCAGAGGGGGGTCAGCGGG	0.697																																							0											0													6.0	7.0	7.0					X																	71351032		1773	3882	5655	SO:0001583	missense	0			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.359C>G	X.37:g.71351032G>C	ENSP00000441366:p.Pro120Arg		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom	p.P120R	ENST00000545866.1	37	c.359	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	G	2.582	-0.297210	0.05532	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.14893	2.47;2.47	4.19	3.32	0.38043	.	.	.	.	.	T	0.11153	0.0272	N	0.19112	0.55	0.09310	N	1	P	0.44627	0.839	B	0.41202	0.35	T	0.13845	-1.0494	8	.	.	.	-0.9132	8.3955	0.32555	0.0:0.0:0.7675:0.2325	.	120	Q5HYW3	RGAG4_HUMAN	R	120	ENSP00000441366:P120R;ENSP00000418667:P120R	.	P	-	2	0	RGAG4	71267757	0.014000	0.17966	0.001000	0.08648	0.013000	0.08279	1.589000	0.36644	1.108000	0.41662	-0.324000	0.08512	CCC	0	NULL		0.697	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	protein_coding	OTTHUMT00000057171.1	24	16	0	0.00	0	0	G	NM_001024455	0	0		71351032	-1	no_errors	ENST00000479991	ensembl	human	known	74_37	missense	6	12	64.71	65.71	11	23	SNP	0.001	C
AIFM1	9131	genome.wustl.edu	37	X	129270037	129270037	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chrX:129270037G>A	ENST00000287295.3	-	12	1518	c.1288C>T	c.(1288-1290)Cgc>Tgc	p.R430C	AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000319908.3_Missense_Mutation_p.R426C|AIFM1_ENST00000440263.1_Missense_Mutation_p.R78C|AIFM1_ENST00000460436.2_Missense_Mutation_p.R91C|AIFM1_ENST00000346424.2_Missense_Mutation_p.R143C	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	430	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	ATGTTAGAGCGTGCTTGTAGC	0.517																																							0											0													137.0	107.0	117.0					X																	129270037		2203	4300	6503	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1288C>T	X.37:g.129270037G>A	ENSP00000287295:p.Arg430Cys		A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.R430C	ENST00000287295.3	37	c.1288	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247909	0.80024	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;T;T;T	0.49720	0.79;0.79;0.89;0.77;0.89	6.0	6.0	0.97389	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.71230	0.3315	M	0.77820	2.39	0.80722	D	1	P;D;D	0.89917	0.803;0.999;1.0	B;D;D	0.70487	0.316;0.923;0.969	T	0.73633	-0.3921	10	0.72032	D	0.01	-8.016	19.4264	0.94742	0.0:0.0:1.0:0.0	.	143;426;430	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	C	91;143;426;78;430	ENSP00000431222:R91C;ENSP00000316320:R143C;ENSP00000315122:R426C;ENSP00000405879:R78C;ENSP00000287295:R430C	ENSP00000287295:R430C	R	-	1	0	AIFM1	129097718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.281000	0.78621	2.542000	0.85734	0.600000	0.82982	CGC	0	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD		0.517	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	protein_coding	OTTHUMT00000058247.2	43	137	0	0.72	0	1	G		0	0		129270037	-1	no_errors	ENST00000287295	ensembl	human	known	74_37	missense	28	69	53.33	52.41	32	76	SNP	1	A
HES3	390992	genome.wustl.edu	37	1	6305563	6305563	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr1:6305563A>G	ENST00000377898.3	+	4	622	c.557A>G	c.(556-558)aAc>aGc	p.N186S		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	186					hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		GATGACCTGAACTGAAGGCGC	0.692																																							0											0													10.0	13.0	12.0					1																	6305563		1737	3854	5591	SO:0001583	missense	0				CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.557A>G	1.37:g.6305563A>G	ENSP00000367130:p.Asn186Ser		Q5TGS0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N186S	ENST00000377898.3	37	c.557	CCDS41238.1	1	.	.	.	.	.	.	.	.	.	.	A	7.934	0.741342	0.15642	.	.	ENSG00000173673	ENST00000377898	T	0.29917	1.55	2.9	1.77	0.24775	.	.	.	.	.	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.20338	-1.0278	9	0.87932	D	0	.	4.1888	0.10411	0.8245:0.0:0.1755:0.0	.	186	Q5TGS1	HES3_HUMAN	S	186	ENSP00000367130:N186S	ENSP00000367130:N186S	N	+	2	0	HES3	6228150	0.003000	0.15002	0.000000	0.03702	0.072000	0.16883	1.345000	0.33953	0.537000	0.28751	0.240000	0.17902	AAC	0	NULL		0.692	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HES3	protein_coding	OTTHUMT00000003716.3	65	97	0	0.00	0	0	A	NM_001024598	0	0		6305563	1	no_errors	ENST00000377898	ensembl	human	known	74_37	missense	42	67	35.38	33.66	23	34	SNP	0	G
LDLRAP1	26119	genome.wustl.edu	37	1	25881384	25881384	+	Missense_Mutation	SNP	A	A	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr1:25881384A>T	ENST00000374338.4	+	3	384	c.265A>T	c.(265-267)Act>Tct	p.T89S	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	89	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGAAGGTGACTCTGAAGGT	0.552																																							0											0													92.0	79.0	84.0					1																	25881384		2203	4300	6503	SO:0001583	missense	0			BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.265A>T	1.37:g.25881384A>T	ENSP00000363458:p.Thr89Ser		A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.T89S	ENST00000374338.4	37	c.265	CCDS30639.1	1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545357	0.45280	.	.	ENSG00000157978	ENST00000374338	T	0.19105	2.17	4.93	3.8	0.43715	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.251798	0.45867	D	0.000327	T	0.17280	0.0415	L	0.43152	1.355	0.34954	D	0.751494	B	0.25105	0.118	B	0.30105	0.111	T	0.17137	-1.0379	10	0.13470	T	0.59	-9.3935	9.7768	0.40623	0.9179:0.0:0.082:0.0	.	89	Q5SW96	ARH_HUMAN	S	89	ENSP00000363458:T89S	ENSP00000363458:T89S	T	+	1	0	LDLRAP1	25753971	0.415000	0.25416	0.999000	0.59377	0.949000	0.60115	2.259000	0.43259	0.847000	0.35167	0.260000	0.18958	ACT	0	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.552	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAP1	protein_coding	OTTHUMT00000019350.3	48	115	0	0.00	0	0	A	NM_015627	0	0		25881384	1	no_errors	ENST00000374338	ensembl	human	known	74_37	missense	18	50	48.57	40.48	17	34	SNP	1	T
FGGY	55277	genome.wustl.edu	37	1	59787274	59787274	+	Missense_Mutation	SNP	G	G	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr1:59787274G>T	ENST00000303721.7	+	2	227	c.53G>T	c.(52-54)gGa>gTa	p.G18V	FGGY_ENST00000371212.1_Missense_Mutation_p.G18V|FGGY_ENST00000371218.4_Missense_Mutation_p.G18V|FGGY_ENST00000474476.1_Intron	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	18					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					GTGGACGTTGGAACAGGCAGT	0.502																																							0											0													88.0	83.0	84.0					1																	59787274		1568	3582	5150	SO:0001583	missense	0				CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.53G>T	1.37:g.59787274G>T	ENSP00000305922:p.Gly18Val		B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_C,pfam_Carb_kinase_FGGY_N,tigrfam_Carb_kinase_FGGY-rel	p.G18V	ENST00000303721.7	37	c.53	CCDS611.2	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731496	0.89390	.	.	ENSG00000172456	ENST00000413489;ENST00000371218;ENST00000303721;ENST00000371212	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.2	5.2	0.72013	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	H	0.97315	3.98	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98459	1.0595	9	.	.	.	-11.7957	18.9316	0.92568	0.0:0.0:1.0:0.0	.	18;18;18;18	Q96C11-3;B1AK94;F2Z2V1;Q96C11	.;.;.;FGGY_HUMAN	V	18	ENSP00000406607:G18V;ENSP00000360262:G18V;ENSP00000305922:G18V;ENSP00000360256:G18V	.	G	+	2	0	FGGY	59559862	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	8.748000	0.91615	2.691000	0.91804	0.655000	0.94253	GGA	0	pfam_Carb_kinase_FGGY_N,tigrfam_Carb_kinase_FGGY-rel		0.502	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGGY	protein_coding	OTTHUMT00000023210.2	45	130	0	0.00	0	0	G	NM_001113411	0	0		59787274	1	no_errors	ENST00000303721	ensembl	human	known	74_37	missense	39	113	46.58	35.43	34	62	SNP	1	T
OVGP1	5016	genome.wustl.edu	37	1	111968033	111968033	+	Missense_Mutation	SNP	T	T	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr1:111968033T>A	ENST00000369732.3	-	4	344	c.289A>T	c.(289-291)Atc>Ttc	p.I97F	OVGP1_ENST00000540696.1_Missense_Mutation_p.I37F|OVGP1_ENST00000481495.1_5'Flank	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	97					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CACCCGCCGATGGACAGTAGT	0.532																																							0											0													133.0	106.0	115.0					1																	111968033		2203	4300	6503	SO:0001583	missense	0			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.289A>T	1.37:g.111968033T>A	ENSP00000358747:p.Ile97Phe		A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.I97F	ENST00000369732.3	37	c.289	CCDS834.1	1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.844844	0.51164	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000540696	T;T	0.10573	2.86;3.26	4.34	0.266	0.15617	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.110343	0.64402	D	0.000008	T	0.14313	0.0346	M	0.74881	2.28	0.43708	D	0.996173	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.75484	0.986;0.986;0.955	T	0.03433	-1.1037	10	0.87932	D	0	-14.161	4.1112	0.10060	0.0:0.3433:0.1867:0.47	.	97;97;161	B2RA77;Q12889;Q59HH5	.;OVGP1_HUMAN;.	F	97;161;37	ENSP00000358747:I97F;ENSP00000438449:I37F	ENSP00000358743:I161F	I	-	1	0	OVGP1	111769556	0.999000	0.42202	0.733000	0.30861	0.471000	0.32888	0.793000	0.26944	-0.017000	0.14103	0.397000	0.26171	ATC	0	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II		0.532	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	protein_coding	OTTHUMT00000032461.1	60	191	0	0.52	0	1	T	NM_002557	0	0		111968033	-1	no_errors	ENST00000369732	ensembl	human	known	74_37	missense	27	95	42.55	43.79	20	74	SNP	0.997	A
RPRD2	23248	genome.wustl.edu	37	1	150445793	150445793	+	Missense_Mutation	SNP	T	T	G			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr1:150445793T>G	ENST00000369068.4	+	11	4373	c.4369T>G	c.(4369-4371)Ttc>Gtc	p.F1457V	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.F1431V	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1457	Pro-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACGCCCATTCTTCCCTCCCAG	0.448																																							0											0													58.0	53.0	55.0					1																	150445793		1858	4094	5952	SO:0001583	missense	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.4369T>G	1.37:g.150445793T>G	ENSP00000358064:p.Phe1457Val		A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_CID_dom	p.F1457V	ENST00000369068.4	37	c.4369	CCDS44216.1	1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.844827	0.51164	.	.	ENSG00000163125	ENST00000401000;ENST00000369068	T;T	0.53423	0.62;0.62	4.94	4.94	0.65067	.	0.132972	0.52532	D	0.000069	T	0.25568	0.0622	N	0.19112	0.55	0.80722	D	1	P;P	0.41450	0.634;0.75	B;B	0.41917	0.204;0.37	T	0.24764	-1.0151	10	0.87932	D	0	-11.0231	14.7672	0.69648	0.0:0.0:0.0:1.0	.	1457;1431	Q5VT52;Q5VT52-3	RPRD2_HUMAN;.	V	1431;1457	ENSP00000383785:F1431V;ENSP00000358064:F1457V	ENSP00000358064:F1457V	F	+	1	0	RPRD2	148712417	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.202000	0.58446	2.054000	0.61138	0.533000	0.62120	TTC	0	NULL		0.448	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	protein_coding	OTTHUMT00000035844.1	41	235	0	0.00	0	0	T	NM_015203	0	0		150445793	1	no_errors	ENST00000369068	ensembl	human	known	74_37	missense	21	128	41.67	37.56	15	77	SNP	1	G
MYO7B	4648	genome.wustl.edu	37	2	128384562	128384562	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr2:128384562C>T	ENST00000409816.2	+	30	4182	c.4150C>T	c.(4150-4152)Cag>Tag	p.Q1384*	MYO7B_ENST00000428314.1_Nonsense_Mutation_p.Q1384*|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Nonsense_Mutation_p.Q1384*|MYO7B_ENST00000409090.1_Nonsense_Mutation_p.Q237*			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1384	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCCATACACTCAGAAGCAAGT	0.597																																							0											0													27.0	30.0	29.0					2																	128384562		2009	4175	6184	SO:0001587	stop_gained	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4150C>T	2.37:g.128384562C>T	ENSP00000386461:p.Gln1384*		Q14786|Q8TEE1	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.Q1384*	ENST00000409816.2	37	c.4150	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	c	37	6.173106	0.97348	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	.	.	.	4.71	2.86	0.33363	.	0.282821	0.37304	N	0.002148	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5321	0.39200	0.2867:0.5747:0.1385:0.0	.	.	.	.	X	1384;1384;237;1384;237	.	ENSP00000272666:Q237X	Q	+	1	0	MYO7B	128101032	0.939000	0.31865	0.899000	0.35326	0.014000	0.08584	1.859000	0.39418	0.595000	0.29777	-0.258000	0.10820	CAG	0	smart_Band_41_domain,pfscan_FERM_domain		0.597	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	protein_coding	OTTHUMT00000331124.3	56	109	1.75	0.00	1	0	C	XM_291001	0	0		128384562	1	no_errors	ENST00000389524	ensembl	human	known	74_37	nonsense	21	53	45	49.52	18	52	SNP	0.24	T
SLMAP	7871	genome.wustl.edu	37	3	57843842	57843842	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr3:57843842T>C	ENST00000428312.1	+	7	737	c.643T>C	c.(643-645)Tca>Cca	p.S215P	SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000295952.3_Missense_Mutation_p.S215P|SLMAP_ENST00000295951.3_Missense_Mutation_p.S215P|SLMAP_ENST00000449503.2_Missense_Mutation_p.S215P|SLMAP_ENST00000383718.3_Missense_Mutation_p.S215P			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	215					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TAGACTCTTATCACGGTTAGA	0.299																																							0											0													112.0	119.0	117.0					3																	57843842		2203	4297	6500	SO:0001583	missense	0			AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.643T>C	3.37:g.57843842T>C	ENSP00000398661:p.Ser215Pro		Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.S215P	ENST00000428312.1	37	c.643		3	.	.	.	.	.	.	.	.	.	.	T	27.0	4.795629	0.90453	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.991;0.958;0.994;0.974	T	0.73338	-0.4014	10	0.62326	D	0.03	-6.1962	16.6512	0.85203	0.0:0.0:0.0:1.0	.	215;215;215;215	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	P	215	ENSP00000295951:S215P;ENSP00000295952:S215P;ENSP00000373224:S215P;ENSP00000398661:S215P;ENSP00000412945:S215P	ENSP00000295951:S215P	S	+	1	0	SLMAP	57818882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.141000	0.77330	2.333000	0.79357	0.482000	0.46254	TCA	0	NULL		0.299	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	protein_coding	OTTHUMT00000351584.1	23	175	0	0.00	0	0	T	NM_007159	0	0		57843842	1	no_errors	ENST00000428312	ensembl	human	known	74_37	missense	32	157	44.83	41.42	26	111	SNP	1	C
FOXL2NB	401089	genome.wustl.edu	37	3	138668430	138668430	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr3:138668430C>T	ENST00000383165.3	+	2	300	c.169C>T	c.(169-171)Ccc>Tcc	p.P57S	FOXL2_ENST00000330315.3_5'Flank	NM_001040061.2	NP_001035150.1	Q6ZUU3	FOXNB_HUMAN		57										large_intestine(1)|lung(3)	4						AATCGGTCTCCCCAAGATGTG	0.542																																							0											0													75.0	79.0	78.0					3																	138668430		1946	4153	6099	SO:0001583	missense	0																														ENST00000383165.3:c.169C>T	3.37:g.138668430C>T	ENSP00000372651:p.Pro57Ser		A6NGX0	Missense_Mutation	SNP	NULL	p.P57S	ENST00000383165.3	37	c.169	CCDS43155.1	3	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537822	0.27475	.	.	ENSG00000206262	ENST00000383165	.	.	.	2.36	0.483	0.16820	.	.	.	.	.	T	0.34832	0.0911	N	0.14661	0.345	0.09310	N	1	D	0.71674	0.998	D	0.69479	0.964	T	0.15407	-1.0438	8	0.87932	D	0	.	4.4152	0.11452	0.0:0.6527:0.0:0.3473	.	57	Q6ZUU3	CC072_HUMAN	S	57	.	ENSP00000372651:P57S	P	+	1	0	C3orf72	140151120	0.000000	0.05858	0.015000	0.15790	0.132000	0.20833	-0.496000	0.06436	0.091000	0.17302	0.555000	0.69702	CCC	0	NULL		0.542	C3orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf72	protein_coding	OTTHUMT00000357986.1	30	101	0	0.00	0	0	C		0	0		138668430	1	no_errors	ENST00000383165	ensembl	human	known	74_37	missense	27	69	46	44.80	23	56	SNP	0.017	T
ZNF718	255403	genome.wustl.edu	37	4	124494	124494	+	lincRNA	SNP	G	G	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr4:124494G>A	ENST00000510175.1	+	0	75							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		GTGGCTCTGTGACCTGCCGGT	0.597																																							0											0													53.0	48.0	49.0					4																	124494		692	1591	2283			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.124494G>A			Q3SXZ4|Q3SXZ5	RNA	SNP	0	NULL	ENST00000510175.1	37	NULL		4																																																																																			0	0		0.597	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	lincRNA	OTTHUMT00000357865.3	45	57	0	0.00	0	0	G	NM_001039127	0	0		124494	1	no_errors	ENST00000510175	ensembl	human	known	74_37	rna	37	34	44.78	42.37	30	25	SNP	0.006	A
ENAM	10117	genome.wustl.edu	37	4	71508185	71508185	+	Missense_Mutation	SNP	C	C	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr4:71508185C>A	ENST00000396073.3	+	9	1323	c.1042C>A	c.(1042-1044)Cct>Act	p.P348T	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	348					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			ACAGAATAGGCCTTTTTACAG	0.398																																							0											0													100.0	103.0	102.0					4																	71508185		2203	4300	6503	SO:0001583	missense	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1042C>A	4.37:g.71508185C>A	ENSP00000379383:p.Pro348Thr		Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.P348T	ENST00000396073.3	37	c.1042	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562823	0.27915	.	.	ENSG00000132464	ENST00000396073	T	0.47177	0.85	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000020	T	0.60025	0.2237	M	0.86028	2.79	0.39215	D	0.963399	B	0.30824	0.296	B	0.38428	0.273	T	0.65245	-0.6215	10	0.62326	D	0.03	-11.8947	15.6185	0.76787	0.0:1.0:0.0:0.0	.	348	Q9NRM1	ENAM_HUMAN	T	348	ENSP00000379383:P348T	ENSP00000379383:P348T	P	+	1	0	ENAM	71727049	0.929000	0.31497	0.891000	0.34965	0.018000	0.09664	2.493000	0.45320	2.769000	0.95229	0.655000	0.94253	CCT	0	NULL		0.398	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	protein_coding	OTTHUMT00000252166.3	39	173	0	0.57	0	1	C	NM_031889	0	0		71508185	1	no_errors	ENST00000396073	ensembl	human	known	74_37	missense	33	112	31.25	46.41	15	97	SNP	0.835	A
LIFR	3977	genome.wustl.edu	37	5	38528850	38528850	+	Missense_Mutation	SNP	A	A	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr5:38528850A>T	ENST00000263409.4	-	3	397	c.235T>A	c.(235-237)Tat>Aat	p.Y79N	LIFR_ENST00000453190.2_Missense_Mutation_p.Y79N|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	79	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CAAACTTCATAATCAGTACCA	0.403			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)		0		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													64.0	59.0	61.0					5																	38528850		2203	4298	6501	SO:0001583	missense	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.235T>A	5.37:g.38528850A>T	ENSP00000263409:p.Tyr79Asn		Q6LCD9	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Y79N	ENST00000263409.4	37	c.235	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	A	12.37	1.918763	0.33908	.	.	ENSG00000113594	ENST00000263409;ENST00000453190;ENST00000506990	T;T;T	0.69685	-0.42;-0.42;0.51	6.08	3.65	0.41850	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.420960	0.04203	N	0.330339	T	0.64125	0.2570	M	0.62723	1.935	0.32101	N	0.59058	P	0.38473	0.633	B	0.36504	0.226	T	0.54390	-0.8301	10	0.31617	T	0.26	-9.4646	6.4898	0.22109	0.6837:0.1563:0.0:0.16	.	79	P42702	LIFR_HUMAN	N	79	ENSP00000263409:Y79N;ENSP00000398368:Y79N;ENSP00000426685:Y79N	ENSP00000263409:Y79N	Y	-	1	0	LIFR	38564607	0.989000	0.36119	0.173000	0.22940	0.181000	0.23173	3.047000	0.49854	0.506000	0.28125	0.533000	0.62120	TAT	0	superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.403	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	protein_coding	OTTHUMT00000253823.1	35	185	0	0.00	0	0	A	NM_002310	0	0		38528850	-1	no_errors	ENST00000263409	ensembl	human	known	74_37	missense	26	129	49.02	47.13	25	115	SNP	0.804	T
FKBPL	63943	genome.wustl.edu	37	6	32096724	32096724	+	Silent	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr6:32096724C>T	ENST00000375156.3	-	2	1104	c.834G>A	c.(832-834)gtG>gtA	p.V278V	ATF6B_ENST00000468502.1_5'Flank|ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	278					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										CCCGCTCCAACACCCGGTCAC	0.587																																							0											0													55.0	60.0	58.0					6																	32096724		2203	4300	6503	SO:0001819	synonymous_variant	0			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.834G>A	6.37:g.32096724C>T			A8K5V3|B0UYX8|Q9H5G3	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V278	ENST00000375156.3	37	c.834	CCDS4738.1	6																																																																																			0	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR-contain_dom		0.587	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	protein_coding	OTTHUMT00000076221.2	27	125	0	0.00	0	0	C		0	0		32096724	-1	no_errors	ENST00000375156	ensembl	human	known	74_37	silent	22	54	45	54.24	18	64	SNP	0.939	T
DNAH8	1769	genome.wustl.edu	37	6	38851748	38851748	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr6:38851748C>T	ENST00000359357.3	+	54	7836	c.7582C>T	c.(7582-7584)Cct>Tct	p.P2528S	DNAH8_ENST00000449981.2_Missense_Mutation_p.P2745S|DNAH8_ENST00000441566.1_Missense_Mutation_p.P2492S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2528	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TATTAATATGCCTGTGATTAA	0.333																																							0											0													97.0	101.0	100.0					6																	38851748		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7582C>T	6.37:g.38851748C>T	ENSP00000352312:p.Pro2528Ser		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2528S	ENST00000359357.3	37	c.7582		6	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768267	0.90020	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.63417	-0.04;-0.04;-0.04	4.86	4.86	0.63082	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.86439	0.5933	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91983	0.5596	10	0.87932	D	0	.	18.3394	0.90300	0.0:1.0:0.0:0.0	.	2528	Q96JB1	DYH8_HUMAN	S	2733;2733;2528;2492	ENSP00000333363:P2733S;ENSP00000352312:P2528S;ENSP00000402294:P2492S	ENSP00000333363:P2733S	P	+	1	0	DNAH8	38959726	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.047000	0.71038	2.399000	0.81585	0.555000	0.69702	CCT	0	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.333	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	96	173	0	0.57	0	1	C	NM_001206927	0	0		38851748	1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	68	122	35.85	39.90	38	81	SNP	1	T
MAP3K4	4216	genome.wustl.edu	37	6	161533727	161533727	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr6:161533727G>A	ENST00000392142.4	+	25	4695	c.4547G>A	c.(4546-4548)cGt>cAt	p.R1516H	MAP3K4_ENST00000366920.2_Missense_Mutation_p.R1512H|MAP3K4_ENST00000348824.7_Missense_Mutation_p.R1462H|MAP3K4_ENST00000366919.2_Missense_Mutation_p.R1466H	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1516	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.R1515H(1)|p.R1516H(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GTCATCACTCGTGCCAAAGGA	0.488																																							0											2	Substitution - Missense(2)	large_intestine(2)											132.0	129.0	130.0					6																	161533727		2203	4300	6503	SO:0001583	missense	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.4547G>A	6.37:g.161533727G>A	ENSP00000375986:p.Arg1516His		A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1516H	ENST00000392142.4	37	c.4547	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.300536	0.95601	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.72282	-0.6;-0.63;-0.64;-0.6	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	N	0.25031	0.7	0.44702	D	0.997693	P;P;D;D	0.71674	0.699;0.587;0.994;0.998	B;B;P;P	0.61201	0.193;0.115;0.742;0.885	T	0.67624	-0.5623	10	0.46703	T	0.11	-17.7876	12.8186	0.57679	0.0744:0.0:0.9256:0.0	.	1512;452;1466;1516	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	H	1466;1516;1466;1512;1462	ENSP00000355886:R1466H;ENSP00000375986:R1516H;ENSP00000355887:R1512H;ENSP00000297332:R1462H	ENSP00000297332:R1462H	R	+	2	0	MAP3K4	161453717	1.000000	0.71417	0.011000	0.14972	0.979000	0.70002	7.878000	0.87231	2.613000	0.88420	0.655000	0.94253	CGT	0	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.488	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	protein_coding	OTTHUMT00000042988.3	43	114	0	0.00	0	0	G		0	0		161533727	1	no_errors	ENST00000392142	ensembl	human	known	74_37	missense	32	80	46.67	42.03	28	58	SNP	0.183	A
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	221	100	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	147	66	50.51	41.74	150	48	SNP	1	A
ANKRD19P	138649	genome.wustl.edu	37	9	95646810	95646810	+	RNA	SNP	G	G	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr9:95646810G>A	ENST00000446878.1	+	0	344				ANKRD19P_ENST00000473204.1_RNA																							GAGATCCCAGGCCCCTCCCTC	0.567																																							0											0																																												0																															9.37:g.95646810G>A				RNA	SNP	0	NULL	ENST00000446878.1	37	NULL		9																																																																																			0	0		0.567	RP11-526D8.7-006	PUTATIVE	basic	processed_transcript	ENSG00000226668	pseudogene	OTTHUMT00000316907.1	128	67	0	0.00	0	0	G		0	0		95646810	1	no_errors	ENST00000446878	ensembl	human	putative	74_37	rna	92	34	47.43	46.03	83	29	SNP	0.003	A
CUBN	8029	genome.wustl.edu	37	10	17085825	17085825	+	Splice_Site	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr10:17085825C>T	ENST00000377833.4	-	26	3895		c.e26+1			NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)						cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTCACACTTACTCTGCCGGTA	0.448																																							0											0													196.0	161.0	173.0					10																	17085825		2203	4300	6503	SO:0001630	splice_region_variant	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3829+1G>A	10.37:g.17085825C>T			B0YIZ4|Q5VTA6|Q96RU9	Splice_Site	SNP	0	e26+1	ENST00000377833.4	37	c.3829+1	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276617	0.80580	.	.	ENSG00000107611	ENST00000377833	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6451	0.88146	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUBN	17125831	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.693000	0.61753	2.262000	0.75019	0.555000	0.69702	.	0	0		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	72	148	0	0.00	0	0	C	NM_001081	0	0	Intron	17085825	-1	no_errors	ENST00000377833	ensembl	human	known	74_37	splice_site	29	78	45.28	41.35	24	55	SNP	1	T
HRAS	3265	genome.wustl.edu	37	11	534285	534285	+	Missense_Mutation	SNP	C	C	A	rs104894226		TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr11:534285C>A	ENST00000451590.1	-	2	225	c.38G>T	c.(37-39)gGt>gTt	p.G13V	HRAS_ENST00000311189.7_Missense_Mutation_p.G13V|HRAS_ENST00000468682.2_5'UTR|HRAS_ENST00000397594.1_Missense_Mutation_p.G13V|HRAS_ENST00000417302.1_Missense_Mutation_p.G13V|HRAS_ENST00000397596.2_Missense_Mutation_p.G13V	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	13			G -> C (in CSTLO). {ECO:0000269|PubMed:16329078}.|G -> D (in CSTLO). {ECO:0000269|PubMed:16170316}.|G -> R (in SFM; somatic mutation; shows constitutive activation of the MAPK and PI3K-AKT signaling pathways). {ECO:0000269|PubMed:22683711}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)	p.G13V(14)|p.G13D(10)|p.G12_G13insAG(1)		adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTTGCCCACACCGCCGGCGCC	0.642		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																													0	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	25	Substitution - Missense(24)|Insertion - In frame(1)	upper_aerodigestive_tract(9)|thyroid(5)|urinary_tract(5)|lung(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|thymus(1)	GRCh37	CM053285	HRAS	M	rs104894226						89.0	83.0	85.0					11																	534285		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.38G>T	11.37:g.534285C>A	ENSP00000407586:p.Gly13Val		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G13V	ENST00000451590.1	37	c.38	CCDS7698.1	11	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344392	0.61073	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81	3.0	3.0	0.34707	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88716	0.6512	H	0.94264	3.515	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.69824	0.943;0.966	D	0.92025	0.5629	10	0.87932	D	0	.	14.1517	0.65389	0.0:1.0:0.0:0.0	.	13;13	P01112-2;P01112	.;RASH_HUMAN	V	13	ENSP00000380722:G13V;ENSP00000380723:G13V;ENSP00000407586:G13V;ENSP00000388246:G13V;ENSP00000309845:G13V	ENSP00000309845:G13V	G	-	2	0	HRAS	524285	1.000000	0.71417	0.470000	0.27216	0.232000	0.25224	7.472000	0.80996	1.986000	0.57962	0.561000	0.74099	GGT	0	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.642	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HRAS	protein_coding	OTTHUMT00000259403.2	37	86	0	0.00	0	0	C	NM_176795	rs104894226	C->A,G,T		534285	-1	no_errors	ENST00000311189	ensembl	human	known	74_37	missense	18	27	47.06	59.70	16	40	SNP	1	A
TRIM37	4591	genome.wustl.edu	37	17	57057844	57057844	+	IGR	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr17:57057844C>T	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Nonsense_Mutation_p.Q574*	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AGATCTCACACAAATAGAAGC	0.458									Mulibrey Nanism																														0											0													94.0	85.0	88.0					17																	57057844		2203	4300	6503	SO:0001628	intergenic_variant	0	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057844C>T			Q7Z3E6|Q8IYF7|Q8WYF7	Nonsense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.Q574*	ENST00000393066.3	37	c.1720	CCDS45746.1	17	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086172	0.76642	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	.	.	.	5.74	3.65	0.41850	.	0.574340	0.19536	N	0.111912	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	0.3522	10.1052	0.42528	0.207:0.6833:0.1098:0.0	.	.	.	.	X	574;425	.	ENSP00000312411:Q574X	Q	+	1	0	PPM1E	54412626	0.997000	0.39634	0.999000	0.59377	0.926000	0.56050	1.064000	0.30579	2.721000	0.93114	0.491000	0.48974	CAA	0	NULL		0.458	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	protein_coding	OTTHUMT00000445928.1	14	191	0	0.00	0	0	C	NM_015294	0	0		57057844	1	no_errors	ENST00000308249	ensembl	human	known	74_37	nonsense	12	124	40	43.38	8	95	SNP	0.996	T
SCGB2B2	284402	genome.wustl.edu	37	19	35085134	35085134	+	Missense_Mutation	SNP	C	C	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr19:35085134C>A	ENST00000601241.1	-	3	2292	c.192G>T	c.(190-192)caG>caT	p.Q64H	SCGB2B2_ENST00000379204.2_Missense_Mutation_p.Q64H|SCGB2B2_ENST00000595326.1_Intron			Q4G0G5	SC2B2_HUMAN	secretoglobin, family 2B, member 2	64						extracellular region (GO:0005576)											CAAAGCATTGCTGGACATTGA	0.517																																							0											0													121.0	105.0	110.0					19																	35085134		2203	4300	6503	SO:0001583	missense	0			AK093495	CCDS32989.1	19q13.12	2011-12-14	2011-12-14	2011-12-14	ENSG00000205209	ENSG00000205209		"""Secretoglobins"""	27616	protein-coding gene	gene with protein product		615063	"""secretoglobin-like"""	SCGBL		22155607	Standard	NM_001025591		Approved	SCGB4A2	uc002nvn.3	Q4G0G5		ENST00000601241.1:c.192G>T	19.37:g.35085134C>A	ENSP00000469876:p.Gln64His			Missense_Mutation	SNP	pfam_Secretoglobin,pfam_Allergen_Fel_d_1_chain2,superfamily_Secretoglobin	p.Q64H	ENST00000601241.1	37	c.192	CCDS32989.1	19	.	.	.	.	.	.	.	.	.	.	C	4.635	0.118082	0.08881	.	.	ENSG00000205209	ENST00000379204	T	0.13657	2.57	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.15349	0.0370	.	.	.	0.09310	N	1	P	0.43826	0.818	P	0.46629	0.522	T	0.16394	-1.0404	7	0.87932	D	0	.	.	.	.	.	64	Q4G0G5	SCGBL_HUMAN	H	64	ENSP00000368502:Q64H	ENSP00000368502:Q64H	Q	-	3	2	SCGBL	39776974	0.021000	0.18746	0.196000	0.23383	0.198000	0.23893	0.145000	0.16157	0.132000	0.18615	0.134000	0.15878	CAG	0	pfam_Secretoglobin,pfam_Allergen_Fel_d_1_chain2,superfamily_Secretoglobin		0.517	SCGB2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB2B2	protein_coding	OTTHUMT00000461457.2	41	57	0	0.00	0	0	C	NM_001025591	0	0		35085134	-1	no_errors	ENST00000379204	ensembl	human	known	74_37	missense	27	40	48.08	42.03	25	29	SNP	0.215	A
GYS1	2997	genome.wustl.edu	37	19	49472822	49472822	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr19:49472822G>C	ENST00000323798.3	-	16	2133	c.1937C>G	c.(1936-1938)cCc>cGc	p.P646R	GYS1_ENST00000544287.1_Missense_Mutation_p.P279R|GYS1_ENST00000263276.6_Missense_Mutation_p.P582R|GYS1_ENST00000541188.1_Missense_Mutation_p.P566R	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	646					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		TGACAGCGAGGGCGACGGTGG	0.677																																							0											0													31.0	16.0	21.0					19																	49472822		2018	3929	5947	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1937C>G	19.37:g.49472822G>C	ENSP00000317904:p.Pro646Arg		Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.P646R	ENST00000323798.3	37	c.1937	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.092633	0.94149	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.88047	0.6332	M	0.88842	2.985	0.80722	D	1	D;D;D	0.71674	0.998;0.993;0.998	D;D;D	0.67382	0.951;0.929;0.951	D	0.89046	0.3452	10	0.59425	D	0.04	-34.6328	17.7236	0.88359	0.0:0.0:1.0:0.0	.	566;582;646	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	R	646;582;566;279	ENSP00000317904:P646R;ENSP00000263276:P582R;ENSP00000437922:P566R;ENSP00000444004:P279R	ENSP00000263276:P582R	P	-	2	0	GYS1	54164634	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	9.139000	0.94554	2.854000	0.98071	0.655000	0.94253	CCC	0	pfam_Glycogen_synth		0.677	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	protein_coding	OTTHUMT00000319791.1	8	60	0	0.00	0	0	G	NM_002103	0	0		49472822	-1	no_errors	ENST00000323798	ensembl	human	known	74_37	missense	4	14	63.64	69.57	7	32	SNP	1	C
MYH14	79784	genome.wustl.edu	37	19	50753918	50753918	+	Missense_Mutation	SNP	C	C	A			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr19:50753918C>A	ENST00000596571.1	+	13	1779	c.1779C>A	c.(1777-1779)gaC>gaA	p.D593E	MYH14_ENST00000440075.2_Missense_Mutation_p.D601E|MYH14_ENST00000262269.8_Missense_Mutation_p.D601E|MYH14_ENST00000425460.1_Missense_Mutation_p.D601E|MYH14_ENST00000376970.2_Missense_Mutation_p.D593E|MYH14_ENST00000601313.1_Missense_Mutation_p.D601E|MYH14_ENST00000598205.1_Missense_Mutation_p.D601E			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	593	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.D601E(1)|p.D593E(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ATCAGGCCGACTTCAGTGTTC	0.652																																							0											2	Substitution - Missense(2)	endometrium(2)											37.0	45.0	43.0					19																	50753918		2099	4215	6314	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1779C>A	19.37:g.50753918C>A	ENSP00000472819:p.Asp593Glu		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D601E	ENST00000596571.1	37	c.1803	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365426	0.41902	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	4.09	4.09	0.47781	Myosin head, motor domain (2);	.	.	.	.	T	0.79644	0.4481	L	0.37561	1.115	0.50813	D	0.999893	B;B;B	0.31989	0.091;0.23;0.35	B;B;B	0.32928	0.066;0.155;0.096	T	0.76713	-0.2858	9	0.38643	T	0.18	.	7.9104	0.29787	0.0:0.8871:0.0:0.1129	.	601;593;601	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	E	593;601;593;601;593;601	ENSP00000406273:D601E;ENSP00000366169:D593E;ENSP00000407879:D601E;ENSP00000262269:D601E	ENSP00000262269:D601E	D	+	3	2	MYH14	55445730	0.889000	0.30405	1.000000	0.80357	0.913000	0.54294	0.034000	0.13776	2.287000	0.76781	0.561000	0.74099	GAC	0	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.652	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	protein_coding	OTTHUMT00000464710.2	76	76	0	0.00	0	0	C	NM_024729	0	0		50753918	1	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	29	45	59.72	48.28	43	42	SNP	1	A
GTSF1L	149699	genome.wustl.edu	37	20	42355134	42355134	+	Missense_Mutation	SNP	G	G	C	rs551274767		TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr20:42355134G>C	ENST00000373003.1	-	1	504	c.201C>G	c.(199-201)agC>agG	p.S67R	GTSF1L_ENST00000373005.2_Missense_Mutation_p.S67R	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	67							metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTTCCACAGCGCTCCTGTTGA	0.537																																							0											0													134.0	115.0	122.0					20																	42355134		2203	4300	6503	SO:0001583	missense	0			AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.201C>G	20.37:g.42355134G>C	ENSP00000362094:p.Ser67Arg		Q5JWH5	Missense_Mutation	SNP	pfam_TRM13/UPF0224_CHHC_Znf_dom	p.S67R	ENST00000373003.1	37	c.201	CCDS13323.1	20	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096627	0.36952	.	.	ENSG00000124196	ENST00000373003;ENST00000373005	T;T	0.46063	0.88;0.95	3.68	1.66	0.24008	.	0.206082	0.35067	N	0.003463	T	0.45296	0.1335	L	0.50333	1.59	0.26522	N	0.974401	D;D	0.71674	0.998;0.995	P;P	0.62298	0.9;0.795	T	0.28776	-1.0033	10	0.20046	T	0.44	-16.2031	5.1506	0.15007	0.1168:0.2114:0.6718:0.0	.	67;67	Q9H1H1;Q5JWH5	GTSFL_HUMAN;.	R	67	ENSP00000362094:S67R;ENSP00000362096:S67R	ENSP00000362094:S67R	S	-	3	2	GTSF1L	41788548	0.910000	0.30920	0.538000	0.28064	0.655000	0.38815	2.034000	0.41145	0.509000	0.28195	0.430000	0.28490	AGC	0	NULL		0.537	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTSF1L	protein_coding	OTTHUMT00000079313.1	42	98	0	0.00	0	0	G	NM_176791	0	0		42355134	-1	no_errors	ENST00000373003	ensembl	human	known	74_37	missense	12	42	65.71	46.91	23	38	SNP	0.557	C
PPP1R42	286187	genome.wustl.edu	37	8	67926672	67926673	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr8:67926672_67926673delTT	ENST00000324682.5	-	3	428_429	c.284_285delAA	c.(283-285)aaafs	p.K95fs	PPP1R42_ENST00000522909.1_Frame_Shift_Del_p.K95fs|PPP1R42_ENST00000517834.1_Intron	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	95					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										GTTTTTCCAGTTTCTTTAATGA	0.297																																							0											0																																										SO:0001589	frameshift_variant	0			BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.284_285delAA	8.37:g.67926672_67926673delTT	ENSP00000315035:p.Lys95fs			Frame_Shift_Del	DEL	pfam_Leu-rich_rpt	p.K95fs	ENST00000324682.5	37	c.285_284	CCDS34902.1	8																																																																																			0	NULL		0.297	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R42	protein_coding	OTTHUMT00000380034.2	64	180	0	0.00	0	0	TT	NM_001013626	0	0		67926673	-1	no_errors	ENST00000522909	ensembl	human	known	74_37	frame_shift_del	79	116	32.48	51.46	38	123	DEL	1.000:1.000	0
C12orf57	113246	genome.wustl.edu	37	12	7055845	7055845	+	IGR	DEL	C	C	-			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr12:7055845delC	ENST00000229281.5	+	0	560				PTPN6_ENST00000447931.2_5'UTR|RNU7-1_ENST00000458811.1_RNA|PTPN6_ENST00000399448.1_5'UTR|U47924.31_ENST00000607421.1_RNA	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57							cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						CTCAGCCCCGCCCCCTGCGGC	0.647																																							0											0													19.0	21.0	20.0					12																	7055845		1911	4105	6016	SO:0001628	intergenic_variant	0			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017		12.37:g.7055845delC			B2R4Q6	RNA	DEL	0	NULL	ENST00000229281.5	37	NULL	CCDS8571.1	12																																																																																			0	0		0.647	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN6	protein_coding	OTTHUMT00000401959.1	145	44	0	0.00	0	0	C	NM_138425	0	0		7055845	1	no_errors	ENST00000534900	ensembl	human	known	74_37	rna	120	24	32.58	51.02	58	25	DEL	0.244	0
SREBF2	6721	genome.wustl.edu	37	22	42262949	42262951	+	In_Frame_Del	DEL	GCA	GCA	-	rs143615881		TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	GCA	GCA	GCA	-	GCA	GCA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr22:42262949_42262951delGCA	ENST00000361204.4	+	2	369_371	c.203_205delGCA	c.(202-207)ggcagc>ggc	p.S74del		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	74	Gly/Pro/Ser-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ggcagcagtggcagcagcagcag	0.567																																							0											0																																										SO:0001651	inframe_deletion	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.203_205delGCA	22.37:g.42262958_42262960delGCA	ENSP00000354476:p.Ser74del		Q05BD5|Q6GTH7|Q86V36|Q9UH04	In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S72in_frame_del	ENST00000361204.4	37	c.203_205	CCDS14023.1	22																																																																																			0	NULL		0.567	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	31	71	0	0.00	0	0	GCA	NM_004599	rs143615881	GGCA->G		42262951	1	no_errors	ENST00000361204	ensembl	human	known	74_37	in_frame_del	29	52	12.12	5.45	4	3	DEL	0.037:0.043:0.048	0
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																							0											1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	0	NULL		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	protein_coding		27	0	0	0.00	0	0	C	NM_030930	rs4014596	C->T		67759316	-1	no_errors	ENST00000227471	ensembl	human	known	74_37	missense	23	0	17.86	0.00	5	0	SNP	0.997	T
SPN	6693	genome.wustl.edu	37	16	29675931	29675931	+	Silent	SNP	C	C	T			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr16:29675931C>T	ENST00000360121.3	+	2	974	c.882C>T	c.(880-882)ggC>ggT	p.G294G	SPN_ENST00000395389.2_Silent_p.G294G	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0				V -> L (in Ref. 4; AAB62704). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						GCAGAGGCGGCAAGCGTAACG	0.716																																							0											0													13.0	13.0	13.0					16																	29675931		2188	4282	6470	SO:0001819	synonymous_variant	0			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.882C>T	16.37:g.29675931C>T			A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Silent	SNP	NULL	p.G294	ENST00000360121.3	37	c.882	CCDS10650.1	16																																																																																			0	NULL		0.716	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPN	protein_coding	OTTHUMT00000215001.2	44	17	0	0.00	0	0	C		0	0		29675931	1	no_errors	ENST00000360121	ensembl	human	known	74_37	silent	30	6	9.09	0.00	3	0	SNP	0.084	T
RP11-489G11.3	0	genome.wustl.edu	37	4	174389308	174389309	+	lincRNA	DEL	TA	TA	-			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr4:174389308_174389309delTA	ENST00000563631.1	-	0	1883_1884																											cccataagattatactgctgta	0.351																																							0											0																																												0																															4.37:g.174389310_174389311delTA				RNA	DEL	0	NULL	ENST00000563631.1	37	NULL		4																																																																																			0	0		0.351	RP11-489G11.3-001	KNOWN	basic	lincRNA	ENSG00000261646	lincRNA	OTTHUMT00000431759.1	18	0	0	0.00	0	0	TA		0	0		174389309	-1	no_errors	ENST00000563631	ensembl	human	known	74_37	rna	16	0	40.74	0.00	11	0	DEL	0.026:0.026	0
ENKD1	84080	genome.wustl.edu	37	16	67700305	67700305	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XU-A92T-01A-11D-A423-09	TCGA-XU-A92T-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e80e05f1-3c9c-4265-8f4b-661a04bca0b4	f269fcbe-be4a-4324-b0b0-f6eee25c5a9f	g.chr16:67700305delG	ENST00000243878.4	-	1	362	c.41delC	c.(40-42)ccafs	p.P14fs	ENKD1_ENST00000602644.1_Frame_Shift_Del_p.P14fs|ENKD1_ENST00000602409.1_5'Flank|C16orf86_ENST00000403458.4_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	14						cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											CGTCGGGTCTGGGGGGATGGG	0.736																																							0											0													7.0	6.0	6.0					16																	67700305		2065	4132	6197	SO:0001589	frameshift_variant	0			BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.41delC	16.37:g.67700305delG	ENSP00000243878:p.Pro14fs		Q6UWD7	Frame_Shift_Del	DEL	NULL	p.P14fs	ENST00000243878.4	37	c.41	CCDS10844.1	16																																																																																			0	NULL		0.736	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENKD1	protein_coding	OTTHUMT00000268884.1	10	14	0	0.00	0	0	G	NM_032140	0	0		67700305	-1	no_errors	ENST00000243878	ensembl	human	known	74_37	frame_shift_del	4	8	33.33	0.00	2	0	DEL	1	0
