#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
GPR112	139378	genome.wustl.edu	37	X	135428327	135428327	+	Missense_Mutation	SNP	G	G	A	rs375491609		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chrX:135428327G>A	ENST00000394143.1	+	6	2753	c.2462G>A	c.(2461-2463)gGt>gAt	p.G821D	GPR112_ENST00000287534.4_Missense_Mutation_p.G758D|GPR112_ENST00000412101.1_Missense_Mutation_p.G616D|GPR112_ENST00000370652.1_Missense_Mutation_p.G821D|GPR112_ENST00000394141.1_Missense_Mutation_p.G616D	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	821					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTATTTGGAGGTACAACGACC	0.368																																							0											0													118.0	106.0	110.0					X																	135428327		2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2462G>A	X.37:g.135428327G>A	ENSP00000377699:p.Gly821Asp		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G821D	ENST00000394143.1	37	c.2462	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.878893	0.00537	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.23348	1.95;1.95;1.91;2.08;1.91	2.99	0.0998	0.14504	.	.	.	.	.	T	0.06416	0.0165	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.36625	-0.9740	9	0.02654	T	1	.	2.9299	0.05796	0.4475:0.2425:0.3101:0.0	.	758;616;821	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	D	821;821;616;758;616	ENSP00000377699:G821D;ENSP00000359686:G821D;ENSP00000416526:G616D;ENSP00000287534:G758D;ENSP00000377697:G616D	ENSP00000287534:G758D	G	+	2	0	GPR112	135255993	0.998000	0.40836	0.049000	0.19019	0.004000	0.04260	0.795000	0.26972	-0.114000	0.11936	-0.976000	0.02587	GGT	0	NULL		0.368	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	36	252	0	0.00	0	0	G		0	0		135428327	1	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	26	203	31.58	34.94	12	109	SNP	0.006	A
MST1L	11223	genome.wustl.edu	37	1	17084313	17084313	+	RNA	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr1:17084313C>T	ENST00000455405.2	-	0	495							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										ACCATTCAGGCGGCAGGCAGA	0.587																																							0											0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084313C>T			B7WPB1|Q13209	RNA	SNP	0	NULL	ENST00000455405.2	37	NULL		1																																																																																			0	0		0.587	MST1L-002	KNOWN	basic	processed_transcript	MST1L	pseudogene	OTTHUMT00000400328.1	253	379	0	0.26	0	1	C	NM_001271733	0	0		17084313	-1	no_errors	ENST00000455405	ensembl	human	known	74_37	rna	201	446	8.22	7.08	18	34	SNP	1	T
OPRD1	4985	genome.wustl.edu	37	1	29189517	29189517	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr1:29189517G>A	ENST00000234961.2	+	3	1083	c.841G>A	c.(841-843)Gtc>Atc	p.V281I		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	281					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCACATCTTCGTCATCGTCTG	0.662																																							0											0													30.0	26.0	27.0					1																	29189517		2201	4298	6499	SO:0001583	missense	0			U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.841G>A	1.37:g.29189517G>A	ENSP00000234961:p.Val281Ile		B5B0B8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Delta_opi_rcpt,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt	p.V281I	ENST00000234961.2	37	c.841	CCDS329.1	1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.176654	0.38413	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.36878	1.23	4.06	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.135819	0.49916	D	0.000139	T	0.21103	0.0508	N	0.12853	0.265	0.44018	D	0.996737	B	0.19935	0.04	B	0.20184	0.028	T	0.05937	-1.0855	10	0.20046	T	0.44	.	13.7884	0.63123	0.0:0.0:1.0:0.0	.	281	P41143	OPRD_HUMAN	I	281;233	ENSP00000234961:V281I	ENSP00000234961:V281I	V	+	1	0	OPRD1	29062104	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.926000	0.70070	2.097000	0.63578	0.462000	0.41574	GTC	0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Neuropept_B/W_rcpt		0.662	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRD1	protein_coding	OTTHUMT00000010330.1	61	86	0	0.00	0	0	G	NM_000911	0	0		29189517	1	no_errors	ENST00000234961	ensembl	human	known	74_37	missense	20	54	28.57	36.05	8	31	SNP	1	A
ZC3H11A	9877	genome.wustl.edu	37	1	203768760	203768760	+	5'UTR	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr1:203768760G>A	ENST00000545588.1	+	0	298				ZC3H11A_ENST00000332127.4_Intron|ZC3H11A_ENST00000367212.3_Intron|ZC3H11A_ENST00000367214.1_Intron|ZC3H11A_ENST00000466470.1_Intron|ZBED6_ENST00000550078.1_Missense_Mutation_p.V704M	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A						poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAAAGTGAGCGTGAAGACCGC	0.453																																							0											0																																										SO:0001623	5_prime_UTR_variant	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.-3530G>A	1.37:g.203768760G>A			Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	pfam_Znf_BED_prd,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.V704M	ENST00000545588.1	37	c.2110	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811247	0.50527	.	.	ENSG00000257315	ENST00000550078	T	0.21734	1.99	5.22	5.22	0.72569	.	.	.	.	.	T	0.17704	0.0425	N	0.08118	0	0.29168	N	0.87729	.	.	.	.	.	.	T	0.15378	-1.0439	7	0.42905	T	0.14	.	17.093	0.86627	0.0:0.0:1.0:0.0	.	.	.	.	M	704	ENSP00000447879:V704M	ENSP00000447879:V704M	V	+	1	0	ZBED6	202035383	0.837000	0.29446	1.000000	0.80357	0.989000	0.77384	1.833000	0.39161	2.821000	0.97095	0.650000	0.86243	GTG	0	superfamily_RNaseH-like_dom		0.453	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED6	protein_coding	OTTHUMT00000087471.3	29	191	3.33	0.00	1	0	G	NM_014827	0	0		203768760	1	no_errors	ENST00000550078	ensembl	human	known	74_37	missense	22	168	37.14	31.43	13	77	SNP	1	A
CCDC142	84865	genome.wustl.edu	37	2	74708427	74708427	+	Missense_Mutation	SNP	A	A	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:74708427A>C	ENST00000393965.3	-	3	1577	c.1181T>G	c.(1180-1182)cTt>cGt	p.L394R	TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.L394R|TTC31_ENST00000233623.5_5'Flank|CCDC142_ENST00000471713.1_5'UTR|TTC31_ENST00000410003.1_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	394										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						CTGCTGCAAAAGTTCAGCAGT	0.582																																							0											0													104.0	116.0	112.0					2																	74708427		2203	4300	6503	SO:0001583	missense	0			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1181T>G	2.37:g.74708427A>C	ENSP00000377537:p.Leu394Arg		B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	NULL	p.L394R	ENST00000393965.3	37	c.1181		2	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908148	0.52333	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.54071	0.59;0.59	4.74	4.74	0.60224	.	0.000000	0.41938	D	0.000800	T	0.68851	0.3046	M	0.72118	2.19	0.18873	N	0.999989	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.994;0.999	T	0.61903	-0.6967	10	0.87932	D	0	-9.4869	10.5546	0.45110	1.0:0.0:0.0:0.0	.	394;394;394	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	R	394	ENSP00000377537:L394R;ENSP00000290418:L394R	ENSP00000290418:L394R	L	-	2	0	CCDC142	74561935	1.000000	0.71417	0.151000	0.22473	0.827000	0.46813	4.278000	0.58946	1.985000	0.57927	0.460000	0.39030	CTT	0	NULL		0.582	CCDC142-003	KNOWN	basic	protein_coding	CCDC142	protein_coding	OTTHUMT00000328391.1	30	115	0	0.86	0	1	A	NM_032779	0	0		74708427	-1	no_errors	ENST00000393965	ensembl	human	known	74_37	missense	12	94	50	21.67	12	26	SNP	0.116	C
FIGN	55137	genome.wustl.edu	37	2	164466135	164466135	+	Missense_Mutation	SNP	A	A	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:164466135A>T	ENST00000333129.3	-	3	2521	c.2207T>A	c.(2206-2208)aTt>aAt	p.I736N	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	736					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GCTAGGCTGAATCTTGCAGAA	0.418																																							0											0													65.0	64.0	64.0					2																	164466135		1894	4124	6018	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.2207T>A	2.37:g.164466135A>T	ENSP00000333836:p.Ile736Asn		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.I736N	ENST00000333129.3	37	c.2207	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040328	0.35989	.	.	ENSG00000182263	ENST00000333129	D	0.98345	-4.88	6.02	6.02	0.97574	.	0.051104	0.85682	D	0.000000	D	0.98394	0.9466	M	0.91768	3.24	0.80722	D	1	B	0.29862	0.259	B	0.36030	0.216	D	0.98336	1.0536	10	0.72032	D	0.01	-24.5094	16.542	0.84395	1.0:0.0:0.0:0.0	.	736	Q5HY92	FIGN_HUMAN	N	736	ENSP00000333836:I736N	ENSP00000333836:I736N	I	-	2	0	FIGN	164174381	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.304000	0.77564	0.528000	0.53228	ATT	0	superfamily_P-loop_NTPase		0.418	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	protein_coding	OTTHUMT00000157220.2	69	184	0	0.00	0	0	A	NM_018086	0	0		164466135	-1	no_errors	ENST00000333129	ensembl	human	known	74_37	missense	50	127	30.14	29.83	22	54	SNP	1	T
HJURP	55355	genome.wustl.edu	37	2	234749861	234749861	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:234749861G>A	ENST00000411486.2	-	8	1630	c.1565C>T	c.(1564-1566)tCa>tTa	p.S522L	HJURP_ENST00000432087.1_Missense_Mutation_p.S468L|HJURP_ENST00000441687.1_Missense_Mutation_p.S437L|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	522					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TGGAAGTGATGAAGATGAATC	0.463																																							0											0													154.0	152.0	153.0					2																	234749861		2203	4300	6503	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1565C>T	2.37:g.234749861G>A	ENSP00000414109:p.Ser522Leu		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.S522L	ENST00000411486.2	37	c.1565	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764768	0.49574	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.11495	3.07;3.08;3.08;2.77	4.41	1.54	0.23209	.	1.224450	0.06100	N	0.665283	T	0.06050	0.0157	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.08055	0.001;0.003;0.001	T	0.40608	-0.9554	10	0.33940	T	0.23	0.0051	6.4859	0.22089	0.3049:0.0:0.6951:0.0	.	437;468;522	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	L	522;468;437;437	ENSP00000414109:S522L;ENSP00000407208:S468L;ENSP00000401944:S437L;ENSP00000393253:S437L	ENSP00000414109:S522L	S	-	2	0	HJURP	234414600	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.119000	0.10676	0.341000	0.23771	-0.302000	0.09304	TCA	0	NULL		0.463	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	protein_coding	OTTHUMT00000130996.6	71	246	0	0.00	0	0	G	NM_018410	0	0		234749861	-1	no_errors	ENST00000411486	ensembl	human	known	74_37	missense	33	159	34	32.20	17	76	SNP	0	A
HJURP	55355	genome.wustl.edu	37	2	234750245	234750245	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:234750245G>C	ENST00000411486.2	-	8	1246	c.1181C>G	c.(1180-1182)gCa>gGa	p.A394G	HJURP_ENST00000432087.1_Missense_Mutation_p.A340G|HJURP_ENST00000441687.1_Missense_Mutation_p.A309G|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	394					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		ATTATATGTTGCACTGGAGTC	0.393																																							0											0													77.0	81.0	79.0					2																	234750245		2203	4300	6503	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1181C>G	2.37:g.234750245G>C	ENSP00000414109:p.Ala394Gly		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.A394G	ENST00000411486.2	37	c.1181	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995427	0.35226	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.11385	3.09;3.09;3.09;2.78	3.22	-0.731	0.11151	.	0.924131	0.09111	N	0.847094	T	0.10121	0.0248	L	0.53249	1.67	0.09310	N	1	B;B;B	0.18013	0.025;0.009;0.015	B;B;B	0.12156	0.007;0.007;0.005	T	0.37709	-0.9694	10	0.72032	D	0.01	-0.0517	3.6113	0.08061	0.3624:0.2177:0.4199:0.0	.	309;340;394	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	G	394;340;309;309	ENSP00000414109:A394G;ENSP00000407208:A340G;ENSP00000401944:A309G;ENSP00000393253:A309G	ENSP00000414109:A394G	A	-	2	0	HJURP	234414984	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.315000	0.08081	-0.177000	0.10690	-0.910000	0.02820	GCA	0	NULL		0.393	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	protein_coding	OTTHUMT00000130996.6	63	247	0	0.00	0	0	G	NM_018410	0	0		234750245	-1	no_errors	ENST00000411486	ensembl	human	known	74_37	missense	30	201	26.83	33.33	11	101	SNP	0	C
HJURP	55355	genome.wustl.edu	37	2	234750577	234750577	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:234750577G>C	ENST00000411486.2	-	8	914	c.849C>G	c.(847-849)atC>atG	p.I283M	HJURP_ENST00000432087.1_Missense_Mutation_p.I229M|HJURP_ENST00000441687.1_Missense_Mutation_p.I198M|HJURP_ENST00000434039.1_5'UTR	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	283					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TTTTGGTGGAGATGATGCTTG	0.473																																							0											0													152.0	137.0	142.0					2																	234750577		2203	4300	6503	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.849C>G	2.37:g.234750577G>C	ENSP00000414109:p.Ile283Met		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.I283M	ENST00000411486.2	37	c.849	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561716	0.45590	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924;ENST00000454020	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41	4.46	4.46	0.54185	Holliday junction recognition protein, HJURP (1);	0.100865	0.43747	D	0.000533	T	0.67221	0.2870	L	0.59436	1.845	0.32626	N	0.522695	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.74067	-0.3784	10	0.87932	D	0	-28.0934	12.924	0.58249	0.0:0.0:1.0:0.0	.	198;229;283	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	M	283;229;198;198;242	ENSP00000414109:I283M;ENSP00000407208:I229M;ENSP00000401944:I198M;ENSP00000393253:I198M;ENSP00000414051:I242M	ENSP00000414109:I283M	I	-	3	3	HJURP	234415316	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	3.817000	0.55668	2.760000	0.94817	0.655000	0.94253	ATC	0	pfam_HJURP		0.473	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	protein_coding	OTTHUMT00000130996.6	45	220	0	0.00	0	0	G	NM_018410	0	0		234750577	-1	no_errors	ENST00000411486	ensembl	human	known	74_37	missense	18	133	40	31.09	12	60	SNP	1	C
HJURP	55355	genome.wustl.edu	37	2	234750681	234750681	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:234750681G>A	ENST00000411486.2	-	8	810	c.745C>T	c.(745-747)Ccc>Tcc	p.P249S	HJURP_ENST00000432087.1_Missense_Mutation_p.P195S|HJURP_ENST00000441687.1_Missense_Mutation_p.P164S|HJURP_ENST00000434039.1_5'UTR	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	249					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TCTTCAAAGGGCTGGCTGCTT	0.507																																							0											0													161.0	144.0	150.0					2																	234750681		2203	4300	6503	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.745C>T	2.37:g.234750681G>A	ENSP00000414109:p.Pro249Ser		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.P249S	ENST00000411486.2	37	c.745	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	0.155	-1.087193	0.01873	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924;ENST00000454020	T;T;T;T;T	0.27720	3.42;3.42;3.45;3.14;1.65	4.22	-0.979	0.10276	.	1.490580	0.03918	N	0.282971	T	0.16300	0.0392	N	0.24115	0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.14172	-1.0482	10	0.05833	T	0.94	-2.1624	4.0288	0.09700	0.4504:0.1941:0.3555:0.0	.	164;195;249	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	S	249;195;164;164;208	ENSP00000414109:P249S;ENSP00000407208:P195S;ENSP00000401944:P164S;ENSP00000393253:P164S;ENSP00000414051:P208S	ENSP00000414109:P249S	P	-	1	0	HJURP	234415420	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.180000	0.09754	-0.153000	0.11137	-0.302000	0.09304	CCC	0	NULL		0.507	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	protein_coding	OTTHUMT00000130996.6	44	257	0	0.00	0	0	G	NM_018410	0	0		234750681	-1	no_errors	ENST00000411486	ensembl	human	known	74_37	missense	27	191	18.18	27.38	6	72	SNP	0	A
HJURP	55355	genome.wustl.edu	37	2	234750835	234750835	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:234750835G>C	ENST00000411486.2	-	8	656	c.591C>G	c.(589-591)atC>atG	p.I197M	HJURP_ENST00000432087.1_Missense_Mutation_p.I143M|HJURP_ENST00000441687.1_Missense_Mutation_p.I112M|HJURP_ENST00000434039.1_5'UTR	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	197					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TCTTTCTGGAGATACGACTGC	0.453																																							0											0													59.0	59.0	59.0					2																	234750835		2203	4300	6503	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.591C>G	2.37:g.234750835G>C	ENSP00000414109:p.Ile197Met		A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.I197M	ENST00000411486.2	37	c.591	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301012	0.23650	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924;ENST00000454020	T;T;T;T;T	0.34859	3.08;3.09;3.09;2.78;1.34	4.22	2.35	0.29111	.	1.217070	0.06063	N	0.658639	T	0.32734	0.0839	L	0.27053	0.805	0.09310	N	1	B;B;B	0.21753	0.06;0.06;0.036	B;B;B	0.31686	0.134;0.134;0.063	T	0.44605	-0.9317	10	0.72032	D	0.01	-1.4582	10.6462	0.45621	0.0:0.4104:0.5896:0.0	.	112;143;197	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	M	197;143;112;112;156	ENSP00000414109:I197M;ENSP00000407208:I143M;ENSP00000401944:I112M;ENSP00000393253:I112M;ENSP00000414051:I156M	ENSP00000414109:I197M	I	-	3	3	HJURP	234415574	0.002000	0.14202	0.000000	0.03702	0.203000	0.24098	0.917000	0.28665	0.682000	0.31407	0.655000	0.94253	ATC	0	NULL		0.453	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	protein_coding	OTTHUMT00000130996.6	19	213	0	0.00	0	0	G	NM_018410	0	0		234750835	-1	no_errors	ENST00000411486	ensembl	human	known	74_37	missense	9	182	40	24.38	6	59	SNP	0.001	C
PPARGC1A	10891	genome.wustl.edu	37	4	23814740	23814740	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr4:23814740T>C	ENST00000264867.2	-	9	1921	c.1802A>G	c.(1801-1803)tAt>tGt	p.Y601C	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	601	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CTCATAGTAATAGCAGGATCT	0.507																																					Esophageal Squamous(29;694 744 13796 34866 44181)		0											0													146.0	140.0	142.0					4																	23814740		2203	4300	6503	SO:0001583	missense	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1802A>G	4.37:g.23814740T>C	ENSP00000264867:p.Tyr601Cys		B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y601C	ENST00000264867.2	37	c.1802	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	T	6.832	0.522634	0.13066	.	.	ENSG00000109819	ENST00000264867	T	0.43688	0.94	5.7	4.49	0.54785	.	0.355506	0.33401	N	0.004959	T	0.21590	0.0520	N	0.11560	0.145	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04915	-1.0918	10	0.38643	T	0.18	-0.687	6.1143	0.20117	0.0:0.1379:0.1391:0.723	.	601	Q9UBK2	PRGC1_HUMAN	C	601	ENSP00000264867:Y601C	ENSP00000264867:Y601C	Y	-	2	0	PPARGC1A	23423838	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.429000	0.44758	0.957000	0.37930	0.533000	0.62120	TAT	0	NULL		0.507	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	protein_coding	OTTHUMT00000214976.1	54	200	0	0.00	0	0	T	NM_013261	0	0		23814740	-1	no_errors	ENST00000264867	ensembl	human	known	74_37	missense	28	115	48.15	31.95	26	54	SNP	1	C
ZNF192P1	651302	genome.wustl.edu	37	6	28134312	28134312	+	RNA	SNP	C	C	G			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr6:28134312C>G	ENST00000440790.2	+	0	415					NR_103448.1				zinc finger protein 192 pseudogene 1																		AAGGTGTCAGCTCTGAAGGGA	0.388																																							0											0													18.0	17.0	17.0					6																	28134312		692	1591	2283			0					6p22.1	2012-10-05	2011-08-31	2011-08-31	ENSG00000226314	ENSG00000226314			18777	pseudogene	pseudogene	"""zinc finger protein 389, pseudogene"""		"""zinc finger protein 389"""	ZNF389			Standard	NR_103448		Approved	dJ265C24.4, ZNF389P	uc021yrq.2		OTTHUMG00000014513		6.37:g.28134312C>G				RNA	SNP	0	NULL	ENST00000440790.2	37	NULL		6																																																																																			0	0		0.388	ZNF192P1-001	KNOWN	basic	processed_transcript	ZNF192P1	pseudogene	OTTHUMT00000040181.1	41	230	0	0.00	0	0	C		0	0		28134312	1	no_errors	ENST00000440790	ensembl	human	known	74_37	rna	22	197	45	30.39	18	86	SNP	0	G
HLA-DMA	3108	genome.wustl.edu	37	6	32920785	32920785	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr6:32920785G>A	ENST00000374843.4	-	1	114	c.29C>T	c.(28-30)gCg>gTg	p.A10V	HLA-DMA_ENST00000464392.1_Intron|XXbac-BPG181M17.5_ENST00000429234.1_Missense_Mutation_p.A10V|HLA-DMA_ENST00000395303.3_Missense_Mutation_p.A10V|HLA-DMA_ENST00000395305.3_Missense_Mutation_p.A10V	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	10					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						CTGTAGCAGCGCAGCTCCTTG	0.552																																							0											0													210.0	189.0	196.0					6																	32920785		1511	2709	4220	SO:0001583	missense	0				CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.29C>T	6.37:g.32920785G>A	ENSP00000363976:p.Ala10Val		Q29639|Q29640	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A10V	ENST00000374843.4	37	c.29	CCDS4761.1	6	.	.	.	.	.	.	.	.	.	.	G	9.154	1.017000	0.19355	.	.	ENSG00000248993;ENSG00000204257;ENSG00000204257;ENSG00000204257	ENST00000429234;ENST00000395305;ENST00000395303;ENST00000374843	T;T;T;T	0.19394	2.15;5.36;4.77;5.79	4.18	-4.08	0.03963	.	1.667580	0.03130	N	0.165003	T	0.03095	0.0091	L	0.29908	0.895	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.08055	0.003;0.003	T	0.19353	-1.0308	10	0.06236	T	0.91	.	7.2692	0.26248	0.6285:0.1408:0.2307:0.0	.	10;10	P28067;Q31604	DMA_HUMAN;.	V	10	ENSP00000412457:A10V;ENSP00000378716:A10V;ENSP00000378714:A10V;ENSP00000363976:A10V	ENSP00000363976:A10V	A	-	2	0	XXbac-BPG181M17.5;HLA-DMA	33028763	0.000000	0.05858	0.026000	0.17262	0.057000	0.15508	-1.757000	0.01811	-1.046000	0.03246	-0.148000	0.13756	GCG	0	NULL		0.552	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMA	protein_coding	OTTHUMT00000076325.2	58	181	0	0.00	0	0	G	NM_006120	0	0		32920785	-1	no_errors	ENST00000374843	ensembl	human	known	74_37	missense	36	132	33.33	35.44	18	73	SNP	0.043	A
RFX6	222546	genome.wustl.edu	37	6	117246707	117246707	+	Missense_Mutation	SNP	G	G	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr6:117246707G>C	ENST00000332958.2	+	16	1786	c.1770G>C	c.(1768-1770)aaG>aaC	p.K590N		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	590					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						ACGCTGTGAAGAATGAAAGCC	0.532																																							0											0													124.0	118.0	120.0					6																	117246707		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1770G>C	6.37:g.117246707G>C	ENSP00000332208:p.Lys590Asn		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.K590N	ENST00000332958.2	37	c.1770	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	G	15.46	2.839592	0.51057	.	.	ENSG00000185002	ENST00000332958	T	0.62364	0.03	5.95	4.16	0.48862	.	0.046676	0.85682	D	0.000000	T	0.63486	0.2515	M	0.62723	1.935	0.51482	D	0.99992	D	0.89917	1.0	D	0.71870	0.975	T	0.67086	-0.5759	10	0.59425	D	0.04	-16.0139	7.5312	0.27685	0.3528:0.0:0.6472:0.0	.	590	Q8HWS3	RFX6_HUMAN	N	590	ENSP00000332208:K590N	ENSP00000332208:K590N	K	+	3	2	RFX6	117353400	1.000000	0.71417	1.000000	0.80357	0.326000	0.28443	3.385000	0.52485	0.840000	0.34995	0.491000	0.48974	AAG	0	NULL		0.532	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	protein_coding	OTTHUMT00000041970.2	34	154	0	0.00	0	0	G	NM_173560	0	0		117246707	1	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	17	113	15	27.10	3	42	SNP	1	C
UTRN	7402	genome.wustl.edu	37	6	144744742	144744742	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr6:144744742C>T	ENST00000367545.3	+	4	292	c.292C>T	c.(292-294)Cag>Tag	p.Q98*		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	98	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CAGAGTGCTGCAGGTTTTACA	0.413																																							0											0													196.0	174.0	181.0					6																	144744742		2203	4300	6503	SO:0001587	stop_gained	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.292C>T	6.37:g.144744742C>T	ENSP00000356515:p.Gln98*		Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.Q98*	ENST00000367545.3	37	c.292	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.592969	0.96602	.	.	ENSG00000152818	ENST00000367529;ENST00000367545;ENST00000421035	.	.	.	5.61	5.61	0.85477	.	0.000000	0.47455	D	0.000223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	19.6481	0.95790	0.0:1.0:0.0:0.0	.	.	.	.	X	98;98;103	.	ENSP00000356499:Q98X	Q	+	1	0	UTRN	144786435	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.270000	0.78493	2.651000	0.90000	0.557000	0.71058	CAG	0	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pirsf_Dystrophin/utrophin,pfscan_CH-domain		0.413	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	protein_coding	OTTHUMT00000042551.1	46	282	0	0.00	0	0	C		0	0		144744742	1	no_errors	ENST00000367545	ensembl	human	known	74_37	nonsense	48	262	9.43	5.42	5	15	SNP	1	T
MPLKIP	136647	genome.wustl.edu	37	7	40173957	40173957	+	Silent	SNP	G	G	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr7:40173957G>A	ENST00000306984.6	-	1	301	c.210C>T	c.(208-210)ggC>ggT	p.G70G	C7orf10_ENST00000540834.1_5'Flank|C7orf10_ENST00000309930.5_5'Flank|C7orf10_ENST00000401647.2_5'Flank|C7orf10_ENST00000335693.4_5'Flank	NM_138701.3	NP_619646.1	Q8TAP9	MPLKI_HUMAN	M-phase specific PLK1 interacting protein	70					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)											GGAAGCTGCCGCCGTGTCGCG	0.731																																							0											0													5.0	6.0	5.0					7																	40173957		2061	4102	6163	SO:0001819	synonymous_variant	0			AX048113	CCDS5463.1	7p14	2014-09-17	2012-03-01	2012-03-01	ENSG00000168303	ENSG00000168303			16002	protein-coding gene	gene with protein product	tricothiodystrophy, non-photosensitive 1	609188	"""chromosome 7 open reading frame 11"""	C7orf11		11829489	Standard	NM_138701		Approved	ORF20, TTDN1	uc003thl.4	Q8TAP9	OTTHUMG00000128797	ENST00000306984.6:c.210C>T	7.37:g.40173957G>A				Silent	SNP	NULL	p.G70	ENST00000306984.6	37	c.210	CCDS5463.1	7																																																																																			0	NULL		0.731	MPLKIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPLKIP	protein_coding	OTTHUMT00000250729.3	19	61	0	0.00	0	0	G	NM_138701	0	0		40173957	-1	no_errors	ENST00000306984	ensembl	human	known	74_37	silent	8	57	52.94	44.66	9	46	SNP	0.98	A
COBL	23242	genome.wustl.edu	37	7	51287490	51287490	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr7:51287490C>T	ENST00000265136.7	-	2	358	c.193G>A	c.(193-195)Gtc>Atc	p.V65I	COBL_ENST00000395542.2_Missense_Mutation_p.V65I|COBL_ENST00000441453.1_Missense_Mutation_p.V65I|COBL_ENST00000395540.2_Missense_Mutation_p.V65I	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	65					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					ACCACGGTGACGTCCATGGTG	0.627																																					NSCLC(189;2119 2138 12223 30818 34679)		0											0													75.0	73.0	74.0					7																	51287490		2203	4300	6503	SO:0001583	missense	0			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.193G>A	7.37:g.51287490C>T	ENSP00000265136:p.Val65Ile		A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.V65I	ENST00000265136.7	37	c.193	CCDS34637.1	7	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046929	0.36085	.	.	ENSG00000106078	ENST00000265136;ENST00000395542;ENST00000395540;ENST00000441453;ENST00000449281	T;T	0.11712	2.79;2.75	5.73	-3.95	0.04118	Cordon-bleu domain (1);	0.793803	0.10687	N	0.645695	T	0.04861	0.0131	N	0.17674	0.51	0.09310	N	1	B;B;B;B	0.27450	0.179;0.009;0.179;0.17	B;B;B;B	0.24394	0.011;0.009;0.024;0.053	T	0.45600	-0.9250	10	0.07990	T	0.79	.	8.2842	0.31920	0.0:0.6833:0.1379:0.1788	.	65;65;65;65	O75128-3;O75128-5;O75128-7;O75128	.;.;.;COBL_HUMAN	I	65;65;65;65;49	ENSP00000265136:V65I;ENSP00000378912:V65I	ENSP00000265136:V65I	V	-	1	0	COBL	51254984	0.001000	0.12720	0.010000	0.14722	0.620000	0.37586	-1.012000	0.03649	-0.572000	0.06006	0.655000	0.94253	GTC	0	pfam_Cordon-bleu_ubiquitin_domain		0.627	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	protein_coding	OTTHUMT00000342682.1	37	60	0	0.00	0	0	C	NM_015198	0	0		51287490	-1	no_errors	ENST00000395542	ensembl	human	known	74_37	missense	18	69	33.33	26.60	9	25	SNP	0.107	T
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	350	127	0	0.78	0	1	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	238	97	30.41	34.46	104	51	SNP	1	A
DGKI	9162	genome.wustl.edu	37	7	137330273	137330273	+	Missense_Mutation	SNP	C	C	T	rs148415050		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr7:137330273C>T	ENST00000288490.5	-	6	749	c.749G>A	c.(748-750)cGt>cAt	p.R250H	DGKI_ENST00000446122.1_Missense_Mutation_p.R250H|DGKI_ENST00000424189.2_Missense_Mutation_p.R250H|DGKI_ENST00000453654.2_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	250					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CCAGTGATGACGTACAAAATT	0.483																																							0											0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	60.0	55.0	56.0		749	5.6	1.0	7	dbSNP_134	56	3,8597	3.0+/-9.4	0,3,4297	yes	missense	DGKI	NM_004717.2	29	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	250/1066	137330273	4,13002	2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.749G>A	7.37:g.137330273C>T	ENSP00000288490:p.Arg250His		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R250H	ENST00000288490.5	37	c.749	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741538	0.69304	2.27E-4	3.49E-4	ENSG00000157680	ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.34667	1.35;1.55	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	L	0.49126	1.545	0.58432	D	0.999999	D	0.65815	0.995	P	0.52159	0.691	T	0.11792	-1.0573	10	0.26408	T	0.33	.	16.6104	0.84881	0.0:1.0:0.0:0.0	.	250	O75912	DGKI_HUMAN	H	198;250;250;250	ENSP00000288490:R250H;ENSP00000399131:R250H	ENSP00000288490:R250H	R	-	2	0	DGKI	136980813	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.527000	0.67123	2.665000	0.90641	0.655000	0.94253	CGT	0	NULL		0.483	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	59	139	0	0.00	0	0	C	NM_004717	rs148415050	C->T		137330273	-1	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	33	104	28.26	36.20	13	59	SNP	1	T
NPR2	4882	genome.wustl.edu	37	9	35808516	35808516	+	Missense_Mutation	SNP	T	T	C	rs369313283		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr9:35808516T>C	ENST00000342694.2	+	19	2978	c.2723T>C	c.(2722-2724)aTt>aCt	p.I908T	SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_Intron	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	908	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GTGGAGACGATTGGGGATGCT	0.478													T|||	1	0.000199681	0.0	0.0	5008	,	,		21937	0.001		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0								T	THR/ILE,	0,4406		0,0,2203	82.0	74.0	76.0		2723,	5.6	1.0	9		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	NPR2,SPAG8	NM_003995.3,NM_172312.1	89,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,	908/1048,	35808516	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2723T>C	9.37:g.35808516T>C	ENSP00000341083:p.Ile908Thr		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.I908T	ENST00000342694.2	37	c.2723	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370367	0.82573	0.0	1.16E-4	ENSG00000159899	ENST00000342694	D	0.85339	-1.97	5.63	5.63	0.86233	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.43919	D	0.000520	D	0.93963	0.8067	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.95220	0.8333	10	0.87932	D	0	.	14.674	0.68964	0.0:0.0:0.0:1.0	.	908;908	P20594-2;P20594	.;ANPRB_HUMAN	T	908	ENSP00000341083:I908T	ENSP00000341083:I908T	I	+	2	0	NPR2	35798516	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	7.959000	0.87885	2.130000	0.65690	0.533000	0.62120	ATT	0	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.478	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	protein_coding	OTTHUMT00000052345.1	11	312	0	0.00	0	0	T		rs369313283	T->C		35808516	1	no_errors	ENST00000342694	ensembl	human	known	74_37	missense	7	256	30	8.54	3	24	SNP	1	C
DMBT1	1755	genome.wustl.edu	37	10	124390692	124390692	+	Missense_Mutation	SNP	G	G	T	rs369454959		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr10:124390692G>T	ENST00000338354.3	+	46	5960	c.5854G>T	c.(5854-5856)Gat>Tat	p.D1952Y	DMBT1_ENST00000368909.3_Missense_Mutation_p.D1952Y|DMBT1_ENST00000330163.4_Missense_Mutation_p.D1324Y|DMBT1_ENST00000344338.3_Missense_Mutation_p.D1942Y|DMBT1_ENST00000368956.2_Missense_Mutation_p.D1324Y|DMBT1_ENST00000359586.6_Missense_Mutation_p.D672Y|DMBT1_ENST00000368955.3_Missense_Mutation_p.D1942Y			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1952	SRCR 14. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.D1952N(2)|p.D2081N(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CACCCTGGACGATGTAGAGTG	0.557																																					Ovarian(182;93 2026 18125 22222 38972)		0											3	Substitution - Missense(3)	lung(3)											139.0	138.0	139.0					10																	124390692		2040	4189	6229	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5854G>T	10.37:g.124390692G>T	ENSP00000342210:p.Asp1952Tyr		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.D1952Y	ENST00000338354.3	37	c.5854		10	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017985	0.54576	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.41	3.53	0.40419	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.63058	0.2479	M	0.81614	2.55	0.33986	D	0.648518	D;D;D;D;D;D;D	0.89917	0.987;1.0;1.0;1.0;0.999;0.999;0.986	D;D;D;D;D;D;D	0.91635	0.949;0.998;0.966;0.999;0.968;0.999;0.91	T	0.71547	-0.4560	9	0.37606	T	0.19	.	11.2813	0.49197	0.2075:0.0:0.7925:0.0	.	672;1932;1201;2081;1324;1942;1952	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	Y	1952;2081;1952;1952;1952;1952;1324;1942;1324;1324;1952;1942;1324;98;672	ENSP00000342210:D1952Y;ENSP00000343175:D1942Y;ENSP00000327747:D1324Y;ENSP00000357905:D1952Y;ENSP00000357951:D1942Y;ENSP00000357952:D1324Y;ENSP00000352593:D672Y	ENSP00000331522:D1324Y	D	+	1	0	DMBT1	124380682	0.003000	0.15002	0.006000	0.13384	0.002000	0.02628	0.058000	0.14301	0.629000	0.30376	-0.136000	0.14681	GAT	0	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.557	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	49	177	2	0.00	1	0	G	NM_004406	0	0		124390692	1	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	40	151	34.43	28.10	21	59	SNP	0.794	T
PRR13	54458	genome.wustl.edu	37	12	53837543	53837543	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr12:53837543C>T	ENST00000429243.2	+	3	596	c.388C>T	c.(388-390)Cac>Tac	p.H130Y	RP11-793H13.8_ENST00000547717.1_RNA|PRR13_ENST00000549135.1_Missense_Mutation_p.H130Y|PRR13_ENST00000549581.1_Missense_Mutation_p.H80Y|PRR13_ENST00000549068.1_3'UTR|PRR13_ENST00000379786.4_Missense_Mutation_p.H80Y|PRR13_ENST00000547368.1_Missense_Mutation_p.H144Y|PRR13_ENST00000551003.1_Missense_Mutation_p.H98Y|PCBP2_ENST00000541275.1_5'UTR|PRR13_ENST00000546581.1_Missense_Mutation_p.H34Y|PRR13_ENST00000549740.1_Missense_Mutation_p.H130Y|PRR13_ENST00000549924.1_Missense_Mutation_p.H130Y	NM_001005354.2|NM_018457.3	NP_001005354.1|NP_060927.1	Q9NZ81	PRR13_HUMAN	proline rich 13	130	His-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(1)|urinary_tract(1)	6						ccacaagtaccacaagcaTGG	0.507																																							0											0													47.0	37.0	41.0					12																	53837543		2203	4300	6503	SO:0001583	missense	0			AF217517	CCDS31811.1, CCDS44899.1	12q13.13	2014-05-28			ENSG00000205352	ENSG00000205352			24528	protein-coding gene	gene with protein product		610459				11230166	Standard	NM_018457		Approved	FLJ23818, DKFZP564J157	uc001scz.4	Q9NZ81	OTTHUMG00000170049	ENST00000429243.2:c.388C>T	12.37:g.53837543C>T	ENSP00000412064:p.His130Tyr		Q0V8U0|Q6FIG7|Q6MZP8|Q6NXQ6|Q6PKF9	Missense_Mutation	SNP	NULL	p.H130Y	ENST00000429243.2	37	c.388	CCDS44899.1	12	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412958	0.25465	.	.	ENSG00000205352	ENST00000429243;ENST00000549924;ENST00000551003;ENST00000549740;ENST00000546581;ENST00000549581;ENST00000547368;ENST00000379786;ENST00000549135	.	.	.	4.2	4.2	0.49525	.	.	.	.	.	T	0.67970	0.2950	L	0.46819	1.47	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.78314	0.991;0.991	T	0.70506	-0.4853	8	0.87932	D	0	.	12.2674	0.54686	0.0:1.0:0.0:0.0	.	130;80	Q9NZ81;Q9NZ81-2	PRR13_HUMAN;.	Y	130;130;98;130;34;80;144;80;130	.	ENSP00000369112:H80Y	H	+	1	0	PRR13	52123810	0.993000	0.37304	0.999000	0.59377	0.451000	0.32288	3.621000	0.54210	2.342000	0.79632	0.655000	0.94253	CAC	0	NULL		0.507	PRR13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRR13	protein_coding	OTTHUMT00000407055.1	27	101	0	0.00	0	0	C	NM_018457	0	0		53837543	1	no_errors	ENST00000429243	ensembl	human	known	74_37	missense	19	56	17.39	38.46	4	35	SNP	0.999	T
ACACB	32	genome.wustl.edu	37	12	109637257	109637257	+	Missense_Mutation	SNP	A	A	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr12:109637257A>C	ENST00000338432.7	+	18	2797	c.2678A>C	c.(2677-2679)gAt>gCt	p.D893A	ACACB_ENST00000377854.5_Missense_Mutation_p.D893A|ACACB_ENST00000377848.3_Missense_Mutation_p.D893A			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	893	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AAGGAGAACGATCCTACAGTC	0.557																																							0											0													150.0	137.0	141.0					12																	109637257		2203	4300	6503	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2678A>C	12.37:g.109637257A>C	ENSP00000341044:p.Asp893Ala		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.D893A	ENST00000338432.7	37	c.2678	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659164	0.67586	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	D;D;D	0.82984	-1.67;-1.67;-1.67	5.42	5.42	0.78866	Single hybrid motif (1);	0.000000	0.85682	D	0.000000	D	0.91116	0.7203	M	0.91510	3.215	0.80722	D	1	D	0.62365	0.991	P	0.56127	0.792	D	0.93163	0.6559	10	0.87932	D	0	.	15.4121	0.74933	1.0:0.0:0.0:0.0	.	893	O00763	ACACB_HUMAN	A	893;893;893;124	ENSP00000341044:D893A;ENSP00000367079:D893A;ENSP00000367085:D893A	ENSP00000341044:D893A	D	+	2	0	ACACB	108121640	1.000000	0.71417	0.092000	0.20876	0.340000	0.28889	9.172000	0.94808	2.181000	0.69327	0.477000	0.44152	GAT	0	superfamily_Single_hybrid_motif		0.557	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	protein_coding	OTTHUMT00000403077.1	37	171	0	0.00	0	0	A	NM_001093	0	0		109637257	1	no_errors	ENST00000338432	ensembl	human	known	74_37	missense	16	142	33.33	28.64	8	57	SNP	1	C
SLITRK1	114798	genome.wustl.edu	37	13	84454909	84454909	+	Missense_Mutation	SNP	G	G	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr13:84454909G>T	ENST00000377084.2	-	1	1619	c.734C>A	c.(733-735)aCc>aAc	p.T245N		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	245	LRRCT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CTGCAGTCTGGTGGGGGCTTC	0.547																																							0											0													60.0	63.0	62.0					13																	84454909		2203	4300	6503	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.734C>A	13.37:g.84454909G>T	ENSP00000366288:p.Thr245Asn		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T245N	ENST00000377084.2	37	c.734	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610431	0.28712	.	.	ENSG00000178235	ENST00000377084	T	0.42513	0.97	4.71	4.71	0.59529	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	N	0.25380	0.74	0.53688	D	0.99997	P	0.38711	0.643	B	0.42188	0.379	T	0.05370	-1.0889	10	0.13853	T	0.58	-15.1213	16.3895	0.83528	0.0:0.0:1.0:0.0	.	245	Q96PX8	SLIK1_HUMAN	N	245	ENSP00000366288:T245N	ENSP00000366288:T245N	T	-	2	0	SLITRK1	83352910	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.880000	0.56145	2.456000	0.83038	0.555000	0.69702	ACC	0	smart_Cys-rich_flank_reg_C		0.547	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	protein_coding	OTTHUMT00000045396.1	81	195	0	0.00	0	0	G	NM_052910	0	0		84454909	-1	no_errors	ENST00000377084	ensembl	human	known	74_37	missense	61	156	20.78	15.68	16	29	SNP	1	T
ARHGEF40	55701	genome.wustl.edu	37	14	21542584	21542584	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr14:21542584A>G	ENST00000298694.4	+	3	822	c.695A>G	c.(694-696)aAt>aGt	p.N232S	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.N232S			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	232						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GATGGGCACAATGCCCCTGTG	0.647																																							0											0													36.0	43.0	41.0					14																	21542584		2203	4300	6503	SO:0001583	missense	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.695A>G	14.37:g.21542584A>G	ENSP00000298694:p.Asn232Ser		A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.N232S	ENST00000298694.4	37	c.695	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	A	14.46	2.540795	0.45280	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02236	4.44;4.38	5.03	5.03	0.67393	.	0.000000	0.48767	D	0.000180	T	0.02156	0.0067	L	0.27053	0.805	0.28918	N	0.892279	B;B	0.29136	0.073;0.234	B;B	0.32090	0.066;0.14	T	0.37686	-0.9695	10	0.31617	T	0.26	.	8.2589	0.31773	0.8229:0.0:0.0:0.1771	.	232;232	Q8TER5;G3V3N2	ARH40_HUMAN;.	S	232	ENSP00000298694:N232S;ENSP00000298693:N232S	ENSP00000298693:N232S	N	+	2	0	ARHGEF40	20612424	0.982000	0.34865	1.000000	0.80357	0.992000	0.81027	2.216000	0.42871	1.896000	0.54893	0.459000	0.35465	AAT	0	NULL		0.647	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	protein_coding	OTTHUMT00000413122.1	39	79	0	0.00	0	0	A		0	0		21542584	1	no_errors	ENST00000298694	ensembl	human	known	74_37	missense	19	76	26.92	32.14	7	36	SNP	0.978	G
N4BP1	9683	genome.wustl.edu	37	16	48594885	48594885	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr16:48594885T>C	ENST00000262384.3	-	2	1905	c.1669A>G	c.(1669-1671)Aat>Gat	p.N557D	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	557					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GTTGAGCAATTTGGCTTAGAA	0.448																																							0											0													132.0	132.0	132.0					16																	48594885		1960	4154	6114	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.1669A>G	16.37:g.48594885T>C	ENSP00000262384:p.Asn557Asp		A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.N557D	ENST00000262384.3	37	c.1669	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	T	9.194	1.026894	0.19512	.	.	ENSG00000102921	ENST00000262384	T	0.46451	0.87	6.08	2.69	0.31865	.	0.660669	0.15577	N	0.255125	T	0.22513	0.0543	N	0.24115	0.695	0.09310	N	1	B	0.23735	0.09	B	0.16722	0.016	T	0.20706	-1.0267	10	0.13470	T	0.59	-10.6964	4.9896	0.14207	0.0:0.3039:0.1644:0.5317	.	557	O75113	N4BP1_HUMAN	D	557	ENSP00000262384:N557D	ENSP00000262384:N557D	N	-	1	0	N4BP1	47152386	0.000000	0.05858	0.008000	0.14137	0.833000	0.47200	0.346000	0.19997	0.548000	0.28955	0.482000	0.46254	AAT	0	NULL		0.448	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	protein_coding	OTTHUMT00000429920.1	40	339	0	0.00	0	0	T	NM_014664	0	0		48594885	-1	no_errors	ENST00000262384	ensembl	human	known	74_37	missense	25	236	35.9	33.52	14	119	SNP	0	C
ONECUT3	390874	genome.wustl.edu	37	19	1754836	1754836	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr19:1754836C>A	ENST00000382349.4	+	1	2465	c.1175C>A	c.(1174-1176)tCg>tAg	p.S392*		NM_001080488.1	NP_001073957.1	O60422	ONEC3_HUMAN	one cut homeobox 3	392					endocrine pancreas development (GO:0031018)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)						Acute lymphoblastic leukemia(61;4.66e-11)|all_hematologic(61;4.59e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGCATGTCGGCGCTGCGC	0.706																																							0											0													14.0	12.0	13.0					19																	1754836		2172	4272	6444	SO:0001587	stop_gained	0			AC004755	CCDS45900.1	19p13.3	2012-03-09	2007-07-16			ENSG00000205922		"""Homeoboxes / CUT class"""	13399	protein-coding gene	gene with protein product		611294	"""one cut domain, family member 3"""			9915796	Standard	NM_001080488		Approved		uc010xgr.2	O60422		ENST00000382349.4:c.1175C>A	19.37:g.1754836C>A	ENSP00000371786:p.Ser392*		A8MZM7	Nonsense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.S392*	ENST00000382349.4	37	c.1175	CCDS45900.1	19	.	.	.	.	.	.	.	.	.	.	C	50	16.436112	0.99863	.	.	ENSG00000205922	ENST00000382349	.	.	.	3.56	3.56	0.40772	.	0.110239	0.38605	U	0.001626	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7163	0.62697	0.0:1.0:0.0:0.0	.	.	.	.	X	392	.	ENSP00000371786:S392X	S	+	2	0	ONECUT3	1705836	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.283000	0.78640	1.524000	0.49035	0.561000	0.74099	TCG	0	pfam_Hmoeo_CUT,superfamily_Lambda_DNA-bd_dom,pfscan_Hmoeo_CUT		0.706	ONECUT3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ONECUT3	protein_coding	OTTHUMT00000418499.1	41	37	0	0.00	0	0	C		0	0		1754836	1	no_errors	ENST00000382349	ensembl	human	known	74_37	nonsense	17	20	32	53.49	8	23	SNP	1	A
FCAR	2204	genome.wustl.edu	37	19	55396876	55396876	+	Silent	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr19:55396876C>T	ENST00000355524.3	+	3	310	c.300C>T	c.(298-300)tgC>tgT	p.C100C	FCAR_ENST00000391723.3_Silent_p.C88C|FCAR_ENST00000359272.4_Silent_p.C88C|FCAR_ENST00000391726.3_Silent_p.C88C|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000345937.4_Silent_p.C100C|FCAR_ENST00000391724.3_Silent_p.C88C|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000469767.1_Silent_p.C100C|FCAR_ENST00000391725.3_Silent_p.C100C	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	100	Ig-like C2-type 1.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GCTATCAGTGCCAATATAGGA	0.507																																							0											0													87.0	76.0	80.0					19																	55396876		2203	4300	6503	SO:0001819	synonymous_variant	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.300C>T	19.37:g.55396876C>T			Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Silent	SNP	smart_Ig_sub	p.C100	ENST00000355524.3	37	c.300	CCDS12907.1	19																																																																																			0	smart_Ig_sub		0.507	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	protein_coding	OTTHUMT00000141243.1	35	139	0	0.00	0	0	C	NM_002000	0	0		55396876	1	no_errors	ENST00000355524	ensembl	human	known	74_37	silent	13	128	31.58	32.28	6	61	SNP	0.011	T
NLRP5	126206	genome.wustl.edu	37	19	56539531	56539531	+	Silent	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr19:56539531C>T	ENST00000390649.3	+	7	1932	c.1932C>T	c.(1930-1932)gaC>gaT	p.D644D		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	644					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGAGCGAAGACGTAAGGAGGC	0.552																																							0											0													61.0	63.0	62.0					19																	56539531		1976	4149	6125	SO:0001819	synonymous_variant	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1932C>T	19.37:g.56539531C>T			A8MTY4|Q86W29	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D644	ENST00000390649.3	37	c.1932	CCDS12938.1	19																																																																																			0	NULL		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	protein_coding	OTTHUMT00000313735.1	36	125	0	0.00	0	0	C	NM_153447	0	0		56539531	1	no_errors	ENST00000390649	ensembl	human	known	74_37	silent	24	88	20	34.56	6	47	SNP	0	T
PMEPA1	56937	genome.wustl.edu	37	20	56227302	56227302	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr20:56227302C>T	ENST00000341744.3	-	4	990	c.671G>A	c.(670-672)cGc>cAc	p.R224H	PMEPA1_ENST00000395816.3_Missense_Mutation_p.R174H|PMEPA1_ENST00000395814.1_Missense_Mutation_p.R174H|PMEPA1_ENST00000265626.4_Missense_Mutation_p.R174H|PMEPA1_ENST00000347215.4_Missense_Mutation_p.R189H	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	224					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						CCCCTCCATGCGCCCGCCGCT	0.692																																							0											0													15.0	18.0	17.0					20																	56227302		2196	4297	6493	SO:0001583	missense	0			AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.671G>A	20.37:g.56227302C>T	ENSP00000345826:p.Arg224His		Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	NULL	p.R224H	ENST00000341744.3	37	c.671	CCDS13463.1	20	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010869	0.93346	.	.	ENSG00000124225	ENST00000341744;ENST00000347215;ENST00000395816;ENST00000265626;ENST00000395814;ENST00000414037	T;T;T;T;T;T	0.54866	0.55;0.59;0.6;0.6;0.6;0.62	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000001	T	0.71592	0.3358	M	0.64170	1.965	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71510	-0.4571	10	0.51188	T	0.08	-47.2292	19.3086	0.94175	0.0:1.0:0.0:0.0	.	189;224	Q5JY37;Q969W9	.;PMEPA_HUMAN	H	224;189;174;174;174;196	ENSP00000345826:R224H;ENSP00000344014:R189H;ENSP00000379161:R174H;ENSP00000265626:R174H;ENSP00000379159:R174H;ENSP00000401506:R196H	ENSP00000265626:R174H	R	-	2	0	PMEPA1	55660708	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.650000	0.67944	2.555000	0.86185	0.650000	0.86243	CGC	0	NULL		0.692	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEPA1	protein_coding	OTTHUMT00000079858.2	32	17	0	0.00	0	0	C	NM_020182	0	0		56227302	-1	no_errors	ENST00000341744	ensembl	human	known	74_37	missense	20	16	23.08	20.00	6	4	SNP	1	T
CSF2RB	1439	genome.wustl.edu	37	22	37334245	37334245	+	Missense_Mutation	SNP	C	C	T	rs544020050	byFrequency	TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr22:37334245C>T	ENST00000403662.3	+	14	2617	c.2395C>T	c.(2395-2397)Cgc>Tgc	p.R799C	CSF2RB_ENST00000262825.5_Missense_Mutation_p.R805C|CSF2RB_ENST00000536485.1_Missense_Mutation_p.R746C|CSF2RB_ENST00000406230.1_Missense_Mutation_p.R805C			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	799					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCCAGGGGAACGCCCGGCAGA	0.657													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16191	0.001		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0													62.0	65.0	64.0					22																	37334245		2203	4300	6503	SO:0001583	missense	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2395C>T	22.37:g.37334245C>T	ENSP00000384053:p.Arg799Cys		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R805C	ENST00000403662.3	37	c.2413	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241180	0.39598	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.91792	-2.4;-2.91;-2.91;-2.91	5.21	0.302	0.15786	.	0.870917	0.09707	N	0.766211	D	0.83344	0.5234	N	0.08118	0	0.09310	N	1	D;D	0.57571	0.98;0.965	P;B	0.47744	0.556;0.353	T	0.75569	-0.3272	10	0.59425	D	0.04	-7.4368	4.2312	0.10604	0.1483:0.4755:0.2892:0.0869	.	805;799	P32927-2;P32927	.;IL3RB_HUMAN	C	799;799;805;805;746	ENSP00000384053:R799C;ENSP00000262825:R805C;ENSP00000385271:R805C;ENSP00000440003:R746C	ENSP00000262825:R805C	R	+	1	0	CSF2RB	35664191	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.226000	0.17776	0.538000	0.28769	0.400000	0.26472	CGC	0	pirsf_IL3_rcpt_beta		0.657	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	protein_coding	OTTHUMT00000318854.1	76	146	0	0.00	0	0	C	NM_000395	rs544020050	C->T		37334245	1	no_errors	ENST00000262825	ensembl	human	known	74_37	missense	52	183	16.13	6.63	10	13	SNP	0.001	T
C11orf45	219833	genome.wustl.edu	37	11	128772397	128772398	+	3'UTR	INS	-	-	GTCTGCAT	rs186223202	byFrequency	TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	-	-	-	GTCTGCAT	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr11:128772397_128772398insGTCTGCAT	ENST00000310799.3	-	0	685_686				C11orf45_ENST00000530168.1_De_novo_Start_OutOfFrame|KCNJ5_ENST00000338350.4_Intron|KCNJ5_ENST00000529694.1_Intron	NM_001256088.1|NM_145013.2	NP_001243017.1|NP_659450.1	Q8TAV5	CK045_HUMAN	chromosome 11 open reading frame 45							extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|pancreas(1)|prostate(2)	7	all_hematologic(175;0.0641)	Lung NSC(97;0.00521)|Breast(109;0.00715)|all_lung(97;0.0111)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.00531)|LUSC - Lung squamous cell carcinoma(976;0.0193)|Lung(977;0.0195)		TCATAGCAGCCGTCTGCATGGG	0.599																																							0											0																																										SO:0001624	3_prime_UTR_variant	0			AK125634	CCDS8478.1	11q24.3	2012-05-30			ENSG00000174370	ENSG00000174370			28584	protein-coding gene	gene with protein product							Standard	NM_001256088		Approved	MGC35558, FLJ43646	uc001qeu.3	Q8TAV5	OTTHUMG00000165796	ENST00000310799.3:c.*55->ATGCAGAC	11.37:g.128772398_128772405dupGTCTGCAT			B2RAD0	RNA	INS	0	NULL	ENST00000310799.3	37	NULL	CCDS8478.1	11																																																																																			0	0		0.599	C11orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf45	protein_coding	OTTHUMT00000386241.1	37	80	0	0.00	0	0	0	NM_145013	0	0		128772398	-1	no_errors	ENST00000530168	ensembl	human	known	74_37	rna	16	81	20	5.81	4	5	INS	0.000:0.000	GTCTGCAT
LOC101927209	101927209	genome.wustl.edu	37	1	142653748	142653748	+	lincRNA	SNP	C	C	T	rs139451205		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr1:142653748C>T	ENST00000610091.1	-	0	3560				AL583842.3_ENST00000580249.1_RNA|AL583842.1_ENST00000459390.1_RNA|AL583842.2_ENST00000582446.1_RNA|RP11-417J8.3_ENST00000426408.1_lincRNA																							atcccatctgcgggacaaaca	0.463																																							0											0																																												0																															1.37:g.142653748C>T				RNA	SNP	0	NULL	ENST00000610091.1	37	NULL		1																																																																																			0	0		0.463	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000239012	lincRNA	OTTHUMT00000037265.2	206	0	0	0.00	0	0	C		0	0		142653748	1	no_errors	ENST00000459390	ensembl	human	novel	74_37	rna	171	0	18.57	0.00	39	0	SNP	0	T
FBXO18	84893	genome.wustl.edu	37	10	5932262	5932262	+	5'UTR	SNP	C	C	T			TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr10:5932262C>T	ENST00000362091.4	+	0	69				FBXO18_ENST00000397269.3_Intron|FBXO18_ENST00000470089.1_3'UTR|ANKRD16_ENST00000191063.8_5'Flank|ANKRD16_ENST00000380092.4_5'Flank|ANKRD16_ENST00000380094.5_5'Flank	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						cggccggcggcgcgggcccgg	0.796																																							0											0													1.0	2.0	1.0					10																	5932262		523	1107	1630	SO:0001623	5_prime_UTR_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.-47C>T	10.37:g.5932262C>T			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	0	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			0	0		0.796	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	44	4	0	0.00	0	0	C	NM_032807	0	0		5932262	1	no_errors	ENST00000462507	ensembl	human	known	74_37	rna	26	3	13.33	0.00	4	0	SNP	0.145	T
AC079610.1	0	genome.wustl.edu	37	2	213628294	213628297	+	RNA	DEL	TGTG	TGTG	-	rs13431748|rs57305053|rs13431749		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	TGTG	TGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr2:213628294_213628297delTGTG	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							tatatatatatgtgtatatatata	0.211																																							0											0																																												0																															2.37:g.213628294_213628297delTGTG				RNA	DEL	0	NULL	ENST00000415387.1	37	NULL		2																																																																																			0	0		0.211	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	sense_overlapping	OTTHUMT00000337265.1	22	0	0	0.00	0	0	TGTG		0	0		213628297	-1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	7	0	22.22	0.00	2	0	DEL	0.000:0.000:0.000:0.000	0
WASH3P	374666	genome.wustl.edu	37	15	102506815	102506816	+	RNA	DEL	CC	CC	-	rs151176585		TCGA-XU-A92V-01A-11D-A423-09	TCGA-XU-A92V-10A-01D-A426-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	07df341c-dadd-4806-8206-293b966635c8	b9db8a9c-bfe7-4157-81db-2b038358930f	g.chr15:102506815_102506816delCC	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						tacctctccacctggagcgcac	0.421																																							0											0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506815_102506816delCC				RNA	DEL	0	NULL	ENST00000557932.1	37	NULL		15																																																																																			0	0		0.421	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	pseudogene	OTTHUMT00000417608.1	10	0	0	0.00	0	0	CC	NM_199163	rs151176585	ACC->A		102506816	1	no_errors	ENST00000559884	ensembl	human	known	74_37	rna	6	0	40	0.00	4	0	DEL	0.000:0.000	0
