#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MAEL	84944	genome.wustl.edu	37	1	166960676	166960676	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr1:166960676C>T	ENST00000367872.4	+	3	531	c.287C>T	c.(286-288)cCt>cTt	p.P96L	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Missense_Mutation_p.P65L	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	96					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						AATGTTTCACCTCCAGATATG	0.398																																							0											0													154.0	152.0	153.0					1																	166960676		2203	4300	6503	SO:0001583	missense	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.287C>T	1.37:g.166960676C>T	ENSP00000356846:p.Pro96Leu		B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_CH-domain	p.P96L	ENST00000367872.4	37	c.287	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543480	0.27563	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.43688	1.03;0.94;0.95	5.9	2.69	0.31865	Domain of unknown function DUF1898 (1);	0.212573	0.34002	N	0.004341	T	0.07143	0.0181	N	0.04508	-0.205	0.54753	D	0.999986	B;B	0.16166	0.002;0.016	B;B	0.12156	0.004;0.007	T	0.10613	-1.0622	10	0.26408	T	0.33	.	5.9666	0.19328	0.0:0.6508:0.0:0.3492	.	65;96	E9JVC3;Q96JY0	.;MAEL_HUMAN	L	96;65;65	ENSP00000356846:P96L;ENSP00000356844:P65L;ENSP00000402143:P65L	ENSP00000356844:P65L	P	+	2	0	MAEL	165227300	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.917000	0.28665	0.845000	0.35118	-0.150000	0.13652	CCT	0	pfam_HMG_box_dom		0.398	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	protein_coding	OTTHUMT00000083239.1	77	225	0	0.00	0	0	C	NM_032858	0	0		166960676	1	no_errors	ENST00000367872	ensembl	human	known	74_37	missense	119	223	7.03	6.28	9	15	SNP	1	T
HLA-DRB1	3123	genome.wustl.edu	37	6	32557449	32557449	+	Missense_Mutation	SNP	G	G	A	rs187619904		TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr6:32557449G>A	ENST00000360004.5	-	1	176	c.71C>T	c.(70-72)tCc>tTc	p.S24F		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	24					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)		p.S24F(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						AGCCAGTGGGGAGCTCAGCAC	0.572										Multiple Myeloma(14;0.17)																													0											1	Substitution - Missense(1)	skin(1)											75.0	91.0	85.0					6																	32557449		1511	2709	4220	SO:0001583	missense	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.71C>T	6.37:g.32557449G>A	ENSP00000353099:p.Ser24Phe		P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.S24F	ENST00000360004.5	37	c.71	CCDS47409.1	6	27	0.012362637362637362	7	0.014227642276422764	7	0.019337016574585635	6	0.01048951048951049	7	0.009234828496042216	.	5.206	0.223607	0.09863	.	.	ENSG00000196126	ENST00000360004	T	0.00267	8.38	4.4	1.53	0.23141	MHC classes I/II-like antigen recognition protein (1);	.	.	.	.	T	0.00144	0.0004	L	0.58810	1.83	0.09310	N	1	D	0.63880	0.993	P	0.60541	0.876	T	0.28839	-1.0031	9	0.62326	D	0.03	.	3.8678	0.09024	0.2075:0.0:0.6026:0.1899	.	24	P01911	2B1F_HUMAN	F	24	ENSP00000353099:S24F	ENSP00000353099:S24F	S	-	2	0	HLA-DRB1	32665427	0.014000	0.17966	0.085000	0.20634	0.032000	0.12392	2.097000	0.41748	0.479000	0.27511	0.462000	0.41574	TCC	0	superfamily_MHC_I/II-like_Ag-recog		0.572	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	protein_coding	OTTHUMT00000076393.3	62	15	1.59	0.00	1	0	G	NM_002124	rs187619904	G->A		32557449	-1	no_errors	ENST00000360004	ensembl	human	known	74_37	missense	97	8	14.16	33.33	16	4	SNP	0.003	A
TEAD3	7005	genome.wustl.edu	37	6	35444152	35444152	+	Missense_Mutation	SNP	C	C	T	rs201570534	byFrequency	TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr6:35444152C>T	ENST00000402886.3	-	7	626	c.473G>A	c.(472-474)cGt>cAt	p.R158H	TEAD3_ENST00000338863.7_Missense_Mutation_p.R218H			Q99594	TEAD3_HUMAN	TEA domain family member 3	218	Pro-rich.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						GGCAATGGTACGGTCCTGCCA	0.617													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17009	0.001		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0													47.0	60.0	56.0					6																	35444152		2090	4226	6316	SO:0001583	missense	0			X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.473G>A	6.37:g.35444152C>T	ENSP00000384577:p.Arg158His		O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	pfam_TEA/ATTS,pirsf_TEF	p.R158H	ENST00000402886.3	37	c.473		6	3	0.0013736263736263737	0	0.0	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	C	24.1	4.497822	0.85069	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905;ENST00000433586	T;T;T	0.60299	0.27;0.2;0.56	4.94	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.77003	0.4067	H	0.94264	3.515	0.80722	D	1	D;P;D	0.89917	1.0;0.809;1.0	D;B;D	0.97110	0.999;0.159;1.0	D	0.83659	0.0160	10	0.87932	D	0	-21.1067	12.3247	0.55003	0.0:0.9187:0.0:0.0813	.	158;234;218	B5MCM0;Q7Z6V0;Q99594	.;.;TEAD3_HUMAN	H	218;158;234;129	ENSP00000345772:R218H;ENSP00000384577:R158H;ENSP00000416400:R129H	ENSP00000345772:R218H	R	-	2	0	TEAD3	35552130	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.547000	0.82146	1.316000	0.45131	0.561000	0.74099	CGT	0	pfam_TEA/ATTS,pirsf_TEF		0.617	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	TEAD3	protein_coding	OTTHUMT00000316961.2	52	58	1.89	0.00	1	0	C		rs201570534	C->T		35444152	-1	no_errors	ENST00000402886	ensembl	human	novel	74_37	missense	26	40	13.33	4.65	4	2	SNP	1	T
RGS3	5998	genome.wustl.edu	37	9	116226116	116226116	+	Intron	SNP	A	A	G			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr9:116226116A>G	ENST00000374140.2	+	4	624				RGS3_ENST00000317613.6_Missense_Mutation_p.S12G|RGS3_ENST00000350696.5_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CTCCCTCGGGAGCCGGCGTGC	0.697																																							0											0													37.0	38.0	38.0					9																	116226116		2203	4299	6502	SO:0001627	intron_variant	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.415+1635A>G	9.37:g.116226116A>G			A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,smart_C2_dom,smart_PDZ,pfscan_C2_dom,pfscan_PDZ	p.S12G	ENST00000374140.2	37	c.34	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	A	15.91	2.973114	0.53614	.	.	ENSG00000138835	ENST00000317613	T	0.37235	1.21	4.02	4.02	0.46733	.	.	.	.	.	T	0.20740	0.0499	.	.	.	0.80722	D	1	B	0.28291	0.206	B	0.22601	0.04	T	0.05386	-1.0888	8	0.15499	T	0.54	.	9.5562	0.39339	1.0:0.0:0.0:0.0	.	12	P49796-5	.	G	12	ENSP00000312844:S12G	ENSP00000312844:S12G	S	+	1	0	RGS3	115265937	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.930000	0.40124	1.831000	0.53308	0.248000	0.18094	AGC	0	NULL		0.697	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	protein_coding	OTTHUMT00000055561.3	33	67	0	1.47	0	1	A	NM_017790	0	0		116226116	1	no_errors	ENST00000317613	ensembl	human	known	74_37	missense	39	45	9.3	13.46	4	7	SNP	1	G
KCNC1	3746	genome.wustl.edu	37	11	17794040	17794040	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr11:17794040G>A	ENST00000379472.3	+	2	1429	c.1399G>A	c.(1399-1401)Gga>Aga	p.G467R	KCNC1_ENST00000265969.6_Missense_Mutation_p.G467R	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	467					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	ACCGCAGCTGGGATCTCCCAA	0.443																																							0											0													52.0	59.0	57.0					11																	17794040		2200	4293	6493	SO:0001583	missense	0			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1399G>A	11.37:g.17794040G>A	ENSP00000368785:p.Gly467Arg		K4DI87	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.G467R	ENST00000379472.3	37	c.1399	CCDS7827.1	11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058289	0.76074	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.96992	-4.2;-4.18	5.24	5.24	0.73138	.	0.231069	0.29459	N	0.012082	D	0.97835	0.9289	M	0.69823	2.125	0.80722	D	1	B;D	0.89917	0.228;1.0	B;D	0.80764	0.133;0.994	D	0.97965	1.0340	10	0.48119	T	0.1	.	18.8513	0.92232	0.0:0.0:1.0:0.0	.	467;467	Q3KNS8;P48547	.;KCNC1_HUMAN	R	467	ENSP00000265969:G467R;ENSP00000368785:G467R	ENSP00000265969:G467R	G	+	1	0	KCNC1	17750616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.445000	0.82738	0.561000	0.74099	GGA	0	NULL		0.443	KCNC1-001	KNOWN	basic|CCDS	protein_coding	KCNC1	protein_coding	OTTHUMT00000389389.1	29	165	0	0.60	0	1	G	NM_004976	0	0		17794040	1	no_errors	ENST00000265969	ensembl	human	known	74_37	missense	31	157	13.89	4.27	5	7	SNP	1	A
LMO7	4008	genome.wustl.edu	37	13	76335145	76335145	+	Silent	SNP	A	A	G	rs369873212|rs559563276	byFrequency	TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr13:76335145A>G	ENST00000341547.4	+	5	1704	c.444A>G	c.(442-444)ctA>ctG	p.L148L	LMO7_ENST00000357063.3_Silent_p.L148L|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000377534.3_Silent_p.L148L|LMO7_ENST00000321797.8_5'UTR|LMO7_ENST00000465261.2_5'UTR|LMO7_ENST00000526202.1_Silent_p.L57L	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	148	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CTGGAGATCTACAGGATTTAT	0.333																																							0											0													68.0	67.0	68.0					13																	76335145		2203	4300	6503	SO:0001819	synonymous_variant	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.444A>G	13.37:g.76335145A>G			E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Silent	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.L148	ENST00000341547.4	37	c.444	CCDS9454.1	13																																																																																			0	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,prints_SM22_calponin		0.333	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO7	protein_coding	OTTHUMT00000045297.1	32	166	0	0.60	0	1	A	NM_005358	0	0		76335145	1	no_errors	ENST00000357063	ensembl	human	known	74_37	silent	41	203	8.89	7.73	4	17	SNP	0.99	G
SPTBN5	51332	genome.wustl.edu	37	15	42167711	42167711	+	Missense_Mutation	SNP	C	C	T	rs181128984		TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr15:42167711C>T	ENST00000320955.6	-	22	4459	c.4232G>A	c.(4231-4233)cGt>cAt	p.R1411H		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1411					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTCGTCCCCACGCTCAGTCAT	0.607																																							0.9998,0.0001997,.											0								C	HIS/ARG	0,4270		0,0,2135	48.0	51.0	50.0		4127	-6.0	0.0	15		50	4,8464		0,4,4230	yes	missense	SPTBN5	NM_016642.2	29	0,4,6365	TT,TC,CC		0.0472,0.0,0.0314	benign	1376/3640	42167711	4,12734	2135	4234	6369	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4232G>A	15.37:g.42167711C>T	ENSP00000317790:p.Arg1411His			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1411H	ENST00000320955.6	37	c.4232		15	.	.	.	.	.	.	.	.	.	.	.	12.28	1.891790	0.33442	0.0	4.72E-4	ENSG00000137877	ENST00000320955	T	0.61392	0.11	5.48	-6.03	0.02185	.	0.699488	0.13256	N	0.401718	T	0.36826	0.0981	L	0.38175	1.15	0.09310	N	1	B	0.26081	0.141	B	0.22880	0.042	T	0.12319	-1.0552	10	0.41790	T	0.15	.	5.9202	0.19078	0.1893:0.3932:0.0:0.4175	.	1411	Q9NRC6	SPTN5_HUMAN	H	1411	ENSP00000317790:R1411H	ENSP00000317790:R1411H	R	-	2	0	SPTBN5	39955003	0.006000	0.16342	0.000000	0.03702	0.007000	0.05969	0.105000	0.15333	-1.303000	0.02332	-0.779000	0.03376	CGT	0	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.607	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	protein_coding	OTTHUMT00000420237.1	32	101	0	0.00	0	0	C	NM_016642	rs181128984	C->A,T		42167711	-1	no_errors	ENST00000320955	ensembl	human	known	74_37	missense	22	89	18.52	5.32	5	5	SNP	0.006	T
TEFM	79736	genome.wustl.edu	37	17	29226104	29226104	+	3'UTR	SNP	C	C	A			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr17:29226104C>A	ENST00000581216.1	-	0	1787				TEFM_ENST00000580840.1_3'UTR|TEFM_ENST00000579183.1_5'UTR	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial						DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										AAAATGTGTTCTTTTCCAATA	0.313																																							0											0																																										SO:0001624	3_prime_UTR_variant	0				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.*83G>T	17.37:g.29226104C>A			E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	RNA	SNP	0	NULL	ENST00000581216.1	37	NULL	CCDS42291.1	17																																																																																			0	0		0.313	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEFM	protein_coding	OTTHUMT00000444498.1	57	287	0	0.69	0	2	C	NM_024683	0	0		29226104	-1	no_errors	ENST00000579183	ensembl	human	putative	74_37	rna	63	302	8.7	7.36	6	24	SNP	0.371	A
PREX1	57580	genome.wustl.edu	37	20	47324938	47324938	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr20:47324938C>T	ENST00000371941.3	-	6	665	c.643G>A	c.(643-645)Ggc>Agc	p.G215S	PREX1_ENST00000396220.1_Missense_Mutation_p.G215S	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	215	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G215S(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGGTGCTTGCCGGGAGTCCTC	0.577																																							0											2	Substitution - Missense(2)	large_intestine(2)											102.0	112.0	108.0					20																	47324938		2203	4300	6503	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.643G>A	20.37:g.47324938C>T	ENSP00000361009:p.Gly215Ser		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G215S	ENST00000371941.3	37	c.643	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433195	0.25813	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.61392	0.11;0.11	5.64	4.69	0.59074	Dbl homology (DH) domain (5);	0.403999	0.19623	U	0.109876	T	0.25827	0.0629	N	0.03948	-0.315	0.09310	N	1	B	0.27416	0.178	B	0.19391	0.025	T	0.18023	-1.0350	10	0.09843	T	0.71	.	5.259	0.15563	0.3277:0.5297:0.0:0.1426	.	215	Q8TCU6	PREX1_HUMAN	S	215	ENSP00000361009:G215S;ENSP00000379522:G215S	ENSP00000361009:G215S	G	-	1	0	PREX1	46758345	0.951000	0.32395	0.749000	0.31150	0.976000	0.68499	3.748000	0.55142	1.359000	0.45940	0.655000	0.94253	GGC	0	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.577	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	protein_coding	OTTHUMT00000079623.1	57	180	0	0.55	0	1	C	NM_020820	0	0		47324938	-1	no_errors	ENST00000371941	ensembl	human	known	74_37	missense	48	141	7.69	11.88	4	19	SNP	0.081	T
MT-ND6	4541	genome.wustl.edu	37	M	14561	14561	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chrM:14561A>G	ENST00000361681.2	-	1	112	c.113T>C	c.(112-114)gTc>gCc	p.V38A	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	38					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TAACACACCCGACCACACCGC	0.383																																							0											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.113T>C	M.37:g.14561A>G	ENSP00000354665:p.Val38Ala		Q34774|Q8HG30	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	p.V38A	ENST00000361681.2	37	c.113		MT																																																																																			0	pfam_NADH_UbQ/plastoQ_OxRdtase_su6		0.383	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	protein_coding		145	0	0	0.00	0	0	A	YP_003024037	0	0		14561	-1	no_errors	ENST00000361681	ensembl	human	known	74_37	missense	518	0	34.63	0.00	275	0	SNP	NULL	G
KRT8P47	644743	genome.wustl.edu	37	1	44569968	44569968	+	lincRNA	SNP	T	T	G			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr1:44569968T>G	ENST00000434244.1	+	0	1965																											GTCTCCAGCTTCAGCTTCTCC	0.542																																							0											0																																												0																															1.37:g.44569968T>G				RNA	SNP	0	NULL	ENST00000434244.1	37	NULL		1																																																																																			0	0		0.542	RP5-1198O20.4-001	KNOWN	basic	lincRNA	ENSG00000230615	lincRNA	OTTHUMT00000022875.2	19	0	0	0.00	0	0	T		0	0		44569968	1	no_errors	ENST00000434244	ensembl	human	known	74_37	rna	16	0	27.27	0.00	6	0	SNP	0.999	G
KRT8P47	644743	genome.wustl.edu	37	1	44569970	44569970	+	lincRNA	SNP	A	A	C	rs71587039		TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr1:44569970A>C	ENST00000434244.1	+	0	1967																											CTCCAGCTTCAGCTTCTCCTG	0.547																																							0											0																																												0																															1.37:g.44569970A>C				RNA	SNP	0	NULL	ENST00000434244.1	37	NULL		1																																																																																			0	0		0.547	RP5-1198O20.4-001	KNOWN	basic	lincRNA	ENSG00000230615	lincRNA	OTTHUMT00000022875.2	19	0	5	0.00	1	0	A		0	0		44569970	1	no_errors	ENST00000434244	ensembl	human	known	74_37	rna	16	0	30.43	0.00	7	0	SNP	1	C
BCAS3	54828	genome.wustl.edu	37	17	59147477	59147477	+	Intron	SNP	C	C	T			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr17:59147477C>T	ENST00000390652.5	+	21	2105				RP11-264B14.1_ENST00000588604.1_RNA|BCAS3_ENST00000588462.1_Intron|BCAS3_ENST00000588874.1_Intron|BCAS3_ENST00000407086.3_Intron|RP11-264B14.2_ENST00000593107.1_RNA|BCAS3_ENST00000408905.3_Intron|BCAS3_ENST00000589222.1_Intron|BCAS3_ENST00000585744.1_Intron	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTCCGCTGACCACTGAGTCTG	0.483																																							0											0													50.0	51.0	51.0					17																	59147477		2201	4295	6496	SO:0001627	intron_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2075-4804C>T	17.37:g.59147477C>T				RNA	SNP	0	NULL	ENST00000390652.5	37	NULL	CCDS45749.1	17																																																																																			0	0		0.483	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000267207	protein_coding	OTTHUMT00000449578.1	42	0	0	0.00	0	0	C	NM_017679	0	0		59147477	-1	no_errors	ENST00000588604	ensembl	human	known	74_37	rna	65	0	10.96	0.00	8	0	SNP	0.999	T
HELZ2	85441	genome.wustl.edu	37	20	62203346	62203346	+	Intron	SNP	G	G	A	rs112287941		TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr20:62203346G>A	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGGGAGCCTCTGGCTC	0.657																																							0											0																																										SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+114C>T	20.37:g.62203346G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	0	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			0	0		0.657	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	35	0	0	0.00	0	0	G	NM_001037335	rs112287941	G->A		62203346	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	22	0	24.14	0.00	7	0	SNP	0.993	A
CLIC4	25932	genome.wustl.edu	37	1	25071991	25071993	+	5'UTR	DEL	AGC	AGC	-			TCGA-XU-A92W-01A-11D-A423-09	TCGA-XU-A92W-10A-01D-A426-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93954a05-70ea-4052-b371-fc776ad333ac	03b1356e-1a3a-4067-8090-4e9a23e88a0d	g.chr1:25071991_25071993delAGC	ENST00000374379.4	+	0	144_146				CLIC4_ENST00000497755.1_3'UTR	NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4						angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		CCGGagcagaagcagcagcagca	0.695																																							0											0										164,3744		15,134,1805						-6.3	0.0			8	278,7318		27,224,3547	no	utr-5	CLIC4	NM_013943.2		42,358,5352	A1A1,A1R,RR		3.6598,4.1965,3.8421				442,11062				SO:0001623	5_prime_UTR_variant	0			AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.-52AGC>-	1.37:g.25072000_25072002delAGC			Q9UFW9|Q9UQJ6	RNA	DEL	0	NULL	ENST00000374379.4	37	NULL	CCDS256.1	1																																																																																			0	0		0.695	CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC4	protein_coding	OTTHUMT00000009332.1	21	6	0	0.00	0	0	AGC	NM_013943	0	0		25071993	1	no_errors	ENST00000489758	ensembl	human	known	74_37	rna	27	5	12.9	0.00	4	0	DEL	0.000:0.001:0.001	0
