#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
CROCCP3	114819	genome.wustl.edu	37	1	16812113	16812113	+	RNA	SNP	G	G	A	rs200988154	byFrequency	TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr1:16812113G>A	ENST00000263511.4	-	0	1438					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											ATCCTTCTCCGGATTCTGCTT	0.607																																							0											0																																												0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16812113G>A			Q96PW6	RNA	SNP	0	NULL	ENST00000263511.4	37	NULL		1																																																																																			0	0		0.607	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	pseudogene	OTTHUMT00000458172.1	58	29	0	0.00	0	0	G	XM_057040	rs200988154	G->A		16812113	-1	no_errors	ENST00000263511	ensembl	human	known	74_37	rna	31	35	11.43	5.41	4	2	SNP	0.004	A
MED6	10001	genome.wustl.edu	37	14	71051621	71051621	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr14:71051621G>A	ENST00000256379.5	-	8	679	c.650C>T	c.(649-651)aCt>aTt	p.T217I	MED6_ENST00000554963.1_Missense_Mutation_p.T217I|MED6_ENST00000430055.2_Missense_Mutation_p.T224I|MED6_ENST00000440435.2_Silent_p.N178N	NM_001284209.1|NM_005466.2	NP_001271138.1|NP_005457.2	O75586	MED6_HUMAN	mediator complex subunit 6	217					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(2)|skin(1)	5				all cancers(60;0.00315)|BRCA - Breast invasive adenocarcinoma(234;0.00685)|OV - Ovarian serous cystadenocarcinoma(108;0.0352)		AGGTTTTACAGTTTCTGGTAT	0.438																																							0											0													227.0	192.0	204.0					14																	71051621		2203	4300	6503	SO:0001583	missense	0			BC004106	CCDS9805.1, CCDS61483.1, CCDS61484.1, CCDS73649.1	14q24.1	2013-02-28	2007-07-30		ENSG00000133997	ENSG00000133997			19970	protein-coding gene	gene with protein product		602984	"""mediator of RNA polymerase II transcription, subunit 6 homolog (S. cerevisiae)"""			9234719, 9671713	Standard	NM_001284209		Approved	NY-REN-28	uc001xmf.3	O75586	OTTHUMG00000171252	ENST00000256379.5:c.650C>T	14.37:g.71051621G>A	ENSP00000256379:p.Thr217Ile		B4DU17|B4E2P0|O15401|Q53FE3|Q53HJ3|Q6FHQ4|Q9BTH1|Q9UHL1	Missense_Mutation	SNP	pfam_Mediator_Med6,pirsf_Mediator_Med6_met/pln	p.T217I	ENST00000256379.5	37	c.650	CCDS9805.1	14	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754726	0.49362	.	.	ENSG00000133997	ENST00000554963;ENST00000256379;ENST00000430055	.	.	.	5.75	5.75	0.90469	.	0.366078	0.34777	N	0.003692	T	0.54806	0.1881	L	0.34521	1.04	0.80722	D	1	B;B	0.16396	0.017;0.005	B;B	0.11329	0.006;0.004	T	0.46992	-0.9151	9	0.40728	T	0.16	-8.424	18.7148	0.91671	0.0:0.0:1.0:0.0	.	224;217	B4DU17;O75586	.;MED6_HUMAN	I	217;217;224	.	ENSP00000256379:T217I	T	-	2	0	MED6	70121374	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	4.699000	0.61796	2.716000	0.92895	0.655000	0.94253	ACT	0	pirsf_Mediator_Med6_met/pln		0.438	MED6-001	KNOWN	basic|CCDS	protein_coding	MED6	protein_coding	OTTHUMT00000412560.2	91	258	0	0.38	0	1	G	NM_005466	0	0		71051621	-1	no_errors	ENST00000256379	ensembl	human	known	74_37	missense	89	333	12.75	8.22	13	30	SNP	0.999	A
STARD5	80765	genome.wustl.edu	37	15	81614806	81614806	+	Silent	SNP	T	T	C			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr15:81614806T>C	ENST00000302824.6	-	3	250	c.225A>G	c.(223-225)ctA>ctG	p.L75L	STARD5_ENST00000559913.1_5'UTR|RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA	NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	75	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						ACTTCACTCGTAGGCCTCCAA	0.483																																							0											0													173.0	136.0	149.0					15																	81614806		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.225A>G	15.37:g.81614806T>C			P59094	Missense_Mutation	SNP	NULL	p.T59A	ENST00000302824.6	37	c.175	CCDS10318.1	15	.	.	.	.	.	.	.	.	.	.	T	4.124	0.021205	0.08006	.	.	ENSG00000172345	ENST00000325346	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.45955	0.1368	.	.	.	0.50467	D	0.999874	.	.	.	.	.	.	T	0.62210	-0.6902	5	0.66056	D	0.02	-8.936	0.4188	0.00453	0.3385:0.1663:0.2466:0.2486	.	.	.	.	A	59	.	ENSP00000317519:T59A	T	-	1	0	STARD5	79401861	0.000000	0.05858	0.002000	0.10522	0.521000	0.34408	-3.787000	0.00366	-3.605000	0.00133	-0.182000	0.12963	ACG	0	NULL		0.483	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD5	protein_coding	OTTHUMT00000303950.2	46	229	0	0.00	0	0	T		0	0		81614806	-1	no_errors	ENST00000325346	ensembl	human	known	74_37	missense	32	228	31.91	20.28	15	58	SNP	0.001	C
ZNF790	388536	genome.wustl.edu	37	19	37310854	37310854	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr19:37310854T>C	ENST00000356725.4	-	5	512	c.392A>G	c.(391-393)cAa>cGa	p.Q131R	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TTGATTATCTTGAAGTGTTTG	0.388																																							0											0													136.0	131.0	132.0					19																	37310854		2203	4300	6503	SO:0001583	missense	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.392A>G	19.37:g.37310854T>C	ENSP00000349161:p.Gln131Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q131R	ENST00000356725.4	37	c.392	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	T	9.572	1.121381	0.20877	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288	T;T;T	0.05580	3.42;6.28;5.87	3.19	0.94	0.19513	.	.	.	.	.	T	0.06416	0.0165	L	0.56769	1.78	0.09310	N	1	B	0.26002	0.139	B	0.19666	0.026	T	0.37430	-0.9706	9	0.34782	T	0.22	.	3.74	0.08526	0.1883:0.1124:0.0:0.6993	.	131	Q6PG37	ZN790_HUMAN	R	131	ENSP00000349161:Q131R;ENSP00000435944:Q131R;ENSP00000433389:Q131R	ENSP00000349161:Q131R	Q	-	2	0	ZNF790	42002694	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	0.000000	0.12993	-0.002000	0.14469	-0.535000	0.04281	CAA	0	NULL		0.388	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	protein_coding	OTTHUMT00000385341.2	62	208	0	0.00	0	0	T	NM_206894	0	0		37310854	-1	no_errors	ENST00000356725	ensembl	human	known	74_37	missense	48	253	20	19.30	12	61	SNP	0.004	C
OTOP1	133060	genome.wustl.edu	37	4	4228358	4228360	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	CAG	CAG	CAG	-	CAG	CAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr4:4228358_4228360delCAG	ENST00000296358.4	-	1	256_258	c.232_234delCTG	c.(232-234)ctgdel	p.L78del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	78					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CGGCCCAGGCCAGCAGCAGCAGC	0.685																																							0											0																																										SO:0001651	inframe_deletion	0			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.232_234delCTG	4.37:g.4228367_4228369delCAG	ENSP00000296358:p.Leu78del		A1L476	In_Frame_Del	DEL	pfam_Otopetrin	p.L78in_frame_del	ENST00000296358.4	37	c.234_232	CCDS3372.1	4																																																																																			0	NULL		0.685	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	13	23	0	0.00	0	0	CAG	NM_177998	0	0		4228360	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	in_frame_del	10	19	23.08	9.52	3	2	DEL	1.000:1.000:0.999	0
SREBF2	6721	genome.wustl.edu	37	22	42262949	42262951	+	In_Frame_Del	DEL	GCA	GCA	-	rs143615881		TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	GCA	GCA	GCA	-	GCA	GCA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr22:42262949_42262951delGCA	ENST00000361204.4	+	2	369_371	c.203_205delGCA	c.(202-207)ggcagc>ggc	p.S74del		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	74	Gly/Pro/Ser-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ggcagcagtggcagcagcagcag	0.567																																							0											0																																										SO:0001651	inframe_deletion	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.203_205delGCA	22.37:g.42262958_42262960delGCA	ENSP00000354476:p.Ser74del		Q05BD5|Q6GTH7|Q86V36|Q9UH04	In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S72in_frame_del	ENST00000361204.4	37	c.203_205	CCDS14023.1	22																																																																																			0	NULL		0.567	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	68	101	1.45	1.94	1	2	GCA	NM_004599	rs143615881	GGCA->G		42262951	1	no_errors	ENST00000361204	ensembl	human	known	74_37	in_frame_del	32	84	11.11	5.62	4	5	DEL	0.037:0.043:0.048	0
PCDHB10	56126	genome.wustl.edu	37	5	140574260	140574260	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr5:140574260C>T	ENST00000239446.4	+	1	2319	c.2135C>T	c.(2134-2136)gCg>gTg	p.A712V		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	712					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTGGCGGTGCGGCTG	0.692																																							0											0													39.0	49.0	46.0					5																	140574260		2081	4055	6136	SO:0001583	missense	0			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2135C>T	5.37:g.140574260C>T	ENSP00000239446:p.Ala712Val		Q96T99	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A712V	ENST00000239446.4	37	c.2135	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	c	16.09	3.025734	0.54683	.	.	ENSG00000120324	ENST00000239446	T	0.15603	2.41	3.18	1.2	0.21068	.	.	.	.	.	T	0.26629	0.0651	M	0.91768	3.24	0.09310	N	1	P	0.48162	0.906	B	0.40506	0.331	T	0.19418	-1.0306	9	0.44086	T	0.13	.	8.9805	0.35961	0.0:0.5249:0.4751:0.0	.	712	Q9UN67	PCDBA_HUMAN	V	712	ENSP00000239446:A712V	ENSP00000239446:A712V	A	+	2	0	PCDHB10	140554444	0.000000	0.05858	0.854000	0.33618	0.880000	0.50808	-2.879000	0.00716	0.149000	0.19098	0.298000	0.19748	GCG	0	NULL		0.692	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	protein_coding	OTTHUMT00000251821.1	67	4	0	0.00	0	0	C	NM_018930	0	0		140574260	1	no_errors	ENST00000239446	ensembl	human	known	74_37	missense	26	2	7.14	0.00	2	0	SNP	0.001	T
GOLGA8DP	100132979	genome.wustl.edu	37	15	22707272	22707272	+	RNA	SNP	G	G	T	rs112081409		TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr15:22707272G>T	ENST00000314246.8	-	0	1489				AC116165.1_ENST00000408073.1_RNA|RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											GCAGCTTCCAGACGCTCCTAA	0.637																																							0											0																																												0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22707272G>T				RNA	SNP	0	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	3.695	-0.062709	0.07273	.	.	ENSG00000185182	ENST00000341390;ENST00000314246;ENST00000317692	.	.	.	0.972	0.972	0.19704	.	.	.	.	.	T	0.19805	0.0476	.	.	.	0.38089	D	0.936913	P	0.42620	0.785	B	0.34931	0.192	T	0.17137	-1.0379	6	0.38643	T	0.18	.	5.3436	0.15996	0.0:0.0:1.0:0.0	.	198	F8WBT8	.	M	198;198;416	.	ENSP00000327024:L198M	L	-	1	2	AC116165.1	20258636	0.241000	0.23857	0.018000	0.16275	0.004000	0.04260	1.176000	0.31957	0.835000	0.34877	0.298000	0.19748	CTG	0	0		0.637	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	pseudogene	OTTHUMT00000415613.1	25	0	3.85	0.00	1	0	G	NR_027407	rs112081409	G->T		22707272	-1	no_errors	ENST00000314246	ensembl	human	known	74_37	rna	8	0	38.46	0.00	5	0	SNP	0.817	T
HMGB3	3149	genome.wustl.edu	37	X	150156358	150156360	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chrX:150156358_150156360delGAG	ENST00000325307.7	+	5	670_672	c.574_576delGAG	c.(574-576)gagdel	p.E198del	HMGB3_ENST00000448905.2_In_Frame_Del_p.E198del	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	198	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					ggaggaagaagaggaggaggagg	0.443																																							0											1	Substitution - coding silent(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	0			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.574_576delGAG	X.37:g.150156367_150156369delGAG	ENSP00000359393:p.Glu198del		O95556|Q6NS40	In_Frame_Del	DEL	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E195in_frame_del	ENST00000325307.7	37	c.574_576	CCDS35428.1	X																																																																																			0	NULL		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	protein_coding	OTTHUMT00000060867.1	34	0	0	0.00	0	0	GAG	NM_005342	0	0		150156360	1	no_errors	ENST00000325307	ensembl	human	known	74_37	in_frame_del	24	0	14.29	0.00	4	0	DEL	0.987:0.994:0.985	0
ORC4	5000	genome.wustl.edu	37	2	148779051	148779053	+	5'UTR	DEL	TGC	TGC	-			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr2:148779051_148779053delTGC	ENST00000264169.2	-	0	94_96				ORC4_ENST00000540442.1_5'Flank|ORC4_ENST00000535373.1_5'Flank|ORC4_ENST00000392857.5_5'Flank|ORC4_ENST00000536575.1_5'Flank|ORC4_ENST00000392858.1_5'Flank|ORC4_ENST00000542387.1_5'Flank|MBD5_ENST00000407073.1_Intron	NM_181742.3	NP_859526.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						ctgctgctgttgctgctgctgct	0.581																																							0											0																																										SO:0001623	5_prime_UTR_variant	0			AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000264169.2:c.-54GCA>-	2.37:g.148779060_148779062delTGC			B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	RNA	DEL	0	NULL	ENST00000264169.2	37	NULL	CCDS2187.1	2																																																																																			0	0		0.581	ORC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	protein_coding	OTTHUMT00000254797.3	41	15	0	0.00	0	0	TGC	NM_181742	0	0		148779053	1	no_errors	ENST00000470063	ensembl	human	known	74_37	rna	9	10	18.18	0.00	2	0	DEL	0.968:0.972:0.990	0
ZCCHC14	23174	genome.wustl.edu	37	16	87525314	87525314	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XU-A92X-01A-11D-A423-09	TCGA-XU-A92X-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1e5acf5d-6f68-4e84-8923-a52f96b012f5	5c05e9c1-352f-4b60-9ea7-05d483f3a571	g.chr16:87525314delC	ENST00000268616.4	-	1	337	c.120delG	c.(118-120)gggfs	p.G40fs	RP11-482M8.1_ENST00000565824.1_lincRNA	NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	40							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		cgccgcccggcccgggcgcgc	0.716																																							0											0													4.0	5.0	4.0					16																	87525314		1970	3789	5759	SO:0001589	frameshift_variant	0			AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.120delG	16.37:g.87525314delC	ENSP00000268616:p.Gly40fs		D3DUN1|O60324|Q3MJD8|Q9UFP0	Frame_Shift_Del	DEL	pfam_SAM_type1,pfam_Znf_CCHC,superfamily_Phox,superfamily_SAM/pointed,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.P41fs	ENST00000268616.4	37	c.120	CCDS10961.1	16																																																																																			0	NULL		0.716	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC14	protein_coding	OTTHUMT00000269107.1	58	7	0	0.00	0	0	C	NM_015144	0	0		87525314	-1	no_errors	ENST00000268616	ensembl	human	known	74_37	frame_shift_del	18	6	10	0.00	2	0	DEL	0.589	0
