#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MT-ND4L	4539	genome.wustl.edu	37	M	10644	10644	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chrM:10644G>A	ENST00000361335.1	+	1	175	c.175G>A	c.(175-177)Gtg>Atg	p.V59M	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	59					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						TAGCCAATATTGTGCCTATTG	0.468																																							0											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.175G>A	M.37:g.10644G>A	ENSP00000354728:p.Val59Met			Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_chain4L/K	p.V59M	ENST00000361335.1	37	c.175		MT																																																																																			0	pfam_NADH_UbQ_OxRdtase_chain4L/K		0.468	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	MT-ND4L	protein_coding		22	3	0	0.00	0	0	G	YP_003024034	0	0		10644	1	no_errors	ENST00000361335	ensembl	human	known	74_37	missense	0	0	100	100.00	9	4	SNP	NULL	A
SRPX2	27286	genome.wustl.edu	37	X	99925838	99925838	+	Missense_Mutation	SNP	A	A	C			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chrX:99925838A>C	ENST00000373004.3	+	11	1680	c.1252A>C	c.(1252-1254)Atg>Ctg	p.M418L	RP11-524D16__A.3_ENST00000568809.1_RNA	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	418					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						CTACTTCAACATGGTGTTGAT	0.517											OREG0019890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											0											0													166.0	129.0	142.0					X																	99925838		2203	4300	6503	SO:0001583	missense	0			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.1252A>C	X.37:g.99925838A>C	ENSP00000362095:p.Met418Leu	1347	B3KQT3|Q8WW85	Missense_Mutation	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,superfamily_Thioredoxin-like_fold,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.M418L	ENST00000373004.3	37	c.1252	CCDS14471.1	X	.	.	.	.	.	.	.	.	.	.	A	16.12	3.034369	0.54896	.	.	ENSG00000102359	ENST00000373004	T	0.40225	1.04	5.09	5.09	0.68999	.	0.037222	0.85682	D	0.000000	T	0.33059	0.0850	L	0.42529	1.33	0.49798	D	0.999821	B	0.18166	0.026	B	0.21917	0.037	T	0.12941	-1.0528	9	.	.	.	-15.3838	8.8108	0.34965	0.9039:0.0:0.0961:0.0	.	418	O60687	SRPX2_HUMAN	L	418	ENSP00000362095:M418L	.	M	+	1	0	SRPX2	99812494	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.657000	0.54474	1.885000	0.54596	0.425000	0.28330	ATG	0	superfamily_Thioredoxin-like_fold		0.517	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	protein_coding	OTTHUMT00000057486.1	29	137	0	0.00	0	0	A	NM_014467	0	0		99925838	1	no_errors	ENST00000373004	ensembl	human	known	74_37	missense	30	81	31.82	27.68	14	31	SNP	1	C
LRRC7	57554	genome.wustl.edu	37	1	70385045	70385045	+	Intron	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:70385045G>A	ENST00000035383.5	+	6	563				PIN1P1_ENST00000412108.1_RNA|LRRC7_ENST00000310961.5_Intron|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GAAAGATGGCGGACGAGGAGA	0.488																																							0											0																																										SO:0001627	intron_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-12145G>A	1.37:g.70385045G>A			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	0	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			0	0		0.488	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	protein_coding	OTTHUMT00000131261.1	39	91	0	0.00	0	0	G	NM_020794	0	0		70385045	1	no_errors	ENST00000412108	ensembl	human	known	74_37	rna	42	53	14.29	11.67	7	7	SNP	0.995	A
DNM3	26052	genome.wustl.edu	37	1	171956945	171956945	+	Splice_Site	SNP	G	G	A	rs371617456		TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:171956945G>A	ENST00000355305.5	+	3	542	c.385G>A	c.(385-387)Gtg>Atg	p.V129M	DNM3_ENST00000520906.1_Splice_Site_p.V129M|DNM3_ENST00000367733.2_Splice_Site_p.V129M|DNM3_ENST00000358155.4_Splice_Site_p.V129M|DNM3_ENST00000367731.1_Splice_Site_p.V129M			Q9UQ16	DYN3_HUMAN	dynamin 3	129	Dynamin-type G.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V129M(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TTCCCCACACGGTAAGTAAAA	0.348																																							0											1	Substitution - Missense(1)	kidney(1)						G	MET/VAL,MET/VAL	0,3650		0,0,1825	96.0	101.0	99.0		385,385	5.3	1.0	1		99	1,8153		0,1,4076	no	missense-near-splice,missense-near-splice	DNM3	NM_001136127.1,NM_015569.3	21,21	0,1,5901	AA,AG,GG		0.0123,0.0,0.0085	probably-damaging,probably-damaging	129/860,129/864	171956945	1,11803	1825	4077	5902	SO:0001630	splice_region_variant	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.385+1G>A	1.37:g.171956945G>A			A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.V129M	ENST00000355305.5	37	c.385		1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535248	0.85812	0.0	1.23E-4	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	5.27	5.27	0.74061	.	0.057000	0.64402	D	0.000001	D	0.98738	0.9576	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	0.99;1.0;0.999;1.0	P;D;D;D	0.71414	0.883;0.925;0.914;0.973	D	0.99679	1.0998	10	0.72032	D	0.01	.	17.4722	0.87649	0.0:0.0:1.0:0.0	.	129;129;129;129	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	M	129;129;129;129;129;129;19	ENSP00000350876:V129M;ENSP00000356707:V129M;ENSP00000347457:V129M;ENSP00000356705:V129M;ENSP00000429701:V129M;ENSP00000429416:V19M	ENSP00000347457:V129M	V	+	1	0	DNM3	170223568	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.731000	0.98807	2.455000	0.83008	0.655000	0.94253	GTG	0	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF		0.348	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	protein_coding	OTTHUMT00000084531.1	22	297	0	0.00	0	0	G	NM_015569	rs371617456	G->A	Missense_Mutation	171956945	1	no_errors	ENST00000358155	ensembl	human	known	74_37	missense	66	341	15.38	10.70	12	41	SNP	1	A
PPP1R12B	4660	genome.wustl.edu	37	1	202464470	202464470	+	Missense_Mutation	SNP	C	C	T	rs143792888		TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:202464470C>T	ENST00000608999.1	+	16	2348	c.2195C>T	c.(2194-2196)aCg>aTg	p.T732M	PPP1R12B_ENST00000336894.4_Missense_Mutation_p.T732M|PPP1R12B_ENST00000290419.5_3'UTR|PPP1R12B_ENST00000391959.3_5'UTR|PPP1R12B_ENST00000367270.4_5'UTR	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	732					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			AAACCCACCACGCCAGCATCT	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		13898	0.0		0.0	False		,,,				2504	0.001						0.9998,0.0001997											0								C	MET/THR,,	7,4399	12.9+/-30.5	0,7,2196	130.0	128.0	129.0		2195,,	3.8	0.0	1	dbSNP_134	129	0,8600		0,0,4300	no	missense,utr-5,utr-5	PPP1R12B	NM_002481.3,NM_032103.2,NM_032104.2	81,,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	possibly-damaging,,	732/983,,	202464470	7,12999	2203	4300	6503	SO:0001583	missense	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.2195C>T	1.37:g.202464470C>T	ENSP00000476755:p.Thr732Met		A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T732M	ENST00000608999.1	37	c.2195	CCDS1426.1	1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466431	0.43839	0.001589	0.0	ENSG00000077157	ENST00000406302;ENST00000336894	T;T	0.03094	4.05;4.05	5.76	3.84	0.44239	.	0.644862	0.15087	N	0.281335	T	0.07503	0.0189	L	0.50333	1.59	0.37025	D	0.896408	P;P	0.49307	0.814;0.922	B;P	0.50440	0.265;0.641	T	0.35549	-0.9784	10	0.41790	T	0.15	.	9.2996	0.37838	0.1471:0.7748:0.0:0.0781	.	732;732	O60237;F8W8M3	MYPT2_HUMAN;.	M	732	ENSP00000384496:T732M;ENSP00000337897:T732M	ENSP00000337897:T732M	T	+	2	0	PPP1R12B	200731093	0.016000	0.18221	0.029000	0.17559	0.689000	0.40095	1.203000	0.32284	1.548000	0.49413	0.650000	0.86243	ACG	0	pirsf_Pase-1_reg_su_12A/B/C_euk		0.468	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	protein_coding	OTTHUMT00000099166.3	174	195	0	0.51	0	1	C	NM_032105	rs143792888	C->T		202464470	1	no_errors	ENST00000336894	ensembl	human	known	74_37	missense	344	220	10.65	7.17	41	17	SNP	0.331	T
OR2T2	401992	genome.wustl.edu	37	1	248616514	248616514	+	Missense_Mutation	SNP	G	G	T	rs201885657		TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:248616514G>T	ENST00000342927.3	+	1	438	c.416G>T	c.(415-417)cGc>cTc	p.R139L		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCATGAACCGCAGGGTTTGC	0.542																																							0											0													46.0	53.0	51.0					1																	248616514		2202	4280	6482	SO:0001583	missense	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.416G>T	1.37:g.248616514G>T	ENSP00000343062:p.Arg139Leu		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R139L	ENST00000342927.3	37	c.416	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	g	3.469	-0.108314	0.06924	.	.	ENSG00000196240	ENST00000342927	T	0.01369	4.97	3.72	0.0921	0.14471	GPCR, rhodopsin-like superfamily (1);	0.286741	0.25275	N	0.031842	T	0.01254	0.0041	L	0.38953	1.18	0.09310	N	1	B	0.26195	0.144	B	0.25987	0.065	T	0.46176	-0.9210	10	0.59425	D	0.04	.	3.0819	0.06265	0.4906:0.0:0.3105:0.1989	.	139	Q6IF00	OR2T2_HUMAN	L	139	ENSP00000343062:R139L	ENSP00000343062:R139L	R	+	2	0	OR2T2	246683137	0.000000	0.05858	0.089000	0.20774	0.071000	0.16799	-2.005000	0.01460	0.175000	0.19841	0.449000	0.29647	CGC	0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	protein_coding	OTTHUMT00000097421.1	53	125	0	1.57	0	2	G	NM_001004136	0	0		248616514	1	no_errors	ENST00000342927	ensembl	human	known	74_37	missense	94	117	9.62	11.36	10	15	SNP	0	T
SLC9A2	6549	genome.wustl.edu	37	2	103324903	103324903	+	Silent	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr2:103324903G>A	ENST00000233969.2	+	12	2536	c.2394G>A	c.(2392-2394)tcG>tcA	p.S798S		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	798					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GGAGGGCATCGGAACCTGGAA	0.567																																							0											0													59.0	70.0	67.0					2																	103324903		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.2394G>A	2.37:g.103324903G>A			B2RMS2	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.S798	ENST00000233969.2	37	c.2394	CCDS2062.1	2																																																																																			0	prints_Na/H_exchanger_2		0.567	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	protein_coding	OTTHUMT00000253292.2	29	233	0	0.00	0	0	G		0	0		103324903	1	no_errors	ENST00000233969	ensembl	human	known	74_37	silent	38	131	7.32	18.12	3	29	SNP	0.451	A
COL5A2	1290	genome.wustl.edu	37	2	189909916	189909916	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr2:189909916G>A	ENST00000374866.3	-	47	3626	c.3352C>T	c.(3352-3354)Cgt>Tgt	p.R1118C		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1118					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GGTAATCCACGTTTCCCAGCT	0.299																																							0											0													28.0	30.0	30.0					2																	189909916		2202	4299	6501	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3352C>T	2.37:g.189909916G>A	ENSP00000364000:p.Arg1118Cys		P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.R1118C	ENST00000374866.3	37	c.3352	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	G	16.65	3.180946	0.57800	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93426	-3.22	5.74	5.74	0.90152	.	0.000000	0.48286	D	0.000196	D	0.96642	0.8904	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96676	0.9500	10	0.72032	D	0.01	.	12.5524	0.56233	0.0:0.0:0.8231:0.1769	.	758;1118	Q5PR22;P05997	.;CO5A2_HUMAN	C	1118;758	ENSP00000364000:R1118C	ENSP00000364000:R1118C	R	-	1	0	COL5A2	189618161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.235000	0.51328	2.715000	0.92844	0.655000	0.94253	CGT	0	pfam_Collagen		0.299	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	protein_coding	OTTHUMT00000313523.1	85	151	0	0.66	0	1	G	NM_000393	0	0		189909916	-1	no_errors	ENST00000374866	ensembl	human	known	74_37	missense	144	98	15.12	8.41	26	9	SNP	1	A
MAP4	4134	genome.wustl.edu	37	3	47933312	47933312	+	Intron	SNP	A	A	C			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr3:47933312A>C	ENST00000360240.6	-	9	2518				MAP4_ENST00000395734.3_Intron|MAP4_ENST00000420772.2_Missense_Mutation_p.S224A|MAP4_ENST00000441748.2_5'Flank|MAP4_ENST00000426837.2_Intron|MAP4_ENST00000383737.4_Intron|MAP4_ENST00000264724.11_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4						cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	AGCTGCTCAGAGTTATCATTT	0.552																																							0											0																																										SO:0001627	intron_variant	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.2000-14299T>G	3.37:g.47933312A>C			Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt	p.S224A	ENST00000360240.6	37	c.670	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	A	1.939	-0.443985	0.04604	.	.	ENSG00000047849	ENST00000420772	T	0.18338	2.22	5.32	-3.69	0.04450	.	.	.	.	.	T	0.07908	0.0198	.	.	.	0.09310	N	0.999998	B;B	0.09022	0.001;0.002	B;B	0.08055	0.003;0.003	T	0.35450	-0.9788	8	0.34782	T	0.22	.	0.5443	0.00651	0.2968:0.1177:0.209:0.3766	.	224;224	F8W9U4;P27816-3	.;.	A	224	ENSP00000409731:S224A	ENSP00000409731:S224A	S	-	1	0	MAP4	47908316	0.067000	0.21026	0.000000	0.03702	0.113000	0.19764	0.428000	0.21395	-0.833000	0.04245	0.533000	0.62120	TCT	0	NULL		0.552	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	protein_coding	OTTHUMT00000346085.1	50	225	0	0.00	0	0	A	NM_002375	0	0		47933312	-1	no_errors	ENST00000420772	ensembl	human	known	74_37	missense	54	105	14.29	22.22	9	30	SNP	0	C
BMP5	653	genome.wustl.edu	37	6	55638913	55638913	+	Nonsense_Mutation	SNP	G	G	A	rs550837639		TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr6:55638913G>A	ENST00000370830.3	-	4	1659	c.961C>T	c.(961-963)Cga>Tga	p.R321*	BMP5_ENST00000446683.2_Nonsense_Mutation_p.R321*	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	321					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.R321*(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGATTTTTTCGTTTGTTGGCT	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18020	0.0		0.0	False		,,,				2504	0.0						0.9998,0.0001997											1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)											202.0	173.0	183.0					6																	55638913		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.961C>T	6.37:g.55638913G>A	ENSP00000359866:p.Arg321*		B4E0Y4|Q9H547|Q9NTM5	Nonsense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.R321*	ENST00000370830.3	37	c.961	CCDS4958.1	6	.	.	.	.	.	.	.	.	.	.	G	43	10.295298	0.99378	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	.	.	.	5.74	-0.0584	0.13797	.	0.052929	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.0604	0.86546	0.0:0.0:0.1964:0.8036	.	.	.	.	X	321	.	ENSP00000359866:R321X	R	-	1	2	BMP5	55746872	1.000000	0.71417	0.967000	0.41034	0.992000	0.81027	1.558000	0.36309	0.033000	0.15463	0.655000	0.94253	CGA	0	NULL		0.473	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP5	protein_coding	OTTHUMT00000041000.1	86	328	0	0.30	0	1	G		rs550837639	G->A		55638913	-1	no_errors	ENST00000370830	ensembl	human	known	74_37	nonsense	79	155	22.55	22.11	23	44	SNP	1	A
ZAN	7455	genome.wustl.edu	37	7	100395209	100395209	+	RNA	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr7:100395209C>T	ENST00000348028.3	+	0	8268				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGAGAAAACGCAGGAGGGAGA	0.612																																							0											0													45.0	51.0	49.0					7																	100395209		1870	4095	5965			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100395209C>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.Q2701*	ENST00000348028.3	37	c.8101		7	.	.	.	.	.	.	.	.	.	.	c	59	37.158500	0.99984	.	.	ENSG00000146839	ENST00000546292;ENST00000546213	.	.	.	4.55	1.72	0.24424	.	.	.	.	.	.	.	.	.	.	.	0.30065	N	0.810528	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.9783	0.19393	0.0:0.676:0.0:0.3239	.	.	.	.	X	2701;1165	.	ENSP00000441117:Q1165X	Q	+	1	0	ZAN	100233145	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.049000	0.14099	0.613000	0.30089	0.645000	0.84053	CAG	0	NULL		0.612	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	42	165	0	0.00	0	0	C	NM_003386	0	0		100395209	1	no_errors	ENST00000546292	ensembl	human	known	74_37	nonsense	47	103	16.07	8.85	9	10	SNP	0	T
PSMC2	5701	genome.wustl.edu	37	7	103008481	103008481	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr7:103008481C>T	ENST00000435765.1	+	13	1693	c.1282C>T	c.(1282-1284)Cgt>Tgt	p.R428C	PSMC2_ENST00000544811.1_Missense_Mutation_p.R291C|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000339444.6_Intron|PSMC2_ENST00000292644.3_Missense_Mutation_p.R428C	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	428					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						TGCTACTCCTCGTTACATGAC	0.368																																							0											0													68.0	66.0	67.0					7																	103008481		2203	4300	6503	SO:0001583	missense	0			D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.1282C>T	7.37:g.103008481C>T	ENSP00000391211:p.Arg428Cys		A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.R428C	ENST00000435765.1	37	c.1282	CCDS5731.1	7	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680952	0.68042	.	.	ENSG00000161057	ENST00000435765;ENST00000292644;ENST00000544811	D;D;D	0.94758	-3.51;-3.51;-3.45	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.90086	0.6903	N	0.22421	0.69	0.80722	D	1	D	0.63046	0.992	B	0.42916	0.402	D	0.91570	0.5271	10	0.87932	D	0	-5.6197	14.2355	0.65925	0.1492:0.8508:0.0:0.0	.	428	P35998	PRS7_HUMAN	C	428;428;291	ENSP00000391211:R428C;ENSP00000292644:R428C;ENSP00000445546:R291C	ENSP00000292644:R428C	R	+	1	0	PSMC2	102795717	0.836000	0.29430	0.998000	0.56505	0.969000	0.65631	1.671000	0.37513	2.573000	0.86826	0.644000	0.83932	CGT	0	NULL		0.368	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC2	protein_coding	OTTHUMT00000347922.1	26	167	0	0.00	0	0	C	NM_002803	0	0		103008481	1	no_errors	ENST00000292644	ensembl	human	known	74_37	missense	34	155	27.66	10.40	13	18	SNP	0.994	T
KCP	375616	genome.wustl.edu	37	7	128526557	128526557	+	RNA	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr7:128526557G>A	ENST00000476647.2	-	0	2869							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						TCGGTGACCTGGAGCTTGCAG	0.677																																							0											0													39.0	46.0	44.0					7																	128526557		692	1591	2283			0			AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128526557G>A			Q8NBE0	RNA	SNP	0	NULL	ENST00000476647.2	37	NULL		7																																																																																			0	0		0.677	KCP-006	KNOWN	basic	processed_transcript	KCP	processed_transcript	OTTHUMT00000403051.1	11	44	0	0.00	0	0	G	NM_199349	0	0		128526557	-1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	17	33	15	8.33	3	3	SNP	0.997	A
CFAP46	54777	genome.wustl.edu	37	10	134671174	134671174	+	Silent	SNP	A	A	G			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr10:134671174A>G	ENST00000368586.5	-	39	5594	c.5494T>C	c.(5494-5496)Tta>Cta	p.L1832L	TTC40_ENST00000263170.5_5'UTR	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						AGGCCATATAAGCCCTGGATG	0.552																																							0											0													109.0	75.0	87.0					10																	134671174		2202	4300	6502	SO:0001819	synonymous_variant	0																														ENST00000368586.5:c.5494T>C	10.37:g.134671174A>G				Silent	SNP	NULL	p.L1832	ENST00000368586.5	37	c.5494	CCDS58101.1	10																																																																																			0	NULL		0.552	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	protein_coding	OTTHUMT00000051095.3	33	138	2.94	0.72	1	1	A		0	0		134671174	-1	no_errors	ENST00000368586	ensembl	human	putative	74_37	silent	33	64	10.81	4.48	4	3	SNP	0.028	G
EED	8726	genome.wustl.edu	37	11	85979560	85979560	+	Missense_Mutation	SNP	A	A	G			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr11:85979560A>G	ENST00000263360.6	+	9	1609	c.923A>G	c.(922-924)tAt>tGt	p.Y308C	EED_ENST00000351625.6_Missense_Mutation_p.Y308C|EED_ENST00000327320.4_Missense_Mutation_p.Y308C|EED_ENST00000528180.1_Intron	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	308	Interaction with EZH2. {ECO:0000250}.|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CATAGGAATTATGTTGATTGT	0.363																																							0											0													244.0	230.0	235.0					11																	85979560		2202	4299	6501	SO:0001583	missense	0			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.923A>G	11.37:g.85979560A>G	ENSP00000263360:p.Tyr308Cys		A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y308C	ENST00000263360.6	37	c.923	CCDS8273.1	11	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655385	0.88056	.	.	ENSG00000074266	ENST00000263360;ENST00000351625;ENST00000327320;ENST00000533228;ENST00000534564	T;T;T	0.55588	0.51;1.57;0.51	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.77707	-0.2487	9	.	.	.	-19.4386	16.1135	0.81278	1.0:0.0:0.0:0.0	.	308;308;308	O75530-3;O75530-2;O75530	.;.;EED_HUMAN	C	308;308;308;101;57	ENSP00000263360:Y308C;ENSP00000338186:Y308C;ENSP00000315587:Y308C	.	Y	+	2	0	EED	85657208	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.144000	0.94629	2.267000	0.75376	0.383000	0.25322	TAT	0	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.363	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EED	protein_coding	OTTHUMT00000393733.1	45	158	0	0.00	0	0	A	NM_003797	0	0		85979560	1	no_errors	ENST00000263360	ensembl	human	known	74_37	missense	35	87	23.91	18.69	11	20	SNP	1	G
MCRS1	10445	genome.wustl.edu	37	12	49953267	49953267	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr12:49953267C>T	ENST00000550165.1	-	13	1321	c.1055G>A	c.(1054-1056)cGc>cAc	p.R352H	MCRS1_ENST00000547182.1_5'UTR|MCRS1_ENST00000343810.4_Missense_Mutation_p.R352H|MCRS1_ENST00000357123.4_Missense_Mutation_p.R365H|MCRS1_ENST00000546244.1_Missense_Mutation_p.R161H			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	352					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						CCGCACCATGCGGCCCCGCAG	0.617																																							0											0													66.0	66.0	66.0					12																	49953267		2203	4300	6503	SO:0001583	missense	0			BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.1055G>A	12.37:g.49953267C>T	ENSP00000448056:p.Arg352His		O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R365H	ENST00000550165.1	37	c.1094	CCDS8787.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.640487	0.96693	.	.	ENSG00000187778	ENST00000551598;ENST00000546244;ENST00000343810;ENST00000550165;ENST00000357123	D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69	5.84	5.84	0.93424	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.047810	0.85682	D	0.000000	D	0.89058	0.6607	M	0.64997	1.995	0.80722	D	1	B;P	0.39759	0.266;0.687	B;B	0.35278	0.019;0.199	D	0.89165	0.3533	10	0.49607	T	0.09	-14.0528	17.6396	0.88132	0.0:1.0:0.0:0.0	.	352;365	Q96EZ8;Q96EZ8-2	MCRS1_HUMAN;.	H	61;161;352;352;365	ENSP00000448947:R61H;ENSP00000444982:R161H;ENSP00000345358:R352H;ENSP00000448056:R352H;ENSP00000349640:R365H	ENSP00000345358:R352H	R	-	2	0	MCRS1	48239534	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.364000	0.79526	2.764000	0.94973	0.650000	0.86243	CGC	0	superfamily_SMAD_FHA_domain		0.617	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MCRS1	protein_coding	OTTHUMT00000405102.1	24	57	0	0.00	0	0	C	NM_006337	0	0		49953267	-1	no_errors	ENST00000357123	ensembl	human	known	74_37	missense	14	42	17.65	4.55	3	2	SNP	1	T
BAZ2A	11176	genome.wustl.edu	37	12	57005324	57005324	+	Intron	SNP	A	A	C			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr12:57005324A>C	ENST00000551812.1	-	7	1870				BAZ2A_ENST00000179765.5_Intron|BAZ2A_ENST00000549884.1_Intron|BAZ2A_ENST00000379441.3_Intron	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						AAACTTGTCAAGGTCAATAAA	0.453																																							0											0													65.0	60.0	62.0					12																	57005324		1896	4126	6022	SO:0001627	intron_variant	0			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1676+32T>G	12.37:g.57005324A>C			B3KN66|O00536|O15030|Q68DI8|Q96H26	RNA	SNP	0	NULL	ENST00000551812.1	37	NULL	CCDS44924.1	12																																																																																			0	0		0.453	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	protein_coding	OTTHUMT00000408561.1	35	312	0	0.63	0	2	A	NM_013449	0	0		57005324	-1	no_errors	ENST00000549327	ensembl	human	known	74_37	rna	46	165	23.33	15.23	14	30	SNP	0.096	C
PHLDA1	22822	genome.wustl.edu	37	12	76424507	76424507	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr12:76424507G>A	ENST00000266671.5	-	1	3205	c.1015C>T	c.(1015-1017)Ccc>Tcc	p.P339S	PHLDA1_ENST00000602540.1_Missense_Mutation_p.P198S|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	339	15 X 2 AA repeats of P-Q.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				ttgggttggggctgaggctgg	0.687																																							0											0													81.0	58.0	66.0					12																	76424507		2095	4127	6222	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.1015C>T	12.37:g.76424507G>A	ENSP00000266671:p.Pro339Ser		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.P339S	ENST00000266671.5	37	c.1015	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	G	10.09	1.254680	0.22965	.	.	ENSG00000139289	ENST00000266671	T	0.70399	-0.48	4.62	1.66	0.24008	.	0.592670	0.13933	N	0.352733	T	0.47691	0.1459	N	0.11927	0.2	0.19300	N	0.999977	B	0.13145	0.007	B	0.13407	0.009	T	0.40156	-0.9578	10	0.87932	D	0	-6.5865	3.7077	0.08407	0.0824:0.1438:0.4779:0.2958	.	339	Q8WV24	PHLA1_HUMAN	S	339	ENSP00000266671:P339S	ENSP00000266671:P339S	P	-	1	0	PHLDA1	74710774	0.973000	0.33851	0.073000	0.20177	0.979000	0.70002	1.431000	0.34925	0.246000	0.21394	0.561000	0.74099	CCC	0	NULL		0.687	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	protein_coding	OTTHUMT00000405846.2	31	42	0	0.00	0	0	G	NM_007350	0	0		76424507	-1	no_errors	ENST00000266671	ensembl	human	known	74_37	missense	33	38	26.67	17.02	12	8	SNP	0.313	A
PPFIA2	8499	genome.wustl.edu	37	12	81799641	81799641	+	Missense_Mutation	SNP	T	T	G			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr12:81799641T>G	ENST00000549396.1	-	8	847	c.687A>C	c.(685-687)aaA>aaC	p.K229N	PPFIA2_ENST00000550584.2_Missense_Mutation_p.K229N|PPFIA2_ENST00000552948.1_Missense_Mutation_p.K229N|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000443686.3_Missense_Mutation_p.K130N|PPFIA2_ENST00000407050.4_Missense_Mutation_p.K155N|PPFIA2_ENST00000549325.1_Missense_Mutation_p.K211N|PPFIA2_ENST00000550359.2_Missense_Mutation_p.K76N|PPFIA2_ENST00000333447.7_Missense_Mutation_p.K211N|PPFIA2_ENST00000548586.1_Missense_Mutation_p.K229N|PPFIA2_ENST00000545296.2_5'UTR	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	229	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TTGATGCCATTTTTCTTTGTA	0.383																																							0											0													89.0	81.0	83.0					12																	81799641		1888	4113	6001	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.687A>C	12.37:g.81799641T>G	ENSP00000450337:p.Lys229Asn		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.K229N	ENST00000549396.1	37	c.687	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.02|14.02	2.411805|2.411805	0.42817|0.42817	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000548790	T;T;T;T;T;T;T|T	0.46819|0.37584	0.86;0.86;0.86;0.86;0.86;1.43;0.86|1.19	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.33673|0.33673	0.0871|0.0871	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	B;P|.	0.40211|.	0.358;0.707|.	B;B|.	0.35971|.	0.215;0.188|.	T|T	0.08722|0.08722	-1.0708|-1.0708	10|8	0.18710|0.18710	T|T	0.47|0.47	-30.3313|-30.3313	8.7653|8.7653	0.34700|0.34700	0.0:0.0871:0.0:0.9129|0.0:0.0871:0.0:0.9129	.|.	129;229|.	B7Z4H8;O75334|.	.;LIPA2_HUMAN|.	N|T	229;211;155;240;211;229;130;229|47	ENSP00000450337:K229N;ENSP00000450298:K211N;ENSP00000385093:K155N;ENSP00000327416:K211N;ENSP00000449338:K229N;ENSP00000388373:K130N;ENSP00000447868:K229N|ENSP00000446555:K47T	ENSP00000327416:K211N|ENSP00000446555:K47T	K|K	-|-	3|2	2|0	PPFIA2|PPFIA2	80323772|80323772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.211000|2.211000	0.42825|0.42825	2.029000|2.029000	0.59856|0.59856	0.455000|0.455000	0.32223|0.32223	AAA|AAA	0	NULL		0.383	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	protein_coding	OTTHUMT00000408030.1	49	258	2	0.00	1	0	T		0	0		81799641	-1	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	54	151	18.18	16.57	12	30	SNP	1	G
NAA16	79612	genome.wustl.edu	37	13	41932577	41932577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr13:41932577G>T	ENST00000379406.3	+	11	1549	c.1225G>T	c.(1225-1227)Gaa>Taa	p.E409*	NAA16_ENST00000379367.3_Nonsense_Mutation_p.E409*|NAA16_ENST00000403412.3_Nonsense_Mutation_p.E409*	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	409					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						AACTCTAATAGAATTATTCTA	0.323																																							0											0													59.0	61.0	60.0					13																	41932577		2203	4300	6503	SO:0001587	stop_gained	0			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1225G>T	13.37:g.41932577G>T	ENSP00000368716:p.Glu409*		B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Nonsense_Mutation	SNP	pfam_TPR_2,pfam_NatA_aux_su,pfam_TPR_1,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E409*	ENST00000379406.3	37	c.1225	CCDS9379.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.447396	0.96205	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	.	.	.	4.82	4.82	0.62117	.	0.162599	0.41605	D	0.000853	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-15.4349	17.8716	0.88813	0.0:0.0:1.0:0.0	.	.	.	.	X	409	.	ENSP00000368674:E409X	E	+	1	0	NAA16	40830577	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	9.171000	0.94802	2.205000	0.71048	0.484000	0.47621	GAA	0	smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR-contain_dom		0.323	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	protein_coding	OTTHUMT00000044672.2	50	240	0	0.41	0	1	G	NM_018527	0	0		41932577	1	no_errors	ENST00000379406	ensembl	human	known	74_37	nonsense	62	147	18.42	21.39	14	40	SNP	1	T
TGM5	9333	genome.wustl.edu	37	15	43525533	43525533	+	Silent	SNP	G	G	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr15:43525533G>T	ENST00000220420.5	-	13	2026	c.2019C>A	c.(2017-2019)gtC>gtA	p.V673V	TGM5_ENST00000349114.4_Silent_p.V591V	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	673					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GGGGTTTGAGGACTCCAAGGC	0.493																																							0											0													137.0	116.0	123.0					15																	43525533		2203	4299	6502	SO:0001819	synonymous_variant	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.2019C>A	15.37:g.43525533G>T			O43549|Q0VF40|Q9UEZ4	Silent	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.V673	ENST00000220420.5	37	c.2019	CCDS32212.1	15																																																																																			0	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.493	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	protein_coding	OTTHUMT00000432257.1	36	295	0	0.34	0	1	G	NM_004245	0	0		43525533	-1	no_errors	ENST00000220420	ensembl	human	known	74_37	silent	52	179	16.13	16.74	10	36	SNP	1	T
SIN3A	25942	genome.wustl.edu	37	15	75692406	75692406	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr15:75692406T>C	ENST00000394947.3	-	12	2143	c.1829A>G	c.(1828-1830)tAt>tGt	p.Y610C	SIN3A_ENST00000360439.4_Missense_Mutation_p.Y610C|SIN3A_ENST00000394949.4_Missense_Mutation_p.Y610C	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TTCACAACGATAAATATGTTC	0.428																																							0											0													149.0	141.0	144.0					15																	75692406		2197	4294	6491	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1829A>G	15.37:g.75692406T>C	ENSP00000378402:p.Tyr610Cys			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.Y610C	ENST00000394947.3	37	c.1829	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	T	26.9	4.786134	0.90282	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.47869	0.83;0.83;0.83	6.08	6.08	0.98989	Histone deacetylase interacting (2);	0.000000	0.85682	D	0.000000	T	0.73171	0.3553	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.78056	-0.2353	10	0.72032	D	0.01	-16.1041	15.8323	0.78764	0.0:0.0:0.0:1.0	.	610	Q96ST3	SIN3A_HUMAN	C	610	ENSP00000378402:Y610C;ENSP00000378403:Y610C;ENSP00000353622:Y610C	ENSP00000353622:Y610C	Y	-	2	0	SIN3A	73479459	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.039000	0.88947	2.333000	0.79357	0.482000	0.46254	TAT	0	pfam_HDAC_interact,smart_HDAC_interact		0.428	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	protein_coding	OTTHUMT00000286469.1	52	293	0	0.00	0	0	T	NM_015477	0	0		75692406	-1	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	64	178	8.57	13.59	6	28	SNP	1	C
ADAMTSL3	57188	genome.wustl.edu	37	15	84639319	84639319	+	Silent	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr15:84639319C>T	ENST00000286744.5	+	20	2798	c.2574C>T	c.(2572-2574)ctC>ctT	p.L858L	ADAMTSL3_ENST00000567716.1_3'UTR|ADAMTSL3_ENST00000567476.1_Silent_p.L858L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	858	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCATCCCCCTCAGTGAGATGA	0.527																																							0											0													184.0	161.0	169.0					15																	84639319		2203	4300	6503	SO:0001819	synonymous_variant	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2574C>T	15.37:g.84639319C>T			A1A566|A1A567|Q9ULI7	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.L858	ENST00000286744.5	37	c.2574	CCDS10326.1	15																																																																																			0	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.527	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	36	159	0	0.00	0	0	C	NM_207517	0	0		84639319	1	no_errors	ENST00000286744	ensembl	human	known	74_37	silent	41	81	22.64	20.59	12	21	SNP	0.001	T
GABARAP	11337	genome.wustl.edu	37	17	7145585	7145585	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr17:7145585C>T	ENST00000302386.5	-	1	504	c.65G>A	c.(64-66)cGa>cAa	p.R22Q	CTD-2545G14.7_ENST00000570760.2_Intron|GABARAP_ENST00000571129.1_5'Flank|GABARAP_ENST00000571253.1_5'Flank|PHF23_ENST00000571362.1_5'Flank|GABARAP_ENST00000573928.1_Missense_Mutation_p.R22Q|PHF23_ENST00000576955.1_5'Flank|PHF23_ENST00000320316.3_5'Flank|GABARAP_ENST00000577035.1_5'Flank	NM_007278.1	NP_009209.1	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein	22	Interaction with beta-tubulin.				autophagy (GO:0006914)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|microtubule cytoskeleton organization (GO:0000226)|protein targeting (GO:0006605)|synaptic transmission (GO:0007268)	actin cytoskeleton (GO:0015629)|autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)|cell body (GO:0044297)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-tubulin binding (GO:0048487)|GABA receptor binding (GO:0050811)			breast(1)|lung(2)	3						GTATTTCTTTCGGATCTTCTC	0.642																																							0											0													47.0	51.0	50.0					17																	7145585		2203	4299	6502	SO:0001583	missense	0			AF161586	CCDS11092.1	17p13.1	2014-02-12			ENSG00000170296	ENSG00000170296			4067	protein-coding gene	gene with protein product		605125				9892355	Standard	NM_007278		Approved	MM46, ATG8A	uc002gfb.3	O95166	OTTHUMG00000102156	ENST00000302386.5:c.65G>A	17.37:g.7145585C>T	ENSP00000306866:p.Arg22Gln			Missense_Mutation	SNP	pfam_Atg8_fam,pfam_Atg12	p.R22Q	ENST00000302386.5	37	c.65	CCDS11092.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.240149	0.97403	.	.	ENSG00000170296	ENST00000302386	T	0.50001	0.76	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.76905	0.4053	H	0.95260	3.645	0.80722	D	1	D	0.76494	0.999	D	0.65140	0.932	D	0.84310	0.0510	10	0.72032	D	0.01	-1.7041	16.5908	0.84764	0.0:1.0:0.0:0.0	.	22	O95166	GBRAP_HUMAN	Q	22	ENSP00000306866:R22Q	ENSP00000306866:R22Q	R	-	2	0	GABARAP	7086309	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.963000	0.76055	2.497000	0.84241	0.650000	0.86243	CGA	0	pfam_Atg8_fam		0.642	GABARAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABARAP	protein_coding	OTTHUMT00000220000.2	91	140	0	0.00	0	0	C		0	0		7145585	-1	no_errors	ENST00000302386	ensembl	human	known	74_37	missense	79	78	24.04	13.33	25	12	SNP	1	T
GAS2L2	246176	genome.wustl.edu	37	17	34071991	34071991	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr17:34071991C>T	ENST00000254466.6	-	6	2552	c.2525G>A	c.(2524-2526)gGa>gAa	p.G842E	GAS2L2_ENST00000587565.1_Missense_Mutation_p.G826E	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	842					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ctcctcctttccttcctcctc	0.612																																							0											0													67.0	60.0	63.0					17																	34071991		2203	4300	6503	SO:0001583	missense	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.2525G>A	17.37:g.34071991C>T	ENSP00000254466:p.Gly842Glu		Q8NHY4	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.G842E	ENST00000254466.6	37	c.2525	CCDS11298.1	17	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.358682	0.01245	.	.	ENSG00000132139	ENST00000254466;ENST00000359507	T	0.17691	2.26	3.91	-0.812	0.10853	.	1.133310	0.06831	N	0.793968	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39840	-0.9594	10	0.09338	T	0.73	-1.123	4.0299	0.09705	0.1783:0.4151:0.0:0.4065	.	842	Q8NHY3	GA2L2_HUMAN	E	842;256	ENSP00000254466:G842E	ENSP00000254466:G842E	G	-	2	0	GAS2L2	31096104	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	-1.332000	0.02670	-0.193000	0.10415	-0.367000	0.07326	GGA	0	NULL		0.612	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	protein_coding	OTTHUMT00000256497.1	56	82	0	0.00	0	0	C	NM_139285	0	0		34071991	-1	no_errors	ENST00000254466	ensembl	human	known	74_37	missense	46	41	11.54	16.33	6	8	SNP	0	T
APCDD1	147495	genome.wustl.edu	37	18	10471541	10471541	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr18:10471541C>T	ENST00000355285.5	+	3	611	c.257C>T	c.(256-258)tCa>tTa	p.S86L	APCDD1_ENST00000578882.1_Missense_Mutation_p.S86L	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GAAGTAAGGTCAGGCCCAGAG	0.423																																							0											0													82.0	79.0	80.0					18																	10471541		2203	4300	6503	SO:0001583	missense	0			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.257C>T	18.37:g.10471541C>T	ENSP00000347433:p.Ser86Leu			Missense_Mutation	SNP	NULL	p.S86L	ENST00000355285.5	37	c.257	CCDS11849.1	18	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772291	0.49680	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.18657	2.2	5.3	5.3	0.74995	.	0.112791	0.64402	D	0.000007	T	0.27798	0.0684	L	0.54323	1.7	0.54753	D	0.999985	B	0.25206	0.12	B	0.29077	0.098	T	0.06844	-1.0804	10	0.87932	D	0	-12.9859	18.945	0.92618	0.0:1.0:0.0:0.0	.	86	Q8J025	APCD1_HUMAN	L	86;137	ENSP00000347433:S86L	ENSP00000347433:S86L	S	+	2	0	APCDD1	10461541	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	7.436000	0.80404	2.477000	0.83638	0.655000	0.94253	TCA	0	NULL		0.423	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCDD1	protein_coding	OTTHUMT00000254529.2	67	333	0	0.30	0	1	C	NM_153000	0	0		10471541	1	no_errors	ENST00000355285	ensembl	human	known	74_37	missense	76	167	16.48	19.71	15	41	SNP	1	T
MIR205HG	642587	genome.wustl.edu	37	1	209605572	209605573	+	lincRNA	INS	-	-	GG			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	-	-	-	GG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:209605572_209605573insGG	ENST00000384891.1	+	0	95_96					NR_029622.1				MIR205 host gene (non-protein coding)																		GAAGTTCAGGAGGCATGGAGCT	0.574																																							0											0																																												0					1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605573_209605574dupGG				RNA	INS	0	NULL	ENST00000384891.1	37	NULL		1																																																																																			0	0		0.574	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	lincRNA		43	120	0	0.00	0	0	0		0	0		209605573	1	no_errors	ENST00000366437	ensembl	human	known	74_37	rna	76	183	18.28	5.67	17	11	INS	1.000:1.000	GG
ASXL1	171023	genome.wustl.edu	37	20	31022442	31022442	+	Frame_Shift_Del	DEL	G	G	-			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr20:31022442delG	ENST00000375687.4	+	13	2351	c.1927delG	c.(1927-1929)gggfs	p.G646fs	ASXL1_ENST00000306058.5_Frame_Shift_Del_p.G641fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	646	Gly-rich.|Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G643fs*15(3)|p.A640fs*14(2)|p.T639_G659>PPWD(1)|p.A637fs*13(1)|p.A640_S664>PCSGG(1)|p.T639fs*14(1)|p.T639fs*19(1)|p.T639_P647>PPSDGS(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TGCCATCGGAGGGGGGGGTGG	0.692			"""F, N, Mis"""		"""MDS, CMML"""																																		0		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	11	Deletion - Frameshift(4)|Complex - deletion inframe(3)|Insertion - Frameshift(3)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(11)								114,54,3462		18,0,78,3,48,1668	6.0	8.0	7.0			4.4	1.0	20		7	161,165,6938		9,0,143,5,155,3320	no	codingComplex	ASXL1	NM_015338.5		27,0,221,8,203,4988	A1A1,A1A2,A1R,A2A2,A2R,RR		4.4879,4.6281,4.5346			31022442	275,219,10400	2008	3998	6006	SO:0001589	frameshift_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1927delG	20.37:g.31022442delG	ENSP00000364839:p.Gly646fs		B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Del	DEL	NULL	p.G645fs	ENST00000375687.4	37	c.1927	CCDS13201.1	20																																																																																			0	NULL		0.692	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	protein_coding	OTTHUMT00000078624.2	69	31	0	0.00	0	0	G	NM_015338	0	0		31022442	1	no_errors	ENST00000375687	ensembl	human	known	74_37	frame_shift_del	92	23	10.68	11.54	11	3	DEL	1	0
MT-ND2	4536	genome.wustl.edu	37	M	2833	2833	+	5'Flank	SNP	A	A	G			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chrM:2833A>G	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCGGAGCAGAACCCAACCT	0.428																																							0											0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2833A>G	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	0	NULL	ENST00000361453.3	37	NULL		MT																																																																																			0	0		0.428	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		112	3	0	0.00	0	0	A	YP_003024027	rs3928312	A->G		2833	1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	41	0	76.02	0.00	130	0	SNP	NULL	G
MT-CO2	4513	genome.wustl.edu	37	M	7852	7852	+	Silent	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chrM:7852G>A	ENST00000361739.1	+	1	267	c.267G>A	c.(265-267)gaG>gaA	p.E89E	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	89					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						ATAACAGACGAGGTCAACGAT	0.498																																							0											0																																										SO:0001819	synonymous_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.267G>A	M.37:g.7852G>A			Q37526	Silent	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.E89	ENST00000361739.1	37	c.267		MT																																																																																			0	superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2		0.498	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		500	0	0	0.00	0	0	G	YP_003024029	rs199751156	G->A		7852	1	no_errors	ENST00000361739	ensembl	human	known	74_37	silent	671	3	7.57	0.00	55	0	SNP	NULL	A
DMAP1	55929	genome.wustl.edu	37	1	44685818	44685818	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:44685818G>A	ENST00000372289.2	+	9	1444	c.1181G>A	c.(1180-1182)cGt>cAt	p.R394H	DMAP1_ENST00000361745.6_Missense_Mutation_p.R394H|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Missense_Mutation_p.R394H	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	394					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					CTGCGGCACCGTCATGAGGCA	0.647											OREG0013438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											0											0													23.0	23.0	23.0					1																	44685818		2202	4299	6501	SO:0001583	missense	0			AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.1181G>A	1.37:g.44685818G>A	ENSP00000361363:p.Arg394His	925	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Missense_Mutation	SNP	pfam_DMAP1,superfamily_Homeodomain-like	p.R394H	ENST00000372289.2	37	c.1181	CCDS509.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.167525	0.94768	.	.	ENSG00000178028	ENST00000361745;ENST00000315913;ENST00000372289	.	.	.	5.09	5.09	0.68999	DNA methyltransferase 1-associated 1 (2);	0.000000	0.85682	D	0.000000	T	0.78886	0.4354	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.986	T	0.80299	-0.1441	9	0.54805	T	0.06	-16.0095	18.5035	0.90890	0.0:0.0:1.0:0.0	.	384;394	B4DQG8;Q9NPF5	.;DMAP1_HUMAN	H	394	.	ENSP00000312697:R394H	R	+	2	0	DMAP1	44458405	1.000000	0.71417	0.902000	0.35471	0.988000	0.76386	9.218000	0.95166	2.376000	0.81061	0.563000	0.77884	CGT	0	pfam_DMAP1		0.647	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DMAP1	protein_coding	OTTHUMT00000020027.3	29	22	0	0.00	0	0	G	NM_019100	0	0		44685818	1	no_errors	ENST00000315913	ensembl	human	known	74_37	missense	38	10	7.32	0.00	3	0	SNP	1	A
KCNN3	3782	genome.wustl.edu	37	1	154842253	154842253	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr1:154842253G>A	ENST00000271915.4	-	1	503	c.188C>T	c.(187-189)cCt>cTt	p.P63L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	aagctgcggaggctgaggctg	0.697																																							0											0													6.0	4.0	5.0					1																	154842253		1984	3925	5909	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188C>T	1.37:g.154842253G>A	ENSP00000271915:p.Pro63Leu		B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.P63L	ENST00000271915.4	37	c.188	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	g	10.39	1.337246	0.24253	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.55413	0.52	5.07	3.18	0.36537	.	1.727610	0.03258	N	0.182822	T	0.16811	0.0404	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.19128	-1.0315	8	0.23302	T	0.38	-4.1487	6.4327	0.21807	0.0918:0.0:0.7284:0.1798	.	.	.	.	L	63;158	ENSP00000271915:P63L	ENSP00000271915:P63L	P	-	2	0	KCNN3	153108877	0.863000	0.29885	1.000000	0.80357	0.998000	0.95712	1.873000	0.39558	0.823000	0.34589	0.563000	0.77884	CCT	0	NULL		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	protein_coding	OTTHUMT00000090688.3	29	6	0	0.00	0	0	G	NM_002249	0	0		154842253	-1	no_errors	ENST00000271915	ensembl	human	novel	74_37	missense	54	8	9.23	0.00	6	0	SNP	0.985	A
PSIP1	11168	genome.wustl.edu	37	9	15510275	15510275	+	5'UTR	SNP	G	G	C			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr9:15510275G>C	ENST00000380733.4	-	0	255				PSIP1_ENST00000380738.4_5'UTR|PSIP1_ENST00000380715.1_5'UTR|PSIP1_ENST00000397519.2_5'UTR|PSIP1_ENST00000484265.1_5'UTR|PSIP1_ENST00000380716.4_5'UTR			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CGCGGGCCCAGCTACCGGGCC	0.751																																							0											0																																										SO:0001623	5_prime_UTR_variant	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.-89C>G	9.37:g.15510275G>C			D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	RNA	SNP	0	NULL	ENST00000380733.4	37	NULL	CCDS6479.1	9																																																																																			0	0		0.751	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	protein_coding	OTTHUMT00000055445.1	26	6	0	0.00	0	0	G	NM_033222	0	0		15510275	-1	no_errors	ENST00000463712	ensembl	human	known	74_37	rna	33	7	17.5	0.00	7	0	SNP	0.002	C
CABLES2	81928	genome.wustl.edu	37	20	60966373	60966373	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr20:60966373C>T	ENST00000279101.5	-	9	1236	c.1228G>A	c.(1228-1230)Gcc>Acc	p.A410T		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	410					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGCACGCAGGCGCCAGCGCAC	0.642																																							0											0													73.0	74.0	74.0					20																	60966373		2203	4300	6503	SO:0001583	missense	0			BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1228G>A	20.37:g.60966373C>T	ENSP00000279101:p.Ala410Thr		Q5JWL0|Q9BYK0	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables	p.A410T	ENST00000279101.5	37	c.1228	CCDS33503.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.286133	0.95517	.	.	ENSG00000149679	ENST00000370560;ENST00000279101	T	0.14266	2.52	5.56	4.61	0.57282	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	L	0.60904	1.88	0.80722	D	1	D	0.71674	0.998	D	0.68353	0.957	T	0.04767	-1.0928	10	0.54805	T	0.06	-29.5547	15.8059	0.78506	0.1374:0.8626:0.0:0.0	.	410	Q9BTV7	CABL2_HUMAN	T	198;410	ENSP00000279101:A410T	ENSP00000279101:A410T	A	-	1	0	CABLES2	60399768	1.000000	0.71417	0.970000	0.41538	0.930000	0.56654	7.639000	0.83342	1.339000	0.45563	0.561000	0.74099	GCC	0	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables		0.642	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABLES2	protein_coding	OTTHUMT00000080027.2	45	41	0	0.00	0	0	C	XM_037265	0	0		60966373	-1	no_errors	ENST00000279101	ensembl	human	known	74_37	missense	52	10	7.14	0.00	4	0	SNP	1	T
SNTG2	54221	genome.wustl.edu	37	2	946704	946704	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XU-A930-01A-11D-A423-09	TCGA-XU-A930-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7d43a967-5fed-462b-a2fc-2b1df4a3c112	67eb82f3-eca1-46f5-99a6-8e80cd397b5a	g.chr2:946704delC	ENST00000308624.5	+	1	151	c.22delC	c.(22-24)cccfs	p.P9fs	SNTG2_ENST00000407292.1_Frame_Shift_Del_p.P9fs|AC116614.1_ENST00000456949.1_RNA	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	9	Poly-Pro.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GGGACCCCCGCCCCCGGCCGC	0.796																																							0											0													1.0	1.0	1.0					2																	946704		396	968	1364	SO:0001589	frameshift_variant	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.22delC	2.37:g.946704delC	ENSP00000311837:p.Pro9fs		Q05AH5	Frame_Shift_Del	DEL	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P9fs	ENST00000308624.5	37	c.22	CCDS46220.1	2																																																																																			0	NULL		0.796	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	protein_coding	OTTHUMT00000322454.1	11	10	0	0.00	0	0	C	NM_018968	0	0		946704	1	no_errors	ENST00000308624	ensembl	human	known	74_37	frame_shift_del	4	4	33.33	0.00	2	0	DEL	0.372	0
