#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MT-ND5	4540	genome.wustl.edu	37	M	12431	12431	+	Missense_Mutation	SNP	A	A	C			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chrM:12431A>C	ENST00000361567.2	+	1	95	c.95A>C	c.(94-96)tAc>tCc	p.Y32S	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	32					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AAAAAACTCATACCCCCATTA	0.403																																							0											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.95A>C	M.37:g.12431A>C	ENSP00000354813:p.Tyr32Ser		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.Y32S	ENST00000361567.2	37	c.95		MT																																																																																			0	tigrfam_NADHpl_OxRdtase_5		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	protein_coding		433	1	0	0.00	0	0	A	YP_003024036	0	0		12431	1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	4	0	82.61	100.00	19	4	SNP	NULL	C
MREG	55686	genome.wustl.edu	37	2	216877966	216877966	+	Missense_Mutation	SNP	G	G	A	rs568336631		TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr2:216877966G>A	ENST00000263268.6	-	1	380	c.85C>T	c.(85-87)Ccc>Tcc	p.P29S		NM_018000.2	NP_060470.2	Q8N565	MREG_HUMAN	melanoregulin	29						plasma membrane (GO:0005886)				large_intestine(1)|lung(2)	3		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)		CTGACGAGGGGCTCCTTCTCA	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		10739	0.0		0.0	False		,,,				2504	0.001						0											0													6.0	12.0	10.0					2																	216877966		1612	3249	4861	SO:0001583	missense	0			AK000978	CCDS46513.1	2q35	2013-09-27			ENSG00000118242	ENSG00000118242			25478	protein-coding gene	gene with protein product		609207				19240024, 22275436	Standard	NM_018000		Approved	FLJ10116, DSU, WDT2	uc002vfo.3	Q8N565	OTTHUMG00000154828	ENST00000263268.6:c.85C>T	2.37:g.216877966G>A	ENSP00000263268:p.Pro29Ser		Q53R89|Q53TC1|Q5XKB6|Q9NWC9|Q9P1S1	Missense_Mutation	SNP	NULL	p.P29S	ENST00000263268.6	37	c.85	CCDS46513.1	2	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795347	0.70452	.	.	ENSG00000118242	ENST00000236976;ENST00000263268	T	0.63913	-0.07	4.03	3.14	0.36123	.	0.124685	0.56097	D	0.000039	T	0.56396	0.1982	L	0.59436	1.845	0.80722	D	1	B	0.33612	0.419	B	0.35353	0.201	T	0.58250	-0.7669	10	0.66056	D	0.02	-12.2786	8.8449	0.35164	0.0:0.0:0.7759:0.2241	.	29	Q8N565	MREG_HUMAN	S	29	ENSP00000263268:P29S	ENSP00000236976:P29S	P	-	1	0	MREG	216586211	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	2.675000	0.46875	0.885000	0.36088	0.462000	0.41574	CCC	0	NULL		0.697	MREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MREG	protein_coding	OTTHUMT00000337297.1	22	30	0	0.00	0	0	G	NM_018000	rs568336631	G->A		216877966	-1	no_errors	ENST00000263268	ensembl	human	known	74_37	missense	11	24	26.67	11.11	4	3	SNP	1	A
MUC4	4585	genome.wustl.edu	37	3	195508500	195508500	+	Missense_Mutation	SNP	G	G	C	rs374619108		TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr3:195508500G>C	ENST00000463781.3	-	2	10410	c.9951C>G	c.(9949-9951)gaC>gaG	p.D3317E	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3317E	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D3317E(2)|p.V3305_S3320delVSTGHATPLLVTDASS(1)|p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)|p.S3317R(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGCGTCGGTGACAA	0.577																																							0											5	Substitution - Missense(3)|Deletion - In frame(2)	stomach(4)|kidney(1)											9.0	12.0	11.0					3																	195508500		600	1514	2114	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9951C>G	3.37:g.195508500G>C	ENSP00000417498:p.Asp3317Glu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D3317E	ENST00000463781.3	37	c.9951	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	6.278	0.419423	0.11928	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.61;1.51	0.423	0.423	0.16463	.	.	.	.	.	T	0.14141	0.0342	N	0.19112	0.55	0.09310	N	1	P	0.43352	0.804	B	0.33196	0.159	T	0.14144	-1.0483	7	.	.	.	.	.	.	.	.	3189	E7ESK3	.	E	3317	ENSP00000417498:D3317E;ENSP00000420243:D3317E	.	D	-	3	2	MUC4	196993279	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.672000	0.25187	0.494000	0.27859	0.089000	0.15464	GAC	0	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	8	0	0	0.00	0	0	G	NM_018406	rs374619108	G->C		195508500	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	22	5	42.11	44.44	16	4	SNP	0.001	C
DCHS2	54798	genome.wustl.edu	37	4	155237053	155237053	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr4:155237053C>T	ENST00000357232.4	-	15	3741	c.3742G>A	c.(3742-3744)Gca>Aca	p.A1248T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1248	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAAGAAAGTGCTGGTGTGCCA	0.403																																							0											0													123.0	116.0	118.0					4																	155237053		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3742G>A	4.37:g.155237053C>T	ENSP00000349768:p.Ala1248Thr		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A1248T	ENST00000357232.4	37	c.3742	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	8.177	0.793013	0.16327	.	.	ENSG00000197410	ENST00000357232	T	0.52295	0.67	5.37	2.61	0.31194	Cadherin (4);Cadherin-like (1);	0.358888	0.26623	N	0.023355	T	0.33323	0.0859	L	0.39147	1.195	0.36227	D	0.852356	B	0.24426	0.103	B	0.23574	0.047	T	0.19095	-1.0316	10	0.32370	T	0.25	.	5.3135	0.15843	0.1403:0.629:0.0:0.2307	.	1248	Q6V1P9	PCD23_HUMAN	T	1248	ENSP00000349768:A1248T	ENSP00000349768:A1248T	A	-	1	0	DCHS2	155456503	0.004000	0.15560	0.008000	0.14137	0.792000	0.44763	0.128000	0.15810	0.302000	0.22762	0.460000	0.39030	GCA	0	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	69	198	0	0.00	0	0	C	NM_001142552	0	0		155237053	-1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	48	80	22.58	33.33	14	41	SNP	0.383	T
ICE1	23379	genome.wustl.edu	37	5	5460800	5460800	+	Missense_Mutation	SNP	A	A	C			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr5:5460800A>C	ENST00000296564.7	+	13	1575	c.1353A>C	c.(1351-1353)gaA>gaC	p.E451D		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		451					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CACTGAGAGAATCTTCTGCCA	0.408																																							0											0													76.0	73.0	74.0					5																	5460800		1967	4140	6107	SO:0001583	missense	0																														ENST00000296564.7:c.1353A>C	5.37:g.5460800A>C	ENSP00000296564:p.Glu451Asp		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.E451D	ENST00000296564.7	37	c.1353	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	A	15.26	2.781680	0.49891	.	.	ENSG00000164151	ENST00000296564	T	0.47528	0.84	4.14	-6.3	0.02007	.	1.544540	0.04193	N	0.328695	T	0.31071	0.0785	L	0.27053	0.805	0.09310	N	1	P	0.50819	0.939	P	0.44673	0.457	T	0.30238	-0.9985	10	0.14656	T	0.56	-3.8027	6.3356	0.21294	0.3451:0.0:0.5063:0.1486	.	451	Q9Y2F5	K0947_HUMAN	D	451	ENSP00000296564:E451D	ENSP00000296564:E451D	E	+	3	2	KIAA0947	5513800	0.000000	0.05858	0.000000	0.03702	0.804000	0.45430	-2.131000	0.01311	-1.512000	0.01791	0.254000	0.18369	GAA	0	NULL		0.408	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	protein_coding	OTTHUMT00000365575.1	23	197	0	0.00	0	0	A		0	0		5460800	1	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	19	145	36.67	39.33	11	94	SNP	0	C
TENM2	57451	genome.wustl.edu	37	5	167379631	167379631	+	Missense_Mutation	SNP	C	C	G			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr5:167379631C>G	ENST00000518659.1	+	4	790	c.751C>G	c.(751-753)Cct>Gct	p.P251A	TENM2_ENST00000545108.1_Missense_Mutation_p.P251A|TENM2_ENST00000519204.1_Missense_Mutation_p.P130A|TENM2_ENST00000403607.2_Missense_Mutation_p.P84A|TENM2_ENST00000520394.1_Missense_Mutation_p.P60A|TENM2_ENST00000520393.1_3'UTR|CTC-353G13.1_ENST00000523050.1_RNA	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	251	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TCTGAGGCCCCCTCTCCCACC	0.567																																							0											0													82.0	93.0	90.0					5																	167379631		2141	4250	6391	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.751C>G	5.37:g.167379631C>G	ENSP00000429430:p.Pro251Ala		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.P251A	ENST00000518659.1	37	c.751		5	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689462	0.48097	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.33	5.33	0.75918	Teneurin intracellular, N-terminal (2);	0.142496	0.47093	D	0.000255	T	0.60753	0.2293	L	0.53249	1.67	0.58432	D	0.999998	D;D;D	0.76494	0.997;0.996;0.999	D;D;D	0.80764	0.989;0.981;0.994	T	0.54827	-0.8235	10	0.02654	T	1	.	19.0113	0.92874	0.0:1.0:0.0:0.0	.	251;60;130	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	A	251;251;130;60;84	ENSP00000429430:P251A;ENSP00000438635:P251A;ENSP00000428964:P130A;ENSP00000427874:P60A;ENSP00000384905:P84A	ENSP00000384905:P84A	P	+	1	0	ODZ2	167312209	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	5.717000	0.68446	2.497000	0.84241	0.563000	0.77884	CCT	0	pfam_Ten_N		0.567	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	protein_coding	OTTHUMT00000376096.1	22	162	0	0.00	0	0	C	NM_001122679	0	0		167379631	1	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	27	102	42.55	35.85	20	57	SNP	1	G
RALA	5898	genome.wustl.edu	37	7	39736352	39736352	+	Missense_Mutation	SNP	T	T	C			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr7:39736352T>C	ENST00000005257.2	+	4	772	c.392T>C	c.(391-393)tTa>tCa	p.L131S	RALA_ENST00000468201.1_3'UTR	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	131					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						AAATCAGATTTAGAAGATAAA	0.343																																							0											0													72.0	71.0	72.0					7																	39736352		2203	4300	6503	SO:0001583	missense	0				CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.392T>C	7.37:g.39736352T>C	ENSP00000005257:p.Leu131Ser		A4D1W3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L131S	ENST00000005257.2	37	c.392	CCDS5460.1	7	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388638	0.82902	.	.	ENSG00000006451	ENST00000005257	D	0.84800	-1.9	4.84	4.84	0.62591	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93566	0.7946	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.94978	0.8123	10	0.87932	D	0	.	14.739	0.69440	0.0:0.0:0.0:1.0	.	131	P11233	RALA_HUMAN	S	131	ENSP00000005257:L131S	ENSP00000005257:L131S	L	+	2	0	RALA	39702877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.036000	0.88901	1.942000	0.56320	0.460000	0.39030	TTA	0	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.343	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALA	protein_coding	OTTHUMT00000250696.2	35	130	0	0.00	0	0	T	NM_005402	0	0		39736352	1	no_errors	ENST00000005257	ensembl	human	known	74_37	missense	58	165	13.43	5.71	9	10	SNP	1	C
ZNF252P	286101	genome.wustl.edu	37	8	146202302	146202302	+	RNA	SNP	G	G	A			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr8:146202302G>A	ENST00000426361.2	-	0	1882					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						TGTGACCCCTGGCTAAAGGCC	0.438																																							0											0																																												0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146202302G>A				RNA	SNP	0	NULL	ENST00000426361.2	37	NULL		8	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492860	0.64074	.	.	ENSG00000196922	ENST00000355436	.	.	.	2.85	0.992	0.19819	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	5.6749	0.17743	0.3915:0.0:0.6085:0.0	.	.	.	.	X	516	.	ENSP00000347611:Q516X	Q	-	1	0	ZNF252	146173106	0.000000	0.05858	0.002000	0.10522	0.877000	0.50540	-1.363000	0.02592	0.002000	0.14630	0.514000	0.50259	CAG	0	0		0.438	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	pseudogene	OTTHUMT00000451422.1	32	186	0	0.53	0	1	G	NR_023392	0	0		146202302	-1	no_errors	ENST00000426361	ensembl	human	known	74_37	rna	36	117	29.41	36.22	15	67	SNP	0	A
RP11-344N10.5	0	genome.wustl.edu	37	10	74860379	74860379	+	lincRNA	SNP	C	C	A			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr10:74860379C>A	ENST00000608005.1	-	0	676																											taattgcctgcccatataagc	0.343																																							0											0																																												0																															10.37:g.74860379C>A				RNA	SNP	0	NULL	ENST00000608005.1	37	NULL		10																																																																																			0	0		0.343	RP11-344N10.5-001	KNOWN	basic	lincRNA	ENSG00000272630	lincRNA	OTTHUMT00000473120.1	30	240	0	0.00	0	0	C		0	0		74860379	-1	no_errors	ENST00000608005	ensembl	human	known	74_37	rna	36	150	25	37.24	12	89	SNP	0.002	A
OPALIN	93377	genome.wustl.edu	37	10	98109555	98109555	+	Missense_Mutation	SNP	G	G	A	rs368645607	byFrequency	TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr10:98109555G>A	ENST00000371172.3	-	4	506	c.101C>T	c.(100-102)gCg>gTg	p.A34V	OPALIN_ENST00000419479.1_Missense_Mutation_p.A24V|OPALIN_ENST00000536387.1_Missense_Mutation_p.A24V|OPALIN_ENST00000393870.2_Missense_Mutation_p.A23V|OPALIN_ENST00000393871.1_Missense_Mutation_p.A11V	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	34						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A24E(1)|p.A34E(1)		breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TGGTATGCCCGCCGCTAATCC	0.478													G|||	4	0.000798722	0.0	0.0	5008	,	,		17584	0.0		0.0	False		,,,				2504	0.0041						0											2	Substitution - Missense(2)	lung(2)						G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	28.0	31.0	30.0		101,71,32	3.5	0.1	10		30	1,8599		0,1,4299	no	missense,missense,missense	OPALIN	NM_033207.3,NM_001040103.1,NM_001040102.1	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	34/142,24/132,11/119	98109555	1,13005	2203	4300	6503	SO:0001583	missense	0			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.101C>T	10.37:g.98109555G>A	ENSP00000360214:p.Ala34Val		A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.A34V	ENST00000371172.3	37	c.101	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	G	8.567	0.879159	0.17395	0.0	1.16E-4	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	5.35	3.46	0.39613	.	0.230517	0.30930	N	0.008582	T	0.20129	0.0484	N	0.24115	0.695	0.09310	N	0.999998	B;B;B	0.33826	0.427;0.427;0.427	B;B;B	0.26202	0.067;0.067;0.067	T	0.11991	-1.0565	9	0.46703	T	0.11	-16.6883	7.6667	0.28434	0.0866:0.1634:0.75:0.0	.	11;34;24	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	V	34;11;24;23;24	.	ENSP00000360214:A34V	A	-	2	0	OPALIN	98099545	0.604000	0.26932	0.057000	0.19452	0.001000	0.01503	1.779000	0.38624	0.916000	0.36871	-0.122000	0.15005	GCG	0	NULL		0.478	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	protein_coding	OTTHUMT00000049606.1	32	163	0	0.00	0	0	G	NM_033207	rs368645607	G->A		98109555	-1	no_errors	ENST00000371172	ensembl	human	known	74_37	missense	25	75	16.67	25.00	5	25	SNP	0.237	A
CHRM1	1128	genome.wustl.edu	37	11	62678157	62678157	+	Missense_Mutation	SNP	G	G	A			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr11:62678157G>A	ENST00000306960.3	-	2	957	c.416C>T	c.(415-417)cCc>cTc	p.P139L	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	139					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	TGCCCGGCGGGGTGTGCGCTT	0.617																																							0											0													42.0	43.0	43.0					11																	62678157		2201	4298	6499	SO:0001583	missense	0			Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.416C>T	11.37:g.62678157G>A	ENSP00000306490:p.Pro139Leu		Q96RH1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M1_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.P139L	ENST00000306960.3	37	c.416	CCDS8040.1	11	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180600	0.57800	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.72835	-0.69;-0.69	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.65739	0.2720	L	0.41356	1.27	0.58432	D	0.999999	B	0.30146	0.27	B	0.34346	0.18	T	0.68804	-0.5312	10	0.72032	D	0.01	-24.9129	15.321	0.74120	0.0:0.0:1.0:0.0	.	139	P11229	ACM1_HUMAN	L	139	ENSP00000306490:P139L;ENSP00000441188:P139L	ENSP00000306490:P139L	P	-	2	0	CHRM1	62434733	1.000000	0.71417	0.854000	0.33618	0.996000	0.88848	9.648000	0.98483	2.483000	0.83821	0.563000	0.77884	CCC	0	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_rcpt		0.617	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM1	protein_coding	OTTHUMT00000396178.1	20	108	0	0.00	0	0	G	NM_000738	0	0		62678157	-1	no_errors	ENST00000306960	ensembl	human	known	74_37	missense	16	47	20	41.98	4	34	SNP	0.958	A
TULP3	7289	genome.wustl.edu	37	12	3043639	3043639	+	Missense_Mutation	SNP	C	C	T			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr12:3043639C>T	ENST00000448120.2	+	8	887	c.836C>T	c.(835-837)aCa>aTa	p.T279I	TULP3_ENST00000397132.2_Missense_Mutation_p.T279I	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	279					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ACCAAGTTTACAGTTTATGAC	0.498																																							0											0													142.0	149.0	146.0					12																	3043639		2203	4300	6503	SO:0001583	missense	0			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.836C>T	12.37:g.3043639C>T	ENSP00000410051:p.Thr279Ile		B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.T279I	ENST00000448120.2	37	c.836	CCDS8519.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043901	0.75732	.	.	ENSG00000078246	ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132	D;D;D	0.96041	-3.89;-3.89;-3.89	5.2	5.2	0.72013	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.97424	0.9157	M	0.71920	2.185	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.983;0.999;0.999	D	0.98164	1.0448	10	0.87932	D	0	-28.4829	17.7272	0.88368	0.0:1.0:0.0:0.0	.	136;279;279	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	I	279;6;136;279;279	ENSP00000442631:T6I;ENSP00000410051:T279I;ENSP00000380321:T279I	ENSP00000228245:T279I	T	+	2	0	TULP3	2913900	1.000000	0.71417	0.685000	0.30070	0.570000	0.35934	7.818000	0.86416	2.431000	0.82371	0.561000	0.74099	ACA	0	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C		0.498	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TULP3	protein_coding	OTTHUMT00000398468.1	42	199	0	0.00	0	0	C	NM_003324	0	0		3043639	1	no_errors	ENST00000448120	ensembl	human	known	74_37	missense	34	139	39.29	28.93	22	57	SNP	1	T
UHRF1	29128	genome.wustl.edu	37	19	4961946	4961946	+	RNA	SNP	A	A	G			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr19:4961946A>G	ENST00000592666.1	+	0	4089							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TAATTTTACCAAAGTTTGCAG	0.303																																							0											0																																												0			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4961946A>G			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	0	NULL	ENST00000592666.1	37	NULL		19																																																																																			0	0		0.303	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	processed_transcript	OTTHUMT00000450444.1	19	193	0	1.03	0	2	A	NM_001048201	0	0		4961946	1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	19	207	13.64	4.61	3	10	SNP	1	G
UHRF1	29128	genome.wustl.edu	37	19	4961971	4961971	+	RNA	SNP	A	A	G			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr19:4961971A>G	ENST00000592666.1	+	0	4114							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TACCTCAATAAAACAGGGATA	0.284																																							0											0																																												0			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4961971A>G			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	0	NULL	ENST00000592666.1	37	NULL		19																																																																																			0	0		0.284	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	processed_transcript	OTTHUMT00000450444.1	17	190	0	1.04	0	2	A	NM_001048201	0	0		4961971	1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	19	209	13.64	4.57	3	10	SNP	0.017	G
LOC285638	285638	genome.wustl.edu	37	5	108660025	108660025	+	lincRNA	SNP	C	C	A			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr5:108660025C>A	ENST00000512693.1	-	0	2045																											cataaattttcttgaaacatt	0.368																																							0											0																																												0																															5.37:g.108660025C>A				RNA	SNP	0	NULL	ENST00000512693.1	37	NULL		5																																																																																			0	0		0.368	CTD-2587M2.1-001	KNOWN	basic	lincRNA	LOC285638	lincRNA	OTTHUMT00000370753.1	19	0	0	0.00	0	0	C		0	0		108660025	-1	no_errors	ENST00000512693	ensembl	human	known	74_37	rna	0	0	100	0.00	2	0	SNP	0.001	A
NPIPB15	440348	genome.wustl.edu	37	16	74425946	74425946	+	Nonsense_Mutation	SNP	C	C	T	rs369331764		TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr16:74425946C>T	ENST00000429990.1	+	7	1396	c.1300C>T	c.(1300-1302)Caa>Taa	p.Q434*				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	434						extracellular region (GO:0005576)		p.Q373*(1)|p.Q434*(1)									aatcaaaaaacaaaaCAAAAC	0.338																																							0											2	Substitution - Nonsense(2)	endometrium(2)											1.0	2.0	1.0					16																	74425946		800	1861	2661	SO:0001587	stop_gained	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1300C>T	16.37:g.74425946C>T	ENSP00000411140:p.Gln434*		C9J9U8	Nonsense_Mutation	SNP	NULL	p.Q434*	ENST00000429990.1	37	c.1300		16	.	.	.	.	.	.	.	.	.	.	-	9.643	1.139392	0.21205	.	.	ENSG00000196436	ENST00000504746;ENST00000429990	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.25876	N	0.983642	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	2.8176	0.05461	0.4997:0.4997:3.0E-4:3.0E-4	.	.	.	.	X	298;434	.	ENSP00000411140:Q434X	Q	+	1	0	NPIPL2	72983447	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	CAA	0	NULL		0.338	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPB15	protein_coding	OTTHUMT00000346597.2	29	0	3.33	0.00	1	0	C	NM_001018059	rs369331764	C->T		74425946	1	no_errors	ENST00000429990	ensembl	human	known	74_37	nonsense	49	0	7.55	0.00	4	0	SNP	0.968	T
AFF3	3899	genome.wustl.edu	37	2	100218011	100218013	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-XU-A931-01A-11D-A423-09	TCGA-XU-A931-10A-01D-A426-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a89eec5a-6aaa-4369-aace-5e5085506262	2bfd1470-1d6b-4f5c-9ff0-78fc8697605c	g.chr2:100218011_100218013delGCT	ENST00000409236.2	-	12	1367_1369	c.1255_1257delAGC	c.(1255-1257)agcdel	p.S419del	AFF3_ENST00000409579.1_In_Frame_Del_p.S444del|AFF3_ENST00000317233.4_In_Frame_Del_p.S419del|AFF3_ENST00000356421.2_In_Frame_Del_p.S444del			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	419	Poly-Ser.				embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						tgctgctgccgctgctgctgctg	0.685																																							0											0									,	365,3157		33,299,1429					,	-5.4	0.9			10	878,6286		79,720,2783	no	coding,coding	AFF3	NM_002285.2,NM_001025108.1	,	112,1019,4212	A1A1,A1R,RR		12.2557,10.3634,11.632	,	,		1243,9443				SO:0001651	inframe_deletion	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1255_1257delAGC	2.37:g.100218020_100218022delGCT	ENSP00000387207:p.Ser419del		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	In_Frame_Del	DEL	pfam_TF_AF4/FMR2	p.S444in_frame_del	ENST00000409236.2	37	c.1332_1330	CCDS42723.1	2																																																																																			0	pfam_TF_AF4/FMR2		0.685	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	protein_coding	OTTHUMT00000328982.3	57	17	0	0.00	0	0	GCT	NM_002285	0	0		100218013	-1	no_errors	ENST00000356421	ensembl	human	known	74_37	in_frame_del	32	6	13.51	0.00	5	0	DEL	1.000:1.000:1.000	0
