#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
RBAK-RBAKDN	100533952	genome.wustl.edu	37	7	5112706	5112706	+	Missense_Mutation	SNP	G	G	C			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr7:5112706G>C	ENST00000407184.1	+	8	855	c.589G>C	c.(589-591)Gcg>Ccg	p.A197P	RBAK-RBAKDN_ENST00000396904.2_3'UTR|RBAKDN_ENST00000498308.1_lincRNA					RBAK-RBAKDN readthrough																		GCAGGCCACGGCGACAGGCTC	0.672																																							0											0													32.0	35.0	34.0					7																	5112706		2203	4300	6503	SO:0001583	missense	0				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.589G>C	7.37:g.5112706G>C	ENSP00000385560:p.Ala197Pro			Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.A197P	ENST00000407184.1	37	c.589		7	.	.	.	.	.	.	.	.	.	.	G	10.80	1.453608	0.26161	.	.	ENSG00000146587	ENST00000407184	T	0.01152	5.26	1.96	0.0141	0.14098	.	.	.	.	.	T	0.01905	0.0060	.	.	.	.	.	.	D	0.53885	0.963	P	0.49361	0.608	T	0.44787	-0.9305	7	0.87932	D	0	.	4.3208	0.11016	0.3798:0.0:0.6202:0.0	.	65	A6NC62	YG007_HUMAN	P	197	ENSP00000385560:A197P	ENSP00000385560:A197P	A	+	1	0	RBAK	5079232	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.171000	0.16685	-0.012000	0.14223	0.563000	0.77884	GCG	0	NULL		0.672	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	RBAK-RBAKDN	protein_coding	OTTHUMT00000472007.1	77	84	1.28	1.18	1	1	G		0	0		5112706	1	no_errors	ENST00000407184	ensembl	human	known	74_37	missense	65	67	20.73	8.22	17	6	SNP	0.001	C
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	435	147	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	391	132	8.43	8.97	36	13	SNP	1	A
GPR158	57512	genome.wustl.edu	37	10	25684867	25684867	+	Missense_Mutation	SNP	G	G	A	rs369165750		TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr10:25684867G>A	ENST00000376351.3	+	3	1395	c.1036G>A	c.(1036-1038)Gtt>Att	p.V346I	RN7SKP220_ENST00000410611.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	346					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCTAGGATTCGTTCTTGGAGC	0.408																																							0											0								G	ILE/VAL	0,4406		0,0,2203	145.0	125.0	132.0		1036	5.3	1.0	10		132	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPR158	NM_020752.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	346/1216	25684867	1,13005	2203	4300	6503	SO:0001583	missense	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1036G>A	10.37:g.25684867G>A	ENSP00000365529:p.Val346Ile		Q6QR81|Q9ULT3	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.V346I	ENST00000376351.3	37	c.1036	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802124	0.70682	0.0	1.16E-4	ENSG00000151025	ENST00000376351	T	0.61040	0.14	5.3	5.3	0.74995	.	0.000000	0.52532	D	0.000064	T	0.56470	0.1987	L	0.45051	1.395	0.52099	D	0.999945	D	0.57571	0.98	P	0.45377	0.478	T	0.56378	-0.7989	10	0.37606	T	0.19	.	19.3159	0.94213	0.0:0.0:1.0:0.0	.	346	Q5T848	GP158_HUMAN	I	346	ENSP00000365529:V346I	ENSP00000365529:V346I	V	+	1	0	GPR158	25724873	1.000000	0.71417	0.984000	0.44739	0.922000	0.55478	6.722000	0.74735	2.630000	0.89119	0.591000	0.81541	GTT	0	NULL		0.408	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	58	267	0	0.00	0	0	G	XM_166110	rs369165750	G->A		25684867	1	no_errors	ENST00000376351	ensembl	human	known	74_37	missense	37	257	9.76	7.55	4	21	SNP	1	A
TAOK3	51347	genome.wustl.edu	37	12	118599688	118599688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr12:118599688C>A	ENST00000392533.3	-	18	2534	c.2044G>T	c.(2044-2046)Gaa>Taa	p.E682*	TAOK3_ENST00000419821.2_Nonsense_Mutation_p.E682*|TAOK3_ENST00000537952.1_Nonsense_Mutation_p.E222*|TAOK3_ENST00000543709.1_5'Flank	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	682					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTTTCCAGTTCCGTCTGGTGC	0.498																																							0											0													227.0	196.0	206.0					12																	118599688		2203	4300	6503	SO:0001587	stop_gained	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.2044G>T	12.37:g.118599688C>A	ENSP00000376317:p.Glu682*		Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E682*	ENST00000392533.3	37	c.2044	CCDS9188.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.605518|12.605518	0.99681|0.99681	.|.	.|.	ENSG00000135090|ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952|ENST00000359811	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.81997	.|0.4941	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.83314	.|-0.0021	.|4	0.87932|0.87932	D|D	0|0	.|.	19.6982|19.6982	0.96039|0.96039	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	682;682;222|299	.|.	ENSP00000376317:E682X|ENSP00000352863:G299V	E|G	-|-	1|2	0|0	TAOK3|TAOK3	117084071|117084071	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.609000|7.609000	0.82925|0.82925	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GAA|GGA	0	NULL		0.498	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	protein_coding	OTTHUMT00000401456.2	23	187	0	0.00	0	0	C	NM_016281	0	0		118599688	-1	no_errors	ENST00000392533	ensembl	human	known	74_37	nonsense	18	253	18.18	7.94	4	22	SNP	1	A
DPEP1	1800	genome.wustl.edu	37	16	89696827	89696827	+	Silent	SNP	C	C	T	rs548760657		TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr16:89696827C>T	ENST00000393092.3	+	2	300	c.9C>T	c.(7-9)agC>agT	p.S3S	DPEP1_ENST00000261615.4_Silent_p.S3S|DPEP1_ENST00000421184.1_Silent_p.S3S	NM_004413.3	NP_004404.1	P16444	DPEP1_HUMAN	dipeptidase 1 (renal)	3					antibiotic metabolic process (GO:0016999)|arachidonic acid metabolic process (GO:0019369)|cellular lactam catabolic process (GO:0072340)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to nitric oxide (GO:0071732)|glutathione metabolic process (GO:0006749)|homocysteine metabolic process (GO:0050667)|leukotriene metabolic process (GO:0006691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dipeptidyl-peptidase activity (GO:0008239)|GPI anchor binding (GO:0034235)|metallodipeptidase activity (GO:0070573)|metalloexopeptidase activity (GO:0008235)|modified amino acid binding (GO:0072341)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	14		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CCATGTGGAGCGGATGGTGGC	0.637																																							0											0													66.0	66.0	66.0					16																	89696827		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS10982.1	16q24	2011-07-22			ENSG00000015413	ENSG00000015413	3.4.13.19		3002	protein-coding gene	gene with protein product		179780					Standard	NM_004413		Approved		uc002fnr.4	P16444	OTTHUMG00000138052	ENST00000393092.3:c.9C>T	16.37:g.89696827C>T			D3DX80|Q96AK2	Silent	SNP	pfam_Peptidase_M19	p.S3	ENST00000393092.3	37	c.9	CCDS10982.1	16																																																																																			0	NULL		0.637	DPEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPEP1	protein_coding	OTTHUMT00000423058.1	57	79	0	0.00	0	0	C	NM_001128141	rs548760657	C->T		89696827	1	no_errors	ENST00000261615	ensembl	human	known	74_37	silent	61	70	8.96	5.41	6	4	SNP	0.103	T
KCNH4	23415	genome.wustl.edu	37	17	40318361	40318361	+	Silent	SNP	G	G	A			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr17:40318361G>A	ENST00000264661.3	-	10	2126	c.1794C>T	c.(1792-1794)tcC>tcT	p.S598S	KCNH4_ENST00000607371.1_Silent_p.S598S	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	598					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CAAGCGAGCCGGAGCAGACAT	0.627																																					NSCLC(117;707 1703 2300 21308 31858)		0											0													57.0	51.0	53.0					17																	40318361		2203	4300	6503	SO:0001819	synonymous_variant	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1794C>T	17.37:g.40318361G>A				Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.S598	ENST00000264661.3	37	c.1794	CCDS11420.1	17																																																																																			0	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.627	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	protein_coding	OTTHUMT00000449791.2	22	139	0	0.00	0	0	G	NM_012285	0	0		40318361	-1	no_errors	ENST00000264661	ensembl	human	known	74_37	silent	25	106	19.35	5.36	6	6	SNP	0.665	A
CCL25	6370	genome.wustl.edu	37	19	8122791	8122791	+	Missense_Mutation	SNP	A	A	G			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr19:8122791A>G	ENST00000390669.3	+	4	482	c.432A>G	c.(430-432)atA>atG	p.I144M	CCL25_ENST00000253451.4_Missense_Mutation_p.I143M			O15444	CCL25_HUMAN	chemokine (C-C motif) ligand 25	144					cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR10 chemokine receptor binding (GO:0031735)|chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|hormone activity (GO:0005179)			NS(1)|endometrium(1)|lung(1)|skin(1)|urinary_tract(1)	5						ccctcctgatatcagctaatt	0.478																																							0											0													160.0	151.0	154.0					19																	8122791		2028	4182	6210	SO:0001583	missense	0			U86358	CCDS12194.1, CCDS56080.1	19p13.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000131142	ENSG00000131142		"""Chemokine ligands"", ""Endogenous ligands"""	10624	protein-coding gene	gene with protein product	"""Ck beta-15"", ""thymus expressed chemokine"", ""TECKvar"""	602565	"""small inducible cytokine subfamily A (Cys-Cys), member 25"""	SCYA25		9285413, 9722960	Standard	NM_005624		Approved	TECK, Ckb15	uc002mjd.3	O15444	OTTHUMG00000141287	ENST00000390669.3:c.432A>G	19.37:g.8122791A>G	ENSP00000375086:p.Ile144Met		A1L4J4|A6NI52|A8K9E7|B5MCA5|Q96KJ7	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.I144M	ENST00000390669.3	37	c.432	CCDS12194.1	19	.	.	.	.	.	.	.	.	.	.	A	3.921	-0.018141	0.07681	.	.	ENSG00000131142	ENST00000253451;ENST00000390669	T;T	0.15139	2.45;2.45	0.996	-0.196	0.13232	.	.	.	.	.	T	0.08492	0.0211	N	0.14661	0.345	0.09310	N	1	B;B	0.21071	0.051;0.051	B;B	0.12837	0.008;0.008	T	0.31194	-0.9952	9	0.62326	D	0.03	.	3.6839	0.08320	0.5895:0.4105:0.0:0.0	.	144;143	O15444;A6NI52	CCL25_HUMAN;.	M	143;144	ENSP00000253451:I143M;ENSP00000375086:I144M	ENSP00000253451:I143M	I	+	3	3	CCL25	8028791	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.107000	0.15375	-0.126000	0.11682	0.254000	0.18369	ATA	0	NULL		0.478	CCL25-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CCL25	protein_coding	OTTHUMT00000280522.1	90	236	0	0.00	0	0	A	NM_005624	0	0		8122791	1	no_errors	ENST00000390669	ensembl	human	known	74_37	missense	67	225	12.99	5.06	10	12	SNP	0	G
HELZ2	85441	genome.wustl.edu	37	20	62191616	62191616	+	Missense_Mutation	SNP	G	G	A	rs561821964		TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr20:62191616G>A	ENST00000467148.1	-	17	7634	c.7565C>T	c.(7564-7566)aCg>aTg	p.T2522M	HELZ2_ENST00000427522.2_Missense_Mutation_p.T1953M	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2522	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GTTGTAGGGCGTGAGGACGGC	0.677													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15817	0.0		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0													44.0	31.0	35.0					20																	62191616		2185	4296	6481	SO:0001583	missense	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7565C>T	20.37:g.62191616G>A	ENSP00000417401:p.Thr2522Met		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.T2522M	ENST00000467148.1	37	c.7565	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182479	0.38511	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.95035	-3.59;-3.59	3.94	2.95	0.34219	.	0.364193	0.25827	N	0.028047	D	0.97873	0.9301	H	0.97186	3.955	0.29207	N	0.874841	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.93410	0.6768	10	0.87932	D	0	-16.7696	11.3755	0.49726	0.0:0.2948:0.7052:0.0	.	2522;1953	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	M	1953;2522	ENSP00000393257:T1953M;ENSP00000417401:T2522M	ENSP00000393257:T1953M	T	-	2	0	RP4-697K14.7	61662060	1.000000	0.71417	0.766000	0.31476	0.192000	0.23643	3.248000	0.51430	1.772000	0.52199	0.491000	0.48974	ACG	0	superfamily_P-loop_NTPase		0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	57	140	0	0.00	0	0	G	NM_001037335	rs561821964	G->A		62191616	-1	no_errors	ENST00000467148	ensembl	human	known	74_37	missense	43	117	10.42	4.84	5	6	SNP	0.843	A
FTHL17	53940	genome.wustl.edu	37	X	31089833	31089833	+	Missense_Mutation	SNP	G	G	T			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chrX:31089833G>T	ENST00000359202.3	-	1	337	c.238C>A	c.(238-240)Cac>Aac	p.H80N		NM_031894.2	NP_114100.1	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	80	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)		ferric iron binding (GO:0008199)			endometrium(2)|large_intestine(2)|liver(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	23						AGGCAGATGTGGCCACCGCGC	0.602																																							0											0													61.0	55.0	57.0					X																	31089833		2202	4300	6502	SO:0001583	missense	0			AF285592	CCDS14227.1	Xp21.2	2010-07-06			ENSG00000132446	ENSG00000132446			3987	protein-coding gene	gene with protein product	"""cancer/testis antigen 38"""	300308				11279525	Standard	NM_031894		Approved	CT38	uc004dcl.1	Q9BXU8	OTTHUMG00000021332	ENST00000359202.3:c.238C>A	X.37:g.31089833G>T	ENSP00000368207:p.His80Asn		Q6NT24|Q6NTE2	Missense_Mutation	SNP	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	p.H80N	ENST00000359202.3	37	c.238	CCDS14227.1	X	.	.	.	.	.	.	.	.	.	.	G	11.95	1.791123	0.31685	.	.	ENSG00000132446	ENST00000359202	T	0.62788	0.0	3.46	0.504	0.16946	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.408346	0.25786	N	0.028318	T	0.46698	0.1406	L	0.41710	1.295	0.09310	N	0.999999	B	0.13594	0.008	B	0.23275	0.045	T	0.41840	-0.9486	10	0.87932	D	0	.	3.9133	0.09213	0.2418:0.0:0.5694:0.1888	.	80	Q9BXU8	FHL17_HUMAN	N	80	ENSP00000368207:H80N	ENSP00000368207:H80N	H	-	1	0	FTHL17	30999754	0.001000	0.12720	0.003000	0.11579	0.002000	0.02628	0.844000	0.27654	-0.014000	0.14175	-0.269000	0.10298	CAC	0	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron		0.602	FTHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTHL17	protein_coding	OTTHUMT00000056178.1	28	8	0	0.00	0	0	G	NM_031894	0	0		31089833	-1	no_errors	ENST00000359202	ensembl	human	known	74_37	missense	22	5	15.38	0.00	4	0	SNP	0.974	T
PPP1R14B	26472	genome.wustl.edu	37	11	64014017	64014017	+	Silent	SNP	C	C	G	rs1063811	byFrequency	TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr11:64014017C>G	ENST00000309318.3	-	1	396	c.129G>C	c.(127-129)ggG>ggC	p.G43G	RP11-783K16.13_ENST00000545800.1_lincRNA|PPP1R14B_ENST00000392210.2_5'Flank|RP11-783K16.5_ENST00000544553.1_RNA|PPP1R14B_ENST00000542235.1_5'Flank|RP11-783K16.5_ENST00000538355.1_RNA	NM_138689.2	NP_619634.1	Q96C90	PP14B_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14B	43					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			kidney(1)|lung(1)|pancreas(1)	3						CATCGTCCGCCCCGCCCGGGC	0.721																																							0											0																																										SO:0001819	synonymous_variant	0			X91195	CCDS31596.1	11q13	2012-04-17		2001-07-06	ENSG00000173457	ENSG00000173457		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9057	protein-coding gene	gene with protein product		601140		PLCB3N		8838322, 10606530	Standard	NM_138689		Approved	SOM172, PNG, PHI-1	uc001nza.3	Q96C90	OTTHUMG00000167846	ENST00000309318.3:c.129G>C	11.37:g.64014017C>G			Q504S7|Q7KZD7	Silent	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.G43	ENST00000309318.3	37	c.129	CCDS31596.1	11																																																																																			0	superfamily_PP1_inhibitor		0.721	PPP1R14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14B	protein_coding	OTTHUMT00000396586.2	64	14	0	0.00	0	0	C	NM_138689	rs1063811	C->G		64014017	-1	no_errors	ENST00000309318	ensembl	human	known	74_37	silent	39	7	9.3	0.00	4	0	SNP	0	G
TUBB8P12	260334	genome.wustl.edu	37	18	47408	47408	+	Silent	SNP	G	G	A			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr18:47408G>A	ENST00000573909.1	-	3	1747	c.1215C>T	c.(1213-1215)gcC>gcT	p.A405A	RP11-683L23.1_ENST00000594555.1_5'Flank|RP11-683L23.1_ENST00000308911.6_Silent_p.A439A																							cctcctcctcggcatactcct	0.517																																							0											0																																										SO:0001819	synonymous_variant	0																														ENST00000573909.1:c.1215C>T	18.37:g.47408G>A				Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.A439	ENST00000573909.1	37	c.1317		18																																																																																			0	prints_Alpha_tubulin		0.517	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	ENSG00000173213	protein_coding	OTTHUMT00000439819.1	21	0	0	0.00	0	0	G		0	0		47408	-1	no_errors	ENST00000308911	ensembl	human	known	74_37	silent	20	0	25.93	0.00	7	0	SNP	0.931	A
BHLHA9	727857	genome.wustl.edu	37	17	1174394	1174394	+	Frame_Shift_Del	DEL	C	C	-			TCGA-YT-A95E-01A-11D-A428-09	TCGA-YT-A95E-10A-01D-A42B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3bce0fcd-ac9e-4258-8d3d-512182391086	408f6213-e92d-414e-b095-4d09713ba744	g.chr17:1174394delC	ENST00000391429.1	+	1	542	c.537delC	c.(535-537)tgcfs	p.C179fs		NM_001164405.1	NP_001157877.1	Q7RTU4	BHA09_HUMAN	basic helix-loop-helix family, member a9	179	Pro-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)										GCGCCTCGTGCCCCCCGCACG	0.821																																							0											0													1.0	1.0	1.0					17																	1174394		17	58	75	SO:0001589	frameshift_variant	0				CCDS45560.1	17p13.3	2009-01-12	2009-01-12		ENSG00000205899	ENSG00000205899		"""Basic helix-loop-helix proteins"""	35126	protein-coding gene	gene with protein product		615416				14516699, 18557763	Standard	NM_001164405		Approved	bHLHa9, BHLHF42	uc021tnd.1	Q7RTU4	OTTHUMG00000132192	ENST00000391429.1:c.537delC	17.37:g.1174394delC	ENSP00000375248:p.Cys179fs		A8MSH6	Frame_Shift_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P181fs	ENST00000391429.1	37	c.537	CCDS45560.1	17																																																																																			0	NULL		0.821	BHLHA9-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BHLHA9	protein_coding	OTTHUMT00000255245.1	8	3	0	0.00	0	0	C	XM_001125971	0	0		1174394	1	no_errors	ENST00000391429	ensembl	human	known	74_37	frame_shift_del	8	2	20	0.00	2	0	DEL	0.021	0
