#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
IQSEC2	23096	genome.wustl.edu	37	X	53272536	53272536	+	Missense_Mutation	SNP	C	C	T			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chrX:53272536C>T	ENST00000375368.5	-	8	3037	c.2837G>A	c.(2836-2838)cGc>cAc	p.R946H	IQSEC2_ENST00000396435.3_Missense_Mutation_p.R956H|IQSEC2_ENST00000375365.2_Missense_Mutation_p.R751H			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	946	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						aACAATCATGCGCTCCACAGC	0.597																																							0											0													74.0	53.0	60.0					X																	53272536		2086	3992	6078	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2837G>A	X.37:g.53272536C>T	ENSP00000364517:p.Arg946His		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_P-loop_NTPase,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.R956H	ENST00000375368.5	37	c.2867		X	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852885	0.91355	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.13196	2.62;2.61;2.65	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	L	0.55481	1.735	0.58432	D	0.999999	D;D	0.57571	0.98;0.97	P;P	0.50490	0.553;0.642	T	0.00800	-1.1561	10	0.72032	D	0.01	.	16.9544	0.86254	0.0:1.0:0.0:0.0	.	956;751	Q5JU85-2;Q5JU85-3	.;.	H	956;946;751	ENSP00000379712:R956H;ENSP00000364517:R946H;ENSP00000364514:R751H	ENSP00000364514:R751H	R	-	2	0	IQSEC2	53289261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.447000	0.44917	2.354000	0.79902	0.589000	0.80489	CGC	0	NULL		0.597	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	protein_coding		25	100	0	0.00	0	0	C	XM_291345	0	0		53272536	-1	no_errors	ENST00000396435	ensembl	human	known	74_37	missense	13	91	18.75	25.41	3	31	SNP	1	T
TBC1D8B	54885	genome.wustl.edu	37	X	106064109	106064109	+	Missense_Mutation	SNP	G	G	A			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chrX:106064109G>A	ENST00000357242.5	+	3	418	c.244G>A	c.(244-246)Gcc>Acc	p.A82T	TBC1D8B_ENST00000310452.2_Missense_Mutation_p.A82T|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.A82T|TBC1D8B_ENST00000481617.2_Missense_Mutation_p.A82T	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	82							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTAATCAGGAGCCAACAGAGA	0.274																																							0											0													56.0	53.0	54.0					X																	106064109		2202	4298	6500	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.244G>A	X.37:g.106064109G>A	ENSP00000349781:p.Ala82Thr		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.A82T	ENST00000357242.5	37	c.244	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711166	0.48517	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.14	4.26	0.50523	.	0.066769	0.64402	D	0.000013	T	0.27205	0.0667	L	0.31664	0.95	0.47778	D	0.999517	P;D;P	0.58620	0.952;0.983;0.877	P;P;B	0.60949	0.536;0.881;0.339	T	0.02093	-1.1215	10	0.14656	T	0.56	-3.8376	12.8793	0.58008	0.0:0.0:0.836:0.164	.	82;82;82	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	T	82	ENSP00000349781:A82T;ENSP00000310675:A82T;ENSP00000421375:A82T;ENSP00000276175:A82T	ENSP00000276175:A82T	A	+	1	0	TBC1D8B	105950765	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.493000	0.60341	1.011000	0.39340	0.415000	0.27848	GCC	0	NULL		0.274	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	protein_coding	OTTHUMT00000057807.2	306	207	0	0.00	0	0	G	NM_017752	0	0		106064109	1	no_errors	ENST00000357242	ensembl	human	known	74_37	missense	160	188	20.4	21.67	41	52	SNP	1	A
ATXN7L2	127002	genome.wustl.edu	37	1	110031490	110031490	+	Missense_Mutation	SNP	C	C	T			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr1:110031490C>T	ENST00000369870.3	+	7	820	c.805C>T	c.(805-807)Cgg>Tgg	p.R269W		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	269	SCA7. {ECO:0000255|PROSITE- ProRule:PRU00838}.									breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		ACACCAGCGCCGGGAAGTCCA	0.617																																							0											0													45.0	51.0	49.0					1																	110031490		2203	4300	6503	SO:0001583	missense	0			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.805C>T	1.37:g.110031490C>T	ENSP00000358886:p.Arg269Trp			Missense_Mutation	SNP	pfam_SCA7_dom	p.R269W	ENST00000369870.3	37	c.805	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859930	0.71834	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.68025	-0.3	5.72	2.69	0.31865	SCA7 domain (2);	0.112000	0.39985	N	0.001214	T	0.70701	0.3254	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.68353	0.957	T	0.74441	-0.3664	10	0.87932	D	0	-9.4129	12.7002	0.57026	0.4353:0.5647:0.0:0.0	.	269	Q5T6C5	AT7L2_HUMAN	W	269	ENSP00000358886:R269W	ENSP00000358886:R269W	R	+	1	2	ATXN7L2	109833013	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.095000	0.30964	0.280000	0.22209	0.561000	0.74099	CGG	0	pfam_SCA7_dom		0.617	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	protein_coding	OTTHUMT00000030331.1	31	77	0	0.00	0	0	C	NM_153340	0	0		110031490	1	no_errors	ENST00000369870	ensembl	human	known	74_37	missense	20	121	13.04	8.33	3	11	SNP	1	T
NES	10763	genome.wustl.edu	37	1	156640813	156640813	+	Missense_Mutation	SNP	G	G	A			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr1:156640813G>A	ENST00000368223.3	-	4	3299	c.3167C>T	c.(3166-3168)cCc>cTc	p.P1056L		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1056	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCCCCTGGGGAGCCTGGAG	0.667																																							0											0													30.0	36.0	34.0					1																	156640813		2195	4288	6483	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3167C>T	1.37:g.156640813G>A	ENSP00000357206:p.Pro1056Leu		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_IF	p.P1056L	ENST00000368223.3	37	c.3167	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114172	0.37339	.	.	ENSG00000132688	ENST00000368223	D	0.84944	-1.92	5.16	2.08	0.27032	.	0.478255	0.15778	N	0.245082	T	0.62998	0.2474	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.60367	-0.7277	10	0.87932	D	0	.	5.9543	0.19265	0.1747:0.0:0.6688:0.1564	.	1056	P48681	NEST_HUMAN	L	1056	ENSP00000357206:P1056L	ENSP00000357206:P1056L	P	-	2	0	NES	154907437	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	0.001000	0.13038	1.325000	0.45301	-0.219000	0.12488	CCC	0	NULL		0.667	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	protein_coding	OTTHUMT00000082844.2	42	57	0	0.00	0	0	G	NM_006617	0	0		156640813	-1	no_errors	ENST00000368223	ensembl	human	known	74_37	missense	21	46	19.23	26.98	5	17	SNP	0.001	A
FNIP1	96459	genome.wustl.edu	37	5	131006239	131006239	+	Missense_Mutation	SNP	C	C	T			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr5:131006239C>T	ENST00000510461.1	-	15	3120	c.3025G>A	c.(3025-3027)Gtg>Atg	p.V1009M	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.V981M|FNIP1_ENST00000307954.8_Missense_Mutation_p.V964M	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	1009					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		AAGTCAGGCACATAAGATGAG	0.478																																							0											0													155.0	141.0	146.0					5																	131006239		2203	4300	6503	SO:0001583	missense	0			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.3025G>A	5.37:g.131006239C>T	ENSP00000421985:p.Val1009Met		D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	NULL	p.V1009M	ENST00000510461.1	37	c.3025	CCDS34227.1	5	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693854	0.30052	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.13901	2.55;2.55;2.56	6.02	6.02	0.97574	.	.	.	.	.	T	0.12305	0.0299	N	0.21282	0.65	0.80722	D	1	B;P	0.37731	0.302;0.607	B;B	0.38921	0.285;0.28	T	0.14337	-1.0476	9	0.11794	T	0.64	-6.54	20.5373	0.99239	0.0:1.0:0.0:0.0	.	981;1009	Q8TF40-3;Q8TF40	.;FNIP1_HUMAN	M	981;964;761;1009	ENSP00000309266:V981M;ENSP00000310453:V964M;ENSP00000421985:V1009M	ENSP00000310453:V964M	V	-	1	0	FNIP1	131034138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.378000	0.79679	2.857000	0.98124	0.650000	0.86243	GTG	0	NULL		0.478	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP1	protein_coding	OTTHUMT00000370077.1	123	167	0.81	0.00	1	0	C	NM_133372	0	0		131006239	-1	no_errors	ENST00000510461	ensembl	human	known	74_37	missense	58	154	23.08	19.37	18	37	SNP	1	T
HEBP2	23593	genome.wustl.edu	37	6	138726307	138726307	+	Missense_Mutation	SNP	A	A	G			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr6:138726307A>G	ENST00000607197.1	+	2	405	c.128A>G	c.(127-129)tAt>tGt	p.Y43C	HEBP2_ENST00000367697.3_Missense_Mutation_p.Y43C|HEBP2_ENST00000448741.1_Missense_Mutation_p.Y54C	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	43					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		ATCCGACACTATGGACCAGCC	0.488																																							0											0													127.0	125.0	126.0					6																	138726307		2203	4300	6503	SO:0001583	missense	0			AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.128A>G	6.37:g.138726307A>G	ENSP00000475750:p.Tyr43Cys		Q96P57	Missense_Mutation	SNP	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom	p.Y43C	ENST00000607197.1	37	c.128	CCDS5191.1	6	.	.	.	.	.	.	.	.	.	.	A	24.0	4.481828	0.84747	.	.	ENSG00000051620	ENST00000448741;ENST00000058691;ENST00000367697	T;T;T	0.40476	1.03;1.03;1.03	5.11	5.11	0.69529	Regulatory factor, effector, bacterial (1);	0.000000	0.85682	D	0.000000	T	0.61788	0.2375	M	0.88031	2.925	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	T	0.70375	-0.4889	10	0.66056	D	0.02	.	12.4296	0.55567	1.0:0.0:0.0:0.0	.	43	Q9Y5Z4	HEBP2_HUMAN	C	54;43;43	ENSP00000392101:Y54C;ENSP00000058691:Y43C;ENSP00000356670:Y43C	ENSP00000058691:Y43C	Y	+	2	0	HEBP2	138768000	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	3.611000	0.54132	1.925000	0.55765	0.454000	0.30748	TAT	0	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom		0.488	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEBP2	protein_coding	OTTHUMT00000042426.2	78	164	1.27	0.00	1	0	A		0	0		138726307	1	no_errors	ENST00000607197	ensembl	human	known	74_37	missense	53	192	18.46	15.35	12	35	SNP	1	G
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H|GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	438	79	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	287	102	17.77	23.31	62	31	SNP	1	A
SVEP1	79987	genome.wustl.edu	37	9	113259212	113259212	+	Splice_Site	SNP	G	G	A	rs75422692	byFrequency	TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr9:113259212G>A	ENST00000401783.2	-	8	2019	c.1683C>T	c.(1681-1683)gaC>gaT	p.D561D	SVEP1_ENST00000374469.1_Splice_Site_p.D538D|SVEP1_ENST00000302728.8_Splice_Site_p.D561D|SVEP1_ENST00000374461.1_Splice_Site_p.D538D|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	561	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.|Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAGCCTCCACGTCTAACTCAG	0.393													G|||	2	0.000399361	0.0	0.0	5008	,	,		20613	0.001		0.001	False		,,,				2504	0.0						0.9996,0.0003994											0								G		1,3707		0,1,1853	58.0	50.0	53.0		1683	-0.9	1.0	9	dbSNP_131	53	0,8072		0,0,4036	no	coding-synonymous-near-splice	SVEP1	NM_153366.3		0,1,5889	AA,AG,GG		0.0,0.027,0.0085		561/3572	113259212	1,11779	1854	4036	5890	SO:0001630	splice_region_variant	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1682-1C>T	9.37:g.113259212G>A			Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.D561	ENST00000401783.2	37	c.1683	CCDS48004.1	9																																																																																			0	pfam_Hyalin,pfscan_Hyalin,pfscan_Sushi_SCR_CCP		0.393	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		71	130	0	0.00	0	0	G		rs75422692	G->A	Silent	113259212	-1	no_errors	ENST00000401783	ensembl	human	known	74_37	silent	37	161	26	17.01	13	33	SNP	0.99	A
ENKUR	219670	genome.wustl.edu	37	10	25304802	25304802	+	Missense_Mutation	SNP	G	G	A			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr10:25304802G>A	ENST00000331161.4	-	1	283	c.64C>T	c.(64-66)Ccc>Tcc	p.P22S	ENKUR_ENST00000376363.1_Missense_Mutation_p.P22S|THNSL1_ENST00000524413.1_5'Flank|THNSL1_ENST00000376356.4_5'Flank	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	22						motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GGAGGCTGGGGAGGCTCCTTC	0.408																																							0											0													116.0	109.0	111.0					10																	25304802		2203	4300	6503	SO:0001583	missense	0			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.64C>T	10.37:g.25304802G>A	ENSP00000331044:p.Pro22Ser		A8K8Y0|D3DRV2	Missense_Mutation	SNP	NULL	p.P22S	ENST00000331161.4	37	c.64	CCDS7146.1	10	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356583	0.24598	.	.	ENSG00000151023	ENST00000331161;ENST00000376363	.	.	.	6.17	2.96	0.34315	.	0.724115	0.15017	N	0.285218	T	0.24851	0.0603	L	0.28274	0.84	0.22796	N	0.998723	B	0.18741	0.03	B	0.17979	0.02	T	0.12915	-1.0529	9	0.17832	T	0.49	-5.6683	5.7366	0.18069	0.0733:0.3582:0.4407:0.1278	.	22	Q8TC29	ENKUR_HUMAN	S	22	.	ENSP00000331044:P22S	P	-	1	0	ENKUR	25344808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.892000	0.28322	1.586000	0.49944	0.655000	0.94253	CCC	0	NULL		0.408	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	protein_coding	OTTHUMT00000047239.2	63	143	0	0.00	0	0	G	NM_145010	0	0		25304802	-1	no_errors	ENST00000331161	ensembl	human	known	74_37	missense	23	158	28.12	11.60	9	21	SNP	0.95	A
EPC1	80314	genome.wustl.edu	37	10	32582521	32582521	+	Splice_Site	SNP	T	T	A			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr10:32582521T>A	ENST00000263062.8	-	3	727	c.458A>T	c.(457-459)cAg>cTg	p.Q153L	EPC1_ENST00000375110.2_Splice_Site_p.Q103L|EPC1_ENST00000319778.6_Splice_Site_p.Q153L	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	153					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				AAGTTGTACCTGCTGACCACT	0.368																																							0											0													61.0	61.0	61.0					10																	32582521		2203	4300	6503	SO:0001630	splice_region_variant	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.459+1A>T	10.37:g.32582521T>A			B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.Q153L	ENST00000263062.8	37	c.458	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	T	26.5	4.746873	0.89663	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.80691	0.4671	M	0.83118	2.625	0.80722	D	1	P;D;D;B	0.76494	0.885;0.996;0.999;0.23	P;D;D;B	0.77557	0.621;0.99;0.99;0.118	T	0.83192	-0.0083	9	0.59425	D	0.04	-8.4767	15.9001	0.79365	0.0:0.0:0.0:1.0	.	153;103;153;153	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	L	103;153;153	.	ENSP00000263062:Q153L	Q	-	2	0	EPC1	32622527	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.040000	0.89188	2.162000	0.67917	0.383000	0.25322	CAG	0	NULL		0.368	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	protein_coding	OTTHUMT00000047484.1	26	174	0	0.57	0	1	T		0	0	Missense_Mutation	32582521	-1	no_errors	ENST00000263062	ensembl	human	known	74_37	missense	22	194	12	23.62	3	60	SNP	1	A
RGR	5995	genome.wustl.edu	37	10	86007481	86007481	+	Missense_Mutation	SNP	G	G	C			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr10:86007481G>C	ENST00000359452.4	+	2	252	c.214G>C	c.(214-216)Gca>Cca	p.A72P	RGR_ENST00000358110.5_Missense_Mutation_p.A72P|RGR_ENST00000372092.3_Missense_Mutation_p.C55S	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	72					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TGCCCTCGTTGCAGCCACATC	0.662																																					NSCLC(15;204 545 5889 6385 32445)		0											0													84.0	77.0	80.0					10																	86007481		2203	4300	6503	SO:0001583	missense	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.214G>C	10.37:g.86007481G>C	ENSP00000352427:p.Ala72Pro		A6NKK7|Q96FC5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_RPE_GPCR,prints_GPCR_Rhodpsn	p.A72P	ENST00000359452.4	37	c.214	CCDS7374.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.347809|4.347809	0.82022|0.82022	.|.	.|.	ENSG00000148604|ENSG00000148604	ENST00000359452;ENST00000358110|ENST00000372092	T;T|.	0.71934|.	-0.61;-0.61|.	4.33|4.33	4.33|4.33	0.51752|0.51752	GPCR, rhodopsin-like superfamily (1);|.	0.053985|.	0.64402|.	D|.	0.000001|.	T|T	0.61751|0.61751	0.2372|0.2372	M|M	0.74258|0.74258	2.255|2.255	0.58432|0.58432	D|D	0.999999|0.999999	P;D;P|P	0.89917|0.36535	0.877;1.0;0.95|0.557	P;D;P|B	0.91635|0.31101	0.722;0.999;0.862|0.124	T|T	0.71220|0.71220	-0.4657|-0.4657	10|8	0.31617|0.87932	T|D	0.26|0	.|.	16.4931|16.4931	0.84207|0.84207	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	72;72;72|55	P47804-3;P47804-2;P47804|Q96HT6	.;.;RGR_HUMAN|.	P|S	72|55	ENSP00000352427:A72P;ENSP00000350823:A72P|.	ENSP00000350823:A72P|ENSP00000361164:C55S	A|C	+|+	1|2	0|0	RGR|RGR	85997461|85997461	1.000000|1.000000	0.71417|0.71417	0.093000|0.093000	0.20910|0.20910	0.806000|0.806000	0.45545|0.45545	6.930000|6.930000	0.75858|0.75858	2.344000|2.344000	0.79699|0.79699	0.591000|0.591000	0.81541|0.81541	GCA|TGC	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.662	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	protein_coding	OTTHUMT00000049116.1	39	70	0	0.00	0	0	G	NM_002921	0	0		86007481	1	no_errors	ENST00000359452	ensembl	human	known	74_37	missense	36	72	16.28	21.74	7	20	SNP	0.972	C
TMEM223	79064	genome.wustl.edu	37	11	62559355	62559355	+	Missense_Mutation	SNP	C	C	G			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr11:62559355C>G	ENST00000307366.7	-	1	138	c.112G>C	c.(112-114)Gag>Cag	p.E38Q	NXF1_ENST00000533048.1_5'Flank|TMEM223_ENST00000527073.1_5'Flank|TMEM223_ENST00000525631.1_Missense_Mutation_p.E38Q	NM_001080501.2	NP_001073970.1	A0PJW6	TM223_HUMAN	transmembrane protein 223	38						integral component of membrane (GO:0016021)											CGATCATGCTCAAAGAGCAGC	0.692																																							0											0													19.0	27.0	24.0					11																	62559355		1981	4148	6129	SO:0001583	missense	0				CCDS44628.1	11q12.3	2008-12-08				ENSG00000168569			28464	protein-coding gene	gene with protein product							Standard	NM_001080501		Approved	MGC3196	uc001nve.2	A0PJW6		ENST00000307366.7:c.112G>C	11.37:g.62559355C>G	ENSP00000303987:p.Glu38Gln		Q504S0|Q86YD4|Q8WUC5|Q96HG0	Missense_Mutation	SNP	NULL	p.E38Q	ENST00000307366.7	37	c.112	CCDS44628.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.70|11.70	1.715946|1.715946	0.30413|0.30413	.|.	.|.	ENSG00000168569|ENSG00000168569	ENST00000525631;ENST00000307366|ENST00000528367	T;T|.	0.45276|.	0.9;0.9|.	5.94|5.94	0.624|0.624	0.17659|0.17659	.|.	0.532156|.	0.19758|.	N|.	0.106733|.	T|.	0.61185|.	0.2327|.	M|M	0.66939|0.66939	2.045|2.045	0.39210|0.39210	D|D	0.963307|0.963307	B|.	0.27166|.	0.17|.	B|.	0.26202|.	0.067|.	T|.	0.57619|.	-0.7780|.	9|.	.|.	.|.	.|.	-7.0937|-7.0937	8.8942|8.8942	0.35453|0.35453	0.0:0.4681:0.3939:0.138|0.0:0.4681:0.3939:0.138	.|.	38|.	A0PJW6|.	TM223_HUMAN|.	Q|S	38|37	ENSP00000436670:E38Q;ENSP00000303987:E38Q|.	.|.	E|X	-|-	1|2	0|2	TMEM223|TMEM223	62315931|62315931	0.764000|0.764000	0.28473|0.28473	0.906000|0.906000	0.35671|0.35671	0.102000|0.102000	0.19082|0.19082	-0.154000|-0.154000	0.10130|0.10130	-0.122000|-0.122000	0.11766|0.11766	-0.291000|-0.291000	0.09656|0.09656	GAG|TGA	0	NULL		0.692	TMEM223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM223	protein_coding	OTTHUMT00000395674.1	26	36	0	0.00	0	0	C		0	0		62559355	-1	no_errors	ENST00000307366	ensembl	human	known	74_37	missense	16	35	20	14.63	4	6	SNP	0.999	G
SCYL2	55681	genome.wustl.edu	37	12	100691878	100691878	+	Silent	SNP	T	T	C			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr12:100691878T>C	ENST00000360820.2	+	4	842	c.405T>C	c.(403-405)aaT>aaC	p.N135N		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	135	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						ACTGGGAAAATCTACCTTCCC	0.318																																							0											0													67.0	66.0	66.0					12																	100691878		2202	4297	6499	SO:0001819	synonymous_variant	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.405T>C	12.37:g.100691878T>C			A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.N135	ENST00000360820.2	37	c.405	CCDS9076.1	12																																																																																			0	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.318	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	protein_coding	OTTHUMT00000408493.2	135	118	0	0.00	0	0	T	NM_017988	0	0		100691878	1	no_errors	ENST00000360820	ensembl	human	known	74_37	silent	93	112	11.43	18.25	12	25	SNP	0.995	C
NDE1	54820	genome.wustl.edu	37	16	15737165	15737165	+	5'UTR	SNP	C	C	T			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr16:15737165C>T	ENST00000396353.2	+	0	42				KIAA0430_ENST00000551742.1_5'Flank|KIAA0430_ENST00000540441.2_5'Flank|NDE1_ENST00000396355.1_5'UTR|KIAA0430_ENST00000602337.1_5'Flank|KIAA0430_ENST00000344181.3_5'Flank|KIAA0430_ENST00000396368.3_5'Flank|KIAA0430_ENST00000548025.1_5'Flank|MIR484_ENST00000606601.1_RNA			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1						centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)			endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						TCGTCAGGCTCAGTCCCCTCC	0.692																																							0											0													9.0	10.0	10.0					16																	15737165		1531	3522	5053	SO:0001623	5_prime_UTR_variant	0			AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.-785C>T	16.37:g.15737165C>T			Q49AQ2	RNA	SNP	0	NULL	ENST00000396353.2	37	NULL		16																																																																																			0	0		0.692	NDE1-202	KNOWN	basic|appris_principal	protein_coding	MIR484	protein_coding		218	84	0	0.00	0	0	C	NM_017668	0	0		15737165	1	no_errors	ENST00000606601	ensembl	human	known	74_37	rna	133	105	13.64	7.08	21	8	SNP	1	T
SPATA31A7	26165	genome.wustl.edu	37	9	65505560	65505560	+	Missense_Mutation	SNP	G	G	A	rs200832265	byFrequency	TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr9:65505560G>A	ENST00000355045.2	-	4	2028	c.2000C>T	c.(1999-2001)cCg>cTg	p.P667L	SPATA31A7_ENST00000491812.2_5'Flank	NM_015667.2	NP_056482.2	Q8IWB4	S31A7_HUMAN	SPATA31 subfamily A, member 7	667					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATGTGGGCACGGGTCCCTCTC	0.557																																							0											0													1.0	1.0	1.0					9																	65505560		6	21	27	SO:0001583	missense	0				CCDS75838.1	9q12	2014-04-11	2012-10-12	2012-10-12	ENSG00000234734	ENSG00000276040			32007	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A7"""	FAM75A7		20850414	Standard	NM_015667		Approved	OTTHUMG00000013196		Q8IWB4	OTTHUMG00000188536	ENST00000355045.2:c.2000C>T	9.37:g.65505560G>A	ENSP00000347153:p.Pro667Leu		Q5TZK4|Q9Y4Q5	Missense_Mutation	SNP	NULL	p.P667L	ENST00000355045.2	37	c.2000	CCDS43825.1	9	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.336725	0.00224	.	.	ENSG00000234734	ENST00000355045	T	0.04603	3.59	1.52	-2.77	0.05877	.	1.513180	0.04302	N	0.347547	T	0.01940	0.0061	N	0.04355	-0.22	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.42224	-0.9464	10	0.09590	T	0.72	1.1779	2.593	0.04847	0.325:0.2854:0.3896:0.0	.	667	Q8IWB4	F75A7_HUMAN	L	667	ENSP00000347153:P667L	ENSP00000347153:P667L	P	-	2	0	FAM75A7	65245380	0.000000	0.05858	0.000000	0.03702	0.172000	0.22775	0.049000	0.14099	-0.585000	0.05905	0.064000	0.15345	CCG	0	NULL		0.557	SPATA31A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A7	protein_coding	OTTHUMT00000036952.1	55	0	1.79	0.00	1	0	G	NM_015667	rs200832265	G->A		65505560	-1	no_errors	ENST00000355045	ensembl	human	known	74_37	missense	42	0	20.75	0.00	11	0	SNP	0	A
GOLGA6L10	647042	genome.wustl.edu	37	15	82635183	82635183	+	Missense_Mutation	SNP	A	A	C	rs62010119		TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr15:82635183A>C	ENST00000439287.4	-	9	1486	c.1387T>G	c.(1387-1389)Tgc>Ggc	p.C463G		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	463										endometrium(1)|kidney(4)	5						AAAGAATGGCATGCAGCCTCT	0.502																																							0											0																																										SO:0001583	missense	0				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.1387T>G	15.37:g.82635183A>C	ENSP00000388606:p.Cys463Gly			Missense_Mutation	SNP	NULL	p.C463G	ENST00000439287.4	37	c.1387	CCDS45325.1	15	.	.	.	.	.	.	.	.	.	.	.	7.797	0.712869	0.15306	.	.	ENSG00000205281	ENST00000439287	T	0.37058	1.22	.	.	.	.	.	.	.	.	T	0.25754	0.0627	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.29366	-1.0014	5	0.87932	D	0	.	.	.	.	.	.	.	.	G	463	ENSP00000388606:C463G	ENSP00000388606:C463G	C	-	1	0	GOLGA6L10	80422238	0.992000	0.36948	0.042000	0.18584	0.043000	0.13939	0.965000	0.29319	0.093000	0.17368	0.092000	0.15492	TGC	0	NULL		0.502	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927601	protein_coding	OTTHUMT00000419403.2	42	0	0	0.00	0	0	A	NM_001164465	rs62010119	A->C		82635183	-1	no_errors	ENST00000439287	ensembl	human	known	74_37	missense	31	0	11.43	0.00	4	0	SNP	0.264	C
ZNF208	7757	genome.wustl.edu	37	19	22154191	22154191	+	Silent	SNP	G	G	A	rs542502577	byFrequency	TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr19:22154191G>A	ENST00000397126.4	-	4	3793	c.3645C>T	c.(3643-3645)caC>caT	p.H1215H	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GAATTTTCTTGTGATATCTAA	0.378													g|||	2	0.000399361	0.0	0.0	5008	,	,		21240	0.002		0.0	False		,,,				2504	0.0						0.9996,0.0003994											0													38.0	41.0	40.0					19																	22154191		2104	4246	6350	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3645C>T	19.37:g.22154191G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H1215	ENST00000397126.4	37	c.3645	CCDS54240.1	19																																																																																			0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	67	1	0	0.00	0	0	G	NM_007153	rs542502577	G->A		22154191	-1	no_errors	ENST00000397126	ensembl	human	novel	74_37	silent	32	1	10.81	0.00	4	0	SNP	0.339	A
ZNF208	7757	genome.wustl.edu	37	19	22154197	22154197	+	Missense_Mutation	SNP	T	T	A	rs560585093		TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr19:22154197T>A	ENST00000397126.4	-	4	3787	c.3639A>T	c.(3637-3639)agA>agT	p.R1213S	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1213					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCTTGTGATATCTAAGGGTTG	0.378													t|||	1	0.000199681	0.0	0.0	5008	,	,		21180	0.001		0.0	False		,,,				2504	0.0						0.9998,0.0001997											0													38.0	41.0	40.0					19																	22154197		2105	4245	6350	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3639A>T	19.37:g.22154197T>A	ENSP00000380315:p.Arg1213Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R1213S	ENST00000397126.4	37	c.3639	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	1.113	-0.657555	0.03480	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.39592	1.07	3.22	-6.43	0.01926	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13329	0.0323	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26292	-1.0107	8	0.07175	T	0.84	.	1.5662	0.02605	0.2343:0.1042:0.1711:0.4905	.	1085	O43345	ZN208_HUMAN	S	1213;1085	ENSP00000380315:R1213S	ENSP00000380315:R1213S	R	-	3	2	ZNF208	21946037	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.047000	0.00306	-1.840000	0.01184	-1.063000	0.02288	AGA	0	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	69	1	0	0.00	0	0	T	NM_007153	rs560585093	T->A		22154197	-1	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	42	1	8.7	0.00	4	0	SNP	0	A
ZDHHC8P1	150244	genome.wustl.edu	37	22	23734810	23734810	+	RNA	SNP	G	G	T			TCGA-YT-A95F-01A-11D-A428-09	TCGA-YT-A95F-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c7c91b7-5b7f-4531-849d-2b85635b3e6e	9b6e27a6-3a33-4a1e-b627-efa66d59382e	g.chr22:23734810G>T	ENST00000255890.4	-	0	1263									zinc finger, DHHC-type containing 8 pseudogene 1																		GCAGCCTCCAGCAGCCATGGA	0.652																																							0											0																																												0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23734810G>T				RNA	SNP	0	NULL	ENST00000255890.4	37	NULL		22																																																																																			0	0		0.652	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	pseudogene	OTTHUMT00000319397.1	31	13	0	0.00	0	0	G	NR_003950	0	0		23734810	-1	no_errors	ENST00000456279	ensembl	human	known	74_37	rna	32	10	11.11	0.00	4	0	SNP	0.787	T
