#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
KISS1	3814	genome.wustl.edu	37	1	204168258	204168258	+	5'Flank	SNP	C	C	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr1:204168258C>T	ENST00000367194.4	-	0	0				GOLT1A_ENST00000308302.3_Intron|GOLT1A_ENST00000475517.1_5'UTR	NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor						cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		TTACCAGCTCCCCTCCGTGTG	0.652																																							0											0													18.0	25.0	23.0					1																	204168258		692	1591	2283	SO:0001631	upstream_gene_variant	0			U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060		1.37:g.204168258C>T	Exception_encountered		A8K6N0|Q9HBP1	RNA	SNP	0	NULL	ENST00000367194.4	37	NULL	CCDS41454.1	1																																																																																			0	0		0.652	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLT1A	protein_coding	OTTHUMT00000087892.1	14	69	0	0.00	0	0	C	NM_002256	0	0		204168258	-1	no_errors	ENST00000475517	ensembl	human	known	74_37	rna	3	43	72.73	34.85	8	23	SNP	0.001	T
CD200R1	131450	genome.wustl.edu	37	3	112648204	112648204	+	Missense_Mutation	SNP	G	G	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr3:112648204G>A	ENST00000471858.1	-	3	516	c.284C>T	c.(283-285)aCc>aTc	p.T95I	CD200R1_ENST00000308611.3_Missense_Mutation_p.T118I|CD200R1_ENST00000490004.1_Missense_Mutation_p.T95I|CD200R1_ENST00000440122.2_Missense_Mutation_p.T118I|CD200R1_ENST00000295863.4_Missense_Mutation_p.T73I	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	95	Ig-like V-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						GGTTTCCTTGGTCTCATTTGT	0.448																																							0											0													180.0	171.0	174.0					3																	112648204		2203	4300	6503	SO:0001583	missense	0			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.284C>T	3.37:g.112648204G>A	ENSP00000418928:p.Thr95Ile		B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.T118I	ENST00000471858.1	37	c.353	CCDS2970.1	3	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837049	0.50951	.	.	ENSG00000163606	ENST00000471858;ENST00000308611;ENST00000295863;ENST00000440122;ENST00000490004	T;T;T;T;T	0.65732	1.52;1.52;1.52;-0.17;-0.17	5.36	2.57	0.30868	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.347798	0.28521	N	0.015059	T	0.52980	0.1768	L	0.56280	1.765	0.09310	N	0.999998	B;P;P;B;B	0.49961	0.298;0.93;0.93;0.192;0.172	B;B;B;B;B	0.44044	0.065;0.323;0.439;0.106;0.084	T	0.41963	-0.9479	10	0.22706	T	0.39	.	6.9633	0.24610	0.2829:0.0:0.7171:0.0	.	73;95;118;95;118	B4E2U2;Q8TD46-3;Q8TD46-2;Q8TD46;Q8TD46-4	.;.;.;MO2R1_HUMAN;.	I	95;118;73;118;95	ENSP00000418928:T95I;ENSP00000311035:T118I;ENSP00000295863:T73I;ENSP00000405733:T118I;ENSP00000418801:T95I	ENSP00000295863:T73I	T	-	2	0	CD200R1	114130894	0.005000	0.15991	0.273000	0.24645	0.508000	0.34012	0.259000	0.18405	0.619000	0.30197	-0.259000	0.10710	ACC	0	NULL		0.448	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200R1	protein_coding	OTTHUMT00000354467.1	43	58	0	1.69	0	1	G	NM_138806	0	0		112648204	-1	no_errors	ENST00000308611	ensembl	human	known	74_37	missense	16	19	42.86	44.12	12	15	SNP	0.127	A
SPATA16	83893	genome.wustl.edu	37	3	172631487	172631487	+	Silent	SNP	T	T	C			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr3:172631487T>C	ENST00000351008.3	-	10	1734	c.1551A>G	c.(1549-1551)agA>agG	p.R517R		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	517					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CATTATTGTTTCTTCTTCCTT	0.368																																							0											0													122.0	111.0	115.0					3																	172631487		2203	4300	6503	SO:0001819	synonymous_variant	0			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1551A>G	3.37:g.172631487T>C			Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Silent	SNP	NULL	p.R517	ENST00000351008.3	37	c.1551	CCDS3221.1	3																																																																																			0	NULL		0.368	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA16	protein_coding	OTTHUMT00000346322.1	125	277	0	0.00	0	0	T	NM_031955	0	0		172631487	-1	no_errors	ENST00000351008	ensembl	human	known	74_37	silent	65	152	39.81	37.45	43	91	SNP	0.901	C
ADAMTS16	170690	genome.wustl.edu	37	5	5146385	5146385	+	Silent	SNP	C	C	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr5:5146385C>T	ENST00000274181.7	+	3	456	c.318C>T	c.(316-318)caC>caT	p.H106H	ADAMTS16_ENST00000511368.1_Silent_p.H106H|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	106					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GCTCCAGGCACGACTTCCACA	0.537																																							0											0													75.0	76.0	76.0					5																	5146385		1998	4172	6170	SO:0001819	synonymous_variant	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.318C>T	5.37:g.5146385C>T			C6G490|Q8IVE2	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.H106	ENST00000274181.7	37	c.318	CCDS43299.1	5																																																																																			0	pfam_Peptidase_M12B_N		0.537	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	protein_coding	OTTHUMT00000365657.1	28	126	0	0.00	0	0	C	NM_139056	0	0		5146385	1	no_errors	ENST00000274181	ensembl	human	known	74_37	silent	10	52	41.18	45.83	7	44	SNP	0.018	T
MAP3K7	6885	genome.wustl.edu	37	6	91226068	91226068	+	3'UTR	SNP	A	A	C			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr6:91226068A>C	ENST00000369329.3	-	0	2134				MAP3K7_ENST00000369325.3_3'UTR|MAP3K7_ENST00000369320.1_3'UTR|MAP3K7_ENST00000479630.1_5'UTR|MAP3K7_ENST00000369332.3_3'UTR|MAP3K7_ENST00000369327.3_3'UTR	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGAAAAGGAAAATAAACAATG	0.358																																							0											0																																										SO:0001624	3_prime_UTR_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.*152T>G	6.37:g.91226068A>C			B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	RNA	SNP	0	NULL	ENST00000369329.3	37	NULL	CCDS5028.1	6																																																																																			0	0		0.358	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	protein_coding	OTTHUMT00000041530.1	42	315	0	0.00	0	0	A	NM_145331	0	0		91226068	-1	no_errors	ENST00000479630	ensembl	human	known	74_37	rna	13	142	45.83	51.86	11	153	SNP	0.998	C
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H|GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	326	143	0	0.00	0	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	128	84	44.35	36.36	102	48	SNP	1	A
PDK4	5166	genome.wustl.edu	37	7	95223079	95223079	+	Silent	SNP	A	A	G			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr7:95223079A>G	ENST00000005178.5	-	3	473	c.276T>C	c.(274-276)taT>taC	p.Y92Y	AC002451.3_ENST00000416502.1_RNA|AC002451.3_ENST00000432265.1_RNA	NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	92					cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GGCTCTGTATATACCTGTAAA	0.313																																							0											0													87.0	89.0	88.0					7																	95223079		2203	4300	6503	SO:0001819	synonymous_variant	0			U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.276T>C	7.37:g.95223079A>G				Silent	SNP	pfam_BCDHK/PDK_N,pfam_HATPase_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.Y92	ENST00000005178.5	37	c.276	CCDS5643.1	7																																																																																			0	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N		0.313	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK4	protein_coding	OTTHUMT00000333298.1	54	267	0	0.00	0	0	A	NM_002612	0	0		95223079	-1	no_errors	ENST00000005178	ensembl	human	known	74_37	silent	26	204	16.13	10.92	5	25	SNP	1	G
PRKAR2B	5577	genome.wustl.edu	37	7	106797706	106797706	+	Missense_Mutation	SNP	G	G	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr7:106797706G>T	ENST00000265717.4	+	10	1319	c.1060G>T	c.(1060-1062)Gcc>Tcc	p.A354S		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	354					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TGGAGAGCTTGCCCTGGTAAC	0.498																																							0											0													125.0	110.0	115.0					7																	106797706		2203	4300	6503	SO:0001583	missense	0				CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.1060G>T	7.37:g.106797706G>T	ENSP00000265717:p.Ala354Ser		A4D0R9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.A354S	ENST00000265717.4	37	c.1060	CCDS5740.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.229447	0.95173	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	D	0.93189	-3.18	5.97	5.97	0.96955	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.97015	0.9025	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96886	0.9649	10	0.87932	D	0	-5.2593	20.4238	0.99064	0.0:0.0:1.0:0.0	.	354	P31323	KAP3_HUMAN	S	354;354;341	ENSP00000265717:A354S	ENSP00000265717:A354S	A	+	1	0	PRKAR2B	106584942	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.773000	0.85462	2.828000	0.97474	0.655000	0.94253	GCC	0	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin		0.498	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR2B	protein_coding	OTTHUMT00000268386.1	49	288	0	0.35	0	1	G		0	0		106797706	1	no_errors	ENST00000265717	ensembl	human	known	74_37	missense	19	109	50	40.86	19	76	SNP	1	T
NRG3	10718	genome.wustl.edu	37	10	83926565	83926565	+	Intron	SNP	C	C	T	rs201815957		TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr10:83926565C>T	ENST00000404547.1	+	2	823				NRG3_ENST00000372142.2_Missense_Mutation_p.T48M|NRG3_ENST00000556918.1_Missense_Mutation_p.T73M|NRG3_ENST00000372141.2_Intron|NRG3_ENST00000404576.2_Missense_Mutation_p.T73M			P56975	NRG3_HUMAN	neuregulin 3						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ctgctgctgacgaattcatac	0.323																																							0											0													205.0	176.0	185.0					10																	83926565		692	1591	2283	SO:0001627	intron_variant	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.824-191930C>T	10.37:g.83926565C>T			A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfscan_EG-like_dom	p.T48M	ENST00000404547.1	37	c.143	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	C	3.625	-0.076644	0.07184	.	.	ENSG00000185737	ENST00000372142;ENST00000404576;ENST00000556918	T;T;T	0.49720	1.43;0.77;1.32	2.24	-2.06	0.07298	.	.	.	.	.	T	0.28167	0.0695	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21348	-1.0248	9	0.66056	D	0.02	.	5.8566	0.18722	0.0:0.4706:0.0:0.5294	.	48	P56975-3	.	M	48;73;73	ENSP00000361215:T48M;ENSP00000385804:T73M;ENSP00000451376:T73M	ENSP00000385804:T48M	T	+	2	0	NRG3	83916545	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.050000	0.11904	-0.412000	0.07519	-0.624000	0.04008	ACG	0	NULL		0.323	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	protein_coding	OTTHUMT00000412262.1	49	288	0	0.00	0	0	C	XM_166086	rs201815957	C->T		83926565	1	no_errors	ENST00000372142	ensembl	human	known	74_37	missense	25	118	43.18	40.20	19	80	SNP	0.001	T
HRAS	3265	genome.wustl.edu	37	11	534289	534289	+	Missense_Mutation	SNP	C	C	G	rs104894229		TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr11:534289C>G	ENST00000451590.1	-	2	221	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	HRAS_ENST00000397594.1_Missense_Mutation_p.G12R|HRAS_ENST00000311189.7_Missense_Mutation_p.G12R|HRAS_ENST00000417302.1_Missense_Mutation_p.G12R|HRAS_ENST00000397596.2_Missense_Mutation_p.G12R|HRAS_ENST00000468682.2_5'UTR	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	12			G -> A (in CSTLO). {ECO:0000269|PubMed:16170316, ECO:0000269|PubMed:16329078, ECO:0000269|PubMed:16443854}.|G -> C (in CSTLO). {ECO:0000269|PubMed:16443854, ECO:0000269|PubMed:18039947}.|G -> D (in CSTLO; severe mutation). {ECO:0000269|PubMed:18039947}.|G -> E (in CSTLO). {ECO:0000269|PubMed:16443854}.|G -> S (in CSTLO, OSCC and CMEMS). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:16170316, ECO:0000269|PubMed:16329078, ECO:0000269|PubMed:16443854, ECO:0000269|PubMed:17054105, ECO:0000269|PubMed:17412879}.|G -> V (in CSTLO, bladder carcinoma and CMEMS; constitutively activated; interacts and recruits PLCE1 to plasma membrane; loss of interaction with and recruitment to plasma membrane of PLCE1 when associated with F-32; loss of interaction with PLCE1 when associated with G-26, F-32 and S-35; no effect on interaction with PLCE1 when associated with A-29, G-34, G-37, N-38 and C-39; no effect on subcellular location of isoform 2). {ECO:0000269|PubMed:16170316, ECO:0000269|PubMed:17412879}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)	p.G12S(58)|p.G12C(25)|p.G12R(12)		adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCACACCGCCGGCGCCCACC	0.647		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																													0	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	95	Substitution - Missense(95)	upper_aerodigestive_tract(33)|urinary_tract(15)|skin(11)|thyroid(10)|cervix(7)|soft_tissue(5)|salivary_gland(5)|pituitary(3)|large_intestine(2)|lung(1)|penis(1)|prostate(1)|bone(1)	GRCh37	CM053283|CM061797	HRAS	M	rs104894229						78.0	74.0	76.0					11																	534289		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.34G>C	11.37:g.534289C>G	ENSP00000407586:p.Gly12Arg		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G12R	ENST00000451590.1	37	c.34	CCDS7698.1	11	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712431	0.68730	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	3.0	3.0	0.34707	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.82540	0.5059	M	0.67625	2.065	0.80722	D	1	P;P	0.46457	0.851;0.878	P;P	0.53954	0.619;0.738	D	0.85406	0.1134	10	0.66056	D	0.02	.	14.1517	0.65389	0.0:1.0:0.0:0.0	.	12;12	P01112-2;P01112	.;RASH_HUMAN	R	12	ENSP00000380722:G12R;ENSP00000380723:G12R;ENSP00000407586:G12R;ENSP00000388246:G12R;ENSP00000309845:G12R	ENSP00000309845:G12R	G	-	1	0	HRAS	524289	1.000000	0.71417	0.332000	0.25469	0.311000	0.27955	7.472000	0.80996	1.986000	0.57962	0.561000	0.74099	GGC	0	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.647	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HRAS	protein_coding	OTTHUMT00000259403.2	29	94	0	0.00	0	0	C	NM_176795	rs104894229	C->A,G,T		534289	-1	no_errors	ENST00000311189	ensembl	human	known	74_37	missense	10	54	33.33	47.06	5	48	SNP	0.998	G
MUC2	4583	genome.wustl.edu	37	11	1090373	1090373	+	Silent	SNP	G	G	A	rs146744772		TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr11:1090373G>A	ENST00000441003.2	+	27	3696	c.3669G>A	c.(3667-3669)ccG>ccA	p.P1223P	MUC2_ENST00000361558.6_5'Flank|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1223					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TCTGCAGGCCGGAGGAAGGTA	0.652																																							0.9998,.,0.0001997											0										1,4379		0,1,2189	58.0	63.0	61.0		3669	-4.9	0.0	11	dbSNP_134	61	0,8558		0,0,4279	no	coding-synonymous	MUC2	NM_002457.2		0,1,6468	AA,AG,GG		0.0,0.0228,0.0077		1223/2813	1090373	1,12937	2190	4279	6469	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3669G>A	11.37:g.1090373G>A			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P1223	ENST00000441003.2	37	c.3669		11																																																																																			0	NULL		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	18	95	0	1.04	0	1	G	NM_002457	rs146744772	G->A,T		1090373	1	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	8	41	46.67	43.84	7	32	SNP	0	A
NCAM1	4684	genome.wustl.edu	37	11	113144285	113144285	+	Intron	SNP	C	C	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr11:113144285C>A	ENST00000397957.4	+	19	2667				NCAM1-AS1_ENST00000526229.1_RNA|NCAM1-AS1_ENST00000533638.1_RNA|NCAM1_ENST00000316851.7_Intron			P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCACCACAAACCCTTCCCAGG	0.617																																							0											0																																										SO:0001627	intron_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000397957.4:c.2667+1687C>A	11.37:g.113144285C>A			A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	RNA	SNP	0	NULL	ENST00000397957.4	37	NULL		11																																																																																			0	0		0.617	NCAM1-001	KNOWN	basic	processed_transcript	NCAM1	protein_coding	OTTHUMT00000393677.2	25	184	0	0.00	0	0	C	NM_000615	0	0		113144285	1	no_errors	ENST00000528158	ensembl	human	putative	74_37	rna	13	83	40.91	49.70	9	82	SNP	1	A
OTOGL	283310	genome.wustl.edu	37	12	80722865	80722865	+	Missense_Mutation	SNP	G	G	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr12:80722865G>T	ENST00000547103.1	+	36	4293	c.4287G>T	c.(4285-4287)atG>atT	p.M1429I	OTOGL_ENST00000458043.2_Missense_Mutation_p.M1429I			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1429					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CAACATTAATGCCACCAGCTA	0.338																																							0											0													88.0	85.0	85.0					12																	80722865		1879	4116	5995	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4287G>T	12.37:g.80722865G>T	ENSP00000447211:p.Met1429Ile		F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.M1429I	ENST00000547103.1	37	c.4287		12	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.619744	0.00828	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.14766	2.51;2.48	4.42	-0.888	0.10583	.	.	.	.	.	T	0.04543	0.0124	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.39840	-0.9594	7	0.21014	T	0.42	.	0.881	0.01234	0.2806:0.1478:0.3995:0.172	.	.	.	.	I	1429	ENSP00000447211:M1429I;ENSP00000400895:M1429I	ENSP00000400895:M1429I	M	+	3	0	OTOGL	79246996	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-1.690000	0.01922	-0.291000	0.09012	-0.964000	0.02622	ATG	0	NULL		0.338	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	protein_coding	OTTHUMT00000407438.1	81	322	1.22	0.00	1	0	G	NM_173591	0	0		80722865	1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	39	218	40.58	35.12	28	118	SNP	0	T
CATSPERB	79820	genome.wustl.edu	37	14	92055900	92055900	+	Missense_Mutation	SNP	G	G	C			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr14:92055900G>C	ENST00000256343.3	-	24	3090	c.2934C>G	c.(2932-2934)aaC>aaG	p.N978K		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	978					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TGTGCCTCATGTTCACTTCAG	0.358																																							0											0													109.0	101.0	104.0					14																	92055900		2203	4300	6503	SO:0001583	missense	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2934C>G	14.37:g.92055900G>C	ENSP00000256343:p.Asn978Lys		A0AV51	Missense_Mutation	SNP	superfamily_Sialidases	p.N978K	ENST00000256343.3	37	c.2934	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	G	11.41	1.629436	0.28978	.	.	ENSG00000133962	ENST00000256343	T	0.63096	-0.02	5.1	-5.67	0.02444	.	0.000000	0.56097	D	0.000033	T	0.71567	0.3355	M	0.64404	1.975	0.20926	N	0.99982	D	0.89917	1.0	D	0.87578	0.998	T	0.71024	-0.4712	10	0.87932	D	0	-30.7608	16.0004	0.80290	0.2665:0.0:0.7335:0.0	.	978	Q9H7T0	CTSRB_HUMAN	K	978	ENSP00000256343:N978K	ENSP00000256343:N978K	N	-	3	2	CATSPERB	91125653	0.000000	0.05858	0.010000	0.14722	0.128000	0.20619	-0.662000	0.05305	-0.920000	0.03799	-0.367000	0.07326	AAC	0	NULL		0.358	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	protein_coding	OTTHUMT00000411769.1	100	372	0	0.00	0	0	G	NM_024764	0	0		92055900	-1	no_errors	ENST00000256343	ensembl	human	known	74_37	missense	37	161	37.29	27.48	22	61	SNP	0.003	C
EXOC3L4	91828	genome.wustl.edu	37	14	103570659	103570659	+	Missense_Mutation	SNP	C	C	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr14:103570659C>A	ENST00000380069.3	+	4	1293	c.1217C>A	c.(1216-1218)gCg>gAg	p.A406E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	406					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						AGTCACTGGGCGGCCGCCGAG	0.687																																							0											0													10.0	12.0	11.0					14																	103570659		2188	4293	6481	SO:0001583	missense	0			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1217C>A	14.37:g.103570659C>A	ENSP00000369409:p.Ala406Glu		Q14CR2	Missense_Mutation	SNP	pfam_Sec6	p.A406E	ENST00000380069.3	37	c.1217	CCDS32163.1	14	.	.	.	.	.	.	.	.	.	.	C	0.668	-0.803179	0.02841	.	.	ENSG00000205436	ENST00000380069	T	0.06528	3.29	4.18	-2.7	0.06004	.	0.665977	0.14024	N	0.346640	T	0.02970	0.0088	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.46911	-0.9157	10	0.02654	T	1	-4.2103	3.2771	0.06902	0.3063:0.3183:0.0:0.3754	.	406	Q17RC7	EX3L4_HUMAN	E	406	ENSP00000369409:A406E	ENSP00000369409:A406E	A	+	2	0	EXOC3L4	102640412	0.005000	0.15991	0.001000	0.08648	0.081000	0.17604	-0.056000	0.11787	-0.925000	0.03775	-0.284000	0.09977	GCG	0	pfam_Sec6		0.687	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	protein_coding	OTTHUMT00000415663.1	21	56	0	0.00	0	0	C	XM_941093	0	0		103570659	1	no_errors	ENST00000380069	ensembl	human	known	74_37	missense	7	8	46.15	69.23	6	18	SNP	0	A
FLYWCH1	84256	genome.wustl.edu	37	16	2983738	2983738	+	Missense_Mutation	SNP	C	C	T	rs546346078		TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr16:2983738C>T	ENST00000253928.9	+	6	1676	c.1271C>T	c.(1270-1272)aCg>aTg	p.T424M	FLYWCH1_ENST00000416288.2_Missense_Mutation_p.T423M|FLYWCH1_ENST00000399667.2_Missense_Mutation_p.T424M			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	424						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						TTCCTGAAGACGCCCCTGGGG	0.677													.|||	1	0.000199681	0.0	0.0	5008	,	,		14781	0.0		0.0	False		,,,				2504	0.001						0.9998,0.0001997											0													19.0	23.0	22.0					16																	2983738		1860	4087	5947	SO:0001583	missense	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.1271C>T	16.37:g.2983738C>T	ENSP00000253928:p.Thr424Met		D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	pfam_Znf_FLYWCH	p.T424M	ENST00000253928.9	37	c.1271		16	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970759	0.53614	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288	.	.	.	3.64	3.64	0.41730	Zinc finger, FLYWCH-type (1);	.	.	.	.	T	0.63908	0.2551	M	0.64404	1.975	0.29987	N	0.817173	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	T	0.59931	-0.7361	8	0.87932	D	0	.	11.1295	0.48339	0.0:1.0:0.0:0.0	.	424;424;423	Q4VC44-3;Q4VC44;Q4VC44-2	.;FWCH1_HUMAN;.	M	424;424;423	.	ENSP00000253928:T424M	T	+	2	0	FLYWCH1	2923739	0.138000	0.22547	0.974000	0.42286	0.658000	0.38924	1.963000	0.40452	2.324000	0.78689	0.462000	0.41574	ACG	0	pfam_Znf_FLYWCH		0.677	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	protein_coding	OTTHUMT00000436479.1	67	28	0	0.00	0	0	C	NM_032296	rs546346078	C->T		2983738	1	no_errors	ENST00000399667	ensembl	human	known	74_37	missense	46	19	25.81	40.62	16	13	SNP	0.98	T
SLC9A5	6553	genome.wustl.edu	37	16	67298985	67298985	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr16:67298985C>T	ENST00000299798.11	+	14	2121	c.2056C>T	c.(2056-2058)Cga>Tga	p.R686*	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	686					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TGGGAAACATCGAGGCCTGGG	0.592																																							0											0													96.0	100.0	99.0					16																	67298985		1987	4178	6165	SO:0001587	stop_gained	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.2056C>T	16.37:g.67298985C>T	ENSP00000299798:p.Arg686*		A5PKY7|Q9Y626	Nonsense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.R686*	ENST00000299798.11	37	c.2056	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	C	11.71	1.721305	0.30503	.	.	ENSG00000135740	ENST00000299798;ENST00000360183	.	.	.	3.37	3.37	0.38596	.	1.053550	0.07438	N	0.896899	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	10.5647	0.45165	0.0:1.0:0.0:0.0	.	.	.	.	X	686;199	.	ENSP00000299798:R686X	R	+	1	2	SLC9A5	65856486	0.995000	0.38212	1.000000	0.80357	0.784000	0.44337	0.628000	0.24522	1.593000	0.50029	0.313000	0.20887	CGA	0	NULL		0.592	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	protein_coding	OTTHUMT00000421386.1	33	185	0	0.00	0	0	C		0	0		67298985	1	no_errors	ENST00000299798	ensembl	human	known	74_37	nonsense	18	61	33.33	46.96	9	54	SNP	0.997	T
SPG7	6687	genome.wustl.edu	37	16	89616931	89616931	+	Missense_Mutation	SNP	A	A	G			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr16:89616931A>G	ENST00000268704.2	+	13	1708	c.1693A>G	c.(1693-1695)Aag>Gag	p.K565E		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	565					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GATCCTGTCCAAGGAAGAACA	0.587																																							0											0													113.0	104.0	107.0					16																	89616931		2198	4300	6498	SO:0001583	missense	0			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1693A>G	16.37:g.89616931A>G	ENSP00000268704:p.Lys565Glu		O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.K565E	ENST00000268704.2	37	c.1693	CCDS10977.1	16	.	.	.	.	.	.	.	.	.	.	A	12.19	1.862424	0.32884	.	.	ENSG00000197912	ENST00000268704	D	0.83591	-1.74	5.84	4.73	0.59995	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.132632	0.64402	D	0.000002	T	0.64940	0.2644	N	0.02192	-0.645	0.80722	D	1	B	0.13594	0.008	B	0.19666	0.026	T	0.61520	-0.7046	10	0.62326	D	0.03	-21.7037	12.6751	0.56889	0.6757:0.3243:0.0:0.0	.	565	Q9UQ90	SPG7_HUMAN	E	565	ENSP00000268704:K565E	ENSP00000268704:K565E	K	+	1	0	SPG7	88144432	1.000000	0.71417	0.938000	0.37757	0.448000	0.32197	4.701000	0.61810	1.018000	0.39521	-0.466000	0.05196	AAG	0	pfam_Peptidase_M41,tigrfam_FtsH		0.587	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG7	protein_coding	OTTHUMT00000269921.2	51	114	0	0.00	0	0	A	NM_003119	0	0		89616931	1	no_errors	ENST00000268704	ensembl	human	known	74_37	missense	53	76	10	16.48	6	15	SNP	0.996	G
NF1	4763	genome.wustl.edu	37	17	29677284	29677284	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr17:29677284G>T	ENST00000358273.4	+	50	7788	c.7405G>T	c.(7405-7407)Gaa>Taa	p.E2469*	NF1_ENST00000417592.2_Nonsense_Mutation_p.E182*|NF1_ENST00000444181.2_Nonsense_Mutation_p.E262*|NF1_ENST00000356175.3_Nonsense_Mutation_p.E2448*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2469					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATTTCAATGGAAAATGTTCC	0.358			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													0	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											133.0	119.0	124.0					17																	29677284		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7405G>T	17.37:g.29677284G>T	ENSP00000351015:p.Glu2469*		O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E2469*	ENST00000358273.4	37	c.7405	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876013	0.91664	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181;ENST00000417592	.	.	.	5.57	5.57	0.84162	.	0.052891	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	19.5321	0.95234	0.0:0.0:1.0:0.0	.	.	.	.	X	2469;2448;2114;262;182	.	ENSP00000348498:E2448X	E	+	1	0	NF1	26701410	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.929000	0.92859	2.626000	0.88956	0.563000	0.77884	GAA	0	superfamily_ARM-type_fold		0.358	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	76	261	0	0.00	0	0	G	NM_000267	0	0		29677284	1	no_errors	ENST00000358273	ensembl	human	known	74_37	nonsense	63	256	17.11	26.78	13	94	SNP	1	T
CRHR1	1394	genome.wustl.edu	37	17	43884403	43884403	+	Missense_Mutation	SNP	G	G	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr17:43884403G>A	ENST00000398285.3	+	2	61	c.61G>A	c.(61-63)Gtc>Atc	p.V21I	CRHR1_ENST00000577353.1_Missense_Mutation_p.V21I|RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000314537.5_Missense_Mutation_p.V21I|CRHR1_ENST00000339069.5_5'UTR|CRHR1_ENST00000352855.5_Missense_Mutation_p.V21I	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	21					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GCTGAACCCCGTCTCTGCCTC	0.617																																					Ovarian(110;57 1568 10207 38216 49865)		0											0													65.0	72.0	70.0					17																	43884403		2102	4239	6341	SO:0001583	missense	0			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.61G>A	17.37:g.43884403G>A	ENSP00000381333:p.Val21Ile		B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF1_rcpt,prints_GPCR_2_diuretic_rcpt	p.V21I	ENST00000398285.3	37	c.61	CCDS45712.1	17	.	.	.	.	.	.	.	.	.	.	G	8.773	0.926468	0.18056	.	.	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T	0.52526	0.66;0.66;0.66;0.87	4.14	0.664	0.17890	.	0.802209	0.11129	N	0.596589	T	0.22820	0.0551	N	0.08118	0	0.26118	N	0.980589	B;B;B;B	0.12013	0.0;0.005;0.0;0.001	B;B;B;B	0.06405	0.0;0.002;0.0;0.001	T	0.25984	-1.0116	10	0.12766	T	0.61	.	7.8635	0.29524	0.2589:0.0:0.7411:0.0	.	21;21;21;21	P34998-4;P34998;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.	I	21	ENSP00000381333:V21I;ENSP00000326060:V21I;ENSP00000239167:V21I;ENSP00000344068:V21I	ENSP00000326060:V21I	V	+	1	0	CRHR1	41240183	0.018000	0.18449	0.282000	0.24776	0.575000	0.36095	0.521000	0.22893	0.047000	0.15862	0.555000	0.69702	GTC	0	prints_GPCR_2_CRF1_rcpt		0.617	CRHR1-001	KNOWN	basic|CCDS	protein_coding	CRHR1	protein_coding	OTTHUMT00000441241.3	20	106	4.76	0.00	1	0	G		0	0		43884403	1	no_errors	ENST00000398285	ensembl	human	known	74_37	missense	19	56	17.39	30.00	4	24	SNP	0.341	A
PPP1R9B	84687	genome.wustl.edu	37	17	48211299	48211299	+	3'UTR	SNP	G	G	C			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr17:48211299G>C	ENST00000316878.6	-	0	3847				AC002401.1_ENST00000451776.1_RNA|PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						TGAAGTGCGCGAGCCCAGGAC	0.667																																							0											0																																										SO:0001624	3_prime_UTR_variant	0			AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*1397C>G	17.37:g.48211299G>C			Q8TCR9	RNA	SNP	0	NULL	ENST00000316878.6	37	NULL		17																																																																																			0	0		0.667	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	protein_coding		82	82	0	0.00	0	0	G	NM_032595	0	0		48211299	-1	no_errors	ENST00000501501	ensembl	human	known	74_37	rna	29	30	54.41	60.53	37	46	SNP	0.141	C
DDX5	1655	genome.wustl.edu	37	17	62496153	62496153	+	Missense_Mutation	SNP	C	C	T			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr17:62496153C>T	ENST00000225792.5	-	13	2134	c.1733G>A	c.(1732-1734)gGa>gAa	p.G578E	MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000450599.2_Missense_Mutation_p.G499E|POLG2_ENST00000539111.2_5'Flank|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.G578E|DDX5_ENST00000580026.1_5'Flank	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	578	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			AACATTACTTCCGTATTGCTG	0.418			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)		0		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													163.0	133.0	143.0					17																	62496153		2203	4300	6503	SO:0001583	missense	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1733G>A	17.37:g.62496153C>T	ENSP00000225792:p.Gly578Glu		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G578E	ENST00000225792.5	37	c.1733	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	10.52	1.374265	0.24857	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	T	0.22743	1.94	5.83	3.79	0.43588	.	0.981149	0.08397	N	0.951979	T	0.17916	0.0430	N	0.24115	0.695	0.47245	D	0.999364	B;P;P	0.37914	0.005;0.611;0.611	B;B;B	0.37888	0.005;0.26;0.26	T	0.04551	-1.0943	10	0.54805	T	0.06	-16.2201	11.846	0.52385	0.0:0.8112:0.1226:0.0662	.	499;578;578	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	E	578;508;567	ENSP00000403085:G508E	ENSP00000225792:G567E	G	-	2	0	DDX5	59926615	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.901000	0.39838	1.493000	0.48517	0.650000	0.86243	GGA	0	pfam_P68HR		0.418	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	protein_coding	OTTHUMT00000444030.1	51	250	0	0.00	0	0	C	NM_004396	0	0		62496153	-1	no_errors	ENST00000225792	ensembl	human	known	74_37	missense	30	207	33.33	29.83	15	88	SNP	0.723	T
SKA1	220134	genome.wustl.edu	37	18	47917597	47917597	+	Missense_Mutation	SNP	T	T	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr18:47917597T>A	ENST00000285116.3	+	6	764	c.553T>A	c.(553-555)Tct>Act	p.S185T	SKA1_ENST00000417656.2_Missense_Mutation_p.S139T|SKA1_ENST00000398452.2_Missense_Mutation_p.S185T|SKA1_ENST00000488454.1_Missense_Mutation_p.S34T	NM_001039535.2|NM_145060.3	NP_001034624.1|NP_659497.1	Q96BD8	SKA1_HUMAN	spindle and kinetochore associated complex subunit 1	185					cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(1)|prostate(1)	13						GCCAAAAAAGTCTATGAATTC	0.313																																							0											0													53.0	55.0	55.0					18																	47917597		2202	4297	6499	SO:0001583	missense	0			BC015706	CCDS11946.1	18q21.1	2013-01-17	2009-08-19	2009-08-19	ENSG00000154839	ENSG00000154839			28109	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 24"""	C18orf24		17093495	Standard	NM_145060		Approved	MGC10200	uc002leu.3	Q96BD8	OTTHUMG00000132685	ENST00000285116.3:c.553T>A	18.37:g.47917597T>A	ENSP00000285116:p.Ser185Thr		B2R9Y6|B4E0P4	Missense_Mutation	SNP	pfam_DUF1395	p.S185T	ENST00000285116.3	37	c.553	CCDS11946.1	18	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098803	0.56183	.	.	ENSG00000154839	ENST00000285116;ENST00000417656;ENST00000398452	T;T;T	0.42131	0.98;0.98;0.98	6.02	3.52	0.40303	.	0.244527	0.44097	D	0.000483	T	0.31420	0.0796	L	0.43757	1.38	0.35479	D	0.798027	B;B	0.27166	0.037;0.17	B;B	0.26310	0.022;0.068	T	0.30090	-0.9990	10	0.16420	T	0.52	-7.8266	10.1122	0.42570	0.2648:0.0:0.0:0.7352	.	139;185	Q96BD8-2;Q96BD8	.;SKA1_HUMAN	T	185;139;185	ENSP00000285116:S185T;ENSP00000397222:S139T;ENSP00000381470:S185T	ENSP00000285116:S185T	S	+	1	0	SKA1	46171595	0.965000	0.33210	0.952000	0.39060	0.917000	0.54804	0.389000	0.20751	1.083000	0.41159	0.533000	0.62120	TCT	0	pfam_DUF1395		0.313	SKA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKA1	protein_coding	OTTHUMT00000255982.2	99	304	0	0.00	0	0	T	NM_145060	0	0		47917597	1	no_errors	ENST00000285116	ensembl	human	known	74_37	missense	76	134	9.41	18.79	8	31	SNP	0.931	A
NLRP8	126205	genome.wustl.edu	37	19	56465979	56465979	+	Silent	SNP	C	C	T	rs112109260	byFrequency	TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr19:56465979C>T	ENST00000291971.3	+	3	626	c.555C>T	c.(553-555)caC>caT	p.H185H	NLRP8_ENST00000590542.1_Silent_p.H185H	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	185					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.H185H(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TACACAGGCACGAGGAGTACT	0.502																																							0											1	Substitution - coding silent(1)	large_intestine(1)											103.0	96.0	99.0					19																	56465979		2203	4300	6503	SO:0001819	synonymous_variant	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.555C>T	19.37:g.56465979C>T			Q7RTR4	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.H185	ENST00000291971.3	37	c.555	CCDS12937.1	19																																																																																			0	superfamily_P-loop_NTPase		0.502	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	protein_coding	OTTHUMT00000457462.1	86	288	0	0.00	0	0	C	NM_176811	0	0		56465979	1	no_errors	ENST00000291971	ensembl	human	known	74_37	silent	32	109	49.21	50.23	31	110	SNP	0	T
ZIM3	114026	genome.wustl.edu	37	19	57646870	57646870	+	Missense_Mutation	SNP	A	A	G			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr19:57646870A>G	ENST00000269834.1	-	5	1220	c.835T>C	c.(835-837)Tat>Cat	p.Y279H	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTACACTGATAGGATTTCTTG	0.373																																							0											0													114.0	112.0	113.0					19																	57646870		2203	4300	6503	SO:0001583	missense	0			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.835T>C	19.37:g.57646870A>G	ENSP00000269834:p.Tyr279His		Q14CA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y279H	ENST00000269834.1	37	c.835	CCDS33125.1	19	.	.	.	.	.	.	.	.	.	.	A	8.471	0.857525	0.17106	.	.	ENSG00000141946	ENST00000269834	T	0.03889	3.77	2.53	2.53	0.30540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12092	0.0294	L	0.37850	1.14	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.11665	-1.0578	9	0.72032	D	0.01	.	9.6356	0.39806	1.0:0.0:0.0:0.0	.	279	Q96PE6	ZIM3_HUMAN	H	279	ENSP00000269834:Y279H	ENSP00000269834:Y279H	Y	-	1	0	ZIM3	62338682	0.001000	0.12720	0.021000	0.16686	0.057000	0.15508	1.235000	0.32671	1.142000	0.42291	0.260000	0.18958	TAT	0	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	protein_coding	OTTHUMT00000465078.1	43	374	0	0.00	0	0	A		0	0		57646870	-1	no_errors	ENST00000269834	ensembl	human	known	74_37	missense	22	281	18.52	10.51	5	33	SNP	0.187	G
SLC9A8	23315	genome.wustl.edu	37	20	48472034	48472034	+	Missense_Mutation	SNP	A	A	G	rs200096437	byFrequency	TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr20:48472034A>G	ENST00000361573.2	+	8	671	c.629A>G	c.(628-630)aAt>aGt	p.N210S	SLC9A8_ENST00000539601.1_5'UTR|SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000417961.1_Missense_Mutation_p.N226S			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	210					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			GCCATTTTCAATGCACTTCAT	0.478													A|||	2	0.000399361	0.0	0.0	5008	,	,		20997	0.0		0.0	False		,,,				2504	0.002						0.9996,0.0003994											0													205.0	181.0	189.0					20																	48472034		2203	4300	6503	SO:0001583	missense	0			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.629A>G	20.37:g.48472034A>G	ENSP00000354966:p.Asn210Ser		B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.N226S	ENST00000361573.2	37	c.677	CCDS13421.1	20	.	.	.	.	.	.	.	.	.	.	A	21.9	4.209842	0.79240	.	.	ENSG00000197818	ENST00000417961;ENST00000361573	T;T	0.14640	2.49;2.49	5.24	5.24	0.73138	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.10465	0.0256	N	0.17901	0.54	0.80722	D	1	B	0.25105	0.118	B	0.23716	0.048	T	0.18461	-1.0336	10	0.28530	T	0.3	.	15.448	0.75248	1.0:0.0:0.0:0.0	.	210	Q9Y2E8	SL9A8_HUMAN	S	226;210	ENSP00000416418:N226S;ENSP00000354966:N210S	ENSP00000354966:N210S	N	+	2	0	SLC9A8	47905441	1.000000	0.71417	0.944000	0.38274	0.951000	0.60555	9.176000	0.94839	2.101000	0.63845	0.528000	0.53228	AAT	0	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.478	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	protein_coding	OTTHUMT00000106483.3	52	228	0	0.00	0	0	A	XM_030524	rs200096437	A->G		48472034	1	no_errors	ENST00000417961	ensembl	human	known	74_37	missense	46	137	13.21	10.46	7	16	SNP	1	G
SLC47A1	55244	genome.wustl.edu	37	17	19480698	19480701	+	Frame_Shift_Del	DEL	TCAG	TCAG	-			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	TCAG	TCAG	TCAG	-	TCAG	TCAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr17:19480698_19480701delTCAG	ENST00000270570.4	+	17	1631_1634	c.1545_1548delTCAG	c.(1543-1548)cctcagfs	p.PQ515fs	AC025627.7_ENST00000420951.1_RNA|SLC47A1_ENST00000571335.1_Frame_Shift_Del_p.PQ261fs|SLC47A1_ENST00000575023.1_Frame_Shift_Del_p.PQ213fs|SLC47A1_ENST00000395585.1_Frame_Shift_Del_p.PQ515fs|RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000457293.1_Frame_Shift_Del_p.PQ515fs|SLC47A1_ENST00000436810.2_3'UTR	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	515					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	CAGGCGAGCCTCAGTCAGATCAGC	0.505																																							0											0																																										SO:0001589	frameshift_variant	0				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1545_1548delTCAG	17.37:g.19480702_19480705delTCAG	ENSP00000270570:p.Pro515fs		Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Frame_Shift_Del	DEL	pfam_MATE,tigrfam_MATE	p.S517fs	ENST00000270570.4	37	c.1545_1548	CCDS11209.1	17																																																																																			0	NULL		0.505	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	protein_coding	OTTHUMT00000132250.1	74	224	0	0.00	0	0	TCAG	NM_018242	0	0		19480701	1	no_errors	ENST00000395585	ensembl	human	known	74_37	frame_shift_del	41	189	29.31	22.22	17	54	DEL	0.000:0.002:0.000:0.000	0
MT-ND2	4536	genome.wustl.edu	37	M	2279	2279	+	5'Flank	SNP	T	T	C			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chrM:2279T>C	ENST00000361453.3	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TGGACCAATCTATCACCCTAT	0.388																																							0											0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2279T>C	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	0	NULL	ENST00000361453.3	37	NULL		MT																																																																																			0	0		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		78	0	0	0.00	0	0	T	YP_003024027	0	0		2279	1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	7	0	90.32	0.00	84	0	SNP	NULL	C
NUTM2F	54754	genome.wustl.edu	37	9	97083468	97083468	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr9:97083468G>A	ENST00000253262.4	-	4	909	c.889C>T	c.(889-891)Cag>Tag	p.Q297*	NUTM2F_ENST00000335456.7_Nonsense_Mutation_p.Q297*|NUTM2F_ENST00000341207.4_Nonsense_Mutation_p.Q297*	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	297																	TTCATCCACTGCGATTTCTGA	0.647																																							0											0													6.0	7.0	6.0					9																	97083468		1020	2142	3162	SO:0001587	stop_gained	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.889C>T	9.37:g.97083468G>A	ENSP00000253262:p.Gln297*		B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Nonsense_Mutation	SNP	NULL	p.Q297*	ENST00000253262.4	37	c.889	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	13.15	2.149973	0.37923	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	.	.	.	1.2	1.2	0.21068	.	1.663620	0.03125	N	0.164262	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	5.8356	0.18605	0.0:0.0:1.0:0.0	.	.	.	.	X	297	.	ENSP00000253262:Q297X	Q	-	1	0	FAM22F	96123289	0.001000	0.12720	0.013000	0.15412	0.087000	0.18053	0.065000	0.14466	0.992000	0.38840	0.456000	0.33151	CAG	0	NULL		0.647	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUTM2F	protein_coding	OTTHUMT00000053173.2	121	0	0	0.00	0	0	G	NM_017561	0	0		97083468	-1	no_errors	ENST00000253262	ensembl	human	known	74_37	nonsense	45	0	8.16	0.00	4	0	SNP	0.015	A
PPP6R2	9701	genome.wustl.edu	37	22	50879410	50879410	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZB-A962-01A-11D-A428-09	TCGA-ZB-A962-10A-01D-A42B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b15a543b-b034-46ab-a7a0-5d7412289d1d	9c759b09-fb84-4da3-8080-37917380aa67	g.chr22:50879410delC	ENST00000216061.5	+	23	2925	c.2555delC	c.(2554-2556)gccfs	p.A852fs	PPP6R2_ENST00000395744.3_Frame_Shift_Del_p.A818fs|PPP6R2_ENST00000359139.3_Frame_Shift_Del_p.A819fs|PPP6R2_ENST00000395741.3_Frame_Shift_Del_p.A819fs			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	852						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GGCCGGGAGGCCCCCCCGCTG	0.721																																							0											0													16.0	19.0	18.0					22																	50879410		2198	4294	6492	SO:0001589	frameshift_variant	0			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.2555delC	22.37:g.50879410delC	ENSP00000216061:p.Ala852fs		A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Frame_Shift_Del	DEL	pfam_SAPS,superfamily_ARM-type_fold	p.P854fs	ENST00000216061.5	37	c.2555		22																																																																																			0	NULL		0.721	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	PPP6R2	protein_coding	OTTHUMT00000316809.1	43	11	0	0.00	0	0	C	NM_014678	0	0		50879410	1	no_errors	ENST00000216061	ensembl	human	known	74_37	frame_shift_del	22	6	8.33	0.00	2	0	DEL	0	0
