#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CAF	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_ref_reads_val	i_normal_vaf	i_normal_vaf_val	i_normal_var_reads	i_normal_var_reads_val	i_reference	i_refseq_mrna_id	i_rsID	i_rsID_ref_var_alleles	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_ref_reads	i_tumor_ref_reads_val	i_tumor_vaf	i_tumor_vaf_val	i_tumor_var_reads	i_tumor_var_reads_val	i_type	i_ucsc_cons	i_variant
MT-CO1	4512	genome.wustl.edu	37	M	5947	5947	+	Missense_Mutation	SNP	T	T	C			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrM:5947T>C	ENST00000361624.2	+	1	44	c.44T>C	c.(43-45)aTt>aCt	p.I15T	MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	15					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCACAAAGACATTGGAACACT	0.498																																							0											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.44T>C	M.37:g.5947T>C	ENSP00000354499:p.Ile15Thr		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.I15T	ENST00000361624.2	37	c.44		MT																																																																																			0	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	protein_coding		12	0	0	0.00	0	0	T	YP_003024028	0	0		5947	1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	31	1	48.33	85.71	29	6	SNP	NULL	C
MXRA5	25878	genome.wustl.edu	37	X	3235593	3235593	+	Silent	SNP	C	C	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:3235593C>G	ENST00000217939.6	-	6	6283	c.6129G>C	c.(6127-6129)gcG>gcC	p.A2043A		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2043						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGGGCAGTGCCGCCACGTGCA	0.637																																							0											0													26.0	22.0	23.0					X																	3235593		2201	4298	6499	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6129G>C	X.37:g.3235593C>G			Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A2043	ENST00000217939.6	37	c.6129	CCDS14124.1	X																																																																																			0	smart_Ig_sub		0.637	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	75	21	0	0.00	0	0	C	NM_015419	0	0		3235593	-1	no_errors	ENST00000217939	ensembl	human	known	74_37	silent	31	18	42.59	47.06	23	16	SNP	0.042	G
PHEX	5251	genome.wustl.edu	37	X	22129592	22129592	+	Missense_Mutation	SNP	G	G	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:22129592G>A	ENST00000379374.4	+	10	1652	c.1087G>A	c.(1087-1089)Gcc>Acc	p.A363T	PHEX_ENST00000418858.3_Missense_Mutation_p.A66T|PHEX_ENST00000537599.1_Missense_Mutation_p.A363T|PHEX_ENST00000535894.1_Missense_Mutation_p.A266T	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	363				A -> D (in Ref. 9; AAC50552). {ECO:0000305}.	bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						CAGGACCATTGCCAACTATTT	0.408																																							0											0													205.0	194.0	197.0					X																	22129592		2203	4300	6503	SO:0001583	missense	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1087G>A	X.37:g.22129592G>A	ENSP00000368682:p.Ala363Thr		O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.A363T	ENST00000379374.4	37	c.1087	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764444	0.89932	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.72	5.72	0.89469	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.84051	0.5387	M	0.71581	2.175	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.69307	0.937;0.963	T	0.80013	-0.1560	10	0.13853	T	0.58	-1.5286	18.5109	0.90916	0.0:0.0:1.0:0.0	.	363;363	F5GXU4;P78562	.;PHEX_HUMAN	T	363;363;266;66	ENSP00000368682:A363T;ENSP00000440362:A363T;ENSP00000439418:A266T;ENSP00000443531:A66T	ENSP00000368682:A363T	A	+	1	0	PHEX	22039513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.944000	0.87722	2.413000	0.81919	0.600000	0.82982	GCC	0	pfam_Peptidase_M13_N		0.408	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	protein_coding	OTTHUMT00000056035.1	83	246	0	0.81	0	2	G	NM_000444	0	0		22129592	1	no_errors	ENST00000379374	ensembl	human	known	74_37	missense	45	127	34.78	36.00	24	72	SNP	1	A
RPGR	6103	genome.wustl.edu	37	X	38146390	38146390	+	Missense_Mutation	SNP	T	T	C			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:38146390T>C	ENST00000339363.3	-	14	2644	c.2477A>G	c.(2476-2478)gAg>gGg	p.E826G	TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.E559G|RPGR_ENST00000318842.7_Missense_Mutation_p.E621G|RPGR_ENST00000338898.3_3'UTR|RPGR_ENST00000378505.2_Missense_Mutation_p.E621G|RPGR_ENST00000342811.3_Missense_Mutation_p.E621G			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	826	Glu-rich.				cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CTCTGTTttctcctttcttcc	0.463																																							0											0													212.0	140.0	164.0					X																	38146390		2202	4300	6502	SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2477A>G	X.37:g.38146390T>C	ENSP00000343671:p.Glu826Gly		B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E621G	ENST00000339363.3	37	c.1862		X	.	.	.	.	.	.	.	.	.	.	t	9.683	1.149810	0.21288	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000318842;ENST00000342811;ENST00000378505	T;T;T;T;T	0.40476	2.22;2.54;2.15;1.03;1.07	3.17	3.17	0.36434	.	0.379473	0.08080	U	1.000000	T	0.27349	0.0671	L	0.27053	0.805	0.09310	N	0.999999	B;B	0.27229	0.107;0.172	B;B	0.25987	0.03;0.065	T	0.25467	-1.0131	10	0.28530	T	0.3	.	3.3967	0.07308	0.0:0.1349:0.2356:0.6296	.	621;621	E9PE28;Q92834-2	.;.	G	826;559;621;621;621	ENSP00000343671:E826G;ENSP00000308783:E559G;ENSP00000322219:E621G;ENSP00000339531:E621G;ENSP00000367766:E621G	ENSP00000308783:E559G	E	-	2	0	RPGR	38031334	0.006000	0.16342	0.009000	0.14445	0.086000	0.17979	1.679000	0.37597	1.105000	0.41606	0.393000	0.25936	GAG	0	NULL		0.463	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	protein_coding		20	244	0	0.00	0	0	T	NM_000328	0	0		38146390	-1	no_errors	ENST00000378505	ensembl	human	known	74_37	missense	11	113	38.89	44.33	7	90	SNP	0.059	C
GPR173	54328	genome.wustl.edu	37	X	53106206	53106206	+	Missense_Mutation	SNP	A	A	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:53106206A>G	ENST00000332582.4	+	2	894	c.403A>G	c.(403-405)Atg>Gtg	p.M135V		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	135					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						CGCCAAGCGCATGACACTCTG	0.582																																							0											0													62.0	48.0	52.0					X																	53106206		2203	4300	6503	SO:0001583	missense	0			AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.403A>G	X.37:g.53106206A>G	ENSP00000331600:p.Met135Val		B1B0A5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M135V	ENST00000332582.4	37	c.403	CCDS14349.1	X	.	.	.	.	.	.	.	.	.	.	A	11.72	1.724244	0.30593	.	.	ENSG00000184194	ENST00000332582	T	0.39406	1.08	4.17	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	M	0.64567	1.98	0.52501	D	0.999952	B	0.28026	0.198	B	0.28011	0.085	T	0.12400	-1.0549	10	0.14252	T	0.57	-11.4851	10.3422	0.43884	1.0:0.0:0.0:0.0	.	135	Q9NS66	GP173_HUMAN	V	135	ENSP00000331600:M135V	ENSP00000331600:M135V	M	+	1	0	GPR173	53122931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.094000	0.64523	1.560000	0.49568	0.430000	0.28490	ATG	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.582	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR173	protein_coding	OTTHUMT00000056717.2	16	28	0	0.00	0	0	A	NM_018969	0	0		53106206	1	no_errors	ENST00000332582	ensembl	human	known	74_37	missense	5	19	66.67	26.92	10	7	SNP	1	G
TMEM185A	84548	genome.wustl.edu	37	X	148692970	148692970	+	Splice_Site	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:148692970C>T	ENST00000316916.8	-	2	519	c.215G>A	c.(214-216)cGa>cAa	p.R72Q	TMEM185A_ENST00000507237.1_Splice_Site_p.R72Q|TMEM185A_ENST00000536359.1_Intron	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	72						dendrite (GO:0030425)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GCAGTATTACCGATATTGAGG	0.418																																							0											0													233.0	230.0	231.0					X																	148692970		2203	4299	6502	SO:0001630	splice_region_variant	0			AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.215+1G>A	X.37:g.148692970C>T			B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	pfam_TM_Fragile-X-F-assoc	p.R72Q	ENST00000316916.8	37	c.215	CCDS14689.1	X	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911811	0.92178	.	.	ENSG00000155984	ENST00000316916;ENST00000507237	T;T	0.49139	1.7;0.79	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70842	-0.4762	9	.	.	.	.	16.2802	0.82672	0.0:1.0:0.0:0.0	.	72	Q8NFB2	T185A_HUMAN	Q	72	ENSP00000359449:R72Q;ENSP00000427766:R72Q	.	R	-	2	0	TMEM185A	148500771	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.249000	0.78278	2.040000	0.60383	0.594000	0.82650	CGA	0	pfam_TM_Fragile-X-F-assoc		0.418	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM185A	protein_coding	OTTHUMT00000058710.4	168	239	0	0.00	0	0	C	NM_032508	0	0	Missense_Mutation	148692970	-1	no_errors	ENST00000316916	ensembl	human	known	74_37	missense	84	120	39.57	42.58	55	89	SNP	1	T
NECAP2	55707	genome.wustl.edu	37	1	16785395	16785395	+	3'UTR	SNP	G	G	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr1:16785395G>A	ENST00000337132.5	+	0	892				NECAP2_ENST00000406746.1_3'UTR|NECAP2_ENST00000443980.2_Silent_p.T242T|NECAP2_ENST00000504551.2_3'UTR|NECAP2_ENST00000457722.2_3'UTR|RP4-798A10.2_ENST00000457898.1_lincRNA	NM_001145278.1|NM_018090.4	NP_001138750.1|NP_060560.1	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2						endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTGAGCACGGTTTTTCCTC	0.562																																							0											0													74.0	76.0	75.0					1																	16785395		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK021938	CCDS173.1, CCDS44066.1, CCDS44067.1	1p36.13	2008-02-05			ENSG00000157191	ENSG00000157191			25528	protein-coding gene	gene with protein product		611624				14555962, 15494011	Standard	NM_001145277		Approved	FLJ10420	uc001ayq.3	Q9NVZ3	OTTHUMG00000002313	ENST00000337132.5:c.*10G>A	1.37:g.16785395G>A			B4DY19|E9PGQ8|Q5VSU4|Q5VSU5|Q9H7L1|Q9H8L1	Silent	SNP	pfam_NECAP-1	p.T242	ENST00000337132.5	37	c.726	CCDS173.1	1																																																																																			0	NULL		0.562	NECAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAP2	protein_coding	OTTHUMT00000006680.2	64	136	0	0.00	0	0	G	NM_018090	0	0		16785395	1	no_errors	ENST00000443980	ensembl	human	known	74_37	silent	43	128	14	6.52	7	9	SNP	0	A
LRRC7	57554	genome.wustl.edu	37	1	70385486	70385486	+	Intron	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr1:70385486C>T	ENST00000035383.5	+	6	563				LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Intron|PIN1P1_ENST00000412108.1_RNA	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ACAGTGTTCACGGATTCCGGC	0.652																																							0											0																																										SO:0001627	intron_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-11704C>T	1.37:g.70385486C>T			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	0	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			0	0		0.652	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	protein_coding	OTTHUMT00000131261.1	53	88	0	0.00	0	0	C	NM_020794	0	0		70385486	1	no_errors	ENST00000412108	ensembl	human	known	74_37	rna	29	37	27.5	33.93	11	19	SNP	0.971	T
CCDC108	255101	genome.wustl.edu	37	2	219870259	219870259	+	Silent	SNP	T	T	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr2:219870259T>G	ENST00000341552.5	-	32	5031	c.4948A>C	c.(4948-4950)Agg>Cgg	p.R1650R	CCDC108_ENST00000453220.1_Silent_p.R1650R|AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000441968.1_Silent_p.R1650R	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1650						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GACTCTTCCCTGGGGGCCTTC	0.552																																							0											0													66.0	67.0	67.0					2																	219870259		2203	4300	6503	SO:0001819	synonymous_variant	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4948A>C	2.37:g.219870259T>G			A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	superfamily_PapD-like,pfscan_MSP_dom	p.R1650	ENST00000341552.5	37	c.4948	CCDS2430.2	2																																																																																			0	NULL		0.552	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	72	147	0	0.00	0	0	T	NM_194302	0	0		219870259	-1	no_errors	ENST00000341552	ensembl	human	known	74_37	silent	49	76	33.78	37.40	25	46	SNP	0	G
PTPRN	5798	genome.wustl.edu	37	2	220164896	220164896	+	Missense_Mutation	SNP	G	G	C			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr2:220164896G>C	ENST00000295718.2	-	9	1487	c.1247C>G	c.(1246-1248)cCt>cGt	p.P416R	PTPRN_ENST00000409251.3_Missense_Mutation_p.P416R|PTPRN_ENST00000423636.2_Missense_Mutation_p.P326R|AC114803.3_ENST00000417355.1_RNA	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	416					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		ACTGGAGGTAGGGCTGGCAGT	0.617																																							0											0													65.0	74.0	71.0					2																	220164896		2203	4300	6503	SO:0001583	missense	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1247C>G	2.37:g.220164896G>C	ENSP00000295718:p.Pro416Arg		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P416R	ENST00000295718.2	37	c.1247	CCDS2440.1	2	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743256	0.30865	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.25912	1.77;1.77;1.77	4.14	4.14	0.48551	.	0.403521	0.21484	N	0.073783	T	0.14614	0.0353	L	0.29908	0.895	0.29033	N	0.885598	P;P	0.39216	0.664;0.664	B;B	0.29942	0.109;0.109	T	0.08638	-1.0712	10	0.27785	T	0.31	.	9.9245	0.41483	0.0:0.2075:0.7925:0.0	.	416;416	Q6NSL1;Q16849	.;PTPRN_HUMAN	R	416;416;416;326	ENSP00000386638:P416R;ENSP00000295718:P416R;ENSP00000444244:P326R	ENSP00000295718:P416R	P	-	2	0	PTPRN	219873140	0.942000	0.31987	0.324000	0.25361	0.829000	0.46940	2.819000	0.48049	2.123000	0.65237	0.462000	0.41574	CCT	0	NULL		0.617	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	protein_coding	OTTHUMT00000256819.2	20	83	0	0.00	0	0	G		0	0		220164896	-1	no_errors	ENST00000295718	ensembl	human	known	74_37	missense	9	55	55	35.29	11	30	SNP	0.732	C
IQCA1	79781	genome.wustl.edu	37	2	237246856	237246856	+	Missense_Mutation	SNP	G	G	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr2:237246856G>T	ENST00000409907.3	-	17	2400	c.2126C>A	c.(2125-2127)tCc>tAc	p.S709Y	IQCA1_ENST00000309507.5_Missense_Mutation_p.S706Y|IQCA1_ENST00000431676.2_Missense_Mutation_p.S668Y	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	709							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						GCCGTATCTGGAAGCATAGTC	0.562																																							0											0													43.0	45.0	44.0					2																	237246856		1919	4119	6038	SO:0001583	missense	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.2126C>A	2.37:g.237246856G>T	ENSP00000387347:p.Ser709Tyr		B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.S709Y	ENST00000409907.3	37	c.2126	CCDS46549.1	2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684194	0.88639	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676	D;D;D	0.88818	-2.43;-2.43;-2.43	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000002	D	0.95557	0.8556	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.99	D	0.96041	0.9024	10	0.87932	D	0	.	18.9821	0.92758	0.0:0.0:1.0:0.0	.	668;717;709	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	Y	709;717;706;668	ENSP00000387347:S709Y;ENSP00000311951:S706Y;ENSP00000407213:S668Y	ENSP00000311951:S706Y	S	-	2	0	IQCA1	236911595	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	9.264000	0.95635	2.572000	0.86782	0.655000	0.94253	TCC	0	superfamily_P-loop_NTPase		0.562	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	protein_coding	OTTHUMT00000329266.1	44	242	0	0.00	0	0	G	NM_024726	0	0		237246856	-1	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	26	109	38.1	35.12	16	59	SNP	1	T
HES1	3280	genome.wustl.edu	37	3	193855974	193855974	+	Missense_Mutation	SNP	C	C	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr3:193855974C>G	ENST00000232424.3	+	4	1031	c.795C>G	c.(793-795)agC>agG	p.S265R		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		CACCTTCCAGCGGCCCCTCGC	0.667																																							0											0													19.0	22.0	21.0					3																	193855974		2201	4294	6495	SO:0001583	missense	0			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.795C>G	3.37:g.193855974C>G	ENSP00000232424:p.Ser265Arg		A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	pfam_Orange,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom	p.S265R	ENST00000232424.3	37	c.795	CCDS3305.1	3	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591455	0.28357	.	.	ENSG00000114315	ENST00000232424	T	0.60171	0.21	5.39	3.59	0.41128	.	0.417415	0.25063	N	0.033437	T	0.34745	0.0908	N	0.24115	0.695	0.28407	N	0.918375	B	0.11235	0.004	B	0.06405	0.002	T	0.12760	-1.0535	10	0.21014	T	0.42	-5.4335	2.5954	0.04853	0.2334:0.4968:0.1212:0.1486	.	265	Q14469	HES1_HUMAN	R	265	ENSP00000232424:S265R	ENSP00000232424:S265R	S	+	3	2	HES1	195338668	0.992000	0.36948	1.000000	0.80357	0.993000	0.82548	0.296000	0.19083	0.741000	0.32674	0.655000	0.94253	AGC	0	NULL		0.667	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES1	protein_coding	OTTHUMT00000342632.1	55	56	0	0.00	0	0	C		0	0		193855974	1	no_errors	ENST00000232424	ensembl	human	known	74_37	missense	27	59	42.55	39.80	20	39	SNP	1	G
ZSCAN16	80345	genome.wustl.edu	37	6	28097443	28097443	+	Silent	SNP	C	C	T	rs113926481		TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr6:28097443C>T	ENST00000340487.4	+	4	911	c.762C>T	c.(760-762)caC>caT	p.H254H	ZSCAN16-AS1_ENST00000602810.1_RNA|ZSCAN16-AS1_ENST00000600652.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	254					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TTAGTAAACACAGGAGAACTC	0.433																																							0											0													102.0	107.0	106.0					6																	28097443		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.762C>T	6.37:g.28097443C>T			Q9H6K2	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.H254	ENST00000340487.4	37	c.762	CCDS4644.1	6																																																																																			0	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN16	protein_coding	OTTHUMT00000040177.1	73	245	0	0.00	0	0	C	NM_025231	0	0		28097443	1	no_errors	ENST00000340487	ensembl	human	known	74_37	silent	28	130	53.33	35.00	32	70	SNP	0.839	T
FILIP1	27145	genome.wustl.edu	37	6	76022744	76022744	+	Missense_Mutation	SNP	A	A	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr6:76022744A>G	ENST00000237172.7	-	5	3134	c.2804T>C	c.(2803-2805)tTt>tCt	p.F935S	FILIP1_ENST00000370020.1_Missense_Mutation_p.F836S|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Missense_Mutation_p.F935S	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	935										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						ACTAGAAAAAAATTCTTCAGA	0.438																																							0											0													155.0	153.0	154.0					6																	76022744		2203	4300	6503	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2804T>C	6.37:g.76022744A>G	ENSP00000237172:p.Phe935Ser		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.F935S	ENST00000237172.7	37	c.2804	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	A	7.874	0.728836	0.15507	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.15834	2.39;2.4;2.41	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.37630	1.12	0.58432	D	0.999991	P;B;B	0.42692	0.787;0.024;0.041	B;B;B	0.36186	0.219;0.019;0.042	T	0.26677	-1.0096	10	0.20046	T	0.44	-20.9288	16.5582	0.84512	1.0:0.0:0.0:0.0	.	935;935;935	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	S	935;935;836	ENSP00000376728:F935S;ENSP00000237172:F935S;ENSP00000359037:F836S	ENSP00000237172:F935S	F	-	2	0	FILIP1	76079464	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	6.950000	0.75977	2.308000	0.77769	0.533000	0.62120	TTT	0	NULL		0.438	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	protein_coding	OTTHUMT00000041263.1	42	219	0	0.00	0	0	A	XM_029179	0	0		76022744	-1	no_errors	ENST00000237172	ensembl	human	known	74_37	missense	17	138	39.29	36.70	11	80	SNP	0.998	G
LFNG	3955	genome.wustl.edu	37	7	2565349	2565349	+	Missense_Mutation	SNP	G	G	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr7:2565349G>A	ENST00000222725.5	+	5	786	c.766G>A	c.(766-768)Ggc>Agc	p.G256S	LFNG_ENST00000338732.3_Missense_Mutation_p.G127S|LFNG_ENST00000402506.1_Missense_Mutation_p.G185S|MIR4648_ENST00000580107.1_RNA|LFNG_ENST00000402045.1_Missense_Mutation_p.G127S|LFNG_ENST00000359574.3_Missense_Mutation_p.G256S	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	256					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		TGCCACGGGCGGCGCTGGCTT	0.682																																							0											0													50.0	51.0	51.0					7																	2565349		2201	4298	6499	SO:0001583	missense	0			BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.766G>A	7.37:g.2565349G>A	ENSP00000222725:p.Gly256Ser		B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	SNP	pfam_Fringe-like,pirsf_Fringe	p.G256S	ENST00000222725.5	37	c.766	CCDS34587.1	7	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690175	0.88735	.	.	ENSG00000106003	ENST00000402506;ENST00000402045;ENST00000338732;ENST00000222725;ENST00000359574	D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.95030	0.8391	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96330	0.9243	10	0.87932	D	0	-7.1584	18.9863	0.92771	0.0:0.0:1.0:0.0	.	256;256	Q8NES3-3;Q8NES3	.;LFNG_HUMAN	S	185;127;127;256;256	ENSP00000385764:G185S;ENSP00000384786:G127S;ENSP00000343095:G127S;ENSP00000222725:G256S;ENSP00000352579:G256S	ENSP00000222725:G256S	G	+	1	0	LFNG	2531875	1.000000	0.71417	0.123000	0.21794	0.963000	0.63663	9.193000	0.94954	2.489000	0.83994	0.561000	0.74099	GGC	0	pfam_Fringe-like,pirsf_Fringe		0.682	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LFNG	protein_coding	OTTHUMT00000325021.1	38	97	0	0.00	0	0	G	NM_002304	0	0		2565349	1	no_errors	ENST00000222725	ensembl	human	known	74_37	missense	37	71	15.91	4.05	7	3	SNP	1	A
GTF2I	2969	genome.wustl.edu	37	7	74146970	74146970	+	Missense_Mutation	SNP	T	T	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr7:74146970T>A	ENST00000324896.4	+	15	1660	c.1271T>A	c.(1270-1272)cTt>cAt	p.L424H	GTF2I_ENST00000353920.4_Missense_Mutation_p.L404H|GTF2I_ENST00000416070.1_Missense_Mutation_p.L383H|GTF2I_ENST00000346152.4_Missense_Mutation_p.L403H	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	424					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATTACTTGCAAAGGAA	0.378																																							0											0													13.0	13.0	13.0					7																	74146970		1741	3768	5509	SO:0001583	missense	0			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1271T>A	7.37:g.74146970T>A	ENSP00000322542:p.Leu424His		O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.L424H	ENST00000324896.4	37	c.1271	CCDS5573.1	7	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565904	0.65651	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.72	4.72	0.59763	.	0.110120	0.39544	N	0.001322	T	0.37019	0.0988	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.999	D;D;P;D;D	0.74348	0.983;0.979;0.874;0.971;0.963	T	0.36089	-0.9762	10	0.56958	D	0.05	-16.5588	13.3771	0.60745	0.0:0.0:0.0:1.0	.	402;383;404;403;424	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	H	424;419;404;403;383	ENSP00000322542:L424H;ENSP00000322671:L404H;ENSP00000322599:L403H;ENSP00000387651:L383H	ENSP00000322542:L424H	L	+	2	0	GTF2I	73784906	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.342000	0.65970	1.753000	0.51906	0.477000	0.44152	CTT	0	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I		0.378	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2I	protein_coding	OTTHUMT00000252708.1	415	143	0.24	0.00	1	0	T	NM_032999	0	0		74146970	1	no_errors	ENST00000324896	ensembl	human	known	74_37	missense	205	53	39.88	41.94	136	39	SNP	1	A
MAMDC4	158056	genome.wustl.edu	37	9	139750227	139750227	+	Silent	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr9:139750227C>T	ENST00000317446.2	+	13	1565	c.1515C>T	c.(1513-1515)gaC>gaT	p.D505D	MAMDC4_ENST00000445819.1_Silent_p.D505D|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GCTGGGAGGACGCCAGCGTGG	0.687																																							0											0													9.0	11.0	10.0					9																	139750227		2137	4220	6357	SO:0001819	synonymous_variant	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1515C>T	9.37:g.139750227C>T				Silent	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt	p.D505	ENST00000317446.2	37	c.1515	CCDS7010.1	9	.	.	.	.	.	.	.	.	.	.	.	6.744	0.506041	0.12883	.	.	ENSG00000177943	ENST00000413647	.	.	.	3.79	-3.54	0.04653	.	.	.	.	.	T	0.63212	0.2492	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61657	-0.7018	4	.	.	.	-26.5277	14.1068	0.65096	0.0:0.8124:0.0:0.1876	.	.	.	.	C	487	.	.	R	+	1	0	MAMDC4	138870048	0.000000	0.05858	0.760000	0.31359	0.588000	0.36517	-2.513000	0.00957	-0.794000	0.04468	-0.367000	0.07326	CGC	0	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.687	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	protein_coding	OTTHUMT00000254642.3	17	33	0	0.00	0	0	C	NM_206920	0	0		139750227	1	no_errors	ENST00000445819	ensembl	human	known	74_37	silent	15	38	28.57	29.63	6	16	SNP	0.908	T
SLC22A6	9356	genome.wustl.edu	37	11	62744854	62744854	+	Missense_Mutation	SNP	G	G	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr11:62744854G>T	ENST00000377871.3	-	9	1633	c.1367C>A	c.(1366-1368)aCa>aAa	p.T456K	SLC22A6_ENST00000537349.1_5'Flank|SLC22A6_ENST00000421062.2_Intron|SLC22A6_ENST00000360421.4_Missense_Mutation_p.T456K|SLC22A6_ENST00000458333.2_Intron	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	456					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TCCCATGCCTGTCTGCCTGCA	0.617																																							0											0													35.0	28.0	31.0					11																	62744854		2200	4298	6498	SO:0001583	missense	0			AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.1367C>A	11.37:g.62744854G>T	ENSP00000367102:p.Thr456Lys		A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.T456K	ENST00000377871.3	37	c.1367	CCDS31591.1	11	.	.	.	.	.	.	.	.	.	.	G	19.07	3.754978	0.69648	.	.	ENSG00000197901	ENST00000360421;ENST00000394651;ENST00000377871	T;T	0.61510	0.1;0.1	4.76	4.76	0.60689	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.169446	0.51477	D	0.000098	T	0.75324	0.3834	M	0.83384	2.64	0.80722	D	1	D;D	0.59767	0.986;0.982	P;P	0.62089	0.898;0.835	T	0.79642	-0.1718	10	0.66056	D	0.02	.	15.2981	0.73925	0.0:0.0:1.0:0.0	.	456;456	Q4U2R8;Q4U2R8-2	S22A6_HUMAN;.	K	456;435;456	ENSP00000353597:T456K;ENSP00000367102:T456K	ENSP00000353597:T456K	T	-	2	0	SLC22A6	62501430	0.965000	0.33210	0.950000	0.38849	0.778000	0.44026	1.672000	0.37523	2.440000	0.82611	0.561000	0.74099	ACA	0	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.617	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	SLC22A6	protein_coding	OTTHUMT00000396186.1	11	67	0	0.00	0	0	G	NM_004790	0	0		62744854	-1	no_errors	ENST00000377871	ensembl	human	known	74_37	missense	4	36	60	33.33	6	18	SNP	0.96	T
OR6M1	390261	genome.wustl.edu	37	11	123676667	123676667	+	Missense_Mutation	SNP	T	T	C			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr11:123676667T>C	ENST00000309154.2	-	1	428	c.391A>G	c.(391-393)Acg>Gcg	p.T131A		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		ATGATGACCGTGTAGTGCAGT	0.522																																							0											0													48.0	50.0	50.0					11																	123676667		2202	4298	6500	SO:0001583	missense	0			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.391A>G	11.37:g.123676667T>C	ENSP00000311038:p.Thr131Ala		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T131A	ENST00000309154.2	37	c.391	CCDS31696.1	11	.	.	.	.	.	.	.	.	.	.	T	0.081	-1.183264	0.01620	.	.	ENSG00000196099	ENST00000309154	T	0.01185	5.21	3.68	1.03	0.20045	GPCR, rhodopsin-like superfamily (1);	0.234669	0.21605	U	0.071896	T	0.01092	0.0036	L	0.28458	0.855	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.46442	-0.9191	10	0.38643	T	0.18	.	9.0926	0.36621	0.0:0.0:0.4576:0.5424	.	131	Q8NGM8	OR6M1_HUMAN	A	131	ENSP00000311038:T131A	ENSP00000311038:T131A	T	-	1	0	OR6M1	123181877	0.000000	0.05858	0.526000	0.27913	0.016000	0.09150	-2.265000	0.01172	-0.016000	0.14127	-0.313000	0.08912	ACG	0	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.522	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6M1	protein_coding	OTTHUMT00000387437.1	51	104	0	0.00	0	0	T	NM_001005325	0	0		123676667	-1	no_errors	ENST00000309154	ensembl	human	known	74_37	missense	27	49	35.71	45.56	15	41	SNP	0.03	C
BBS10	79738	genome.wustl.edu	37	12	76741446	76741446	+	Missense_Mutation	SNP	G	G	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr12:76741446G>A	ENST00000393262.3	-	2	402	c.319C>T	c.(319-321)Cct>Tct	p.P107S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	107					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						CACATCAAAGGATCCTTTTCT	0.378									Bardet-Biedl syndrome																														0											0													95.0	94.0	94.0					12																	76741446		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.319C>T	12.37:g.76741446G>A	ENSP00000376946:p.Pro107Ser		Q96CW2|Q9H5D2	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.P107S	ENST00000393262.3	37	c.319	CCDS9014.2	12	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.538964	0.00143	.	.	ENSG00000179941	ENST00000393262;ENST00000547830	D	0.89415	-2.51	5.2	1.3	0.21679	.	0.766930	0.12094	N	0.500133	T	0.58652	0.2137	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56968	-0.7891	10	0.09338	T	0.73	-0.02	5.392	0.16249	0.6701:0.1629:0.167:0.0	.	107	Q8TAM1	BBS10_HUMAN	S	107;41	ENSP00000376946:P107S	ENSP00000376946:P107S	P	-	1	0	BBS10	75265577	0.000000	0.05858	0.004000	0.12327	0.234000	0.25298	0.286000	0.18902	0.157000	0.19338	-0.300000	0.09419	CCT	0	superfamily_Cpn60/TCP-1		0.378	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS10	protein_coding	OTTHUMT00000303983.2	27	188	0	0.00	0	0	G	NM_024685	0	0		76741446	-1	no_errors	ENST00000393262	ensembl	human	known	74_37	missense	11	86	31.25	35.82	5	48	SNP	0.051	A
SACS	26278	genome.wustl.edu	37	13	23913409	23913409	+	Missense_Mutation	SNP	C	C	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr13:23913409C>A	ENST00000382292.3	-	9	4879	c.4606G>T	c.(4606-4608)Gtg>Ttg	p.V1536L	SACS_ENST00000402364.1_Missense_Mutation_p.V786L|SACS_ENST00000382298.3_Missense_Mutation_p.V1536L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1536					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GTTATGTTCACAAAATCTGAA	0.383																																							0											0													60.0	59.0	59.0					13																	23913409		2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4606G>T	13.37:g.23913409C>A	ENSP00000371729:p.Val1536Leu		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.V1536L	ENST00000382292.3	37	c.4606	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	8.085	0.773176	0.16051	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	T;T;T	0.79940	-1.32;-1.32;-1.32	5.96	1.66	0.24008	ATPase-like, ATP-binding domain (2);	0.321555	0.30356	N	0.009809	T	0.53029	0.1771	N	0.05230	-0.09	0.23936	N	0.99641	B	0.02656	0.0	B	0.01281	0.0	T	0.29852	-0.9998	10	0.24483	T	0.36	.	1.9265	0.03318	0.3142:0.3851:0.1463:0.1544	.	1536	Q9NZJ4	SACS_HUMAN	L	1536;786;1536	ENSP00000371729:V1536L;ENSP00000385844:V786L;ENSP00000371735:V1536L	ENSP00000371729:V1536L	V	-	1	0	SACS	22811409	0.998000	0.40836	0.996000	0.52242	0.998000	0.95712	0.849000	0.27723	0.372000	0.24591	0.650000	0.86243	GTG	0	superfamily_HATPase_ATP-bd		0.383	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	41	277	0	0.00	0	0	C	NM_014363	0	0		23913409	-1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	20	148	42.86	36.48	15	85	SNP	0.989	A
THAP11	57215	genome.wustl.edu	37	16	67876808	67876808	+	Silent	SNP	G	G	A			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr16:67876808G>A	ENST00000303596.1	+	1	596	c.351G>A	c.(349-351)caG>caA	p.Q117Q	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	117	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		agcagcaacagcagcagcagc	0.667																																							0											0													22.0	27.0	25.0					16																	67876808		1916	3809	5725	SO:0001819	synonymous_variant	0			AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.351G>A	16.37:g.67876808G>A			A4UCT5|A8K002|O94795	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.Q117	ENST00000303596.1	37	c.351	CCDS10847.1	16																																																																																			0	NULL		0.667	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP11	protein_coding	OTTHUMT00000268879.1	9	11	0	0.00	0	0	G	NM_020457	0	0		67876808	1	no_errors	ENST00000303596	ensembl	human	known	74_37	silent	17	11	19.05	15.38	4	2	SNP	0.946	A
SPIRE2	84501	genome.wustl.edu	37	16	89936636	89936636	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr16:89936636C>T	ENST00000378247.3	+	15	2144	c.2101C>T	c.(2101-2103)Caa>Taa	p.Q701*	SPIRE2_ENST00000393062.2_Nonsense_Mutation_p.Q653*	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	701					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TCGCCAGACCCAATCCCTCTA	0.607																																							0											0													98.0	62.0	74.0					16																	89936636		2196	4300	6496	SO:0001587	stop_gained	0			AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.2101C>T	16.37:g.89936636C>T	ENSP00000367494:p.Gln701*		A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_KIND	p.Q701*	ENST00000378247.3	37	c.2101	CCDS32516.1	16	.	.	.	.	.	.	.	.	.	.	c	37	6.089579	0.97271	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	.	.	.	4.98	4.98	0.66077	.	0.380530	0.28135	N	0.016473	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-37.0087	17.3585	0.87343	0.0:1.0:0.0:0.0	.	.	.	.	X	701;653	.	ENSP00000367494:Q701X	Q	+	1	0	SPIRE2	88464137	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	3.372000	0.52387	2.756000	0.94617	0.543000	0.68304	CAA	0	NULL		0.607	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIRE2	protein_coding	OTTHUMT00000421843.1	39	185	0	0.00	0	0	C	XM_047462	0	0		89936636	1	no_errors	ENST00000378247	ensembl	human	known	74_37	nonsense	22	90	46.34	40.40	19	61	SNP	0.997	T
IGFLR1	79713	genome.wustl.edu	37	19	36230713	36230713	+	Missense_Mutation	SNP	G	G	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr19:36230713G>T	ENST00000592537.1	-	4	719	c.619C>A	c.(619-621)Ccc>Acc	p.P207T	IGFLR1_ENST00000587101.1_5'Flank|IGFLR1_ENST00000592889.1_Intron|IGFLR1_ENST00000344990.3_Intron|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000246532.1_Missense_Mutation_p.P207T|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000588992.1_Intron			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						TGGGTGTTGGGGACTCCGCAG	0.607																																							0											0													92.0	99.0	96.0					19																	36230713		2203	4300	6503	SO:0001583	missense	0			AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.619C>A	19.37:g.36230713G>T	ENSP00000466181:p.Pro207Thr		Q8N5X0	Missense_Mutation	SNP	superfamily_DEATH-like_dom	p.P207T	ENST00000592537.1	37	c.619	CCDS12472.1	19	.	.	.	.	.	.	.	.	.	.	G	8.210	0.800052	0.16397	.	.	ENSG00000126246	ENST00000246532	D	0.96774	-4.12	5.08	-0.0863	0.13682	.	0.769359	0.11551	N	0.552781	D	0.88629	0.6488	N	0.17082	0.46	0.09310	N	0.999997	B	0.19583	0.037	B	0.21917	0.037	T	0.77310	-0.2635	10	0.11182	T	0.66	-2.33	4.1999	0.10460	0.2929:0.0:0.5437:0.1633	.	207	Q9H665	IGFR1_HUMAN	T	207	ENSP00000246532:P207T	ENSP00000246532:P207T	P	-	1	0	IGFLR1	40922553	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.358000	0.20216	-0.083000	0.12618	0.462000	0.41574	CCC	0	NULL		0.607	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	IGFLR1	protein_coding	OTTHUMT00000459077.1	23	84	0	0.00	0	0	G	NM_024660	0	0		36230713	-1	no_errors	ENST00000246532	ensembl	human	known	74_37	missense	12	66	55.56	48.84	15	63	SNP	0	T
PTH2	113091	genome.wustl.edu	37	19	49926534	49926534	+	Silent	SNP	C	C	A	rs371950649		TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr19:49926534C>A	ENST00000270631.1	-	1	164	c.63G>T	c.(61-63)ctG>ctT	p.L21L	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	21					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GCACCACcagcagcagcagca	0.692																																							0											0													12.0	16.0	14.0					19																	49926534		2192	4283	6475	SO:0001819	synonymous_variant	0			AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.63G>T	19.37:g.49926534C>A			Q96DJ4	Silent	SNP	NULL	p.L21	ENST00000270631.1	37	c.63	CCDS12763.1	19																																																																																			0	NULL		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	protein_coding	OTTHUMT00000465366.1	80	29	0	0.00	0	0	C	NM_178449	0	0		49926534	-1	no_errors	ENST00000270631	ensembl	human	known	74_37	silent	64	33	17.95	15.38	14	6	SNP	0.057	A
EBF4	57593	genome.wustl.edu	37	20	2730141	2730141	+	Missense_Mutation	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr20:2730141C>T	ENST00000609451.1	+	8	806	c.734C>T	c.(733-735)gCg>gTg	p.A245V	EBF4_ENST00000380648.4_Missense_Mutation_p.A241V			Q9BQW3	COE4_HUMAN	early B-cell factor 4	245					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GGCCGCAGGGCGCGCCGCCTG	0.726																																							0											0													18.0	20.0	20.0					20																	2730141		691	1590	2281	SO:0001583	missense	0			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.734C>T	20.37:g.2730141C>T	ENSP00000477023:p.Ala245Val		Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.A241V	ENST00000609451.1	37	c.722		20	.	.	.	.	.	.	.	.	.	.	c	23.1	4.369452	0.82463	.	.	ENSG00000088881	ENST00000380648;ENST00000342725	T;T	0.56941	0.43;0.43	4.34	4.34	0.51931	.	0.000000	0.47455	D	0.000236	T	0.52964	0.1767	M	0.81682	2.555	0.54753	D	0.999983	D	0.57571	0.98	B	0.38156	0.266	T	0.67138	-0.5746	10	0.72032	D	0.01	-21.4528	14.376	0.66879	0.0:1.0:0.0:0.0	.	241	E9PEI2	.	V	241;245	ENSP00000370022:A241V;ENSP00000345030:A245V	ENSP00000345030:A245V	A	+	2	0	EBF4	2678141	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.350000	0.79385	2.263000	0.75096	0.486000	0.48141	GCG	0	NULL		0.726	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	EBF4	protein_coding	OTTHUMT00000471930.1	39	45	0	0.00	0	0	C	XM_938882	0	0		2730141	1	no_errors	ENST00000380648	ensembl	human	known	74_37	missense	22	22	47.62	48.84	20	21	SNP	1	T
ATP9A	10079	genome.wustl.edu	37	20	50221408	50221408	+	Silent	SNP	C	C	G			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr20:50221408C>G	ENST00000338821.5	-	27	3219	c.2955G>C	c.(2953-2955)ctG>ctC	p.L985L	ATP9A_ENST00000311637.5_Silent_p.L849L|ATP9A_ENST00000402822.1_Silent_p.L864L	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	985					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCAGGCTGAGCAGCTCCGCCA	0.587																																							0											0													56.0	43.0	47.0					20																	50221408		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2955G>C	20.37:g.50221408C>G			E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L985	ENST00000338821.5	37	c.2955	CCDS33489.1	20																																																																																			0	tigrfam_ATPase_P-typ_Plipid-transp		0.587	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	protein_coding	OTTHUMT00000106494.1	41	72	0	0.00	0	0	C	NM_006045	0	0		50221408	-1	no_errors	ENST00000338821	ensembl	human	known	74_37	silent	26	43	35	31.75	14	20	SNP	1	G
CEP290	80184	genome.wustl.edu	37	12	88512304	88512305	+	Frame_Shift_Ins	INS	-	-	T	rs77980773		TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr12:88512304_88512305insT	ENST00000552810.1	-	17	2009_2010	c.1666_1667insA	c.(1666-1668)attfs	p.I556fs	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Frame_Shift_Ins_p.I558fs	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	556					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.I558fs*20(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CATTTGACGAATTTTTTTTTTC	0.312																																							0											1	Insertion - Frameshift(1)	central_nervous_system(1)	GRCh37	CD073590	CEP290	D	rs77980773																																			SO:0001589	frameshift_variant	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1667dupA	12.37:g.88512314_88512314dupT	ENSP00000448012:p.Ile556fs		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Ins	INS	NULL	p.I558fs	ENST00000552810.1	37	c.1673_1672	CCDS55858.1	12																																																																																			0	NULL		0.312	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	83	174	0	1.14	0	2	0	NM_025114	0	0		88512305	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	frame_shift_ins	69	110	8	4.35	6	5	INS	1.000:0.983	T
BEGAIN	57596	genome.wustl.edu	37	14	101005271	101005273	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	CCT	CCT	CCT	-	CCT	CCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr14:101005271_101005273delCCT	ENST00000355173.2	-	7	886_888	c.815_817delAGG	c.(814-819)gaggcc>gcc	p.E272del	CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_In_Frame_Del_p.E208del|BEGAIN_ENST00000443071.2_In_Frame_Del_p.E272del	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	272						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GCCGCCTCGGCCTCCTCCTCCTC	0.724																																					NSCLC(159;1889 2010 9965 27479 40101)		0											0																																										SO:0001651	inframe_deletion	0			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.815_817delAGG	14.37:g.101005280_101005282delCCT	ENSP00000347301:p.Glu272del		Q9NPU3|Q9P282	In_Frame_Del	DEL	superfamily_Prefoldin	p.E272in_frame_del	ENST00000355173.2	37	c.817_815	CCDS9962.1	14																																																																																			0	NULL		0.724	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	protein_coding	OTTHUMT00000414329.1	12	35	0	0.00	0	0	CCT	NM_020836	0	0		101005273	-1	no_errors	ENST00000355173	ensembl	human	known	74_37	in_frame_del	10	29	16.67	6.45	2	2	DEL	0.781:0.856:0.982	0
PTH2	113091	genome.wustl.edu	37	19	49926530	49926531	+	In_Frame_Ins	INS	-	-	CAGAAG	rs371950649|rs112077618	byFrequency	TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	-	-	-	CAGAAG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr19:49926530_49926531insCAGAAG	ENST00000270631.1	-	1	167_168	c.66_67insCTTCTG	c.(64-69)ctggtg>ctgCTTCTGgtg	p.21_22insLL	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	21					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		CAGGGCACCACcagcagcagca	0.688																																							0											0																																										SO:0001652	inframe_insertion	0			AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.66_67insCTTCTG	19.37:g.49926530_49926531insCAGAAG	ENSP00000270631:p.Leu20_Leu21dup		Q96DJ4	In_Frame_Ins	INS	NULL	p.22in_frame_insLL	ENST00000270631.1	37	c.67_66	CCDS12763.1	19																																																																																			0	NULL		0.688	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	protein_coding	OTTHUMT00000465366.1	77	29	0	0.00	0	0	0	NM_178449	0	0		49926531	-1	no_errors	ENST00000270631	ensembl	human	known	74_37	in_frame_ins	60	34	21.05	15.00	16	6	INS	0.016:0.016	CAGAAG
WASH6P	653440	genome.wustl.edu	37	X	155252167	155252167	+	RNA	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chrX:155252167C>T	ENST00000461007.1	+	0	1175				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GCGGGAGGCCCGGCCTGGCTT	0.647																																							0											0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252167C>T			A6NGF1|Q8N305	RNA	SNP	0	NULL	ENST00000461007.1	37	NULL		X																																																																																			0	0		0.647	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	pseudogene	OTTHUMT00000058840.1	67	0	1.45	0.00	1	0	C	NG_008380	0	0		155252167	1	no_errors	ENST00000340131	ensembl	human	known	74_37	rna	60	0	18.92	0.00	14	0	SNP	0.96	T
NPIPA2	642799	genome.wustl.edu	37	16	14859247	14859247	+	Missense_Mutation	SNP	C	C	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr16:14859247C>T	ENST00000529166.1	+	8	1087	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	NPIPA2_ENST00000553201.1_Missense_Mutation_p.R344W			E9PIF3	NPIA2_HUMAN	nuclear pore complex interacting protein family, member A2	363																	CCACCCTCAGCGGATGATAAT	0.418																																							0											0																																										SO:0001583	missense	0				CCDS59263.1	16p13.11	2013-06-11			ENSG00000254852	ENSG00000254852			41979	protein-coding gene	gene with protein product							Standard	NM_001277324		Approved			E9PIF3	OTTHUMG00000166264	ENST00000529166.1:c.1087C>T	16.37:g.14859247C>T	ENSP00000432029:p.Arg363Trp			Missense_Mutation	SNP	NULL	p.R363W	ENST00000529166.1	37	c.1087		16	.	.	.	.	.	.	.	.	.	.	.	9.766	1.171381	0.21621	.	.	ENSG00000254852	ENST00000529166;ENST00000553201	T;T	0.52526	1.97;0.66	.	.	.	.	.	.	.	.	T	0.36608	0.0973	N	0.19112	0.55	0.09310	N	1	D	0.58620	0.983	P	0.49637	0.617	T	0.23119	-1.0197	7	0.87932	D	0	.	.	.	.	.	363	E9PJI5	.	W	363;344	ENSP00000432029:R363W;ENSP00000446882:R344W	ENSP00000432029:R363W	R	+	1	2	RP11-719K4.2	14766748	.	.	0.064000	0.19789	0.064000	0.16182	.	.	0.073000	0.16731	0.074000	0.15403	CGG	0	NULL		0.418	NPIPA2-002	NOVEL	basic|appris_candidate_longest	protein_coding	NPIPA2	protein_coding	OTTHUMT00000389062.1	50	0	1.96	0.00	1	0	C		0	0		14859247	1	no_errors	ENST00000529166	ensembl	human	novel	74_37	missense	38	0	15.56	0.00	7	0	SNP	0.065	T
DSC3	1825	genome.wustl.edu	37	18	28622608	28622608	+	Silent	SNP	G	G	T			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr18:28622608G>T	ENST00000360428.4	-	1	99	c.19C>A	c.(19-21)Cgg>Agg	p.R7R	DSC3_ENST00000434452.1_Silent_p.R7R	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	7					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ACGGAGCGCCGGGGCCCAGCG	0.746																																							0											0													3.0	3.0	3.0					18																	28622608		1665	3296	4961	SO:0001819	synonymous_variant	0			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.19C>A	18.37:g.28622608G>T			A6NN35|Q14200|Q9HAZ9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.R7	ENST00000360428.4	37	c.19	CCDS32810.1	18																																																																																			0	NULL		0.746	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	DSC3	protein_coding	OTTHUMT00000447384.1	23	8	0	0.00	0	0	G	NM_001941, NM_024423	0	0		28622608	-1	no_errors	ENST00000360428	ensembl	human	known	74_37	silent	24	9	14.29	0.00	4	0	SNP	0.02	T
BHLHE22	27319	genome.wustl.edu	37	8	65493948	65493950	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr8:65493948_65493950delGGC	ENST00000321870.1	+	1	1135_1137	c.601_603delGGC	c.(601-603)ggcdel	p.G207del	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	207	Gly-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						ggggggcctgggcggcggcggcg	0.783																																					Colon(113;104 1586 2865 9855 18065)		0											0										4,766		1,2,382						-1.2	0.0			1	17,2213		4,9,1102	no	coding	BHLHE22	NM_152414.4		5,11,1484	A1A1,A1R,RR		0.7623,0.5195,0.7				21,2979				SO:0001651	inframe_deletion	0			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.601_603delGGC	8.37:g.65493957_65493959delGGC	ENSP00000318799:p.Gly207del			In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G204in_frame_del	ENST00000321870.1	37	c.601_603	CCDS6179.1	8																																																																																			0	NULL		0.783	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE22	protein_coding	OTTHUMT00000378549.1	12	11	0	0.00	0	0	GGC	NM_152414	0	0		65493950	1	no_errors	ENST00000321870	ensembl	human	known	74_37	in_frame_del	4	10	33.33	0.00	2	0	DEL	0.956:0.962:0.959	0
DHX33	56919	genome.wustl.edu	37	17	5372037	5372039	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-ZB-A96C-01A-11D-A428-09	TCGA-ZB-A96C-10A-01D-A42B-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	12bc7f4b-7163-4b87-93e5-69c4dc232c36	a391c3fe-3d7d-4a3d-bd29-b4ef22e6b929	g.chr17:5372037_5372039delCCT	ENST00000225296.3	-	1	341_343	c.141_143delAGG	c.(139-144)ggaggc>ggc	p.47_48GG>G	CTC-524C5.5_ENST00000571506.1_lincRNA|DHX33_ENST00000433302.3_In_Frame_Del_p.47_48GG>G	NM_001199699.1|NM_020162.3	NP_001186628.1|NP_064547.2	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	47					positive regulation of transcription from RNA polymerase I promoter (GO:0045943)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|rDNA binding (GO:0000182)			breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CTGCCTCCGGCCTCCTCCTCCTC	0.724																																							0											0									,	85,4071		5,75,1998					,	2.9	1.0			12	159,7947		11,137,3905	no	coding,utr-5	DHX33	NM_020162.3,NM_001199699.1	,	16,212,5903	A1A1,A1R,RR		1.9615,2.0452,1.9899	,	,		244,12018				SO:0001651	inframe_deletion	0			AL359945	CCDS11072.1	17p13	2003-06-13	2003-06-13	2003-06-13	ENSG00000005100	ENSG00000005100		"""DEAH-boxes"""	16718	protein-coding gene	gene with protein product		614405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33"""	DDX33			Standard	NM_020162		Approved	FLJ21972, DKFZp762F2011	uc002gca.3	Q9H6R0	OTTHUMG00000102041	ENST00000225296.3:c.141_143delAGG	17.37:g.5372046_5372048delCCT	ENSP00000225296:p.Gly48del		B4DHF9|Q4G149|Q5CZ73|Q9H5M9	In_Frame_Del	DEL	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G48in_frame_del	ENST00000225296.3	37	c.143_141	CCDS11072.1	17																																																																																			0	NULL		0.724	DHX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX33	protein_coding	OTTHUMT00000219826.2	31	4	0	0.00	0	0	CCT	NM_020162	0	0		5372039	-1	no_errors	ENST00000225296	ensembl	human	known	74_37	in_frame_del	19	2	9.52	0.00	2	0	DEL	1.000:1.000:1.000	0
