#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	broad.mit.edu;bcgsc.ca	37	1	6204158	6204158	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:6204158G>T	ENST00000262450.3	-	12	1959	c.1860C>A	c.(1858-1860)gaC>gaA	p.D620E	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGGTGCACTGGTCGTAGGGCA	0.582																																					p.D620E		.											.	CHD5-719	0			c.C1860A						.						264.0	209.0	227.0					1																	6204158		2203	4300	6503	SO:0001583	missense	26038	exon12			GCACTGGTCGTAG	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1860C>A	1.37:g.6204158G>T	ENSP00000262450:p.Asp620Glu	246	0		278	9	NM_015557	0	0	1	1	0	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269982	0.40095	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.71461	-0.57	4.3	3.39	0.38822	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.85682	D	0.000000	T	0.76637	0.4015	L	0.60845	1.875	0.80722	D	1	D	0.63046	0.992	D	0.79108	0.992	T	0.72093	-0.4394	10	0.16896	T	0.51	-42.5485	9.1886	0.37184	0.1677:0.0:0.8323:0.0	.	620	Q8TDI0	CHD5_HUMAN	E	620;136;28;28	ENSP00000262450:D620E	ENSP00000262450:D620E	D	-	3	2	CHD5	6126745	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	2.618000	0.46393	1.166000	0.42689	-0.448000	0.05591	GAC	.		0.582	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
RPS6KA1	6195	hgsc.bcm.edu	37	1	26856462	26856462	+	Silent	SNP	T	T	G	rs11800553	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:26856462T>G	ENST00000374168.2	+	1	205	c.51T>G	c.(49-51)ccT>ccG	p.P17P	RPS6KA1_ENST00000526792.1_5'Flank|RPS6KA1_ENST00000374162.2_5'Flank|RPS6KA1_ENST00000374166.4_Silent_p.P17P	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	17					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCTAGTGCCTCTGGACCCGG	0.786													G|||	4691	0.936701	0.9259	0.9179	5008	,	,		6031	0.9583		0.9553	False		,,,				2504	0.9233				p.P17P		.											.	RPS6KA1-510	0			c.T51G						.						2.0	2.0	2.0					1																	26856462		1084	2070	3154	SO:0001819	synonymous_variant	6195	exon1			AGTGCCTCTGGAC	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.51T>G	1.37:g.26856462T>G		0	0		6	6	NM_002953	0	0	0	0	0	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			T|0.065;G|0.935		0.786	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
SLC9A1	6548	broad.mit.edu	37	1	27440466	27440468	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:27440466_27440468delTGT	ENST00000263980.3	-	2	1237_1239	c.662_664delACA	c.(661-666)aacatc>atc	p.N221del	SLC9A1_ENST00000545949.1_Intron|SLC9A1_ENST00000374086.3_In_Frame_Del_p.N221del	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	221					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	AGGAGGCCGATGTTGTTGATCTG	0.596																																					p.221_222del		.											.	SLC9A1-91	0			c.662_664del						.																																			SO:0001651	inframe_deletion	6548	exon2			GGCCGATGTTGTT	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.662_664delACA	1.37:g.27440469_27440471delTGT	ENSP00000263980:p.Asn221del	161	0		150	11	NM_003047	0	0	0	0	0	B1ALD6|D3DPL4|Q96EM2	In_Frame_Del	DEL	ENST00000263980.3	37	CCDS295.1																																																																																			.		0.596	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		19	19	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
CSMD2	114784	broad.mit.edu	37	1	34291361	34291361	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:34291361C>A	ENST00000373381.4	-	7	1224	c.1048G>T	c.(1048-1050)Gag>Tag	p.E350*		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	310	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GACTTCAACTCAATTTGCTTC	0.537																																					p.E310X		.											.	CSMD2-103	0			c.G928T						.						103.0	78.0	86.0					1																	34291361		2203	4300	6503	SO:0001587	stop_gained	114784	exon7			TCAACTCAATTTG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1048G>T	1.37:g.34291361C>A	ENSP00000362479:p.Glu350*	58	0		92	3	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Nonsense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	40	8.469402	0.98825	.	.	ENSG00000121904	ENST00000373381	.	.	.	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	17.5357	0.87830	0.0:1.0:0.0:0.0	.	.	.	.	X	350	.	ENSP00000241312:E310X	E	-	1	0	CSMD2	34063948	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.546000	0.82137	2.438000	0.82558	0.655000	0.94253	GAG	.		0.537	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
KCNQ4	9132	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	41296756	41296756	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:41296756C>G	ENST00000347132.5	+	10	1375	c.1293C>G	c.(1291-1293)agC>agG	p.S431R	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Splice_Site_p.S377R	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	431					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GCCCTGCCAGCAGCCGGATGG	0.632																																					p.S431R		.											.	KCNQ4-90	0			c.C1293G						.						14.0	13.0	13.0					1																	41296756		2191	4290	6481	SO:0001630	splice_region_variant	9132	exon10			TGCCAGCAGCCGG	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1293-1C>G	1.37:g.41296756C>G		133	0		137	77	NM_004700	0	0	0	0	0	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.54|12.54	1.968354|1.968354	0.34754|0.34754	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000443478|ENST00000347132;ENST00000509682	.|D;D	.|0.99298	.|-5.71;-5.12	5.02|5.02	4.11|4.11	0.48088|0.48088	.|.	.|0.175833	.|0.47093	.|D	.|0.000250	D|D	0.96522|0.96522	0.8865|0.8865	L|L	0.34521|0.34521	1.04|1.04	0.31309|0.31309	N|N	0.687332|0.687332	.|B;P	.|0.42409	.|0.046;0.779	.|B;B	.|0.36030	.|0.033;0.216	D|D	0.95726|0.95726	0.8770|0.8770	5|9	.|.	.|.	.|.	.|.	7.9679|7.9679	0.30111|0.30111	0.0:0.8129:0.0:0.1871|0.0:0.8129:0.0:0.1871	.|.	.|377;431	.|P56696-2;P56696	.|.;KCNQ4_HUMAN	E|R	292|431;377	.|ENSP00000262916:S431R;ENSP00000423756:S377R	.|.	Q|S	+|+	1|3	0|2	KCNQ4|KCNQ4	41069343|41069343	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.886000|0.886000	0.51366|0.51366	2.484000|2.484000	0.45242|0.45242	1.256000|1.256000	0.44068|0.44068	0.543000|0.543000	0.68304|0.68304	CAG|AGC	.		0.632	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	Missense_Mutation
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000453418.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.V171V|BTBD19_ENST00000409335.2_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		0	0		19	17	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
DMRTB1	63948	broad.mit.edu;bcgsc.ca	37	1	53930345	53930345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:53930345C>A	ENST00000371445.3	+	3	841	c.786C>A	c.(784-786)taC>taA	p.Y262*	DMRTB1_ENST00000463126.1_3'UTR	NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	262	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						AGCCAAGCTACTACCTgccgc	0.652																																					p.Y262X		.											.	DMRTB1-92	0			c.C786A						.						31.0	36.0	35.0					1																	53930345		2203	4300	6503	SO:0001587	stop_gained	63948	exon3			AAGCTACTACCTG	AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.786C>A	1.37:g.53930345C>A	ENSP00000360500:p.Tyr262*	119	1		176	12	NM_033067	0	0	0	0	0	Q96SD2	Nonsense_Mutation	SNP	ENST00000371445.3	37	CCDS581.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095739	0.76870	.	.	ENSG00000143006	ENST00000371445;ENST00000431335	.	.	.	4.5	3.59	0.41128	.	1.896660	0.02580	N	0.098740	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7671	9.9231	0.41476	0.0:0.9035:0.0:0.0965	.	.	.	.	X	262;109	.	ENSP00000360500:Y262X	Y	+	3	2	DMRTB1	53702933	0.676000	0.27567	0.682000	0.30024	0.898000	0.52572	1.072000	0.30678	1.246000	0.43901	0.455000	0.32223	TAC	.		0.652	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1		
FGGY	55277	broad.mit.edu	37	1	59844420	59844420	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:59844420G>T	ENST00000303721.7	+	5	639		c.e5-1		FGGY_ENST00000371218.4_Splice_Site|FGGY_ENST00000371212.1_Splice_Site|FGGY_ENST00000474476.1_Splice_Site	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					TAATTTGGCAGAACTTGAGAG	0.373																																					.		.											.	FGGY-69	0			c.466-1G>T						.						76.0	78.0	77.0					1																	59844420		2203	4299	6502	SO:0001630	splice_region_variant	55277	exon5			TTGGCAGAACTTG		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.466-1G>T	1.37:g.59844420G>T		61	0		45	3	NM_001113411	0	0	0	0	0	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Splice_Site	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060494	0.76074	.	.	ENSG00000172456	ENST00000413489;ENST00000371218;ENST00000303721;ENST00000371212	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8435	0.88722	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FGGY	59617008	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.942000	0.75928	2.880000	0.98712	0.650000	0.86243	.	.		0.373	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	Intron
TGFBR3	7049	broad.mit.edu	37	1	92187512	92187512	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:92187512C>A	ENST00000525962.1	-	7	1136	c.1075G>T	c.(1075-1077)Gca>Tca	p.A359S	TGFBR3_ENST00000370399.2_Splice_Site_p.E359*|TGFBR3_ENST00000212355.4_Splice_Site_p.A359S			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	359					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TCTAACTTACCATTATTTTCA	0.368																																					p.E359X		.											.	TGFBR3-93	0			c.G1075T						.						60.0	57.0	58.0					1																	92187512		2203	4300	6503	SO:0001630	splice_region_variant	7049	exon8			ACTTACCATTATT	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1075+1G>T	1.37:g.92187512C>A		46	0		45	6	NM_001195683	0	0	0	0	0	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Nonsense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.206063|10.206063	0.99359|0.99359	.|.	.|.	ENSG00000069702|ENSG00000069702	ENST00000212355;ENST00000525962|ENST00000370399;ENST00000465892	T;T|.	0.30182|.	1.54;1.54|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.391554|.	0.23100|.	N|.	0.051930|.	T|.	0.69788|.	0.3150|.	.|.	.|.	.|.	0.42214|0.42214	D|D	0.991825|0.991825	P|.	0.34522|.	0.455|.	B|.	0.33392|.	0.163|.	T|.	0.67413|.	-0.5677|.	8|.	.|.	.|.	.|.	-8.4168|-8.4168	19.4155|19.4155	0.94694|0.94694	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	359|.	Q03167|.	TGBR3_HUMAN|.	S|X	359|359	ENSP00000212355:A359S;ENSP00000436127:A359S|.	.|.	A|E	-|-	1|1	0|0	TGFBR3|TGFBR3	91960100|91960100	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.533000|0.533000	0.34776|0.34776	6.520000|6.520000	0.73773|0.73773	2.681000|2.681000	0.91329|0.91329	0.561000|0.561000	0.74099|0.74099	GCA|GAG	.		0.368	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	Missense_Mutation
ATP5F1	515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	111999313	111999313	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:111999313T>C	ENST00000369722.3	+	5	1055	c.449T>C	c.(448-450)aTt>aCt	p.I150T	ATP5F1_ENST00000369721.4_3'UTR|ATP5F1_ENST00000483994.1_Missense_Mutation_p.I89T	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	150					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAGAATGCAATTGATACGGAG	0.428																																					p.I150T		.											.	ATP5F1-90	0			c.T449C						.						112.0	104.0	107.0					1																	111999313		2203	4300	6503	SO:0001583	missense	515	exon5			ATGCAATTGATAC	X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.449T>C	1.37:g.111999313T>C	ENSP00000358737:p.Ile150Thr	355	2		342	208	NM_001688	0	0	52	207	155	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	ENST00000369722.3	37	CCDS836.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867218	0.51588	.	.	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.48522	0.81;0.81	5.22	5.22	0.72569	.	0.043292	0.85682	D	0.000000	T	0.60431	0.2268	M	0.86864	2.845	0.58432	D	0.999999	D;D	0.54601	0.967;0.967	P;P	0.55667	0.781;0.781	T	0.70303	-0.4909	10	0.87932	D	0	.	15.0572	0.71925	0.0:0.0:0.0:1.0	.	150;150	Q08ET0;P24539	.;AT5F1_HUMAN	T	150;89	ENSP00000358737:I150T;ENSP00000420366:I89T	ENSP00000358737:I150T	I	+	2	0	ATP5F1	111800836	1.000000	0.71417	0.565000	0.28409	0.038000	0.13279	6.219000	0.72231	2.103000	0.63969	0.533000	0.62120	ATT	.		0.428	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032455.1	NM_001688	
TRIM33	51592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114948141	114948141	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:114948141C>A	ENST00000358465.2	-	15	2742	c.2659G>T	c.(2659-2661)Gaa>Taa	p.E887*	TRIM33_ENST00000369543.2_Nonsense_Mutation_p.E887*|TRIM33_ENST00000450349.2_Nonsense_Mutation_p.E519*|TRIM33_ENST00000476908.1_5'UTR	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	887					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACCAGTCTTCATTTGGGTCA	0.463			T	RET	papillary thyroid																																p.E887X		.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33-1351	0			c.G2659T						.						275.0	240.0	252.0					1																	114948141		2203	4300	6503	SO:0001587	stop_gained	51592	exon15			AGTCTTCATTTGG	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.2659G>T	1.37:g.114948141C>A	ENSP00000351250:p.Glu887*	120	0		116	77	NM_033020	0	0	0	0	0	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Nonsense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.983277|6.983277	0.97979|0.97979	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349|ENST00000448034	.|.	.|.	.|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.69033	.|0.3066	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.67601	.|-0.5629	.|3	0.87932|.	D|.	0|.	-14.7851|-14.7851	18.8932|18.8932	0.92413|0.92413	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	887;887;519|647	.|.	ENSP00000351250:E887X|.	E|M	-|-	1|3	0|0	TRIM33|TRIM33	114749664|114749664	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.750000|7.750000	0.85110|0.85110	2.533000|2.533000	0.85409|0.85409	0.491000|0.491000	0.48974|0.48974	GAA|ATG	.		0.463	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		17	10	NM_024408	0	0	0	2	2	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		0	0		12	5	NM_024408	0	0	4	5	1	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
IVL	3713	bcgsc.ca	37	1	152883056	152883056	+	Silent	SNP	A	A	G	rs45609438	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:152883056A>G	ENST00000368764.3	+	2	847	c.783A>G	c.(781-783)ggA>ggG	p.G261G	IVL_ENST00000392667.2_Silent_p.G115G			P07476	INVO_HUMAN	involucrin	261	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			agcaggagggacagctgaagc	0.657																																					p.G261G		.											.	IVL-93	0			c.A783G						.																																			SO:0001819	synonymous_variant	3713	exon2			GGAGGGACAGCTG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.783A>G	1.37:g.152883056A>G		110	3		122	15	NM_005547	0	0	0	0	0	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																			A|0.697;G|0.303		0.657	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
SPRR3	6707	ucsc.edu;mdanderson.org	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		108	0		117	54	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR3	6707	hgsc.bcm.edu;ucsc.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000331860.3_Silent_p.G81G|SPRR3_ENST00000542696.1_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		.											.	SPRR3-45	1	Substitution - coding silent(1)	prostate(1)	c.T243A						.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		125	0		109	22	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
CD1C	911	bcgsc.ca	37	1	158261043	158261043	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:158261043G>T	ENST00000368170.3	+	2	460	c.181G>T	c.(181-183)Gaa>Taa	p.E61*		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	61					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					CTGGGACAGTGAATCAGGCAC	0.478																																					p.E61X		.											.	CD1C-94	0			c.G181T						.						117.0	104.0	108.0					1																	158261043		2203	4300	6503	SO:0001587	stop_gained	911	exon2			GACAGTGAATCAG	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.181G>T	1.37:g.158261043G>T	ENSP00000357152:p.Glu61*	398	2		349	31	NM_001765	0	0	0	0	0	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Nonsense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	.	.	.	.	.	.	.	.	.	.	-	36	5.693531	0.96793	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	.	.	.	3.08	2.05	0.26809	.	0.258283	0.20459	N	0.091926	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	5.3421	0.15988	0.1833:0.0:0.8167:0.0	.	.	.	.	X	61	.	ENSP00000357151:E61X	E	+	1	0	CD1C	156527667	0.000000	0.05858	0.003000	0.11579	0.227000	0.25037	-0.026000	0.12392	0.754000	0.32968	0.650000	0.86243	GAA	.		0.478	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765	
FCRL6	343413	broad.mit.edu;bcgsc.ca	37	1	159778893	159778893	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:159778893C>T	ENST00000368106.3	+	4	463	c.462C>T	c.(460-462)caC>caT	p.H154H	FCRL6_ENST00000321935.6_Silent_p.H161H|FCRL6_ENST00000339348.5_Silent_p.H154H|FCRL6_ENST00000392235.3_Intron	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	154	Ig-like C2-type 2.					external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					AGGACGGCCACACCTTGCAGG	0.627																																					p.H154H		.											.	FCRL6-93	0			c.C462T						.						64.0	64.0	64.0					1																	159778893		2203	4300	6503	SO:0001819	synonymous_variant	343413	exon4			CGGCCACACCTTG	AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.462C>T	1.37:g.159778893C>T		174	0		140	6	NM_001004310	0	0	3	3	0	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Silent	SNP	ENST00000368106.3	37	CCDS30912.1																																																																																			.		0.627	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276853.1	NM_001004310	
HHIPL2	79802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	222713605	222713605	+	Silent	SNP	C	C	A	rs376492495		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:222713605C>A	ENST00000343410.6	-	4	1255	c.1197G>T	c.(1195-1197)tcG>tcT	p.S399S		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	399					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		ATGGATTGTCCGAGGGGACTC	0.547																																					p.S399S		.											.	HHIPL2-69	0			c.G1197T						.						72.0	69.0	70.0					1																	222713605		2203	4300	6503	SO:0001819	synonymous_variant	79802	exon4			ATTGTCCGAGGGG	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1197G>T	1.37:g.222713605C>A		118	0		100	11	NM_024746	0	0	0	0	0	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	37	CCDS1530.2																																																																																			.		0.547	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
LEFTY2	7044	bcgsc.ca	37	1	226125385	226125385	+	Missense_Mutation	SNP	G	G	A	rs2295418	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:226125385G>A	ENST00000366820.5	-	4	1205	c.857C>T	c.(856-858)cCg>cTg	p.P286L	LEFTY2_ENST00000420304.2_Missense_Mutation_p.P252L|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'Flank	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	286			P -> L (in dbSNP:rs2295418).		blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					CAGGAAGCCCGGGGGCTCCAG	0.647													G|||	256	0.0511182	0.0008	0.0504	5008	,	,		15275	0.1052		0.0308	False		,,,				2504	0.0849				p.P286L	Colon(172;116 2643 9098 43333)	.											.	LEFTY2-90	0			c.C857T						.	G	LEU/PRO,LEU/PRO	46,4360	46.7+/-81.2	0,46,2157	21.0	24.0	23.0		755,857	4.2	0.9	1	dbSNP_100	23	293,8307	103.1+/-164.3	8,277,4015	no	missense,missense	LEFTY2	NM_001172425.1,NM_003240.3	98,98	8,323,6172	AA,AG,GG		3.407,1.044,2.6065	probably-damaging,probably-damaging	252/333,286/367	226125385	339,12667	2203	4300	6503	SO:0001583	missense	7044	exon4			AAGCCCGGGGGCT	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.857C>T	1.37:g.226125385G>A	ENSP00000355785:p.Pro286Leu	191	2		223	7	NM_003240	0	0	4	4	0	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	ENST00000366820.5	37	CCDS1549.1	97	0.044413919413919416	1	0.0020325203252032522	14	0.03867403314917127	54	0.0944055944055944	28	0.036939313984168866	g	16.59	3.166005	0.57476	0.01044	0.03407	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.63417	-0.04;-0.04	5.1	4.18	0.49190	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.105282	0.64402	N	0.000004	T	0.13030	0.0316	M	0.73962	2.25	0.20563	P	0.999880306	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64622	-0.6364	9	0.87932	D	0	.	13.5588	0.61777	0.077:0.0:0.923:0.0	rs2295418;rs52828121;rs2295418	252;286	E9PDM4;O00292	.;LFTY2_HUMAN	L	252;286	ENSP00000388009:P252L;ENSP00000355785:P286L	ENSP00000355785:P286L	P	-	2	0	LEFTY2	224192008	1.000000	0.71417	0.867000	0.34043	0.137000	0.21094	8.729000	0.91490	1.271000	0.44313	-0.258000	0.10820	CCG	G|0.969;A|0.031		0.647	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228505189	228505189	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:228505189C>G	ENST00000422127.1	+	52	13630	c.13586C>G	c.(13585-13587)gCt>gGt	p.A4529G	OBSCN_ENST00000366707.4_Missense_Mutation_p.A2163G|OBSCN_ENST00000570156.2_Missense_Mutation_p.A5486G|OBSCN_ENST00000366709.4_Missense_Mutation_p.A1648G|OBSCN_ENST00000284548.11_Missense_Mutation_p.A4529G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4529	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCAGAGGATGCTGAGGTGGTG	0.642																																					p.A5486G		.											.	OBSCN-403	0			c.C16457G						.						29.0	31.0	31.0					1																	228505189		2011	4185	6196	SO:0001583	missense	84033	exon63			AGGATGCTGAGGT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13586C>G	1.37:g.228505189C>G	ENSP00000409493:p.Ala4529Gly	114	0		107	19	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	c	23.7	4.452730	0.84209	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	4.42	4.42	0.53409	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.079753	0.49916	D	0.000136	T	0.66992	0.2846	M	0.66939	2.045	0.48040	D	0.999576	D;D	0.64830	0.994;0.988	D;P	0.64506	0.926;0.717	T	0.63075	-0.6718	10	0.16420	T	0.52	.	17.2147	0.86940	0.0:1.0:0.0:0.0	.	4529;4529	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	4529;4529;2163;1648	ENSP00000284548:A4529G;ENSP00000409493:A4529G;ENSP00000355668:A2163G;ENSP00000355670:A1648G	ENSP00000284548:A4529G	A	+	2	0	OBSCN	226571812	1.000000	0.71417	0.935000	0.37517	0.454000	0.32378	7.281000	0.78621	2.310000	0.77875	0.479000	0.44913	GCT	.		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
SIPA1L2	57568	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	232615375	232615375	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:232615375G>T	ENST00000366630.1	-	6	2441	c.2083C>A	c.(2083-2085)Cag>Aag	p.Q695K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.Q695K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	695	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GGACATACCTGTTGTCTGTTG	0.478																																					p.Q695K		.											.	SIPA1L2-95	0			c.C2083A						.						162.0	172.0	168.0					1																	232615375		2028	4202	6230	SO:0001583	missense	57568	exon5			ATACCTGTTGTCT	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2083C>A	1.37:g.232615375G>T	ENSP00000355589:p.Gln695Lys	156	0		176	14	NM_020808	0	0	0	0	0	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792793	0.90453	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.94376	-3.41;-3.41	5.53	5.53	0.82687	Rap/ran-GAP (2);	0.059437	0.64402	D	0.000001	D	0.97201	0.9085	M	0.88979	2.995	0.80722	D	1	D	0.65815	0.995	D	0.68039	0.955	D	0.97177	0.9848	10	0.59425	D	0.04	-29.5602	19.8228	0.96604	0.0:0.0:1.0:0.0	.	695	Q9P2F8	SI1L2_HUMAN	K	695	ENSP00000355589:Q695K;ENSP00000262861:Q695K	ENSP00000262861:Q695K	Q	-	1	0	SIPA1L2	230681998	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	9.809000	0.99208	2.759000	0.94783	0.650000	0.86243	CAG	.		0.478	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234745009	234745009	+	Missense_Mutation	SNP	A	A	G	rs7545855	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:234745009A>G	ENST00000366609.3	-	1	262	c.232T>C	c.(232-234)Tcg>Ccg	p.S78P	IRF2BP2_ENST00000491430.1_5'Flank|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.S78P	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GCGGCGGCCGAGGCCGCGGCG	0.776													G|||	3024	0.603834	0.8729	0.549	5008	,	,		4430	0.2679		0.7734	False		,,,				2504	0.4509				p.S78P		.											.	IRF2BP2-90	0			c.T232C						.						1.0	1.0	1.0					1																	234745009		821	1921	2742	SO:0001583	missense	359948	exon1			CGGCCGAGGCCGC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.232T>C	1.37:g.234745009A>G	ENSP00000355568:p.Ser78Pro	0	0		7	7	NM_182972	0	0	0	0	0	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	ENST00000366609.3	37	CCDS1602.1	1348	0.6172161172161172	403	0.8191056910569106	204	0.56353591160221	177	0.3094405594405594	564	0.7440633245382586	G	0.003	-2.470482	0.00167	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.31510	1.49;1.51	2.56	0.223	0.15292	.	0.798061	0.10979	N	0.612909	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31110	-0.9955	9	0.07813	T	0.8	.	4.7903	0.13245	0.3855:0.1782:0.4362:0.0	rs7545855	78;78	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	P	78	ENSP00000355569:S78P;ENSP00000355568:S78P	ENSP00000355568:S78P	S	-	1	0	IRF2BP2	232811632	0.056000	0.20664	0.000000	0.03702	0.004000	0.04260	0.684000	0.25364	-0.115000	0.11915	-0.817000	0.03123	TCG	A|0.383;G|0.617		0.776	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
OR2T4	127074	bcgsc.ca	37	1	248525380	248525380	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr1:248525380C>A	ENST00000366475.1	+	1	498	c.498C>A	c.(496-498)gtC>gtA	p.V166V		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTTACCCTGTCCTCATGAACC	0.527																																					p.V166V		.											.	OR2T4-68	0			c.C498A						.						271.0	236.0	248.0					1																	248525380		2203	4300	6503	SO:0001819	synonymous_variant	127074	exon1			CCCTGTCCTCATG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.498C>A	1.37:g.248525380C>A		919	5		925	549	NM_001004696	0	0	0	0	0	Q6IEZ8	Silent	SNP	ENST00000366475.1	37	CCDS31113.1																																																																																			.		0.527	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		13	13	NM_001077494	0	0	0	6	6	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
NRAP	4892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115364490	115364490	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr10:115364490C>A	ENST00000359988.3	-	35	4349	c.4105G>T	c.(4105-4107)Gcc>Tcc	p.A1369S	NRAP_ENST00000369360.3_Missense_Mutation_p.A1342S|NRAP_ENST00000369358.4_Missense_Mutation_p.A1377S|NRAP_ENST00000360478.3_Missense_Mutation_p.A1334S	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GCATTCTTGGCATGGACCAGG	0.612																																					p.A1369S		.											.	NRAP-522	0			c.G4105T						.						127.0	124.0	125.0					10																	115364490		2203	4300	6503	SO:0001583	missense	4892	exon35			TCTTGGCATGGAC		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.4105G>T	10.37:g.115364490C>A	ENSP00000353078:p.Ala1369Ser	113	0		102	14	NM_001261463	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708244	0.89018	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	L	0.57536	1.79	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.81739	-0.0795	10	0.87932	D	0	.	19.4903	0.95047	0.0:1.0:0.0:0.0	.	527;1369;1334;1369	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	S	1377;1342;1369;1334;527	ENSP00000358365:A1377S;ENSP00000358367:A1342S;ENSP00000353078:A1369S;ENSP00000353666:A1334S	ENSP00000353078:A1369S	A	-	1	0	NRAP	115354480	1.000000	0.71417	0.912000	0.35992	0.736000	0.42039	7.818000	0.86416	2.622000	0.88805	0.555000	0.69702	GCC	.		0.612	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
JAKMIP3	282973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	133930934	133930934	+	Silent	SNP	C	C	T	rs369892382		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr10:133930934C>T	ENST00000298622.4	+	2	627	c.489C>T	c.(487-489)ggC>ggT	p.G163G		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	163						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGCTCAAGGGCGCCAAAAGGC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		16932	0.0		0.0	False		,,,				2504	0.001				p.G163G		.											.	JAKMIP3-23	0			c.C489T						.	C		0,4352		0,0,2176	66.0	79.0	74.0		489	-9.0	0.9	10		74	1,8519		0,1,4259	no	coding-synonymous	JAKMIP3	NM_001105521.2		0,1,6435	TT,TC,CC		0.0117,0.0,0.0078		163/845	133930934	1,12871	2176	4260	6436	SO:0001819	synonymous_variant	282973	exon2			CAAGGGCGCCAAA	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.489C>T	10.37:g.133930934C>T		198	1		206	127	NM_001105521	0	0	0	0	0	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	ENST00000298622.4	37	CCDS44494.1																																																																																			.		0.612	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
FRG2B	441581	mdanderson.org	37	10	135440214	135440214	+	Missense_Mutation	SNP	G	G	T	rs144521881		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr10:135440214G>T	ENST00000425520.1	-	1	85	c.33C>A	c.(31-33)caC>caA	p.H11Q	FRG2B_ENST00000443774.1_Missense_Mutation_p.H11Q	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	11						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGGAGGAGCAGTGGAGATCGG	0.498																																					p.H11Q		.											.	.	0			c.C33A						.						275.0	301.0	292.0					10																	135440214		2203	4300	6503	SO:0001583	missense	441581	exon1			GGAGCAGTGGAGA	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.33C>A	10.37:g.135440214G>T	ENSP00000401310:p.His11Gln	688	0		617	77	NM_001080998	0	0	0	0	0	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	3.861	-0.029779	0.07589	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.44482	0.92;0.92	0.109	0.109	0.14578	.	2.509510	0.01866	N	0.036921	T	0.32010	0.0815	N	0.24115	0.695	0.09310	N	1	B	0.22909	0.077	B	0.27380	0.079	T	0.34675	-0.9819	9	0.72032	D	0.01	0.2076	.	.	.	.	11	Q96QU4	FRG2B_HUMAN	Q	11	ENSP00000408343:H11Q;ENSP00000401310:H11Q	ENSP00000401310:H11Q	H	-	3	2	FRG2B	135290204	0.997000	0.39634	0.024000	0.17045	0.025000	0.11179	0.831000	0.27476	0.181000	0.19994	0.184000	0.17185	CAC	.		0.498	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
MUC5B	727897	bcgsc.ca	37	11	1253976	1253976	+	Missense_Mutation	SNP	A	A	G	rs76956995		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:1253976A>G	ENST00000529681.1	+	17	2099	c.2041A>G	c.(2041-2043)Agc>Ggc	p.S681G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S684G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	681					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTACAGCTCAGCGACTGGAG	0.687																																					p.S681G		.											.	.	0			c.A2041G						.						22.0	25.0	24.0					11																	1253976		2121	4235	6356	SO:0001583	missense	727897	exon17			CAGCTCAGCGACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2041A>G	11.37:g.1253976A>G	ENSP00000436812:p.Ser681Gly	54	0		125	17	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	5.230	0.228008	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76578	-1.03;-1.03	4.6	-7.0	0.01599	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.70605	0.3243	N	0.25144	0.715	0.09310	N	1	B;D;D	0.59357	0.425;0.985;0.985	B;P;P	0.54499	0.131;0.675;0.754	T	0.69614	-0.5098	9	0.87932	D	0	.	10.9271	0.47197	0.2958:0.5687:0.1355:0.0	.	681;1340;684	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	681;684;682;717	ENSP00000436812:S681G;ENSP00000415793:S684G	ENSP00000343037:S682G	S	+	1	0	MUC5B	1210552	0.000000	0.05858	0.011000	0.14972	0.067000	0.16453	-4.642000	0.00204	-1.098000	0.03038	0.260000	0.18958	AGC	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	51	0		121	17	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-3	387266	bcgsc.ca	37	11	1629043	1629043	+	Silent	SNP	T	T	C	rs12795274		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:1629043T>C	ENST00000399685.1	-	1	650	c.573A>G	c.(571-573)aaA>aaG	p.K191K		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	191	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		aacagcagggtttgcagcagc	0.632																																					p.K191K		.											.	KRTAP5-3-92	0			c.A573G						.						167.0	168.0	168.0					11																	1629043		2202	4290	6492	SO:0001819	synonymous_variant	387266	exon1			GCAGGGTTTGCAG	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.573A>G	11.37:g.1629043T>C		54	3		33	15	NM_001012708	0	0	0	0	0	Q6PL44|Q701N3	Silent	SNP	ENST00000399685.1	37	CCDS41591.1																																																																																			A|0.500;T|0.500		0.632	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
MRGPRE	116534	hgsc.bcm.edu;broad.mit.edu	37	11	3249197	3249197	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:3249197C>T	ENST00000389832.5	-	2	1139	c.833G>A	c.(832-834)cGc>cAc	p.R278H	MRGPRE_ENST00000436689.2_Missense_Mutation_p.R277H|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGCAGCCTGCGGCCCTGGGC	0.687																																					p.R278H		.											.	MRGPRE-136	0			c.G833A						.						11.0	15.0	14.0					11																	3249197		1861	4065	5926	SO:0001583	missense	116534	exon2			AGCCTGCGGCCCT	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.833G>A	11.37:g.3249197C>T	ENSP00000374482:p.Arg278His	23	0		76	6	NM_001039165	0	0	0	0	0	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37		.	.	.	.	.	.	.	.	.	.	c	18.87	3.715971	0.68844	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	T	0.03065	4.06	3.51	-0.726	0.11170	.	0.677608	0.11982	U	0.510670	T	0.06325	0.0163	L	0.43598	1.365	0.09310	N	1	D	0.76494	0.999	P	0.60415	0.874	T	0.31475	-0.9942	10	0.28530	T	0.3	-3.5781	1.4778	0.02430	0.1688:0.41:0.2467:0.1744	.	277	Q86SM8	MRGRE_HUMAN	H	278;277	ENSP00000393251:R278H	ENSP00000374482:R277H	R	-	2	0	MRGPRE	3205773	0.000000	0.05858	0.000000	0.03702	0.864000	0.49448	-1.914000	0.01579	-0.439000	0.07222	0.462000	0.41574	CGC	.		0.687	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
OR51Q1	390061	broad.mit.edu	37	11	5443642	5443642	+	Missense_Mutation	SNP	C	C	T	rs371190479		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:5443642C>T	ENST00000300778.4	+	1	302	c.212C>T	c.(211-213)aCg>aTg	p.T71M	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGCCCTGACGGACCTGGGT	0.532																																					p.T71M		.											.	OR51Q1-69	0			c.C212T						.						216.0	190.0	199.0					11																	5443642		2201	4297	6498	SO:0001583	missense	390061	exon1			CCCTGACGGACCT	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.212C>T	11.37:g.5443642C>T	ENSP00000300778:p.Thr71Met	119	0		152	6	NM_001004757	0	0	0	0	0	B2RNN1	Missense_Mutation	SNP	ENST00000300778.4	37	CCDS31381.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311487	0.23821	.	.	ENSG00000167360	ENST00000300778	T	0.02890	4.12	4.86	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000011	T	0.11367	0.0277	M	0.72624	2.21	0.31824	N	0.625533	D	0.89917	1.0	D	0.91635	0.999	T	0.01273	-1.1399	10	0.62326	D	0.03	.	9.0136	0.36157	0.1456:0.7748:0.0:0.0796	.	71	Q8NH59	O51Q1_HUMAN	M	71	ENSP00000300778:T71M	ENSP00000300778:T71M	T	+	2	0	OR51Q1	5400218	0.000000	0.05858	0.998000	0.56505	0.050000	0.14768	-0.163000	0.09997	1.319000	0.45190	-1.780000	0.00649	ACG	.		0.532	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757	
TUB	7275	ucsc.edu;bcgsc.ca	37	11	8123050	8123050	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:8123050C>A	ENST00000299506.2	+	12	1554	c.1405C>A	c.(1405-1407)Cag>Aag	p.Q469K	TUB_ENST00000534099.1_Missense_Mutation_p.Q475K|TUB_ENST00000305253.4_Missense_Mutation_p.Q524K	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	469					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		CATCGTGATGCAGTTTGGCCG	0.552																																					p.Q524K		.											.	TUB-91	0			c.C1570A						.						188.0	150.0	163.0					11																	8123050		2201	4296	6497	SO:0001583	missense	7275	exon13			GTGATGCAGTTTG	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1405C>A	11.37:g.8123050C>A	ENSP00000299506:p.Gln469Lys	181	3		206	144	NM_003320	0	0	0	0	0	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	ENST00000299506.2	37	CCDS7787.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946653	0.92593	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.97752	-4.52;-4.52;-4.52	5.08	5.08	0.68730	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99272	0.9746	H	0.97465	4.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98737	1.0715	10	0.87932	D	0	-16.914	18.8214	0.92099	0.0:1.0:0.0:0.0	.	475;469;524	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	K	475;524;469	ENSP00000434400:Q475K;ENSP00000305426:Q524K;ENSP00000299506:Q469K	ENSP00000299506:Q469K	Q	+	1	0	TUB	8079626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.519000	0.84933	0.591000	0.81541	CAG	.		0.552	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385823.1	NM_003320	
WEE1	7465	hgsc.bcm.edu	37	11	9595768	9595768	+	Silent	SNP	C	C	T	rs117347074	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:9595768C>T	ENST00000450114.2	+	1	541	c.288C>T	c.(286-288)ccC>ccT	p.P96P	WEE1_ENST00000299613.6_5'Flank	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	96					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		TGTTGCTGCCCGGCGCCTGCC	0.826													C|||	288	0.057508	0.0658	0.0605	5008	,	,		4788	0.005		0.0527	False		,,,				2504	0.1033				p.P96P		.											.	WEE1-1404	0			c.C288T						.						2.0	2.0	2.0					11																	9595768		1140	2650	3790	SO:0001819	synonymous_variant	7465	exon1			GCTGCCCGGCGCC	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.288C>T	11.37:g.9595768C>T		0	0		5	5	NM_003390	0	0	0	0	0	B3KVE1|D3DQV0	Silent	SNP	ENST00000450114.2	37	CCDS7800.1																																																																																			C|0.953;T|0.047		0.826	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
LDHC	3948	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18451364	18451364	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:18451364C>T	ENST00000541669.1	+	4	436	c.325C>T	c.(325-327)Ctg>Ttg	p.L109L	LDHC_ENST00000535809.1_Silent_p.L109L|LDHC_ENST00000280704.4_Silent_p.L109L|LDHC_ENST00000544105.1_Silent_p.L109L|LDHC_ENST00000537486.1_Silent_p.L109L|LDHC_ENST00000536880.1_Silent_p.L95L|LDHC_ENST00000546146.1_Intron			P07864	LDHC_HUMAN	lactate dehydrogenase C	109					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCGCCTTGCCCTGGTCCAACG	0.408																																					p.L109L		.											.	LDHC-226	0			c.C325T						.						136.0	118.0	124.0					11																	18451364		2199	4293	6492	SO:0001819	synonymous_variant	3948	exon4			CTTGCCCTGGTCC	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.325C>T	11.37:g.18451364C>T		97	0		87	7	NM_002301	0	0	0	0	0	D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	ENST00000541669.1	37	CCDS7840.1																																																																																			.		0.408	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
OR1S2	219958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57970736	57970736	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:57970736C>A	ENST00000302592.6	-	1	917	c.918G>T	c.(916-918)agG>agT	p.R306S		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TATCCTTATTCCTCAAGCTGT	0.438																																					p.R306S		.											.	OR1S2-69	0			c.G918T						.						143.0	141.0	142.0					11																	57970736		2201	4296	6497	SO:0001583	missense	219958	exon1			CTTATTCCTCAAG	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.918G>T	11.37:g.57970736C>A	ENSP00000305469:p.Arg306Ser	201	0		184	51	NM_001004459	0	0	0	0	0	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.309961	0.60414	.	.	ENSG00000197887	ENST00000302592	T	0.39592	1.07	4.75	1.79	0.24919	.	0.000000	0.49916	D	0.000135	T	0.70666	0.3250	H	0.95365	3.66	0.32500	N	0.538974	D	0.89917	1.0	D	0.85130	0.997	T	0.78357	-0.2235	10	0.87932	D	0	.	10.1753	0.42935	0.0:0.7809:0.0:0.2191	.	306	Q8NGQ3	OR1S2_HUMAN	S	306	ENSP00000305469:R306S	ENSP00000305469:R306S	R	-	3	2	OR1S2	57727312	0.996000	0.38824	1.000000	0.80357	0.996000	0.88848	0.457000	0.21875	0.300000	0.22699	0.655000	0.94253	AGG	.		0.438	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
RPS6KA4	8986	hgsc.bcm.edu	37	11	64138905	64138905	+	Missense_Mutation	SNP	T	T	G	rs17857342	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:64138905T>G	ENST00000334205.4	+	17	2337	c.2272T>G	c.(2272-2274)Tcc>Gcc	p.S758A	MIR1237_ENST00000408346.1_RNA|RPS6KA4_ENST00000294261.4_Missense_Mutation_p.S510A|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.S751A	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	758	Required for nuclear targeting and association with MAPK14.		S -> A (in dbSNP:rs17857342). {ECO:0000269|PubMed:17344846, ECO:0000269|Ref.3}.		axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						CCCCGTCGCCTCCAAAGGGGC	0.746													G|||	1267	0.252995	0.0514	0.3833	5008	,	,		6140	0.2123		0.3708	False		,,,				2504	0.3538				p.S758A		.											.	RPS6KA4-1036	0			c.T2272G						.	G	ALA/SER,ALA/SER	213,3183		11,191,1496	5.0	7.0	7.0		2254,2272	0.3	0.0	11	dbSNP_123	7	1763,4917		262,1239,1839	no	missense,missense	RPS6KA4	NM_001006944.1,NM_003942.2	99,99	273,1430,3335	GG,GT,TT		26.3922,6.2721,19.611	benign,benign	752/767,758/773	64138905	1976,8100	1698	3340	5038	SO:0001583	missense	8986	exon17			GTCGCCTCCAAAG	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.2272T>G	11.37:g.64138905T>G	ENSP00000333896:p.Ser758Ala	0	0		5	5	NM_003942	0	1	0	15	14	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	CCDS8073.1	585	0.26785714285714285	36	0.07317073170731707	128	0.35359116022099446	124	0.21678321678321677	297	0.391820580474934	t	0.003	-2.471938	0.00167	0.062721	0.263922	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261	T;T;T	0.67698	-0.28;-0.24;-0.2	4.42	0.286	0.15710	.	0.184892	0.22331	N	0.061478	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.31779	-0.9931	9	0.87932	D	0	.	1.4991	0.02473	0.1652:0.1327:0.2949:0.4072	rs17857342	510;751;758;752	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	A	751;758;510	ENSP00000435580:S751A;ENSP00000333896:S758A;ENSP00000294261:S510A	ENSP00000294261:S510A	S	+	1	0	RPS6KA4	63895481	0.048000	0.20356	0.001000	0.08648	0.004000	0.04260	-0.066000	0.11598	-0.570000	0.06022	-2.538000	0.00180	TCC	T|0.731;G|0.269		0.746	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
IGHMBP2	3508	bcgsc.ca	37	11	68682402	68682402	+	Missense_Mutation	SNP	A	A	G	rs10896380	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:68682402A>G	ENST00000255078.3	+	6	934	c.823A>G	c.(823-825)Att>Gtt	p.I275V	IGHMBP2_ENST00000539224.1_3'UTR	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	275	Leu-rich.		I -> V (in dbSNP:rs10896380). {ECO:0000269|PubMed:8349627}.		ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CCTGGAGTCCATTCAGCAGCA	0.597													A|||	600	0.119808	0.1074	0.1888	5008	,	,		15618	0.0149		0.2674	False		,,,				2504	0.044				p.I275V		.											.	IGHMBP2-90	0			c.A823G						.	A	VAL/ILE	545,3855	246.8+/-255.3	37,471,1692	102.0	92.0	95.0		823	0.1	0.4	11	dbSNP_120	95	2127,6461	366.2+/-334.2	258,1611,2425	yes	missense	IGHMBP2	NM_002180.2	29	295,2082,4117	GG,GA,AA		24.7671,12.3864,20.5728	benign	275/994	68682402	2672,10316	2200	4294	6494	SO:0001583	missense	3508	exon6			GAGTCCATTCAGC	L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.823A>G	11.37:g.68682402A>G	ENSP00000255078:p.Ile275Val	136	1		133	5	NM_002180	0	0	0	0	0	A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	ENST00000255078.3	37	CCDS8187.1	343	0.15705128205128205	60	0.12195121951219512	73	0.20165745856353592	11	0.019230769230769232	199	0.262532981530343	A	5.864	0.343588	0.11126	0.123864	0.247671	ENSG00000132740	ENST00000255078	T	0.81078	-1.45	3.71	0.0501	0.14292	DEAD-like helicase (1);Helicase/UvrB domain (1);ATPase, AAA+ type, core (1);	0.262406	0.37012	N	0.002293	T	0.00012	0.0000	N	0.02854	-0.475	0.09310	P	1.0	B	0.10296	0.003	B	0.15870	0.014	T	0.04915	-1.0918	9	0.02654	T	1	-23.5642	3.4248	0.07406	0.5127:0.0:0.3163:0.171	rs10896380;rs17533010;rs60474416;rs10896380	275	P38935	SMBP2_HUMAN	V	275	ENSP00000255078:I275V	ENSP00000255078:I275V	I	+	1	0	IGHMBP2	68438978	0.869000	0.29996	0.423000	0.26634	0.699000	0.40488	1.576000	0.36504	-0.090000	0.12462	0.454000	0.30748	ATT	A|0.824;G|0.176		0.597	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396862.1	NM_002180	
DHCR7	1717	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71149950	71149950	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:71149950G>A	ENST00000355527.3	-	7	1082	c.806C>T	c.(805-807)gCc>gTc	p.A269V	DHCR7_ENST00000407721.2_Missense_Mutation_p.A269V	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	269					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						CAGGACCATGGCATTGGTCAC	0.622									Smith-Lemli-Opitz syndrome																												p.A269V		.											.	DHCR7-228	0			c.C806T						.						75.0	70.0	71.0					11																	71149950		2200	4294	6494	SO:0001583	missense	1717	exon7	Familial Cancer Database	SLOS type I & II	ACCATGGCATTGG	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.806C>T	11.37:g.71149950G>A	ENSP00000347717:p.Ala269Val	116	1		60	9	NM_001163817	0	0	2	2	0	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	37	CCDS8200.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250405	0.80024	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000533800;ENST00000525137;ENST00000527316	D;D;D;D;D	0.98105	-4.72;-4.72;-4.72;-4.72;-4.72	4.53	4.53	0.55603	.	0.112802	0.64402	D	0.000007	D	0.96390	0.8822	L	0.54965	1.715	0.40830	D	0.983589	P	0.36837	0.571	B	0.39876	0.312	D	0.97423	1.0010	10	0.72032	D	0.01	-42.5377	14.8164	0.70039	0.0:0.0:1.0:0.0	.	269	Q9UBM7	DHCR7_HUMAN	V	269;269;19;58;237	ENSP00000384739:A269V;ENSP00000347717:A269V;ENSP00000435011:A19V;ENSP00000435956:A58V;ENSP00000435047:A237V	ENSP00000347717:A269V	A	-	2	0	DHCR7	70827598	1.000000	0.71417	1.000000	0.80357	0.290000	0.27261	8.579000	0.90781	2.068000	0.61886	0.485000	0.47835	GCC	.		0.622	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	92532969	92532969	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:92532969C>A	ENST00000298047.6	+	9	6807	c.6790C>A	c.(6790-6792)Ctt>Att	p.L2264I	FAT3_ENST00000409404.2_Missense_Mutation_p.L2264I|FAT3_ENST00000525166.1_Missense_Mutation_p.L2114I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2264	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGCGACGCCCTTACTGGTGC	0.428										TCGA Ovarian(4;0.039)																											p.L2264I		.											.	FAT3-73	0			c.C6790A						.						81.0	73.0	76.0					11																	92532969		1908	4116	6024	SO:0001583	missense	120114	exon9			GACGCCCTTACTG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6790C>A	11.37:g.92532969C>A	ENSP00000298047:p.Leu2264Ile	158	0		136	19	NM_001008781	0	0	0	0	0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	11.60	1.688345	0.29962	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.60920	0.15;0.15;0.15	5.94	3.96	0.45880	.	.	.	.	.	T	0.64148	0.2572	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.62253	-0.6893	9	0.49607	T	0.09	.	9.6532	0.39910	0.1403:0.7837:0.0:0.076	.	2264	Q8TDW7-3	.	I	2264;2264;2114	ENSP00000298047:L2264I;ENSP00000387040:L2264I;ENSP00000432586:L2114I	ENSP00000298047:L2264I	L	+	1	0	FAT3	92172617	0.994000	0.37717	0.968000	0.41197	0.300000	0.27592	3.166000	0.50785	0.731000	0.32448	0.650000	0.86243	CTT	.		0.428	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
KBTBD3	143879	broad.mit.edu	37	11	105924412	105924412	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:105924412G>T	ENST00000526793.1	-	3	1163	c.1004C>A	c.(1003-1005)tCt>tAt	p.S335Y	KBTBD3_ENST00000534815.1_Missense_Mutation_p.S256Y|KBTBD3_ENST00000531837.1_Missense_Mutation_p.S335Y	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	331										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		CGAAAGACTAGATCCTGGCAA	0.383																																					p.S335Y		.											.	KBTBD3-91	0			c.C1004A						.						79.0	78.0	78.0					11																	105924412		2201	4298	6499	SO:0001583	missense	143879	exon3			AGACTAGATCCTG	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1004C>A	11.37:g.105924412G>T	ENSP00000436262:p.Ser335Tyr	31	0		31	3	NM_152433	0	0	0	0	0	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	37	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	G	4.395	0.073001	0.08485	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.67171	-0.25;-0.25;-0.25	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.047462	0.85682	D	0.000000	T	0.65790	0.2725	N	0.14661	0.345	0.50467	D	0.999872	D;D	0.71674	0.978;0.998	P;D	0.63488	0.719;0.915	T	0.57682	-0.7769	10	0.06099	T	0.92	.	20.4135	0.99023	0.0:0.0:1.0:0.0	.	335;331	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	Y	256;335;335	ENSP00000431910:S256Y;ENSP00000436262:S335Y;ENSP00000432163:S335Y	ENSP00000436262:S335Y	S	-	2	0	KBTBD3	105429622	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.115000	0.77110	2.835000	0.97688	0.591000	0.81541	TCT	.		0.383	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
BTG4	54766	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111384236	111384236	+	5'Flank	SNP	A	A	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr11:111384236A>T	ENST00000356018.2	-	0	0				MIR34C_ENST00000384831.1_RNA|RP11-794P6.6_ENST00000530283.1_RNA|C11orf88_ENST00000529167.1_5'Flank|C11orf88_ENST00000375618.4_5'Flank|BTG4_ENST00000525791.1_5'Flank|C11orf88_ENST00000332814.6_5'Flank|MIR34B_ENST00000385076.1_RNA	NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4						cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)					large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		CCAGGTAAAAAGATTTGGGAA	0.423																																					.		.											.	.	0			.						.						76.0	65.0	68.0					11																	111384236		1566	3579	5145	SO:0001631	upstream_gene_variant	407042	.			GTAAAAAGATTTG	AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30			11.37:g.111384236A>T	Exception_encountered	57	0		59	9	.	0	0	0	0	0	Q8NEH7	RNA	SNP	ENST00000356018.2	37	CCDS8346.1																																																																																			.		0.423	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391177.1		
CHD4	1108	broad.mit.edu	37	12	6710509	6710509	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:6710509G>C	ENST00000357008.2	-	6	908	c.745C>G	c.(745-747)Cca>Gca	p.P249A	CHD4_ENST00000309577.6_Missense_Mutation_p.P249A|CHD4_ENST00000544040.1_Missense_Mutation_p.P242A|CHD4_ENST00000544484.1_Missense_Mutation_p.P246A	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	249	Poly-Pro.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GGGGGAGGTGGTGGTGCAACC	0.592																																					p.P249A	Colon(32;586 792 4568 16848 45314)	.											.	CHD4-228	0			c.C745G						.						95.0	98.0	97.0					12																	6710509		2203	4300	6503	SO:0001583	missense	1108	exon6			GAGGTGGTGGTGC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.745C>G	12.37:g.6710509G>C	ENSP00000349508:p.Pro249Ala	121	0		183	6	NM_001273	0	0	7	7	0	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436155	0.25813	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.89810	-2.55;-2.57;-2.56;-2.56;0.89	5.73	5.73	0.89815	.	0.206608	0.41396	D	0.000892	D	0.86464	0.5939	L	0.47190	1.495	0.47341	D	0.999398	P;P;B	0.46578	0.759;0.88;0.004	B;B;B	0.42188	0.379;0.345;0.011	D	0.84607	0.0676	10	0.25106	T	0.35	2.4203	17.6812	0.88243	0.0:0.0:1.0:0.0	.	249;249;242	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	A	246;242;249;249;223;249	ENSP00000440392:P246A;ENSP00000440542:P242A;ENSP00000312419:P249A;ENSP00000349508:P249A;ENSP00000437506:P249A	ENSP00000312419:P249A	P	-	1	0	CHD4	6580770	0.993000	0.37304	0.240000	0.24138	0.998000	0.95712	2.386000	0.44380	2.705000	0.92388	0.555000	0.69702	CCA	.		0.592	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
ZNF384	171017	hgsc.bcm.edu	37	12	6777081	6777081	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:6777081C>T	ENST00000396801.3	-	11	1740	c.1533G>A	c.(1531-1533)caG>caA	p.Q511Q	ZNF384_ENST00000361959.3_Silent_p.Q511Q|RP4-761J14.8_ENST00000586338.1_RNA|ZNF384_ENST00000396795.1_Silent_p.Q450Q|ZNF384_ENST00000355772.4_Silent_p.Q395Q|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000396799.2_Silent_p.Q450Q|ZNF384_ENST00000319770.3_Silent_p.Q434Q	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	511	Gln-rich.				nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						gctgctgctgctgctgctgct	0.667			T	"""EWSR1, TAF15 """	ALL																																p.Q511Q		.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	.	ZNF384-1083	0			c.G1533A						.						15.0	19.0	18.0					12																	6777081		2200	4287	6487	SO:0001819	synonymous_variant	171017	exon11			CTGCTGCTGCTGC	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1533G>A	12.37:g.6777081C>T		31	0		72	6	NM_001135734	0	0	160	161	1	O15407|Q7Z722|Q8N938	Silent	SNP	ENST00000396801.3	37	CCDS44817.1																																																																																			.		0.667	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
USP15	9958	ucsc.edu;bcgsc.ca	37	12	62778065	62778065	+	Silent	SNP	A	A	G	rs2044846	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:62778065A>G	ENST00000280377.5	+	11	1513	c.1455A>G	c.(1453-1455)ccA>ccG	p.P485P	USP15_ENST00000353364.3_Silent_p.P456P|USP15_ENST00000393654.3_Silent_p.P460P	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	485	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GAATGGATCCACTTACCAAAC	0.308													G|||	2806	0.560304	0.5212	0.5634	5008	,	,		13820	0.5813		0.6332	False		,,,				2504	0.5143				p.P485P	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15-1084	0			c.A1455G						.	G		2353,2053	558.7+/-380.1	643,1067,493	66.0	59.0	62.0		1368	0.1	1.0	12	dbSNP_94	62	5368,3230	482.7+/-370.9	1696,1976,627	no	coding-synonymous	USP15	NM_006313.1		2339,3043,1120	GG,GA,AA		37.5669,46.5956,40.626		456/953	62778065	7721,5283	2203	4299	6502	SO:0001819	synonymous_variant	9958	exon11			GGATCCACTTACC	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1455A>G	12.37:g.62778065A>G		55	0		61	6	NM_001252078	0	0	6	6	0	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	37	CCDS58251.1																																																																																			A|0.415;G|0.585		0.308	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
NUP107	57122	broad.mit.edu;bcgsc.ca	37	12	69129046	69129046	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:69129046C>T	ENST00000229179.4	+	26	2756	c.2424C>T	c.(2422-2424)gcC>gcT	p.A808A	NUP107_ENST00000378905.2_Silent_p.A569A|NUP107_ENST00000401003.3_Intron|NUP107_ENST00000539906.1_Silent_p.A779A	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	808					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			ATTTGGATGCCCTAACTGCTG	0.373																																					p.A808A		.											.	NUP107-629	0			c.C2424T						.						327.0	291.0	303.0					12																	69129046		2203	4300	6503	SO:0001819	synonymous_variant	57122	exon26			GGATGCCCTAACT	AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2424C>T	12.37:g.69129046C>T		232	2		299	11	NM_020401	0	0	123	127	4	B4DZ67|Q6PJE1	Silent	SNP	ENST00000229179.4	37	CCDS8985.1																																																																																			.		0.373	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403195.1	NM_020401	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		20	20	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
NEDD1	121441	broad.mit.edu;bcgsc.ca	37	12	97345221	97345221	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:97345221A>G	ENST00000266742.4	+	15	2162	c.1823A>G	c.(1822-1824)cAt>cGt	p.H608R	NEDD1_ENST00000411739.2_Missense_Mutation_p.H519R|NEDD1_ENST00000457368.2_Missense_Mutation_p.H519R|NEDD1_ENST00000557644.1_Missense_Mutation_p.H615R|NEDD1_ENST00000429527.2_Missense_Mutation_p.H608R	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	608					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						GAAGCATGCCATAGGGACATT	0.299																																					p.H615R		.											.	NEDD1-90	0			c.A1844G						.						78.0	82.0	80.0					12																	97345221		2203	4289	6492	SO:0001583	missense	121441	exon14			CATGCCATAGGGA		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1823A>G	12.37:g.97345221A>G	ENSP00000266742:p.His608Arg	128	0		171	6	NM_001135175	0	0	0	0	0	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070409	0.76301	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.60171	0.22;0.22;1.0;0.21;1.0	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	L	0.61036	1.89	0.58432	D	0.999999	D;P	0.89917	1.0;0.473	D;B	0.83275	0.996;0.157	T	0.73883	-0.3842	10	0.46703	T	0.11	.	16.3736	0.83374	1.0:0.0:0.0:0.0	.	615;608	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	R	608;608;519;615;519	ENSP00000266742:H608R;ENSP00000404978:H608R;ENSP00000411307:H519R;ENSP00000451211:H615R;ENSP00000407964:H519R	ENSP00000266742:H608R	H	+	2	0	NEDD1	95869352	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.419000	0.66435	2.273000	0.75805	0.482000	0.46254	CAT	.		0.299	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	1	0		22	11	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
LINC00173	100287569	bcgsc.ca	37	12	116972637	116972637	+	RNA	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:116972637G>A	ENST00000480237.1	+	0	908					NR_027345.1		Q6ZV60	YL023_HUMAN	long intergenic non-protein coding RNA 173																		TGCAAGGGCCGCATTCCCGGG	0.597																																					.		.											.	.	0			.						.						73.0	64.0	67.0					12																	116972637		2203	4300	6503			100287569	.			AGGGCCGCATTCC	AC090670, BC038547, BC121822		12q24.22	2012-10-12	2011-08-11	2011-08-11	ENSG00000196668	ENSG00000196668		"""Long non-coding RNAs"""	33791	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 173"""	NCRNA00173			Standard	NR_027345		Approved	FLJ42957	uc001tvx.1	Q6ZV60	OTTHUMG00000157726		12.37:g.116972637G>A		100	0		171	6	.	0	0	1	1	0		RNA	SNP	ENST00000480237.1	37																																																																																				.		0.597	LINC00173-002	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000349521.1	NR_027345	
KDM2B	84678	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	121882310	121882310	+	Missense_Mutation	SNP	G	G	C	rs371581440		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:121882310G>C	ENST00000377071.4	-	15	2205	c.2133C>G	c.(2131-2133)gaC>gaG	p.D711E	KDM2B_ENST00000377069.4_Missense_Mutation_p.D680E|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.D79E	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	711					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TTGGAAGCTCGTCGTTGACCA	0.617																																					p.D711E		.											.	KDM2B-638	0			c.C2133G						.						86.0	91.0	89.0					12																	121882310		2137	4229	6366	SO:0001583	missense	84678	exon15			AAGCTCGTCGTTG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2133C>G	12.37:g.121882310G>C	ENSP00000366271:p.Asp711Glu	118	1		154	30	NM_032590	0	0	2	6	4	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018477	0.35606	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	D;D;D	0.87571	-2.27;-2.27;-2.27	5.81	-1.95	0.07548	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.53938	D	0.000049	T	0.71929	0.3398	L	0.37630	1.12	0.80722	D	1	B;B;B;B	0.25809	0.057;0.135;0.013;0.057	B;B;B;B	0.24155	0.035;0.051;0.015;0.035	T	0.55585	-0.8118	10	0.07990	T	0.79	-31.6371	4.2442	0.10663	0.5521:0.0966:0.255:0.0963	.	151;711;680;151	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	E	711;79;680;711;151;711	ENSP00000437821:D79E;ENSP00000366269:D680E;ENSP00000366271:D711E	ENSP00000261824:D711E	D	-	3	2	KDM2B	120366693	0.180000	0.23148	0.994000	0.49952	0.996000	0.88848	-0.194000	0.09559	-0.246000	0.09611	-0.137000	0.14449	GAC	.		0.617	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	129558465	129558465	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:129558465G>T	ENST00000422113.2	-	9	3581	c.3255C>A	c.(3253-3255)tgC>tgA	p.C1085*	TMEM132D_ENST00000389441.4_Nonsense_Mutation_p.C623*	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1085					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCAGCTCTTTGCAGTCCCCAG	0.507																																					p.C1085X		.											.	TMEM132D-106	0			c.C3255A						.						199.0	172.0	182.0					12																	129558465		2203	4300	6503	SO:0001587	stop_gained	121256	exon9			CTCTTTGCAGTCC	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3255C>A	12.37:g.129558465G>T	ENSP00000408581:p.Cys1085*	134	0		188	77	NM_133448	0	0	0	0	0	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Nonsense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	G	40	8.190862	0.98699	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	.	.	.	4.22	1.29	0.21616	.	0.634660	0.15939	N	0.237271	.	.	.	.	.	.	0.53688	D	0.999977	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.8108	9.645	0.39861	0.247:0.0:0.753:0.0	.	.	.	.	X	623;1085	.	.	C	-	3	2	TMEM132D	128124418	0.010000	0.17322	0.000000	0.03702	0.013000	0.08279	1.011000	0.29911	0.356000	0.24157	-0.253000	0.11424	TGC	.		0.507	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
PXMP2	5827	hgsc.bcm.edu	37	12	133264332	133264332	+	Silent	SNP	C	C	T	rs11538534	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr12:133264332C>T	ENST00000317479.3	+	1	141	c.76C>T	c.(76-78)Ctg>Ttg	p.L26L	PXMP2_ENST00000543589.1_Silent_p.L26L|POLE_ENST00000320574.5_5'Flank|RP13-672B3.2_ENST00000537262.1_5'Flank|PXMP2_ENST00000428960.2_5'Flank|PXMP2_ENST00000539093.1_5'Flank|POLE_ENST00000535270.1_5'Flank|PXMP2_ENST00000545677.1_5'Flank	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	26						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)				large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		CGCCCAGTACCTGCTCTTCCT	0.801													c|||	1952	0.389776	0.2231	0.464	5008	,	,		4712	0.3244		0.5706	False		,,,				2504	0.4438				p.L26L		.											.	PXMP2-90	0			c.C76T						.						1.0	1.0	1.0					12																	133264332		888	1858	2746	SO:0001819	synonymous_variant	5827	exon1			CAGTACCTGCTCT		CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.76C>T	12.37:g.133264332C>T		0	0		8	8	NM_018663	0	0	7	22	15		Silent	SNP	ENST00000317479.3	37	CCDS9279.1																																																																																			C|0.572;T|0.428		0.801	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397553.1	NM_018663	
Unknown	0	bcgsc.ca	37	13	103400936	103400936	+	IGR	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr13:103400936G>C								LINC00283 (3362 upstream) : TEX30 (17403 downstream)																							CATTTCAGGAGAGGAAACAAG	0.353																																					p.S704C		.											.	.	0			c.C2111G						.						123.0	94.0	103.0					13																	103400936		692	1591	2283	SO:0001628	intergenic_variant	643677	exon4			TCAGGAGAGGAAA																													13.37:g.103400936G>C		36	1		52	19	NM_001146197	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.353								
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000375775.3_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000464141.1_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		0	0		11	10	NM_005537	0	0	2	6	4	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
ZNF219	51222	hgsc.bcm.edu	37	14	21560753	21560758	+	In_Frame_Del	DEL	GAGGCT	GAGGCT	-	rs71794845|rs11278664|rs3841049	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	GAGGCT	GAGGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:21560753_21560758delGAGGCT	ENST00000360947.3	-	3	1109_1114	c.698_703delAGCCTC	c.(697-705)cagcctcca>cca	p.QP233del	ZNF219_ENST00000451119.2_In_Frame_Del_p.QP233del|ZNF219_ENST00000421093.2_In_Frame_Del_p.QP233del|ZNF219_ENST00000556101.1_5'Flank|RP11-998D10.7_ENST00000554733.2_lincRNA	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	233				Missing (in Ref. 4; AAH00694). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q233_P234delQP(3)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ggctggggtggaggctgaggctgagg	0.743											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		1230	0.245607	0.2549	0.3775	5008	,	,		14407	0.125		0.1879	False		,,,				2504	0.3231				p.233_235del		.											.	ZNF219-90	3	Deletion - In frame(3)	large_intestine(1)|prostate(1)|breast(1)	c.698_703del						.		,,	821,2789		238,345,1222					,,	2.7	1.0		dbSNP_107	4	1173,6075		279,615,2730	no	coding,coding,coding	ZNF219	NM_016423.2,NM_001102454.1,NM_001101672.1	,,	517,960,3952	A1A1,A1R,RR		16.1838,22.7424,18.3643	,,	,,		1994,8864				SO:0001651	inframe_deletion	51222	exon3			GGGGTGGAGGCTG	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.698_703delAGCCTC	14.37:g.21560759_21560764delGAGGCT	ENSP00000354206:p.Gln233_Pro234del	0	0	749	45	13	NM_001102454	0	0	0	0	0	D3DS16|Q53Y57|Q8IYC1|Q9BW28	In_Frame_Del	DEL	ENST00000360947.3	37	CCDS9568.1																																																																																			.		0.743	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
SSTR1	6751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	38679240	38679240	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:38679240G>A	ENST00000267377.2	+	3	1263	c.646G>A	c.(646-648)Gct>Act	p.A216T		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	216					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	GCCAGAGCCCGCTCAACGCTG	0.602																																					p.A216T		.											.	SSTR1-947	0			c.G646A						.						70.0	67.0	68.0					14																	38679240		2203	4300	6503	SO:0001583	missense	6751	exon3			GAGCCCGCTCAAC		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.646G>A	14.37:g.38679240G>A	ENSP00000267377:p.Ala216Thr	116	0		97	11	NM_001049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000267377.2	37	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468084	0.43839	.	.	ENSG00000139874	ENST00000267377	T	0.36699	1.24	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.235596	0.29342	N	0.012422	T	0.19167	0.0460	N	0.13272	0.32	0.34023	D	0.652854	B	0.18610	0.029	B	0.21708	0.036	T	0.17684	-1.0361	10	0.27785	T	0.31	.	5.5216	0.16936	0.1017:0.0:0.6982:0.2001	.	216	P30872	SSR1_HUMAN	T	216	ENSP00000267377:A216T	ENSP00000267377:A216T	A	+	1	0	SSTR1	37748991	0.209000	0.23505	0.998000	0.56505	0.991000	0.79684	2.058000	0.41374	2.514000	0.84764	0.561000	0.74099	GCT	.		0.602	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
TRIM9	114088	hgsc.bcm.edu	37	14	51492067	51492067	+	Silent	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:51492067G>T	ENST00000298355.3	-	2	1955	c.834C>A	c.(832-834)tcC>tcA	p.S278S	TRIM9_ENST00000360392.4_Silent_p.S278S|TRIM9_ENST00000338969.5_Silent_p.S278S	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	278					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TCAGCGCCTGGGAGAGCTGGC	0.527																																					p.S278S		.											.	TRIM9-227	0			c.C834A						.						120.0	107.0	111.0					14																	51492067		2203	4300	6503	SO:0001819	synonymous_variant	114088	exon2			CGCCTGGGAGAGC	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.834C>A	14.37:g.51492067G>T		73	0		60	4	NM_015163	0	0	0	0	0	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	ENST00000298355.3	37	CCDS9703.1																																																																																			.		0.527	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276874.1	NM_015163	
IRF2BPL	64207	broad.mit.edu	37	14	77493762	77493767	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:77493762_77493767delTGCTGC	ENST00000238647.3	-	1	1267_1272	c.369_374delGCAGCA	c.(367-375)cagcagcaa>caa	p.123_125QQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	123	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgct	0.714														4658	0.930112	0.9297	0.9769	5008	,	,		7189	0.872		0.9712	False		,,,				2504	0.9151				p.123_125del		.											.	IRF2BPL-90	0			c.369_374del						.																																			SO:0001651	inframe_deletion	64207	exon1			TGTTGTTGCTGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.369_374delGCAGCA	14.37:g.77493768_77493773delTGCTGC	ENSP00000238647:p.Gln125_Gln126del	16	0		19	9	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			CTG|1.000;|0.000		0.714	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
FOXN3	1112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	89817135	89817135	+	Silent	SNP	C	C	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:89817135C>G	ENST00000345097.4	-	3	677	c.561G>C	c.(559-561)tcG>tcC	p.S187S	FOXN3_ENST00000555353.1_Silent_p.S187S|RP11-356K23.1_ENST00000555407.1_RNA|FOXN3_ENST00000261302.5_Silent_p.S187S|FOXN3_ENST00000557258.1_Silent_p.S187S|RP11-356K23.1_ENST00000556942.1_RNA|FOXN3_ENST00000555658.1_5'UTR	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	187					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TGCACCACAACGACCCTTTCC	0.368																																					p.S187S		.											.	FOXN3-229	0			c.G561C						.						153.0	133.0	140.0					14																	89817135		2203	4300	6503	SO:0001819	synonymous_variant	1112	exon3			CCACAACGACCCT		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.561G>C	14.37:g.89817135C>G		90	0		85	32	NM_005197	0	0	1	1	0	Q96II7|Q9UIE7	Silent	SNP	ENST00000345097.4	37	CCDS41977.1	.	.	.	.	.	.	.	.	.	.	C	8.307	0.821306	0.16678	.	.	ENSG00000053254	ENST00000553840;ENST00000556916	.	.	.	6.06	-12.1	0.00011	.	.	.	.	.	T	0.41789	0.1174	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51694	-0.8673	4	.	.	.	.	6.3846	0.21554	0.1161:0.077:0.43:0.3769	.	.	.	.	P	37;48	.	.	R	-	2	0	FOXN3	88886888	0.129000	0.22400	0.274000	0.24659	0.987000	0.75469	-0.657000	0.05335	-2.405000	0.00575	-0.878000	0.02970	CGT	.		0.368	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197	
CCDC88C	440193	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	91739504	91739504	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:91739504G>A	ENST00000389857.6	-	30	5638	c.5552C>T	c.(5551-5553)cCc>cTc	p.P1851L	CCDC88C_ENST00000331194.7_Missense_Mutation_p.P375L	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1851					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				ATGGGAGCTGGGGGGTGCGGG	0.697																																					p.P1851L		.											.	CCDC88C-25	0			c.C5552T						.						6.0	8.0	7.0					14																	91739504		1871	4067	5938	SO:0001583	missense	440193	exon30			GAGCTGGGGGGTG		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5552C>T	14.37:g.91739504G>A	ENSP00000374507:p.Pro1851Leu	40	0		44	7	NM_001080414	0	0	4	4	0	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	4.142	0.024624	0.08054	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.41065	2.67;1.01	4.39	3.42	0.39159	.	0.608791	0.13388	U	0.391614	T	0.30324	0.0761	L	0.38175	1.15	0.09310	N	1	B;B;B	0.24368	0.001;0.102;0.037	B;B;B	0.23852	0.001;0.049;0.049	T	0.10428	-1.0630	10	0.27082	T	0.32	-10.0551	7.5606	0.27849	0.0896:0.1684:0.7421:0.0	.	1851;375;301	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	L	1851;329;375	ENSP00000374507:P1851L;ENSP00000330332:P375L	ENSP00000330332:P375L	P	-	2	0	CCDC88C	90809257	0.003000	0.15002	0.158000	0.22627	0.100000	0.18952	1.447000	0.35101	1.980000	0.57719	0.313000	0.20887	CCC	.		0.697	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.H515P	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P		.											.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	54	7		143	31	NM_001202429	0	0	0	0	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		37	9	NM_001127258	0	0	1	1	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
BEGAIN	57596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	101011366	101011366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:101011366G>A	ENST00000355173.2	-	4	285	c.214C>T	c.(214-216)Cag>Tag	p.Q72*	BEGAIN_ENST00000556751.1_Nonsense_Mutation_p.Q8*|BEGAIN_ENST00000443071.2_Nonsense_Mutation_p.Q72*|BEGAIN_ENST00000554747.1_5'Flank	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	72						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				TCCAGCTCCTGGTTGATCCTC	0.647																																					p.Q72X	NSCLC(159;1889 2010 9965 27479 40101)	.											.	BEGAIN-68	0			c.C214T						.						222.0	152.0	176.0					14																	101011366		2203	4300	6503	SO:0001587	stop_gained	57596	exon4			GCTCCTGGTTGAT	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.214C>T	14.37:g.101011366G>A	ENSP00000347301:p.Gln72*	60	0		58	12	NM_020836	0	0	2	2	0	Q9NPU3|Q9P282	Nonsense_Mutation	SNP	ENST00000355173.2	37	CCDS9962.1	.	.	.	.	.	.	.	.	.	.	G	32	5.167564	0.94768	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071;ENST00000553553;ENST00000556188;ENST00000554356;ENST00000557378;ENST00000554140	.	.	.	3.16	3.16	0.36331	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	12.5808	0.56390	0.0:0.0:1.0:0.0	.	.	.	.	X	72;8;72;84;72;8;72;91	.	ENSP00000347301:Q72X	Q	-	1	0	BEGAIN	100081119	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	8.404000	0.90210	2.077000	0.62373	0.555000	0.69702	CAG	.		0.647	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568729	103568729	+	Silent	SNP	A	A	G	rs10142200	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:103568729A>G	ENST00000380069.3	+	2	745	c.669A>G	c.(667-669)gaA>gaG	p.E223E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	223					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CGGAGGAGGAAGCCCACCCTT	0.756													G|||	2646	0.528355	0.5666	0.5303	5008	,	,		12079	0.6042		0.3917	False		,,,				2504	0.5378				p.E223E		.											.	EXOC3L4-23	0			c.A669G						.	G		2098,2000		603,892,554	5.0	5.0	5.0		669	2.5	0.8	14	dbSNP_119	5	2949,5055		663,1623,1716	no	coding-synonymous	EXOC3L4	NM_001077594.1		1266,2515,2270	GG,GA,AA		36.8441,48.8043,41.7039		223/723	103568729	5047,7055	2049	4002	6051	SO:0001819	synonymous_variant	91828	exon2			GGAGGAAGCCCAC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.669A>G	14.37:g.103568729A>G		0	0		4	4	NM_001077594	0	0	0	0	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			A|0.486;G|0.514		0.756	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
KIF26A	26153	hgsc.bcm.edu	37	14	104644168	104644168	+	Silent	SNP	C	C	T	rs201501169	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr14:104644168C>T	ENST00000423312.2	+	12	5043	c.5043C>T	c.(5041-5043)agC>agT	p.S1681S	KIF26A_ENST00000315264.7_Silent_p.S1542S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1681					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		ACTCCATGAGCGAGAGTGGGG	0.687													C|||	23	0.00459265	0.0174	0.0	5008	,	,		14039	0.0		0.0	False		,,,				2504	0.0				p.S1681S		.											.	KIF26A-24	0			c.C5043T						.	C		21,3645		0,21,1812	4.0	6.0	6.0		5043	-3.9	0.8	14		6	0,7736		0,0,3868	no	coding-synonymous	KIF26A	NM_015656.1		0,21,5680	TT,TC,CC		0.0,0.5728,0.1842		1681/1883	104644168	21,11381	1833	3868	5701	SO:0001819	synonymous_variant	26153	exon12			CATGAGCGAGAGT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5043C>T	14.37:g.104644168C>T		1	0		5	5	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			C|0.998;T|0.002		0.687	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	33962729	33962729	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:33962729G>T	ENST00000389232.4	+	38	5902	c.5832G>T	c.(5830-5832)caG>caT	p.Q1944H	RYR3_ENST00000415757.3_Missense_Mutation_p.Q1944H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1944	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGAAGGAGCAGCCGACGGAGG	0.458																																					p.Q1944H		.											.	RYR3-520	0			c.G5832T						.						75.0	90.0	85.0					15																	33962729		1959	4138	6097	SO:0001583	missense	6263	exon38			GGAGCAGCCGACG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5832G>T	15.37:g.33962729G>T	ENSP00000373884:p.Gln1944His	79	0		77	12	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.442994	0.25987	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96651	-4.08;-4.08	5.48	0.407	0.16371	.	0.349316	0.26642	N	0.023249	D	0.88768	0.6526	N	0.08118	0	0.21627	N	0.999615	B;B	0.23377	0.084;0.0	B;B	0.30401	0.115;0.0	T	0.81426	-0.0938	10	0.72032	D	0.01	.	4.5835	0.12271	0.2365:0.0:0.5216:0.2419	.	1944;1944	Q15413-2;Q15413	.;RYR3_HUMAN	H	1944	ENSP00000373884:Q1944H;ENSP00000399610:Q1944H	ENSP00000354735:Q1944H	Q	+	3	2	RYR3	31750021	0.620000	0.27068	0.007000	0.13788	0.552000	0.35366	0.119000	0.15626	-0.059000	0.13154	0.650000	0.86243	CAG	.		0.458	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
PLA2G4E	123745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	42297141	42297141	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:42297141C>A	ENST00000399518.3	-	5	1047	c.561G>T	c.(559-561)gaG>gaT	p.E187D	PLA2G4E_ENST00000413860.2_Missense_Mutation_p.E158D|CTD-2382E5.2_ENST00000552704.1_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	169					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		CTCACCTCTCCTCCAGCAGGA	0.617																																					p.E187D		.											.	.	0			c.G561T						.						26.0	30.0	29.0					15																	42297141		2013	4173	6186	SO:0001583	missense	123745	exon5			CCTCTCCTCCAGC		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.561G>T	15.37:g.42297141C>A	ENSP00000382434:p.Glu187Asp	159	0		149	12	NM_001206670	0	0	0	0	0	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	37	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665300	0.47677	.	.	ENSG00000188089	ENST00000399518;ENST00000413860	T;T	0.39997	1.05;4.69	5.41	3.39	0.38822	.	0.202917	0.29376	U	0.012330	T	0.38295	0.1035	M	0.70595	2.14	0.26118	N	0.980592	B	0.20368	0.044	B	0.19666	0.026	T	0.28839	-1.0031	10	0.35671	T	0.21	-10.5866	6.61	0.22747	0.0:0.7376:0.0:0.2624	.	158	C9JK77	.	D	187;158	ENSP00000382434:E187D;ENSP00000413897:E158D	ENSP00000382434:E187D	E	-	3	2	PLA2G4E	40084433	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.573000	0.23699	1.112000	0.41740	0.655000	0.94253	GAG	.		0.617	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
SLC30A4	7782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45814279	45814279	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:45814279C>G	ENST00000261867.4	-	2	588	c.274G>C	c.(274-276)Gtg>Ctg	p.V92L	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	92	Asp-rich (acidic).				regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CAGGAGTCCACCTTCAAACTC	0.512																																					p.V92L		.											.	SLC30A4-90	0			c.G274C						.						181.0	165.0	171.0					15																	45814279		2198	4298	6496	SO:0001583	missense	7782	exon2			AGTCCACCTTCAA		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.274G>C	15.37:g.45814279C>G	ENSP00000261867:p.Val92Leu	166	1		175	106	NM_013309	0	0	0	3	3	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403842	0.42613	.	.	ENSG00000104154	ENST00000261867	T	0.63255	-0.03	5.23	3.29	0.37713	.	0.926203	0.09285	N	0.823123	T	0.43986	0.1272	N	0.19112	0.55	0.20764	N	0.999857	B	0.09022	0.002	B	0.06405	0.002	T	0.29058	-1.0024	10	0.23891	T	0.37	-2.7195	6.3829	0.21544	0.0:0.7107:0.1871:0.1022	.	92	O14863	ZNT4_HUMAN	L	92	ENSP00000261867:V92L	ENSP00000261867:V92L	V	-	1	0	SLC30A4	43601571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.117000	0.41939	0.549000	0.28973	0.655000	0.94253	GTG	.		0.512	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	51755647	51755647	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:51755647G>A	ENST00000251076.5	-	33	8139	c.7852C>T	c.(7852-7854)Ctt>Ttt	p.L2618F	RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.L1982F|RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.L2619F	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2618						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TGTTTAACAAGGAAATGCCAA	0.299																																					p.L2619F		.											.	DMXL2-99	0			c.C7855T						.						65.0	72.0	70.0					15																	51755647		2196	4288	6484	SO:0001583	missense	23312	exon33			TAACAAGGAAATG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7852C>T	15.37:g.51755647G>A	ENSP00000251076:p.Leu2618Phe	124	0		153	101	NM_001174116	0	0	2	5	3	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480491	0.84747	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.61040	0.23;0.23;0.14	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.79839	0.4515	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.91635	0.999;0.986;0.995;0.997	T	0.82682	-0.0336	10	0.87932	D	0	.	19.0674	0.93117	0.0:0.0:1.0:0.0	.	2619;1982;2618;2619	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	F	2618;2619;1982;163	ENSP00000251076:L2618F;ENSP00000441858:L2619F;ENSP00000400855:L1982F	ENSP00000251076:L2618F	L	-	1	0	DMXL2	49542939	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.274000	0.78538	2.732000	0.93576	0.557000	0.71058	CTT	.		0.299	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		6	6	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	93522377	93522377	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr15:93522377C>T	ENST00000394196.4	+	22	3808	c.2740C>T	c.(2740-2742)Cgc>Tgc	p.R914C	CHD2_ENST00000557381.1_Missense_Mutation_p.R914C	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	914	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAATATTTACCGCTTAGTTAC	0.463																																					p.R914C		.											.	CHD2-229	0			c.C2740T						.						159.0	162.0	161.0					15																	93522377		2197	4298	6495	SO:0001583	missense	1106	exon22			ATTTACCGCTTAG	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2740C>T	15.37:g.93522377C>T	ENSP00000377747:p.Arg914Cys	57	0		57	6	NM_001271	0	0	0	0	0	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	C	32	5.144756	0.94603	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.96334	-3.98;-3.98	5.82	5.82	0.92795	Helicase, C-terminal (1);	0.000000	0.34959	U	0.003553	D	0.99146	0.9705	H	0.99130	4.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.98742	1.0717	10	0.87932	D	0	-16.0716	20.1178	0.97943	0.0:1.0:0.0:0.0	.	914;914;914	A8K9Y5;O14647;O14647-2	.;CHD2_HUMAN;.	C	914	ENSP00000377747:R914C;ENSP00000451366:R914C	ENSP00000377747:R914C	R	+	1	0	CHD2	91323381	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.010000	0.70753	2.759000	0.94783	0.557000	0.71058	CGC	.		0.463	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	EME2_ENST00000307394.7_Silent_p.V72V|NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000177742.3_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		9	9	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		6	6	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
PRSS27	83886	broad.mit.edu	37	16	2762757	2762757	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:2762757A>C	ENST00000302641.3	-	6	791	c.737T>G	c.(736-738)gTg>gGg	p.V246G	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						CCAGCTGATCACCCCCGCCTG	0.667																																					p.V246G		.											.	PRSS27-91	0			c.T737G						.						27.0	24.0	25.0					16																	2762757		2178	4284	6462	SO:0001583	missense	83886	exon6			CTGATCACCCCCG	AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.737T>G	16.37:g.2762757A>C	ENSP00000306390:p.Val246Gly	45	2		106	21	NM_031948	0	0	0	0	0		Missense_Mutation	SNP	ENST00000302641.3	37	CCDS10476.1	.	.	.	.	.	.	.	.	.	.	.	16.11	3.030268	0.54790	.	.	ENSG00000172382	ENST00000302641;ENST00000543965	D	0.85861	-2.04	5.21	5.21	0.72293	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48286	D	0.000182	D	0.94670	0.8281	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.96007	0.8998	10	0.87932	D	0	.	13.0312	0.58842	1.0:0.0:0.0:0.0	.	246;210	Q9BQR3;B3KP25	PRS27_HUMAN;.	G	246;210	ENSP00000306390:V246G	ENSP00000306390:V246G	V	-	2	0	PRSS27	2702758	0.956000	0.32656	0.212000	0.23672	0.512000	0.34134	8.849000	0.92178	1.969000	0.57287	0.459000	0.35465	GTG	.		0.667	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250908.1	NM_031948	
DNAH3	55567	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20974923	20974923	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:20974923G>T	ENST00000261383.3	-	53	10282	c.10283C>A	c.(10282-10284)gCc>gAc	p.A3428D	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3428					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTTGGGTAAGGCAGATGCACG	0.552																																					p.A3428D		.											.	DNAH3-167	0			c.C10283A						.						113.0	92.0	99.0					16																	20974923		2201	4300	6501	SO:0001583	missense	55567	exon53			GGTAAGGCAGATG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10283C>A	16.37:g.20974923G>T	ENSP00000261383:p.Ala3428Asp	107	1		101	17	NM_017539	0	0	0	1	1	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.043731	0.00039	.	.	ENSG00000158486	ENST00000261383	T	0.08458	3.09	5.6	2.95	0.34219	Dynein heavy chain (1);	1.139360	0.06404	N	0.719433	T	0.02727	0.0082	N	0.02403	-0.565	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.48422	-0.9037	10	0.06494	T	0.89	.	2.9159	0.05752	0.0873:0.1824:0.4282:0.3021	.	3428	Q8TD57	DYH3_HUMAN	D	3428	ENSP00000261383:A3428D	ENSP00000261383:A3428D	A	-	2	0	DNAH3	20882424	0.000000	0.05858	0.006000	0.13384	0.058000	0.15608	0.214000	0.17541	2.632000	0.89209	0.563000	0.77884	GCC	.		0.552	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
CHD9	80205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53326859	53326859	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:53326859A>G	ENST00000398510.3	+	28	5492	c.5405A>G	c.(5404-5406)cAg>cGg	p.Q1802R	CHD9_ENST00000447540.1_Missense_Mutation_p.Q1802R|CHD9_ENST00000564845.1_Missense_Mutation_p.Q1802R|CHD9_ENST00000566029.1_Missense_Mutation_p.Q1802R			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1802					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGACAAATTCAGCAGATACAA	0.428																																					p.Q1802R		.											.	CHD9-272	0			c.A5405G						.						106.0	98.0	101.0					16																	53326859		1898	4125	6023	SO:0001583	missense	80205	exon29			AAATTCAGCAGAT	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5405A>G	16.37:g.53326859A>G	ENSP00000381522:p.Gln1802Arg	170	0		152	20	NM_025134	0	0	2	2	0	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	A	5.641	0.302947	0.10678	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	T;T	0.80304	-1.36;-1.36	5.35	4.21	0.49690	.	0.000000	0.53938	D	0.000057	T	0.64681	0.2620	N	0.15975	0.35	0.33009	D	0.527212	P;B;P;P	0.46512	0.808;0.02;0.808;0.879	B;B;B;B	0.42827	0.225;0.032;0.225;0.399	T	0.68187	-0.5475	10	0.12430	T	0.62	-8.2591	11.6537	0.51304	0.8676:0.0:0.0:0.1324	.	170;1802;1802;1802	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	R	1802;1802;170	ENSP00000396345:Q1802R;ENSP00000381522:Q1802R	ENSP00000381522:Q1802R	Q	+	2	0	CHD9	51884360	1.000000	0.71417	0.999000	0.59377	0.876000	0.50452	4.363000	0.59473	2.023000	0.59567	0.482000	0.46254	CAG	.		0.428	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
TANGO6	79613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69007975	69007975	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:69007975G>T	ENST00000261778.1	+	15	2758	c.2746G>T	c.(2746-2748)Gac>Tac	p.D916Y		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	916						integral component of membrane (GO:0016021)											AATCTTGCCGGACTTGTTGGC	0.458																																					p.D916Y		.											.	.	0			c.G2746T						.						84.0	83.0	84.0					16																	69007975		1945	4150	6095	SO:0001583	missense	79613	exon15			TTGCCGGACTTGT		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2746G>T	16.37:g.69007975G>T	ENSP00000261778:p.Asp916Tyr	181	1		181	116	NM_024562	0	0	1	6	5	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	37	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	G	1.134	-0.651512	0.03506	.	.	ENSG00000103047	ENST00000261778	T	0.65549	-0.16	5.59	2.02	0.26589	Armadillo-like helical (1);Armadillo-type fold (1);	0.589580	0.19580	N	0.110887	T	0.34424	0.0897	N	0.14661	0.345	0.09310	N	1	P	0.43938	0.822	B	0.41440	0.357	T	0.27191	-1.0081	10	0.07175	T	0.84	-0.8203	2.9378	0.05820	0.0938:0.1387:0.4971:0.2704	.	916	Q9C0B7	TMCO7_HUMAN	Y	916	ENSP00000261778:D916Y	ENSP00000261778:D916Y	D	+	1	0	TMCO7	67565476	0.640000	0.27243	0.122000	0.21767	0.831000	0.47069	0.757000	0.26433	0.806000	0.34183	0.650000	0.86243	GAC	.		0.458	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
CMC2	56942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81015457	81015457	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr16:81015457T>C	ENST00000219400.3	-	3	522	c.107A>G	c.(106-108)tAt>tGt	p.Y36C	CMC2_ENST00000564174.1_Intron|CMC2_ENST00000564249.1_Missense_Mutation_p.Y36C|CMC2_ENST00000570195.1_Missense_Mutation_p.Y55C|CMC2_ENST00000562713.1_Missense_Mutation_p.Y36C|CMC2_ENST00000566231.1_5'UTR|CMC2_ENST00000565108.1_Intron|CMC2_ENST00000565914.1_Missense_Mutation_p.Y36C|CMC2_ENST00000486645.1_Intron|CMC2_ENST00000565925.1_Missense_Mutation_p.Y36C	NM_020188.3	NP_064573.1	Q9NRP2	COXM2_HUMAN	C-x(9)-C motif containing 2	36						mitochondrion (GO:0005739)											ATCATTACAATAACCAAAAAA	0.323																																					p.Y36C		.											.	.	0			c.A107G						.						80.0	74.0	76.0					16																	81015457		2203	4298	6501	SO:0001583	missense	56942	exon3			TTACAATAACCAA	BC032631	CCDS10930.1	16q23.2	2013-10-18	2013-10-18	2012-02-14	ENSG00000103121	ENSG00000103121			24447	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 61"", ""COX assembly mitochondrial protein 2 homolog (S. cerevisiae)"""	C16orf61		20220131	Standard	NM_020188		Approved	DC13, MGC45036	uc002ffu.3	Q9NRP2	OTTHUMG00000137625	ENST00000219400.3:c.107A>G	16.37:g.81015457T>C	ENSP00000219400:p.Tyr36Cys	80	0		86	14	NM_020188	0	0	87	113	26	D3DUK6	Missense_Mutation	SNP	ENST00000219400.3	37	CCDS10930.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.724895	0.30593	.	.	ENSG00000103121	ENST00000219400	T	0.42131	0.98	5.87	3.6	0.41247	.	0.402706	0.29653	N	0.011551	T	0.38878	0.1057	.	.	.	0.22479	N	0.999064	P	0.36577	0.558	P	0.44623	0.455	T	0.21484	-1.0244	9	0.39692	T	0.17	.	6.4263	0.21772	0.0:0.0804:0.1575:0.762	.	36	Q9NRP2	CP061_HUMAN	C	36	ENSP00000219400:Y36C	ENSP00000219400:Y36C	Y	-	2	0	C16orf61	79572958	1.000000	0.71417	0.999000	0.59377	0.007000	0.05969	2.118000	0.41949	0.544000	0.28883	-0.316000	0.08728	TAT	.		0.323	CMC2-001	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269047.1	NM_020188	
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000466740.2_RNA|AC108004.3_ENST00000599026.1_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		2	0		35	7	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
SGSM2	9905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	2280076	2280076	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:2280076C>A	ENST00000426855.2	+	19	2699	c.2524C>A	c.(2524-2526)Ctg>Atg	p.L842M	SGSM2_ENST00000574563.1_Missense_Mutation_p.L842M|SGSM2_ENST00000268989.3_Missense_Mutation_p.L887M|RP1-59D14.5_ENST00000573007.1_RNA|RP1-59D14.5_ENST00000574290.1_RNA	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	842	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CATGTGCGATCTGCTGGCGCC	0.627																																					p.L887M		.											.	SGSM2-68	0			c.C2659A						.						166.0	151.0	156.0					17																	2280076		2203	4300	6503	SO:0001583	missense	9905	exon20			TGCGATCTGCTGG	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2524C>A	17.37:g.2280076C>A	ENSP00000415107:p.Leu842Met	78	0		101	10	NM_014853	0	0	16	16	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	ENST00000426855.2	37	CCDS45570.1	.	.	.	.	.	.	.	.	.	.	c	24.6	4.548907	0.86127	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.09255	3.0;3.0	5.48	5.48	0.80851	Rab-GAP/TBC domain (4);	0.063054	0.64402	D	0.000003	T	0.45337	0.1337	M	0.92691	3.335	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.56269	-0.8007	10	0.87932	D	0	-11.9935	18.7018	0.91623	0.0:1.0:0.0:0.0	.	842;842;842;887	O43147-5;B9A6J3;O43147;O43147-2	.;.;SGSM2_HUMAN;.	M	887;842	ENSP00000268989:L887M;ENSP00000415107:L842M	ENSP00000268989:L887M	L	+	1	2	SGSM2	2226826	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	4.811000	0.62606	2.748000	0.94277	0.651000	0.88453	CTG	.		0.627	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
SGSM2	9905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	2280078	2280078	+	Silent	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:2280078G>T	ENST00000426855.2	+	19	2701	c.2526G>T	c.(2524-2526)ctG>ctT	p.L842L	SGSM2_ENST00000574563.1_Silent_p.L842L|SGSM2_ENST00000268989.3_Silent_p.L887L|RP1-59D14.5_ENST00000573007.1_RNA|RP1-59D14.5_ENST00000574290.1_RNA	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	842	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		TGTGCGATCTGCTGGCGCCTC	0.627																																					p.L887L		.											.	SGSM2-68	0			c.G2661T						.						163.0	148.0	153.0					17																	2280078		2203	4300	6503	SO:0001819	synonymous_variant	9905	exon20			CGATCTGCTGGCG	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2526G>T	17.37:g.2280078G>T		76	0		101	10	NM_014853	0	0	17	17	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	37	CCDS45570.1																																																																																			.		0.627	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
SPNS2	124976	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4436414	4436414	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:4436414G>T	ENST00000329078.3	+	7	1288	c.1078G>T	c.(1078-1080)Gcc>Tcc	p.A360S		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	360					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						GCCCTGTGGGGCCAAGGACAG	0.697																																					p.A360S		.											.	SPNS2-68	0			c.G1078T						.						13.0	16.0	15.0					17																	4436414		1565	3579	5144	SO:0001583	missense	124976	exon7			TGTGGGGCCAAGG	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1078G>T	17.37:g.4436414G>T	ENSP00000333292:p.Ala360Ser	60	1		75	8	NM_001124758	0	0	0	0	0	B9A1T3	Missense_Mutation	SNP	ENST00000329078.3	37	CCDS42237.1	.	.	.	.	.	.	.	.	.	.	g	0.079	-1.187583	0.01620	.	.	ENSG00000183018	ENST00000329078	T	0.59083	0.29	4.76	2.45	0.29901	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.169745	0.50627	D	0.000106	T	0.18718	0.0449	N	0.00873	-1.125	0.29529	N	0.852903	B	0.09022	0.002	B	0.10450	0.005	T	0.12528	-1.0544	10	0.13470	T	0.59	.	2.511	0.04657	0.2825:0.2978:0.4197:0.0	.	360	Q8IVW8	SPNS2_HUMAN	S	360	ENSP00000333292:A360S	ENSP00000333292:A360S	A	+	1	0	SPNS2	4383163	1.000000	0.71417	0.997000	0.53966	0.091000	0.18340	4.914000	0.63348	0.962000	0.38057	-0.492000	0.04666	GCC	.		0.697	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438802.1		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		9	9	NM_001014985	0	0	0	1	1	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.T125T	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	c.G375T	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639	.						66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACTGACCGTGCAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A		141	0		193	118	NM_000546	0	0	0	10	10	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent
WDR16	146845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	9542007	9542007	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:9542007C>A	ENST00000352665.5	+	12	1623	c.1554C>A	c.(1552-1554)atC>atA	p.I518I	RP11-55L4.2_ENST00000584676.1_RNA|WDR16_ENST00000396219.3_Silent_p.I450I|WDR16_ENST00000299764.5_Silent_p.I528I|WDR16_ENST00000576714.1_3'UTR	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						TCCAGATCATCACCAGCGGAA	0.507																																					p.I518I		.											.	WDR16-71	0			c.C1554A						.						98.0	87.0	91.0					17																	9542007		2203	4300	6503	SO:0001819	synonymous_variant	146845	exon12			GATCATCACCAGC	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1554C>A	17.37:g.9542007C>A		106	0		111	69	NM_145054	0	0	0	0	0		Silent	SNP	ENST00000352665.5	37	CCDS11149.2																																																																																			.		0.507	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
NF1	4763	bcgsc.ca	37	17	29560115	29560115	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:29560115G>T	ENST00000358273.4	+	27	3975	c.3592G>T	c.(3592-3594)Gaa>Taa	p.E1198*	NF1_ENST00000356175.3_Nonsense_Mutation_p.E1198*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1198					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.G1190fs*1(1)|p.E1198*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CACACTTGCAGAAACAGTATT	0.443			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.E1198X		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	14	Whole gene deletion(8)|Unknown(4)|Substitution - Nonsense(1)|Deletion - Frameshift(1)	soft_tissue(8)|lung(2)|autonomic_ganglia(2)|central_nervous_system(2)	c.G3592T						.						128.0	111.0	117.0					17																	29560115		2203	4300	6503	SO:0001587	stop_gained	4763	exon27	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CTTGCAGAAACAG		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3592G>T	17.37:g.29560115G>T	ENSP00000351015:p.Glu1198*	241	5		250	151	NM_000267	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	47	13.429988	0.99741	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.8989	0.96978	0.0:0.0:1.0:0.0	.	.	.	.	X	1198;1198;864	.	ENSP00000348498:E1198X	E	+	1	0	NF1	26584241	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.434000	0.97515	2.706000	0.92434	0.555000	0.69702	GAA	.		0.443	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		7	6	NM_001199417	0	0	0	1	1		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830727	36830727	+	Missense_Mutation	SNP	G	G	A	rs76756126	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:36830727G>A	ENST00000325814.5	-	1	460	c.22C>T	c.(22-24)Ccc>Tcc	p.P8S		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	8	Pro-rich.				neuron fate commitment (GO:0048663)												GCCAGGCGGGGCGCAGGGCAC	0.746													G|||	346	0.0690895	0.0121	0.049	5008	,	,		11987	0.0724		0.0348	False		,,,				2504	0.1922				p.P8S		.											.	.	0			c.C22T						.						1.0	2.0	2.0					17																	36830727		436	1184	1620	SO:0001583	missense	100170841	exon1			GGCGGGGCGCAGG		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.22C>T	17.37:g.36830727G>A	ENSP00000317905:p.Pro8Ser	2	0		44	11	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	99	0.04532967032967033	7	0.014227642276422764	19	0.052486187845303865	45	0.07867132867132867	28	0.036939313984168866	G	2.519	-0.311228	0.05458	.	.	ENSG00000179294	ENST00000325814	.	.	.	4.24	-1.13	0.09775	.	.	.	.	.	T	0.00784	0.0026	N	0.12182	0.205	0.19775	N	0.999956	B	0.02656	0.0	B	0.06405	0.002	T	0.19321	-1.0309	8	0.25751	T	0.34	.	3.8915	0.09120	0.3532:0.0:0.4745:0.1723	.	8	A6NHQ4	CQ096_HUMAN	S	8	.	ENSP00000317905:P8S	P	-	1	0	C17orf96	34084253	0.004000	0.15560	0.753000	0.31225	0.145000	0.21501	-0.344000	0.07780	-0.065000	0.13021	-0.448000	0.05591	CCC	G|0.954;A|0.046		0.746	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
KRT17	3872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39780559	39780559	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:39780559C>A	ENST00000311208.8	-	1	270	c.203G>T	c.(202-204)gGc>gTc	p.G68V	JUP_ENST00000540235.1_Intron|KRT42P_ENST00000438131.1_RNA	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	68	Head.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				GCTGCCATAGCCACCACCAGA	0.642																																					p.G68V	Pancreas(92;1242 2086 39193 50508)	.											.	KRT17-92	0			c.G203T						.						43.0	46.0	45.0					17																	39780559		2202	4300	6502	SO:0001583	missense	3872	exon1			CCATAGCCACCAC	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.203G>T	17.37:g.39780559C>A	ENSP00000308452:p.Gly68Val	215	0		343	39	NM_000422	0	0	0	0	0	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	37	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.958102	0.34565	.	.	ENSG00000128422	ENST00000311208	D	0.83755	-1.76	5.1	4.12	0.48240	.	0.710400	0.12198	N	0.490512	T	0.81361	0.4806	L	0.50333	1.59	0.80722	D	1	P	0.39883	0.693	B	0.40506	0.331	T	0.78272	-0.2268	10	0.36615	T	0.2	.	15.759	0.78063	0.0:0.8631:0.1369:0.0	.	68	Q04695	K1C17_HUMAN	V	68	ENSP00000308452:G68V	ENSP00000308452:G68V	G	-	2	0	KRT17	37034085	0.013000	0.17824	0.524000	0.27887	0.161000	0.22273	2.663000	0.46774	1.501000	0.48654	0.563000	0.77884	GGC	.		0.642	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
HSD17B1	3292	hgsc.bcm.edu	37	17	40706906	40706906	+	Missense_Mutation	SNP	G	G	A	rs605059	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:40706906G>A	ENST00000585807.1	+	6	4657	c.937G>A	c.(937-939)Ggt>Agt	p.G313S	RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA|HSD17B1_ENST00000225929.5_Missense_Mutation_p.G314S	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	313			G -> S (in dbSNP:rs605059). {ECO:0000269|PubMed:1327779, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2197970, ECO:0000269|PubMed:2330005, ECO:0000269|PubMed:2779584, ECO:0000269|PubMed:2846351, ECO:0000269|PubMed:8389226, ECO:0000269|Ref.6, ECO:0000269|Ref.9}.		bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GGCCGGGCGCGGTGCGGTGGG	0.736													A|||	2617	0.522564	0.4849	0.4942	5008	,	,		11834	0.4534		0.5249	False		,,,				2504	0.6626				p.G313S		.											.	HSD17B1-90	0			c.G937A	GRCh37	CM057951	HSD17B1	M	rs605059	.	A	SER/GLY	2209,1645		683,843,401	3.0	5.0	4.0		937	-1.2	0.0	17	dbSNP_83	4	4593,3023		1489,1615,704	no	missense	HSD17B1	NM_000413.2	56	2172,2458,1105	AA,AG,GG		39.6928,42.6829,40.6975	benign	313/329	40706906	6802,4668	1927	3808	5735	SO:0001583	missense	3292	exon6			GGGCGCGGTGCGG		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.937G>A	17.37:g.40706906G>A	ENSP00000466799:p.Gly313Ser	0	0		8	8	NM_000413	0	0	0	4	4	B3KXS1|Q2M2L8	Missense_Mutation	SNP	ENST00000585807.1	37	CCDS11428.1	1065	0.4876373626373626	249	0.5060975609756098	161	0.4447513812154696	257	0.4493006993006993	398	0.525065963060686	A	1.679	-0.506941	0.04231	0.573171	0.603072	ENSG00000108786	ENST00000225929	.	.	.	0.605	-1.21	0.09524	.	15.510600	0.00792	N	0.001347	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.09022	0.002;0.002	B;B	0.01281	0.0;0.0	T	0.49916	-0.8888	7	0.15952	T	0.53	.	.	.	.	rs605059;rs58087383	344;313	B3RFR9;P14061	.;DHB1_HUMAN	S	313	.	ENSP00000225929:G313S	G	+	1	0	HSD17B1	37960432	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.026000	0.03596	-2.560000	0.00474	-1.912000	0.00520	GGT	G|0.505;A|0.495		0.736	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
ABCC3	8714	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	48746781	48746781	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:48746781C>A	ENST00000285238.8	+	17	2213	c.2133C>A	c.(2131-2133)ttC>ttA	p.F711L		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	711	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	ACGTGCTTTTCGGCAAAGCCC	0.582																																					p.F711L		.											.	ABCC3-93	0			c.C2133A						.						98.0	92.0	94.0					17																	48746781		2203	4300	6503	SO:0001583	missense	8714	exon17			GCTTTTCGGCAAA	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2133C>A	17.37:g.48746781C>A	ENSP00000285238:p.Phe711Leu	105	0		141	12	NM_003786	0	0	0	0	0	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426048	0.43020	.	.	ENSG00000108846	ENST00000285238	D	0.89746	-2.56	4.36	-5.0	0.03001	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.061542	0.64402	D	0.000003	D	0.86314	0.5903	N	0.13299	0.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84060	0.0374	10	0.87932	D	0	-15.5217	12.9237	0.58247	0.0:0.4065:0.0:0.5935	.	711	O15438	MRP3_HUMAN	L	711	ENSP00000285238:F711L	ENSP00000285238:F711L	F	+	3	2	ABCC3	46101780	0.828000	0.29307	0.085000	0.20634	0.284000	0.27059	-0.118000	0.10692	-0.913000	0.03832	-1.800000	0.00619	TTC	.		0.582	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
APPBP2	10513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58525008	58525008	+	Silent	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:58525008G>A	ENST00000083182.3	-	13	1979	c.1692C>T	c.(1690-1692)ccC>ccT	p.P564P		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	564					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			CAGTGGACTGGGGGCTGGTGC	0.488																																					p.P564P		.											.	APPBP2-226	0			c.C1692T						.						165.0	167.0	166.0					17																	58525008		2203	4300	6503	SO:0001819	synonymous_variant	10513	exon13			GGACTGGGGGCTG	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1692C>T	17.37:g.58525008G>A		102	0		150	18	NM_006380	0	0	23	24	1	A8K862|O95095|Q8WVC9	Silent	SNP	ENST00000083182.3	37	CCDS32699.1																																																																																			.		0.488	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380	
GRIN2C	2905	broad.mit.edu;bcgsc.ca	37	17	72842224	72842224	+	Silent	SNP	G	G	C	rs41282061	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:72842224G>C	ENST00000293190.5	-	11	2477	c.2331C>G	c.(2329-2331)ctC>ctG	p.L777L	GRIN2C_ENST00000347612.4_Silent_p.L777L	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	777					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGAACTGCAAGAGCGCCAGGT	0.602													G|||	3	0.000599042	0.0	0.0043	5008	,	,		19490	0.0		0.0	False		,,,				2504	0.0				p.L777L		.											.	GRIN2C-228	0			c.C2331G						.	G		4,4402	8.1+/-20.4	0,4,2199	148.0	118.0	128.0		2331	1.2	1.0	17	dbSNP_127	128	44,8556	29.6+/-80.5	1,42,4257	no	coding-synonymous	GRIN2C	NM_000835.3		1,46,6456	CC,CG,GG		0.5116,0.0908,0.3691		777/1234	72842224	48,12958	2203	4300	6503	SO:0001819	synonymous_variant	2905	exon11			CTGCAAGAGCGCC		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.2331C>G	17.37:g.72842224G>C		127	0		153	6	NM_000835	0	0	1	1	0	B2RTT1	Silent	SNP	ENST00000293190.5	37	CCDS32724.1																																																																																			G|0.997;C|0.003		0.602	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
FADS6	283985	ucsc.edu	37	17	72889676	72889676	+	Silent	SNP	G	G	C	rs4319809|rs1625113	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:72889676G>C	ENST00000310226.6	-	1	32	c.18C>G	c.(16-18)ccC>ccG	p.P6P		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	12	3 X 6 AA tandem repeat of M-E-P-T-E-P.				fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					TAGGTTCCATGGGCTCCGTGG	0.726																																					p.P6P		.											.	FADS6-22	0			c.C18G						.						17.0	23.0	21.0					17																	72889676		2064	4192	6256	SO:0001819	synonymous_variant	283985	exon1			TTCCATGGGCTCC	AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.18C>G	17.37:g.72889676G>C		54	2		204	115	NM_178128	0	0	0	0	0	Q17RQ7|Q6XYE1	Silent	SNP	ENST00000310226.6	37	CCDS54163.1																																																																																			G|0.586;C|0.414		0.726	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1		
NT5C	30833	hgsc.bcm.edu	37	17	73127683	73127683	+	Silent	SNP	T	T	C	rs4788867	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:73127683T>C	ENST00000245552.2	-	1	207	c.120A>G	c.(118-120)caA>caG	p.Q40Q	NT5C_ENST00000579082.1_5'UTR|NT5C_ENST00000582160.1_5'Flank|NT5C_ENST00000578337.1_5'Flank|NT5C_ENST00000582170.1_Silent_p.Q40Q	NM_014595.2	NP_055410.1	Q8TCD5	NT5C_HUMAN	5', 3'-nucleotidase, cytosolic	40					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|pyrimidine nucleotide binding (GO:0019103)					all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Lamivudine(DB00709)	AGCCGCGGCGTTGCTCCAGCG	0.766													C|||	2491	0.497404	0.4372	0.5115	5008	,	,		10373	0.2817		0.66	False		,,,				2504	0.6237				p.Q40Q		.											.	NT5C-90	0			c.A120G						.						1.0	1.0	1.0					17																	73127683		1084	2247	3331	SO:0001819	synonymous_variant	30833	exon1			GCGGCGTTGCTCC	AF154829	CCDS11715.1	17q25	2011-03-29	2002-05-23		ENSG00000125458	ENSG00000125458	3.1.3.5		17144	protein-coding gene	gene with protein product		191720	"""5' nucleotidase, deoxy (pyrimidine), cytosolic type C"", ""uridine 5-prime monophosphate hydrolase 2"""	UMPH2		10899995	Standard	NM_014595		Approved	DNT1, DNT-1, PN-I, cdN, dNT-1	uc002jmx.3	Q8TCD5		ENST00000245552.2:c.120A>G	17.37:g.73127683T>C		0	0		5	5	NM_001252377	0	0	6	8	2	Q96HS6|Q9NP82	Silent	SNP	ENST00000245552.2	37	CCDS11715.1																																																																																			T|0.502;C|0.498		0.766	NT5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445853.1		
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74003739	74003739	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:74003739C>A	ENST00000301607.3	-	22	5800	c.5547G>T	c.(5545-5547)atG>atT	p.M1849I	EVPL_ENST00000586740.1_Missense_Mutation_p.M1871I|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1849	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGGGGTCCAGCATGTTCTTGG	0.607																																					p.M1849I		.											.	EVPL-93	0			c.G5547T						.						112.0	116.0	114.0					17																	74003739		2203	4300	6503	SO:0001583	missense	2125	exon22			GTCCAGCATGTTC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5547G>T	17.37:g.74003739C>A	ENSP00000301607:p.Met1849Ile	79	0		81	22	NM_001988	0	0	0	0	0	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854161	0.32791	.	.	ENSG00000167880	ENST00000301607	T	0.71103	-0.54	5.48	4.45	0.53987	.	0.122174	0.56097	D	0.000027	T	0.44456	0.1294	N	0.03608	-0.345	0.32722	N	0.510136	B;B	0.13145	0.007;0.005	B;B	0.18871	0.023;0.023	T	0.50127	-0.8864	10	0.26408	T	0.33	-52.7297	9.2841	0.37746	0.0:0.778:0.1465:0.0755	.	1871;1849	B7ZLH8;Q92817	.;EVPL_HUMAN	I	1849	ENSP00000301607:M1849I	ENSP00000301607:M1849I	M	-	3	0	EVPL	71515334	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.603000	0.46266	2.564000	0.86499	0.561000	0.74099	ATG	.		0.607	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
FOXJ1	2302	hgsc.bcm.edu	37	17	74133974	74133974	+	Silent	SNP	C	C	T	rs894542	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:74133974C>T	ENST00000322957.6	-	3	1080	c.726G>A	c.(724-726)acG>acA	p.T242T	RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	242					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGTATTCACCGTCAGCGGCC	0.716													C|||	385	0.076877	0.0431	0.134	5008	,	,		12954	0.0347		0.1103	False		,,,				2504	0.091				p.T242T		.											.	FOXJ1-227	0			c.G726A						.	C		156,3988		3,150,1919	4.0	6.0	5.0		726	1.5	1.0	17	dbSNP_86	5	700,7392		28,644,3374	no	coding-synonymous	FOXJ1	NM_001454.3		31,794,5293	TT,TC,CC		8.6505,3.7645,6.9958		242/422	74133974	856,11380	2072	4046	6118	SO:0001819	synonymous_variant	2302	exon3			ATTCACCGTCAGC	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.726G>A	17.37:g.74133974C>T		1	0		18	5	NM_001454	0	0	0	0	0	O00630	Silent	SNP	ENST00000322957.6	37	CCDS32739.1																																																																																			C|0.925;T|0.075		0.716	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	NM_001454	
GREB1L	80000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19053018	19053018	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr18:19053018G>T	ENST00000580732.2	+	16	2590	c.2209G>T	c.(2209-2211)Gaa>Taa	p.E737*	GREB1L_ENST00000424526.1_Nonsense_Mutation_p.E737*|GREB1L_ENST00000400483.4_Intron|GREB1L_ENST00000269218.6_Nonsense_Mutation_p.E628*			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	737						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GGGTCTGGAGGAAAATGGGAC	0.393																																					p.E737X		.											.	.	0			c.G2209T						.						125.0	120.0	121.0					18																	19053018		692	1591	2283	SO:0001587	stop_gained	80000	exon16			CTGGAGGAAAATG	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.2209G>T	18.37:g.19053018G>T	ENSP00000464162:p.Glu737*	143	0		184	50	NM_001142966	0	0	0	0	0	A4QN17|Q9H8F1	Nonsense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	41	8.884404	0.98990	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-14.6194	20.6647	0.99678	0.0:0.0:1.0:0.0	.	.	.	.	X	737;628	.	ENSP00000269218:E628X	E	+	1	0	GREB1L	17307016	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.745000	0.98856	2.890000	0.99128	0.655000	0.94253	GAA	.		0.393	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
RBBP8	5932	broad.mit.edu	37	18	20602106	20602106	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr18:20602106G>T	ENST00000399722.2	+	18	2820	c.2469G>T	c.(2467-2469)atG>atT	p.M823I	Y_RNA_ENST00000411091.1_RNA|RBBP8_ENST00000327155.5_Missense_Mutation_p.M823I|RBBP8_ENST00000399725.2_Missense_Mutation_p.C791F|RBBP8_ENST00000360790.5_Missense_Mutation_p.M828I|RBBP8_ENST00000581687.1_Start_Codon_SNP_p.M1I	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	823					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			ATGCAGATATGCCAGCAGAAG	0.343								Homologous recombination																													p.M823I		.											.	RBBP8-659	0			c.G2469T						.						115.0	125.0	121.0					18																	20602106		2203	4300	6503	SO:0001583	missense	5932	exon18			AGATATGCCAGCA	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2469G>T	18.37:g.20602106G>T	ENSP00000382628:p.Met823Ile	56	2		68	3	NM_002894	0	0	1	1	0	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	37	CCDS11875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.82|11.82	1.751811|1.751811	0.31046|0.31046	.|.	.|.	ENSG00000101773|ENSG00000101773	ENST00000399725;ENST00000399721|ENST00000327155;ENST00000399722;ENST00000360790	T|T;T;T	0.27890|0.27256	1.64|1.68;1.68;1.68	5.93|5.93	-0.187|-0.187	0.13268|0.13268	.|.	.|0.533866	.|0.21259	.|N	.|0.077506	T|T	0.08537|0.08537	0.0212|0.0212	N|N	0.04880|0.04880	-0.145|-0.145	0.80722|0.80722	D|D	1|1	B|B;B	0.02656|0.02656	0.0|0.0;0.0	B|B;B	0.01281|0.04013	0.0|0.001;0.001	T|T	0.21314|0.21314	-1.0249|-1.0249	9|10	0.87932|0.22109	D|T	0|0.4	1.7882|1.7882	2.3672|2.3672	0.04322|0.04322	0.0977:0.1768:0.2983:0.4273|0.0977:0.1768:0.2983:0.4273	.|.	791|828;823	A6NKN2|E7ETY1;Q99708	.|.;COM1_HUMAN	F|I	791|823;823;828	ENSP00000382630:C791F|ENSP00000323050:M823I;ENSP00000382628:M823I;ENSP00000354024:M828I	ENSP00000382627:C791F|ENSP00000323050:M823I	C|M	+|+	2|3	0|0	RBBP8|RBBP8	18856104|18856104	0.926000|0.926000	0.31397|0.31397	0.900000|0.900000	0.35374|0.35374	0.994000|0.994000	0.84299|0.84299	-0.055000|-0.055000	0.11807|0.11807	-0.031000|-0.031000	0.13781|0.13781	0.585000|0.585000	0.79938|0.79938	TGC|ATG	.		0.343	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
MEX3C	51320	hgsc.bcm.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	GCCGCCGCG	GCCGCCGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																					p.179_182del		.											.	MEX3C-659	0			c.537_545del						.			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				SO:0001627	intron_variant	51320	exon1			GCCGCCGCCGCCG	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		0	0		22	13	NM_016626	0	0	0	0	0	A1L022|Q9NZE3	In_Frame_Del	DEL	ENST00000591040.1	37																																																																																				.		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
RAX	30062	hgsc.bcm.edu	37	18	56940307	56940307	+	Missense_Mutation	SNP	G	G	T	rs2271733	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr18:56940307G>T	ENST00000334889.3	-	1	318	c.132C>A	c.(130-132)gaC>gaA	p.D44E	RAX_ENST00000256852.7_Missense_Mutation_p.D44E	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	44			D -> E (in dbSNP:rs2271733). {ECO:0000269|PubMed:14662654}.		camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GGATCCCGTCGTCCTTGGTAA	0.746													G|||	980	0.195687	0.1452	0.1571	5008	,	,		10556	0.128		0.3002	False		,,,				2504	0.2536				p.D44E	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.C132A						.	G	GLU/ASP	490,2640		39,412,1114	11.0	9.0	10.0		132	0.1	1.0	18	dbSNP_100	10	1484,4096		212,1060,1518	yes	missense	RAX	NM_013435.2	45	251,1472,2632	TT,TG,GG		26.595,15.655,22.6636	benign	44/347	56940307	1974,6736	1565	2790	4355	SO:0001583	missense	30062	exon1			CCCGTCGTCCTTG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.132C>A	18.37:g.56940307G>T	ENSP00000334813:p.Asp44Glu	0	0		10	7	NM_013435	0	0	0	0	0	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	37	CCDS11972.1	453	0.20741758241758243	75	0.1524390243902439	69	0.19060773480662985	76	0.13286713286713286	233	0.3073878627968338	G	12.43	1.936984	0.34189	0.15655	0.26595	ENSG00000134438	ENST00000256852;ENST00000334889;ENST00000555288	T;D;T	0.87966	0.09;-2.32;0.09	5.56	0.117	0.14652	.	0.213892	0.50627	N	0.000107	T	0.00012	0.0000	N	0.12182	0.205	0.42455	P	0.0072349999999999914	B;B	0.22800	0.075;0.004	B;B	0.23574	0.047;0.009	T	0.06481	-1.0824	9	0.06365	T	0.9	.	0.4639	0.00520	0.2353:0.2064:0.3162:0.2421	rs2271733;rs58469971;rs2271733	44;44	Q86V11;Q9Y2V3	.;RX_HUMAN	E	44	ENSP00000256852:D44E;ENSP00000334813:D44E;ENSP00000450583:D44E	ENSP00000256852:D44E	D	-	3	2	RAX	55091287	0.002000	0.14202	0.999000	0.59377	0.992000	0.81027	-0.819000	0.04462	0.271000	0.22005	0.561000	0.74099	GAC	G|0.801;T|0.199		0.746	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
ZNF236	7776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74637402	74637402	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr18:74637402G>C	ENST00000253159.8	+	22	4111	c.3913G>C	c.(3913-3915)Gac>Cac	p.D1305H	ZNF236_ENST00000320610.9_Missense_Mutation_p.D1307H	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1305					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CTCCTCTACTGACCCAAACGT	0.483																																					p.D1305H		.											.	ZNF236-94	0			c.G3913C						.						87.0	85.0	85.0					18																	74637402		1995	4169	6164	SO:0001583	missense	7776	exon22			TCTACTGACCCAA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3913G>C	18.37:g.74637402G>C	ENSP00000253159:p.Asp1305His	143	0		160	19	NM_007345	0	0	0	0	0	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174310	0.78452	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11712	2.75;2.88	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03043	-1.1079	10	0.72032	D	0.01	.	17.6314	0.88109	0.0:0.0:1.0:0.0	.	1305	Q9UL36	ZN236_HUMAN	H	1305	ENSP00000253159:D1305H;ENSP00000444524:D1305H	ENSP00000253159:D1305H	D	+	1	0	ZNF236	72766390	1.000000	0.71417	0.602000	0.28890	0.002000	0.02628	7.590000	0.82653	2.216000	0.71823	0.557000	0.71058	GAC	.		0.483	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ARID3A	1820	hgsc.bcm.edu	37	19	929741	929741	+	Silent	SNP	C	C	T	rs34967265	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:929741C>T	ENST00000263620.3	+	2	540	c.213C>T	c.(211-213)ggC>ggT	p.G71G	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	71						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCTGCGGGCCTGGGACACC	0.766													c|||	805	0.160743	0.354	0.1167	5008	,	,		8522	0.0873		0.0586	False		,,,				2504	0.1115				p.G71G	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C213T						.	C		862,2694		85,692,1001	3.0	5.0	4.0		213	2.4	0.4	19	dbSNP_126	4	366,7224		12,342,3441	no	coding-synonymous	ARID3A	NM_005224.2		97,1034,4442	TT,TC,CC		4.8221,24.2407,11.0174		71/594	929741	1228,9918	1778	3795	5573	SO:0001819	synonymous_variant	1820	exon2			TGCGGGCCTGGGA	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.213C>T	19.37:g.929741C>T		0	0		15	12	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			C|0.865;T|0.135		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
GRIN3B	116444	hgsc.bcm.edu	37	19	1009485	1009485	+	Missense_Mutation	SNP	C	C	G	rs10401245	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:1009485C>G	ENST00000234389.3	+	9	3035	c.3016C>G	c.(3016-3018)Cag>Gag	p.Q1006E		NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	1006					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCGGCGCGGCCAGCTCCTGGC	0.766													-|||	2765	0.552117	0.6989	0.4539	5008	,	,		7826	0.3571		0.6044	False		,,,				2504	0.5706				p.Q1006E		.											.	GRIN3B-90	0			c.C3016G						.		GLU/GLN	1366,510		516,334,88	1.0	2.0	2.0		3016	2.3	0.0	19	dbSNP_119	2	2951,1521		1041,869,326	no	missense	GRIN3B	NM_138690.1	29	1557,1203,414	GG,GC,CC		34.0116,27.1855,31.9943	benign	1006/1044	1009485	4317,2031	938	2236	3174	SO:0001583	missense	116444	exon9			CGCGGCCAGCTCC		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.3016C>G	19.37:g.1009485C>G	ENSP00000234389:p.Gln1006Glu	0	0		6	6	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	1149	0.5260989010989011	340	0.6910569105691057	183	0.505524861878453	180	0.3146853146853147	446	0.5883905013192612	G	0.015	-1.555403	0.00918	0.728145	0.659884	ENSG00000116032	ENST00000234389	T	0.05382	3.45	4.53	2.3	0.28687	.	1.124140	0.06884	U	0.803130	T	0.00012	0.0000	N	0.02916	-0.46	0.20821	P	0.999849587	B	0.02656	0.0	B	0.01281	0.0	T	0.40869	-0.9540	9	0.02654	T	1	.	15.4334	0.75121	0.0:0.5531:0.4469:0.0	rs10401245;rs59900162	1006	O60391	NMD3B_HUMAN	E	1006	ENSP00000234389:Q1006E	ENSP00000234389:Q1006E	Q	+	1	0	GRIN3B	960485	0.026000	0.19158	0.004000	0.12327	0.116000	0.19942	0.670000	0.25157	0.107000	0.17824	-0.504000	0.04507	CAG	C|0.474;G|0.526		0.766	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000435683.2_Silent_p.G1915G|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000313093.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		2	0		24	12	NM_019112	0	0	0	4	4	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ABHD17A	81926	broad.mit.edu	37	19	1881329	1881329	+	Silent	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:1881329G>A	ENST00000292577.7	-	2	670	c.237C>T	c.(235-237)agC>agT	p.S79S	ABHD17A_ENST00000250974.9_Silent_p.S79S|ABHD17A_ENST00000590661.1_Silent_p.S79S	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	79						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GCTCGCGCTGGCTGTACTGGA	0.701																																					p.S79S		.											.	FAM108A1-90	0			c.C237T						.						25.0	28.0	27.0					19																	1881329		2196	4272	6468	SO:0001819	synonymous_variant	81926	exon2			GCGCTGGCTGTAC	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.237C>T	19.37:g.1881329G>A		45	1		95	5	NM_031213	0	0	152	152	0	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																			.		0.701	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
FUT3	2525	broad.mit.edu;bcgsc.ca	37	19	5844077	5844077	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:5844077C>A	ENST00000303225.6	-	3	1408	c.774G>T	c.(772-774)gaG>gaT	p.E258D	FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000589620.1_Missense_Mutation_p.E258D|FUT3_ENST00000458379.2_Missense_Mutation_p.E258D|FUT3_ENST00000589918.1_Missense_Mutation_p.E258D	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	258					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						TCCACAGCTTCTCGGTGATGT	0.637																																					p.E258D	Esophageal Squamous(82;745 1728 24593 44831)	.											.	FUT3-90	0			c.G774T						.						66.0	67.0	67.0					19																	5844077		2201	4298	6499	SO:0001583	missense	2525	exon3			CAGCTTCTCGGTG		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.774G>T	19.37:g.5844077C>A	ENSP00000305603:p.Glu258Asp	393	1		427	48	NM_001097640	0	0	0	0	0	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	CCDS12153.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473204	0.43942	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.65178	-0.14;-0.14	2.29	2.29	0.28610	.	0.000000	0.64402	D	0.000018	T	0.82226	0.4991	H	0.94306	3.52	0.36578	D	0.873352	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.87718	0.2571	10	0.87932	D	0	.	10.7145	0.46005	0.0:1.0:0.0:0.0	.	258;258;258;258	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	D	258	ENSP00000305603:E258D;ENSP00000416443:E258D	ENSP00000305603:E258D	E	-	3	2	FUT3	5795077	1.000000	0.71417	0.744000	0.31058	0.211000	0.24417	2.185000	0.42584	1.221000	0.43506	0.194000	0.17425	GAG	.		0.637	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		0	0		8	8	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
CACNA1A	773	hgsc.bcm.edu	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644				p.H2220H		.											.	CACNA1A-67	0			c.T6660C						.		,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773	exon46			CGGGGGATGGTGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G		4	0		14	12	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			A|0.360;G|0.640		0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000602238.1_5'Flank|RINL_ENST00000598904.1_Missense_Mutation_p.P288L|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	0	0		25	25	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
ZNF221	7638	ucsc.edu;bcgsc.ca	37	19	44470147	44470147	+	Missense_Mutation	SNP	G	G	A	rs16976937	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:44470147G>A	ENST00000251269.5	+	6	821	c.493G>A	c.(493-495)Gtg>Atg	p.V165M	ZNF221_ENST00000587682.1_Missense_Mutation_p.V165M|ZNF221_ENST00000592350.1_Missense_Mutation_p.V165M	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	165			V -> M (in dbSNP:rs16976937).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TATAAGTCACGTGCAACAGAA	0.418													G|||	391	0.0780751	0.2057	0.0231	5008	,	,		23058	0.0119		0.0258	False		,,,				2504	0.0665				p.V165M		.											.	ZNF221-91	0			c.G493A						.	G	MET/VAL	728,3678	300.4+/-286.3	73,582,1548	134.0	114.0	121.0		493	0.2	0.0	19	dbSNP_123	121	192,8408	84.8+/-147.2	1,190,4109	yes	missense	ZNF221	NM_013359.2	21	74,772,5657	AA,AG,GG		2.2326,16.5229,7.0737	benign	165/618	44470147	920,12086	2203	4300	6503	SO:0001583	missense	7638	exon6			AGTCACGTGCAAC	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.493G>A	19.37:g.44470147G>A	ENSP00000251269:p.Val165Met	194	2		205	114	NM_013359	0	0	0	0	0	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	CCDS12633.1	95	0.043498168498168496	65	0.13211382113821138	6	0.016574585635359115	2	0.0034965034965034965	22	0.029023746701846966	g	11.62	1.694269	0.30052	0.165229	0.022326	ENSG00000159905	ENST00000251269	T	0.05786	3.39	2.59	0.173	0.15036	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.53885	0.963	P	0.47603	0.551	T	0.48198	-0.9056	8	0.72032	D	0.01	.	4.087	0.09951	0.6595:0.2076:0.1329:0.0	rs16976937;rs52800071;rs16976937	165	Q9UK13	ZN221_HUMAN	M	165	ENSP00000251269:V165M	ENSP00000251269:V165M	V	+	1	0	ZNF221	49161987	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.307000	0.02733	-0.159000	0.11021	-0.379000	0.06801	GTG	G|0.935;A|0.065		0.418	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		0	0		4	4	NM_145807	0	0	0	2	2	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
PPP1R15A	23645	bcgsc.ca	37	19	49377436	49377436	+	Missense_Mutation	SNP	G	G	C	rs556052	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:49377436G>C	ENST00000200453.5	+	2	1215	c.946G>C	c.(946-948)Gct>Cct	p.A316P		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	316	Glu-rich.		A -> P (in dbSNP:rs556052). {ECO:0000269|PubMed:14702039}.		apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		TGAGGTCAAGGCTTTGGGGGC	0.622													G|||	2132	0.425719	0.7761	0.3329	5008	,	,		18799	0.1151		0.336	False		,,,				2504	0.4305				p.A316P		.											.	PPP1R15A-226	0			c.G946C						.	G	PRO/ALA	3190,1216	705.8+/-407.3	1158,874,171	73.0	78.0	76.0		946	1.2	0.0	19	dbSNP_83	76	2910,5690	452.5+/-363.0	490,1930,1880	yes	missense	PPP1R15A	NM_014330.3	27	1648,2804,2051	CC,CG,GG		33.8372,27.5987,46.9014	possibly-damaging	316/675	49377436	6100,6906	2203	4300	6503	SO:0001583	missense	23645	exon2			GTCAAGGCTTTGG	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.946G>C	19.37:g.49377436G>C	ENSP00000200453:p.Ala316Pro	140	0		123	6	NM_014330	1	0	132	133	0	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	805	0.3685897435897436	358	0.7276422764227642	123	0.3397790055248619	71	0.12412587412587413	253	0.3337730870712401	G	8.601	0.886951	0.17540	0.724013	0.338372	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.05319	3.46	4.68	1.24	0.21308	.	1.663540	0.03882	N	0.277310	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.34675	-0.9819	9	0.29301	T	0.29	2.0956	7.9394	0.29950	0.147:0.1372:0.7158:0.0	rs556052;rs3170540;rs3745700;rs556052	316	O75807	PR15A_HUMAN	P	316;156;274	ENSP00000200453:A316P	ENSP00000200453:A316P	A	+	1	0	PPP1R15A	54069248	0.070000	0.21116	0.000000	0.03702	0.000000	0.00434	2.920000	0.48844	-0.076000	0.12775	-1.761000	0.00669	GCT	G|0.500;C|0.500		0.622	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
HAS1	3036	hgsc.bcm.edu	37	19	52223026	52223026	+	Silent	SNP	C	C	A	rs61736497	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:52223026C>A	ENST00000222115.1	-	2	169	c.135G>T	c.(133-135)ccG>ccT	p.P45P	HAS1_ENST00000594621.1_5'Flank|HAS1_ENST00000540069.2_Silent_p.P44P|HAS1_ENST00000601714.1_Silent_p.P52P	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	45					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CGGAGGCCAGCGGCACCCCGG	0.711													c|||	271	0.0541134	0.1891	0.0202	5008	,	,		12432	0.0		0.003	False		,,,				2504	0.0041				p.P45P	NSCLC(132;636 2450 45807 47979)	.											.	HAS1-92	0			c.G135T						.	C		634,3594		36,562,1516	5.0	7.0	6.0		135	-6.3	1.0	19	dbSNP_129	6	8,8282		0,8,4137	no	coding-synonymous	HAS1	NM_001523.2		36,570,5653	AA,AC,CC		0.0965,14.9953,5.1286		45/579	52223026	642,11876	2114	4145	6259	SO:0001819	synonymous_variant	3036	exon2			GGCCAGCGGCACC	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.135G>T	19.37:g.52223026C>A		2	0		53	17	NM_001523	0	0	0	0	0	Q14470|Q9NS49	Silent	SNP	ENST00000222115.1	37	CCDS12838.1																																																																																			C|0.946;A|0.054		0.711	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
HSPBP1	23640	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	55785775	55785775	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:55785775C>A	ENST00000255631.5	-	5	941	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	HSPBP1_ENST00000433386.2_Missense_Mutation_p.A211S|HSPBP1_ENST00000587922.1_Missense_Mutation_p.A211S|HSPBP1_ENST00000376343.3_Intron	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	214					negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CAGGAGATGGCGAAGAGGGCC	0.726																																					p.A211S		.											.	HSPBP1-90	0			c.G631T						.						10.0	9.0	9.0					19																	55785775		2147	4228	6375	SO:0001583	missense	23640	exon4			AGATGGCGAAGAG		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.631G>T	19.37:g.55785775C>A	ENSP00000255631:p.Ala211Ser	13	0		37	20	NM_012267	0	0	0	0	0	B3KQP0|B4DG11|O95351|Q6ZNU5	Missense_Mutation	SNP	ENST00000255631.5	37	CCDS33111.1	.	.	.	.	.	.	.	.	.	.	C	34	5.391091	0.95988	.	.	ENSG00000133265	ENST00000433386;ENST00000255631	T;T	0.60424	0.19;0.19	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	M	0.80508	2.5	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.80246	-0.1462	10	0.72032	D	0.01	-24.662	18.7345	0.91749	0.0:1.0:0.0:0.0	.	214;257	Q9NZL4;B4DG11	HPBP1_HUMAN;.	S	211	ENSP00000398244:A211S;ENSP00000255631:A211S	ENSP00000255631:A211S	A	-	1	0	HSPBP1	60477587	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.305000	0.72805	2.813000	0.96785	0.655000	0.94253	GCC	.		0.726	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
ZNF579	163033	hgsc.bcm.edu	37	19	56090493	56090493	+	Silent	SNP	A	A	C	rs12974617	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr19:56090493A>C	ENST00000325421.4	-	2	541	c.513T>G	c.(511-513)ccT>ccG	p.P171P	CTD-2537I9.5_ENST00000589396.1_lincRNA	NM_152600.2	NP_689813.2	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		GCCACGTCTCAGGCCACGCTG	0.771													A|||	891	0.177915	0.1808	0.196	5008	,	,		8843	0.1825		0.172	False		,,,				2504	0.1626				p.P171P		.											.	ZNF579-90	0			c.T513G						.	A		405,2995		16,373,1311	3.0	3.0	3.0		513	-2.0	0.0	19	dbSNP_121	3	947,5815		53,841,2487	no	coding-synonymous	ZNF579	NM_152600.2		69,1214,3798	CC,CA,AA		14.0047,11.9118,13.3045		171/563	56090493	1352,8810	1700	3381	5081	SO:0001819	synonymous_variant	163033	exon2			CGTCTCAGGCCAC	AK092772	CCDS12927.1	19q13.42	2013-09-20			ENSG00000218891	ENSG00000218891		"""Zinc fingers, C2H2-type"""	26646	protein-coding gene	gene with protein product							Standard	NM_152600		Approved	FLJ35453	uc002qlh.3	Q8NAF0	OTTHUMG00000180857	ENST00000325421.4:c.513T>G	19.37:g.56090493A>C		0	0		6	6	NM_152600	0	0	0	2	2		Silent	SNP	ENST00000325421.4	37	CCDS12927.1																																																																																			A|0.837;C|0.163		0.771	ZNF579-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453348.1	NM_152600	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	0	0		8	7	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
ALK	238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	29754831	29754831	+	Silent	SNP	G	G	A	rs534481890		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:29754831G>A	ENST00000389048.3	-	4	2010	c.1104C>T	c.(1102-1104)caC>caT	p.H368H	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	368	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CAGCCTCGTTGTGGGGCAGCA	0.557			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.H368H		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK-3833	0			c.C1104T						.						89.0	86.0	87.0					2																	29754831		2203	4300	6503	SO:0001819	synonymous_variant	238	exon4	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CTCGTTGTGGGGC	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1104C>T	2.37:g.29754831G>A		160	0		158	19	NM_004304	0	0	0	0	0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																			.		0.557	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
AMER3	205147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131519854	131519854	+	Missense_Mutation	SNP	C	C	T	rs200636300		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:131519854C>T	ENST00000423981.1	+	2	319	c.209C>T	c.(208-210)gCg>gTg	p.A70V	AMER3_ENST00000321420.4_Missense_Mutation_p.A70V	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	70					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										AACAAAGGGGCGCAGCTGGAC	0.632																																					p.A70V		.											.	.	0			c.C209T						.						18.0	29.0	25.0					2																	131519854		2195	4294	6489	SO:0001583	missense	205147	exon2			AAGGGGCGCAGCT	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.209C>T	2.37:g.131519854C>T	ENSP00000392700:p.Ala70Val	84	0		75	45	NM_152698	0	0	0	0	0	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	C	11.15	1.555149	0.27739	.	.	ENSG00000178171	ENST00000321420;ENST00000431758;ENST00000458606;ENST00000423981	T;T	0.42900	0.96;0.96	5.39	-5.1	0.02911	.	0.803692	0.11384	N	0.569471	T	0.16769	0.0403	N	0.17082	0.46	0.09310	N	1	B	0.24533	0.105	B	0.12156	0.007	T	0.16541	-1.0399	10	0.21014	T	0.42	.	1.8922	0.03250	0.1147:0.2328:0.2261:0.4264	.	70	Q8N944	F123C_HUMAN	V	70	ENSP00000314914:A70V;ENSP00000392700:A70V	ENSP00000314914:A70V	A	+	2	0	FAM123C	131236324	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.078000	0.11375	-1.407000	0.02043	0.561000	0.74099	GCG	.		0.632	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
ANKRD30BL	554226	broad.mit.edu;bcgsc.ca	37	2	132919167	132919167	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:132919167C>A	ENST00000409867.1	-	1	361	c.112G>T	c.(112-114)Gat>Tat	p.D38Y	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	38										endometrium(1)|kidney(3)	4						TTCCTGAGATCCCCATGGTGA	0.577																																					.		.											.	.	0			.						.																																			SO:0001583	missense	554226	.			TGAGATCCCCATG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.112G>T	2.37:g.132919167C>A	ENSP00000386398:p.Asp38Tyr	325	0		325	33	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	9.219	1.032831	0.19590	.	.	ENSG00000163046	ENST00000409867	T	0.32515	1.45	0.484	0.484	0.16825	.	.	.	.	.	T	0.42426	0.1202	.	.	.	0.42978	D	0.994459	.	.	.	.	.	.	T	0.48456	-0.9034	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	Y	38	ENSP00000386398:D38Y	ENSP00000295181:D38Y	D	-	1	0	ANKRD30BL	132635637	0.784000	0.28713	0.022000	0.16811	0.014000	0.08584	1.242000	0.32755	0.506000	0.28125	0.298000	0.19748	GAT	.		0.577	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																					.		.											.	.	0			.						.						27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824	.			CAGACAGGAGGGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		52	3		114	35	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.500;C|0.500		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	133014612	133014612	+	Intron	SNP	A	A	C	rs199913868|rs74853538	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:133014612A>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGAGGGAGGTACCGCAGCGAC	0.716																																					.		.											.	.	0			.						.						27.0	46.0	40.0					2																	133014612		1553	3577	5130	SO:0001627	intron_variant	100313824	.			GGAGGTACCGCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+489T>G	2.37:g.133014612A>C		55	3		127	38	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				A|0.333;C|0.667		0.716	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	152484133	152484133	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:152484133G>T	ENST00000172853.10	-	65	9465	c.9318C>A	c.(9316-9318)agC>agA	p.S3106R	NEB_ENST00000603639.1_Missense_Mutation_p.S3349R|NEB_ENST00000409198.1_Missense_Mutation_p.S3106R|NEB_ENST00000397345.3_Missense_Mutation_p.S3349R|NEB_ENST00000427231.2_Missense_Mutation_p.S3349R|NEB_ENST00000604864.1_Missense_Mutation_p.S3349R			P20929	NEBU_HUMAN	nebulin	3106					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTCCACATCGCTGACTAAGG	0.537																																					p.S3349R		.											.	NEB-145	0			c.C10047A						.						328.0	323.0	325.0					2																	152484133		2130	4222	6352	SO:0001583	missense	4703	exon69			CACATCGCTGACT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9318C>A	2.37:g.152484133G>T	ENSP00000172853:p.Ser3106Arg	304	0		373	32	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	14.45	2.539592	0.45176	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.58	-5.18	0.02840	.	0.040861	0.85682	D	0.000000	T	0.65322	0.2680	M	0.85945	2.785	0.80722	D	1	D	0.69078	0.997	D	0.65684	0.937	T	0.74256	-0.3724	10	0.87932	D	0	.	16.2775	0.82651	0.4856:0.0:0.5144:0.0	.	3106	P20929	NEBU_HUMAN	R	3106;3349;3349;3106	ENSP00000386259:S3106R;ENSP00000380505:S3349R;ENSP00000416578:S3349R;ENSP00000172853:S3106R	ENSP00000172853:S3106R	S	-	3	2	NEB	152192379	0.932000	0.31603	0.516000	0.27786	0.249000	0.25844	0.145000	0.16157	-0.772000	0.04602	-1.074000	0.02243	AGC	.		0.537	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
KCNH7	90134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	163693261	163693261	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:163693261A>C	ENST00000332142.5	-	2	192	c.93T>G	c.(91-93)atT>atG	p.I31M	KCNH7_ENST00000328032.4_Missense_Mutation_p.I31M	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	31					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TGGCATTTGCAATGATAAATT	0.388																																					p.I31M	GBM(196;1492 2208 17507 24132 45496)	.											.	KCNH7-95	0			c.T93G						.						51.0	47.0	48.0					2																	163693261		2203	4300	6503	SO:0001583	missense	90134	exon2			ATTTGCAATGATA	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.93T>G	2.37:g.163693261A>C	ENSP00000331727:p.Ile31Met	64	0		61	41	NM_033272	0	0	0	0	0	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.355022	0.61293	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99695	-6.43;-6.43	6.08	2.44	0.29823	PAS (1);	0.000000	0.85682	D	0.000000	D	0.99554	0.9840	M	0.80746	2.51	0.38799	D	0.955164	D;D	0.69078	0.997;0.987	D;D	0.87578	0.998;0.991	D	0.99764	1.1022	10	0.87932	D	0	.	9.2475	0.37536	0.7961:0.0:0.2039:0.0	.	31;31	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	M	31	ENSP00000331727:I31M;ENSP00000333781:I31M	ENSP00000333781:I31M	I	-	3	3	KCNH7	163401507	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.080000	0.41586	0.190000	0.20209	0.533000	0.62120	ATT	.		0.388	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	197122592	197122592	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:197122592C>A	ENST00000260983.3	-	18	3556	c.3374G>T	c.(3373-3375)gGa>gTa	p.G1125V	HECW2_ENST00000409111.1_Missense_Mutation_p.G769V|AC020571.3_ENST00000430904.1_RNA|AC020571.3_ENST00000433933.1_RNA|AC020571.3_ENST00000605907.1_RNA	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1125					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G1125E(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCGCACCAATCCTGGAGTCCC	0.418																																					p.G1125V		.											.	HECW2-668	1	Substitution - Missense(1)	lung(1)	c.G3374T						.						130.0	109.0	116.0					2																	197122592		2203	4300	6503	SO:0001583	missense	57520	exon18			ACCAATCCTGGAG	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3374G>T	2.37:g.197122592C>A	ENSP00000260983:p.Gly1125Val	93	0		116	9	NM_020760	0	0	0	0	0	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320108	0.81469	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.86097	-2.07;-2.07	5.55	5.55	0.83447	.	0.117087	0.64402	D	0.000018	D	0.88396	0.6425	L	0.59436	1.845	0.80722	D	1	D	0.59767	0.986	P	0.53954	0.738	D	0.89140	0.3516	10	0.87932	D	0	.	16.5241	0.84326	0.0:1.0:0.0:0.0	.	1125	Q9P2P5	HECW2_HUMAN	V	769;1125	ENSP00000386775:G769V;ENSP00000260983:G1125V	ENSP00000260983:G1125V	G	-	2	0	HECW2	196830837	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.049000	0.57397	2.890000	0.99128	0.585000	0.79938	GGA	.		0.418	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
SF3B1	23451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198281581	198281581	+	Missense_Mutation	SNP	C	C	A	rs139823279		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:198281581C>A	ENST00000335508.6	-	6	641	c.550G>T	c.(550-552)Gtc>Ttc	p.V184F		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	184					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCTCCATTGACGACTTTTAGT	0.428			Mis		myelodysplastic syndrome																																p.V184F		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.G550T						.						176.0	170.0	172.0					2																	198281581		2203	4300	6503	SO:0001583	missense	23451	exon6			CATTGACGACTTT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.550G>T	2.37:g.198281581C>A	ENSP00000335321:p.Val184Phe	81	0		60	35	NM_012433	0	0	2	19	17	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299923	0.81136	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	L	0.52573	1.65	0.80722	D	1	P	0.36944	0.574	B	0.32677	0.15	T	0.58526	-0.7621	9	0.54805	T	0.06	.	19.0485	0.93032	0.0:1.0:0.0:0.0	.	184	O75533	SF3B1_HUMAN	F	184	.	ENSP00000335321:V184F	V	-	1	0	SF3B1	197989826	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.562000	0.82300	2.736000	0.93811	0.579000	0.79373	GTC	C|1.000;T|0.000		0.428	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
ADAM23	8745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207454139	207454139	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:207454139C>A	ENST00000264377.3	+	21	2187	c.1859C>A	c.(1858-1860)gCa>gAa	p.A620E	ADAM23_ENST00000374416.1_Missense_Mutation_p.A620E|ADAM23_ENST00000374415.3_Missense_Mutation_p.A620E	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	620					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AAAGAGGCTGCAGGGTCTGAC	0.438																																					p.A620E	Melanoma(194;1127 2130 19620 24042 27855)	.											.	ADAM23-228	0			c.C1859A						.						61.0	59.0	59.0					2																	207454139		2203	4300	6503	SO:0001583	missense	8745	exon21			AGGCTGCAGGGTC	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1859C>A	2.37:g.207454139C>A	ENSP00000264377:p.Ala620Glu	73	0		66	47	NM_003812	0	0	0	0	0	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426987	0.43122	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.20598	2.06;2.06;2.06	5.72	5.72	0.89469	ADAM, cysteine-rich (2);	0.452344	0.20464	N	0.091823	T	0.19248	0.0462	N	0.21142	0.635	0.40845	D	0.983709	B	0.14012	0.009	B	0.25759	0.063	T	0.08371	-1.0725	10	0.25106	T	0.35	.	19.8709	0.96851	0.0:1.0:0.0:0.0	.	620	O75077	ADA23_HUMAN	E	620;620;514;620	ENSP00000264377:A620E;ENSP00000363537:A620E;ENSP00000363536:A620E	ENSP00000264377:A620E	A	+	2	0	ADAM23	207162384	1.000000	0.71417	0.966000	0.40874	0.965000	0.64279	3.912000	0.56386	2.698000	0.92095	0.591000	0.81541	GCA	.		0.438	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	215866333	215866333	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:215866333C>A	ENST00000272895.7	-	21	3031	c.2812G>T	c.(2812-2814)Gaa>Taa	p.E938*	ABCA12_ENST00000389661.4_Nonsense_Mutation_p.E620*	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	938					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.E938K(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTCTCCATTTCATCTATGGTT	0.388																																					p.E938X	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12-99	1	Substitution - Missense(1)	central_nervous_system(1)	c.G2812T						.						188.0	179.0	182.0					2																	215866333		2203	4300	6503	SO:0001587	stop_gained	26154	exon21			CCATTTCATCTAT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2812G>T	2.37:g.215866333C>A	ENSP00000272895:p.Glu938*	125	0		116	7	NM_173076	0	0	0	0	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Nonsense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	40	8.232141	0.98717	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	.	.	.	5.77	4.9	0.64082	.	0.083518	0.51477	D	0.000092	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	14.8116	0.70000	0.0:0.9309:0.0:0.0691	.	.	.	.	X	938;620	.	ENSP00000272895:E938X	E	-	1	0	ABCA12	215574578	0.990000	0.36364	0.951000	0.38953	0.979000	0.70002	2.891000	0.48617	1.451000	0.47736	0.561000	0.74099	GAA	.		0.388	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217332761	217332761	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:217332761G>T	ENST00000357276.4	+	14	2566	c.2236G>T	c.(2236-2238)Gag>Tag	p.E746*	SMARCAL1_ENST00000358207.5_Nonsense_Mutation_p.E746*	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	746	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCAAGAGCTTGAGAGAAAGGT	0.448									Schimke Immuno-Osseous Dysplasia																												p.E746X		.											.	SMARCAL1-293	0			c.G2236T						.						119.0	113.0	115.0					2																	217332761		2203	4300	6503	SO:0001587	stop_gained	50485	exon14	Familial Cancer Database	SIOD	GAGCTTGAGAGAA	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2236G>T	2.37:g.217332761G>T	ENSP00000349823:p.Glu746*	69	0		70	49	NM_014140	0	0	0	0	0	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Nonsense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	39	7.708894	0.98447	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	.	.	.	4.85	4.85	0.62838	.	0.226759	0.44285	D	0.000475	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-28.4524	12.5871	0.56424	0.0821:0.0:0.9179:0.0	.	.	.	.	X	746;746;588	.	ENSP00000349823:E746X	E	+	1	0	SMARCAL1	217041006	1.000000	0.71417	0.957000	0.39632	0.270000	0.26580	3.255000	0.51484	2.529000	0.85273	0.655000	0.94253	GAG	.		0.448	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
PPP1R7	5510	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	242092956	242092956	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:242092956G>A	ENST00000234038.6	+	2	592	c.118G>A	c.(118-120)Gtg>Atg	p.V40M	PPP1R7_ENST00000406106.3_Missense_Mutation_p.V40M|PPP1R7_ENST00000272983.8_Intron|PPP1R7_ENST00000402734.1_Intron|PPP1R7_ENST00000401987.1_Intron|PPP1R7_ENST00000407025.1_Missense_Mutation_p.V40M|PPP1R7_ENST00000404405.3_Missense_Mutation_p.V40M	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	40					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		CAGTGGCATCGTGGCCGACCT	0.572																																					p.V40M	NSCLC(62;446 1299 5417 11238 27640)	.											.	PPP1R7-660	0			c.G118A						.						110.0	102.0	104.0					2																	242092956		2203	4300	6503	SO:0001583	missense	5510	exon2			GGCATCGTGGCCG	AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.118G>A	2.37:g.242092956G>A	ENSP00000234038:p.Val40Met	125	0		185	10	NM_002712	0	0	69	78	9	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Missense_Mutation	SNP	ENST00000234038.6	37	CCDS2546.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747150	0.49257	.	.	ENSG00000115685	ENST00000438799;ENST00000407025;ENST00000234038;ENST00000404405;ENST00000439916;ENST00000406106;ENST00000427172	T;T;T;T;T;T;T	0.52983	0.78;0.64;0.64;0.87;1.07;1.08;1.23	4.61	4.61	0.57282	.	0.215289	0.38548	N	0.001641	T	0.45657	0.1353	N	0.08118	0	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.999;0.998	P;P;P;P	0.62740	0.807;0.735;0.906;0.807	T	0.50996	-0.8761	10	0.34782	T	0.22	-28.98	15.6297	0.76893	0.0:0.0:1.0:0.0	.	24;40;40;40	C9JD73;Q15435;Q15435-3;B5MBZ8	.;PP1R7_HUMAN;.;.	M	24;40;40;40;40;40;49	ENSP00000396376:V24M;ENSP00000385657:V40M;ENSP00000234038:V40M;ENSP00000385498:V40M;ENSP00000409719:V40M;ENSP00000385022:V40M;ENSP00000397985:V49M	ENSP00000234038:V40M	V	+	1	0	PPP1R7	241741629	1.000000	0.71417	0.422000	0.26621	0.010000	0.07245	4.464000	0.60134	2.115000	0.64714	0.561000	0.74099	GTG	.		0.572	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257244.4	NM_002712	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		0	0		9	9	NM_004609	0	0	0	1	1	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	PANK2_ENST00000497424.1_Intron|RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		8	8	NM_153638	0	0	0	2	2	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
SMOX	54498	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	4168035	4168035	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:4168035T>C	ENST00000305958.4	+	7	1874	c.1649T>C	c.(1648-1650)cTc>cCc	p.L550P	SMOX_ENST00000278795.3_Missense_Mutation_p.L527P|SMOX_ENST00000346595.2_Missense_Mutation_p.L185P|SMOX_ENST00000379460.2_Missense_Mutation_p.L550P|SMOX_ENST00000339123.6_Missense_Mutation_p.L497P	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	550					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	TACCGAGACCTCTTCCAGCAG	0.637																																					p.L580P		.											.	SMOX-153	0			c.T1739C						.						63.0	56.0	58.0					20																	4168035		2203	4300	6503	SO:0001583	missense	54498	exon8			GAGACCTCTTCCA	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1649T>C	20.37:g.4168035T>C	ENSP00000307252:p.Leu550Pro	166	1		172	13	NM_001270691	0	0	42	53	11	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	37	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355291	0.61293	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000346595;ENST00000379460;ENST00000457205	T;T;T;T;T;T	0.52057	1.37;1.77;1.28;0.68;1.77;1.27	5.09	5.09	0.68999	.	0.876172	0.10166	N	0.707688	T	0.52821	0.1758	N	0.12182	0.205	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;1.0;0.991;0.999;0.998;1.0	P;D;D;D;D;D	0.87578	0.903;0.998;0.955;0.986;0.955;0.997	T	0.52815	-0.8525	10	0.66056	D	0.02	-23.0749	12.8378	0.57784	0.0:0.0:0.0:1.0	.	474;580;185;550;497;527	B4DE63;Q9NWM0-6;Q9NWM0-3;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;.;SMOX_HUMAN;.;.	P	497;550;527;185;550;437	ENSP00000344595:L497P;ENSP00000307252:L550P;ENSP00000278795:L527P;ENSP00000341775:L185P;ENSP00000368773:L550P;ENSP00000407269:L437P	ENSP00000278795:L527P	L	+	2	0	SMOX	4116035	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.604000	0.67626	1.912000	0.55364	0.455000	0.32223	CTC	.		0.637	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
LRRN4	164312	hgsc.bcm.edu	37	20	6033033	6033033	+	Missense_Mutation	SNP	G	G	A	rs6107751	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:6033033G>A	ENST00000378858.4	-	2	637	c.413C>T	c.(412-414)cCg>cTg	p.P138L		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	138			P -> L (in dbSNP:rs6107751). {ECO:0000269|PubMed:15489334}.		long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GGTGCACGGCGGCAGAGCGGC	0.781													G|||	565	0.112819	0.053	0.1844	5008	,	,		11700	0.0972		0.173	False		,,,				2504	0.0971				p.P138L		.											.	LRRN4-93	0			c.C413T						.	G	LEU/PRO	120,2142		3,114,1014	2.0	2.0	2.0		413	4.2	0.8	20	dbSNP_114	2	724,4820		32,660,2080	no	missense	LRRN4	NM_152611.3	98	35,774,3094	AA,AG,GG		13.0592,5.305,10.8122	possibly-damaging	138/741	6033033	844,6962	1131	2772	3903	SO:0001583	missense	164312	exon2			CACGGCGGCAGAG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.413C>T	20.37:g.6033033G>A	ENSP00000368135:p.Pro138Leu	0	0		7	5	NM_152611	0	0	0	0	0	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	295	0.13507326007326007	29	0.05894308943089431	65	0.17955801104972377	62	0.10839160839160839	139	0.18337730870712401	G	16.04	3.009170	0.54361	0.05305	0.130592	ENSG00000125872	ENST00000378858	T	0.09073	3.02	5.09	4.15	0.48705	.	0.091120	0.46758	D	0.000263	T	0.00039	0.0001	M	0.76328	2.33	0.22762	P	0.99876042	D;P	0.59767	0.986;0.809	P;P	0.57960	0.83;0.787	T	0.04915	-1.0918	9	0.87932	D	0	-27.3795	13.7965	0.63175	0.0747:0.0:0.9253:0.0	rs6107751;rs17852455	138;138	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	L	138	ENSP00000368135:P138L	ENSP00000368135:P138L	P	-	2	0	LRRN4	5981033	0.997000	0.39634	0.763000	0.31416	0.008000	0.06430	2.667000	0.46808	1.278000	0.44430	0.491000	0.48974	CCG	G|0.864;A|0.136		0.781	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
RBM12	10137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	34241123	34241123	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:34241123G>T	ENST00000374114.3	-	3	2385	c.2122C>A	c.(2122-2124)Ctg>Atg	p.L708M	RBM12_ENST00000359646.1_Missense_Mutation_p.L708M|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.L708M|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397446.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	708	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			CCTACAGTCAGGAAGGCATGC	0.522																																					p.L708M		.											.	RBM12-93	0			c.C2122A						.						57.0	54.0	55.0					20																	34241123		2195	4284	6479	SO:0001583	missense	10137	exon2			CAGTCAGGAAGGC	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2122C>A	20.37:g.34241123G>T	ENSP00000363228:p.Leu708Met	83	0		83	7	NM_001198840	0	0	20	20	0	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	5.240	0.229678	0.09916	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.19806	2.12;2.12;2.12	5.01	-0.95	0.10372	.	0.000000	0.64402	D	0.000012	T	0.08980	0.0222	N	0.24115	0.695	0.23555	N	0.997423	P	0.35982	0.531	B	0.33042	0.157	T	0.18493	-1.0335	10	0.30078	T	0.28	-3.9993	2.3122	0.04189	0.4335:0.119:0.3265:0.121	.	708	Q9NTZ6	RBM12_HUMAN	M	708;708;708;507	ENSP00000363228:L708M;ENSP00000352668:L708M;ENSP00000363217:L708M	ENSP00000339879:L507M	L	-	1	2	RBM12	33704537	1.000000	0.71417	0.614000	0.29051	0.100000	0.18952	0.797000	0.26999	-0.312000	0.08741	-0.251000	0.11542	CTG	.		0.522	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
CDH22	64405	hgsc.bcm.edu;broad.mit.edu	37	20	44803312	44803312	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:44803312C>T	ENST00000372262.3	-	11	2720	c.2320G>A	c.(2320-2322)Gcc>Acc	p.A774T	CDH22_ENST00000537909.1_Missense_Mutation_p.A774T	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	774					brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CCCTCGAAGGCGTAGGTCTGG	0.682																																					p.A774T		.											.	CDH22-95	0			c.G2320A						.						8.0	8.0	8.0					20																	44803312		2131	4203	6334	SO:0001583	missense	64405	exon12			CGAAGGCGTAGGT	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.2320G>A	20.37:g.44803312C>T	ENSP00000361336:p.Ala774Thr	24	0		108	13	NM_021248	0	0	0	0	0	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742724	0.89573	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.78707	-1.2;-1.2	3.82	2.85	0.33270	Cadherin, cytoplasmic domain (1);	0.066212	0.64402	N	0.000014	D	0.86838	0.6029	M	0.81179	2.53	0.48040	D	0.999572	D	0.89917	1.0	D	0.91635	0.999	D	0.87308	0.2310	10	0.72032	D	0.01	.	11.6424	0.51242	0.1791:0.8209:0.0:0.0	.	774	Q9UJ99	CAD22_HUMAN	T	774	ENSP00000361336:A774T;ENSP00000437790:A774T	ENSP00000361336:A774T	A	-	1	0	CDH22	44236719	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.567000	0.67378	0.794000	0.33899	-0.188000	0.12872	GCC	.		0.682	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
LAMA5	3911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60900600	60900600	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr20:60900600C>A	ENST00000252999.3	-	41	5367	c.5301G>T	c.(5299-5301)ggG>ggT	p.G1767G		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1767	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCGGAAGTTCCCCTGTGGGT	0.627																																					p.G1767G		.											.	LAMA5-93	0			c.G5301T						.						53.0	40.0	44.0					20																	60900600		2202	4298	6500	SO:0001819	synonymous_variant	3911	exon41			GAAGTTCCCCTGT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5301G>T	20.37:g.60900600C>A		166	0		197	42	NM_005560	0	0	0	0	0	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																			.		0.627	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
LZTR1	8216	broad.mit.edu	37	22	21343966	21344002	+	Splice_Site	DEL	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	-	rs138025454|rs4822786|rs372705680|rs544346603|rs7410444|rs398036571|rs541944601|rs550797478|rs59718704	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr22:21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	ENST00000215739.8	+	7	1005_1010	c.646_651delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	c.(646-651)gaggagdel	p.EE216fs	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.EE197fs	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	216					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCTGCTgggaggaggtgaggggcgtggggagccagggcgcaggtagaggaggtga	0.662														897	0.179113	0.1354	0.1859	5008	,	,		20879	0.2907		0.166	False		,,,				2504	0.1319				p.216_217del		.											.	LZTR1-280	0			c.646_651del						.																																			SO:0001630	splice_region_variant	8216	exon7			TGCTGGGAGGAGG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.651+1GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA>-	22.37:g.21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA		26	0		30	8	NM_006767	0	0	0	0	0	Q14776|Q20WK0	In_Frame_Del	DEL	ENST00000215739.8	37	CCDS33606.1																																																																																			.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Frame_Shift_Del
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		223	0		198	47	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	224	0		195	20	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
PRR34	55267	hgsc.bcm.edu	37	22	46449678	46449678	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr22:46449678G>A	ENST00000396008.2	-	1	346	c.296C>T	c.(295-297)gCc>gTc	p.A99V	RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.A99V|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|FLJ27365_ENST00000381051.2_5'Flank|RP6-109B7.3_ENST00000451166.1_RNA			Q9NV39	PRR34_HUMAN		99													Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		AGGCAGCCTGGCACCGTGCCA	0.746																																					p.A99V		.											.	C22orf26-90	0			c.C296T						.						2.0	4.0	3.0					22																	46449678		1437	3215	4652	SO:0001583	missense	55267	exon1			AGCCTGGCACCGT																												ENST00000396008.2:c.296C>T	22.37:g.46449678G>A	ENSP00000379329:p.Ala99Val	0	0		12	11	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041705	0.55003	.	.	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.38401	1.14;1.14	3.25	3.25	0.37280	.	.	.	.	.	T	0.37433	0.1003	N	0.08118	0	0.25218	N	0.989923	D	0.76494	0.999	D	0.80764	0.994	T	0.20240	-1.0281	9	0.87932	D	0	.	10.2769	0.43515	0.0:0.0:1.0:0.0	.	99	Q9NV39	CV026_HUMAN	V	99	ENSP00000379329:A99V;ENSP00000327764:A99V	ENSP00000327764:A99V	A	-	2	0	C22orf26	44828342	1.000000	0.71417	0.993000	0.49108	0.810000	0.45777	3.761000	0.55242	2.119000	0.64992	0.650000	0.86243	GCC	.		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
BTD	686	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	15683552	15683552	+	Missense_Mutation	SNP	C	C	A	rs574575635		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:15683552C>A	ENST00000303498.5	+	3	556	c.447C>A	c.(445-447)ttC>ttA	p.F149L	BTD_ENST00000482824.1_3'UTR|BTD_ENST00000449107.1_Missense_Mutation_p.F151L|BTD_ENST00000437172.1_Missense_Mutation_p.F151L|BTD_ENST00000383778.4_Missense_Mutation_p.F129L	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	149	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						CTCACCGCTTCAATGACACAG	0.478																																					p.F149L		.											.	BTD-90	0			c.C447A						.						97.0	78.0	85.0					3																	15683552		2203	4300	6503	SO:0001583	missense	686	exon3			CCGCTTCAATGAC	AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.447C>A	3.37:g.15683552C>A	ENSP00000306477:p.Phe149Leu	105	1		115	26	NM_000060	0	0	11	14	3	A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	ENST00000303498.5	37	CCDS2628.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717665	0.68844	.	.	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000436193;ENST00000383778	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.22;-2.5	5.82	4.95	0.65309	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.196398	0.53938	D	0.000046	D	0.90755	0.7098	M	0.83953	2.67	0.52099	D	0.99994	P;P;P	0.49358	0.923;0.923;0.923	P;P;P	0.49799	0.622;0.622;0.622	D	0.88732	0.3237	10	0.22706	T	0.39	-2.086	10.8627	0.46835	0.0:0.8568:0.0:0.1432	.	151;151;149	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	L	151;149;151;129;129	ENSP00000388212:F151L;ENSP00000306477:F149L;ENSP00000400995:F151L;ENSP00000394277:F129L;ENSP00000373288:F129L	ENSP00000306477:F149L	F	+	3	2	BTD	15658556	1.000000	0.71417	0.925000	0.36789	0.506000	0.33950	3.308000	0.51896	1.468000	0.48064	0.561000	0.74099	TTC	.		0.478	BTD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252103.2	NM_000060	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38105387	38105387	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:38105387T>C	ENST00000308059.6	+	6	1171	c.1150T>C	c.(1150-1152)Tat>Cat	p.Y384H	DLEC1_ENST00000452631.2_Missense_Mutation_p.Y384H|DLEC1_ENST00000346219.3_Missense_Mutation_p.Y384H|DLEC1_ENST00000469151.1_3'UTR					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TTTCACAGATTATGAAATTGG	0.383																																					p.Y384H		.											.	DLEC1-161	0			c.T1150C						.						173.0	163.0	166.0					3																	38105387		1834	4088	5922	SO:0001583	missense	9940	exon6			ACAGATTATGAAA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1150T>C	3.37:g.38105387T>C	ENSP00000308597:p.Tyr384His	102	0		110	17	NM_007337	0	0	0	0	0		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645842	0.67358	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.13778	2.57;2.56;2.8	4.67	4.67	0.58626	.	0.064498	0.64402	D	0.000005	T	0.36054	0.0953	M	0.78637	2.42	0.47547	D	0.999459	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.994;0.996	T	0.14699	-1.0463	10	0.72032	D	0.01	-13.6962	10.426	0.44378	0.0:0.0:0.0:1.0	.	384;384;384;384	A1L305;F8W6T4;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	H	384	ENSP00000308597:Y384H;ENSP00000315914:Y384H;ENSP00000410427:Y384H	ENSP00000308597:Y384H	Y	+	1	0	DLEC1	38080391	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.241000	0.58707	1.949000	0.56562	0.528000	0.53228	TAT	.		0.383	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
PROK2	60675	hgsc.bcm.edu	37	3	71834135	71834135	+	Silent	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:71834135G>T	ENST00000295619.3	-	1	77	c.69C>A	c.(67-69)cgC>cgA	p.R23R	PROK2_ENST00000353065.3_Silent_p.R23R	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	23					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CGTCCCCAGCGCGGGGCGTGA	0.756																																					p.R23R		.											.	PROK2-90	0			c.C69A						.						3.0	4.0	4.0					3																	71834135		1498	3014	4512	SO:0001819	synonymous_variant	60675	exon1			CCCAGCGCGGGGC	AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.69C>A	3.37:g.71834135G>T		2	0		48	25	NM_001126128	0	0	0	0	0	Q53Z79|Q6ISR0	Silent	SNP	ENST00000295619.3	37	CCDS46868.1																																																																																			.		0.756	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	NM_001126128	
CHST13	166012	hgsc.bcm.edu	37	3	126260630	126260630	+	Missense_Mutation	SNP	A	A	G	rs12495696	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:126260630A>G	ENST00000319340.2	+	3	285	c.235A>G	c.(235-237)Agc>Ggc	p.S79G		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	79					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		CCTGCTGAACAGCGCCTGTAG	0.716													A|||	442	0.0882588	0.0499	0.0879	5008	,	,		8598	0.1042		0.0626	False		,,,				2504	0.1503				p.S79G		.											.	CHST13-90	0			c.A235G						.	A	GLY/SER	169,4005		1,167,1919	9.0	8.0	8.0		235	-2.8	0.8	3	dbSNP_120	8	288,7872		3,282,3795	no	missense	CHST13	NM_152889.2	56	4,449,5714	GG,GA,AA		3.5294,4.0489,3.7052	benign	79/342	126260630	457,11877	2087	4080	6167	SO:0001583	missense	166012	exon3			CTGAACAGCGCCT	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.235A>G	3.37:g.126260630A>G	ENSP00000317404:p.Ser79Gly	2	0		30	23	NM_152889	0	0	0	0	0	Q3SYA3|Q3SYA5	Missense_Mutation	SNP	ENST00000319340.2	37	CCDS3039.1	137	0.06272893772893773	23	0.046747967479674794	25	0.06906077348066299	41	0.07167832167832168	48	0.0633245382585752	A	10.08	1.252004	0.22880	0.040489	0.035294	ENSG00000180767	ENST00000319340;ENST00000383575	T	0.68331	-0.32	4.84	-2.85	0.05734	.	0.448844	0.21668	N	0.070917	T	0.05318	0.0141	L	0.29908	0.895	0.58432	P	1.0000000000287557E-6	B	0.22480	0.07	B	0.24974	0.057	T	0.04373	-1.0956	9	0.40728	T	0.16	-12.1141	5.2514	0.15524	0.6241:0.184:0.1095:0.0824	rs12495696	79	Q8NET6	CHSTD_HUMAN	G	79	ENSP00000317404:S79G	ENSP00000317404:S79G	S	+	1	0	CHST13	127743320	0.989000	0.36119	0.763000	0.31416	0.782000	0.44232	1.632000	0.37102	-0.572000	0.06006	-0.619000	0.04042	AGC	A|0.936;G|0.064		0.716	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
RUVBL1	8607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127842496	127842496	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:127842496C>A	ENST00000322623.5	-	1	171	c.72G>T	c.(70-72)ctG>ctT	p.L24L	RUVBL1_ENST00000464873.1_Intron|RUVBL1_ENST00000417360.1_Silent_p.L24L	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	24					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)			endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		CGTCCAGCCCCAGCCCTTTCA	0.637																																					p.L24L		.											.	RUVBL1-227	0			c.G72T						.						45.0	45.0	45.0					3																	127842496		2203	4300	6503	SO:0001819	synonymous_variant	8607	exon1			CAGCCCCAGCCCT	AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.72G>T	3.37:g.127842496C>A		66	0		104	12	NM_003707	0	0	19	20	1	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Silent	SNP	ENST00000322623.5	37	CCDS3047.1																																																																																			.		0.637	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2		
HLTF	6596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	148763946	148763946	+	Missense_Mutation	SNP	T	T	A	rs137866464		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:148763946T>A	ENST00000310053.5	-	18	2186	c.1993A>T	c.(1993-1995)Att>Ttt	p.I665F	HLTF_ENST00000392912.2_Missense_Mutation_p.I665F|HLTF_ENST00000494055.1_Missense_Mutation_p.I665F|HLTF_ENST00000465259.1_Missense_Mutation_p.I664F	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	665					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATGTGCTGAATAAATACTTTA	0.343																																					p.I665F		.											.	HLTF-659	0			c.A1993T						.						108.0	107.0	107.0					3																	148763946		2203	4296	6499	SO:0001583	missense	6596	exon18			GCTGAATAAATAC	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.1993A>T	3.37:g.148763946T>A	ENSP00000308944:p.Ile665Phe	119	0		121	83	NM_139048	0	0	0	4	4	D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.034175	0.75617	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000467858	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38;-3.38	5.74	5.74	0.90152	SNF2-related (1);	.	.	.	.	D	0.96531	0.8868	M	0.80028	2.48	0.48511	D	0.999664	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.74674	0.984;0.976;0.955	D	0.96980	0.9714	9	0.72032	D	0.01	-23.3577	15.0224	0.71640	0.0:0.0:0.0:1.0	.	665;665;665	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	F	664;665;665;665;129	ENSP00000420745:I664F;ENSP00000308944:I665F;ENSP00000376644:I665F;ENSP00000420429:I665F;ENSP00000420106:I129F	ENSP00000308944:I665F	I	-	1	0	HLTF	150246636	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.636000	0.54317	2.174000	0.68829	0.528000	0.53228	ATT	T|1.000;C|0.000		0.343	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1		
RNF13	11342	bcgsc.ca	37	3	149678534	149678534	+	Silent	SNP	C	C	T	rs6768054	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:149678534C>T	ENST00000344229.3	+	11	1491	c.789C>T	c.(787-789)caC>caT	p.H263H	RNF13_ENST00000361785.6_Silent_p.H144H|RNF13_ENST00000392894.3_Silent_p.H263H	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	263					protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAGCTTATCACTGCAAGTGTG	0.373													C|||	3349	0.66873	0.4501	0.7176	5008	,	,		16979	0.8661		0.7068	False		,,,				2504	0.6871				p.H263H		.											.	RNF13-227	0			c.C789T						.	C	,	2057,2349	564.5+/-381.5	502,1053,648	55.0	54.0	54.0		789,789	1.1	1.0	3	dbSNP_116	54	5891,2709	680.7+/-403.7	2042,1807,451	no	coding-synonymous,coding-synonymous	RNF13	NM_007282.4,NM_183381.2	,	2544,2860,1099	TT,TC,CC		31.5,46.6863,38.8897	,	263/382,263/382	149678534	7948,5058	2203	4300	6503	SO:0001819	synonymous_variant	11342	exon11			TTATCACTGCAAG	AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.789C>T	3.37:g.149678534C>T		139	0		207	11	NM_007282	0	0	0	0	0	A6NC87|B3KR12|Q05D66|Q6IBJ9	Silent	SNP	ENST00000344229.3	37	CCDS3146.1																																																																																			C|0.360;T|0.640		0.373	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	NM_183384	
TSC22D2	9819	hgsc.bcm.edu	37	3	150128392	150128392	+	Missense_Mutation	SNP	G	G	A	rs879634	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:150128392G>A	ENST00000361875.3	+	1	2271	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A419T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	419			A -> T (in dbSNP:rs879634).		response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGGCCAGAATGCTTCCTCGGT	0.771													G|||	952	0.190096	0.2224	0.1657	5008	,	,		13018	0.0407		0.2724	False		,,,				2504	0.2331				p.A419T		.											.	TSC22D2-91	0			c.G1255A						.	G	THR/ALA	435,2751		29,377,1187	2.0	3.0	3.0		1255	1.5	0.0	3	dbSNP_86	3	1458,5444		170,1118,2163	yes	missense	TSC22D2	NM_014779.2	58	199,1495,3350	AA,AG,GG		21.1243,13.6535,18.7649	benign	419/781	150128392	1893,8195	1593	3451	5044	SO:0001583	missense	9819	exon1			CAGAATGCTTCCT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1255G>A	3.37:g.150128392G>A	ENSP00000354543:p.Ala419Thr	1	0		14	13	NM_014779	0	0	0	1	1	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	433	0.19826007326007325	126	0.25609756097560976	72	0.19889502762430938	23	0.04020979020979021	212	0.2796833773087071	G	1.438	-0.568481	0.03910	0.136535	0.211243	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.30182	1.54;1.54	3.57	1.47	0.22746	.	0.687211	0.12935	N	0.427041	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.33599	-0.9862	9	0.51188	T	0.08	.	6.993	0.24765	0.0:0.4503:0.379:0.1707	rs879634;rs3749399;rs58335631	419;419	O75157-2;O75157	.;T22D2_HUMAN	T	419	ENSP00000354543:A419T;ENSP00000354893:A419T	ENSP00000354893:A419T	A	+	1	0	TSC22D2	151611082	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.305000	0.19254	0.805000	0.34159	0.557000	0.71058	GCT	G|0.797;A|0.203		0.771	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
CLCN2	1181	broad.mit.edu;ucsc.edu	37	3	184075805	184075805	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:184075805G>T	ENST00000265593.4	-	5	731	c.560C>A	c.(559-561)gCt>gAt	p.A187D	CLCN2_ENST00000457512.1_Missense_Mutation_p.A187D|CLCN2_ENST00000423355.2_5'UTR|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000434054.2_Missense_Mutation_p.A143D|CLCN2_ENST00000344937.7_Missense_Mutation_p.A187D|EIF2B5_ENST00000444495.1_Intron	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	187					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	AATGACCTTAGCTATAAAGGT	0.562																																					p.A187D		.											.	CLCN2-90	0			c.C560A						.						81.0	76.0	78.0					3																	184075805		2203	4300	6503	SO:0001583	missense	1181	exon5			ACCTTAGCTATAA	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.560C>A	3.37:g.184075805G>T	ENSP00000265593:p.Ala187Asp	123	2		125	18	NM_001171087	0	0	1	1	0	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	g	24.1	4.497253	0.85069	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57	4.45	4.45	0.53987	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.97929	0.9319	M	0.94063	3.49	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.995;0.966;0.997	D	0.99246	1.0886	10	0.87932	D	0	-11.8071	16.8755	0.86051	0.0:0.0:1.0:0.0	.	187;143;187;187;187	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	D	187;187;143;187	ENSP00000265593:A187D;ENSP00000345056:A187D;ENSP00000400425:A143D;ENSP00000391928:A187D	ENSP00000265593:A187D	A	-	2	0	CLCN2	185558499	1.000000	0.71417	0.967000	0.41034	0.867000	0.49689	9.640000	0.98453	2.308000	0.77769	0.462000	0.41574	GCT	.		0.562	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
CLDN1	9076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	190039777	190039777	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:190039777C>A	ENST00000295522.3	-	1	487	c.219G>T	c.(217-219)ctG>ctT	p.L73L		NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1	73					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		ACTCACTGCTCAGATTCAGCA	0.597																																					p.L73L		.											.	CLDN1-91	0			c.G219T						.						69.0	64.0	66.0					3																	190039777		2203	4300	6503	SO:0001819	synonymous_variant	9076	exon1			ACTGCTCAGATTC	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.219G>T	3.37:g.190039777C>A		113	0		130	72	NM_021101	0	0	0	0	0		Silent	SNP	ENST00000295522.3	37	CCDS3295.1																																																																																			.		0.597	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343516.2	NM_021101	
CC2D2A	57545	broad.mit.edu	37	4	15516455	15516455	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:15516455G>T	ENST00000503292.1	+	10	1023	c.843G>T	c.(841-843)atG>atT	p.M281I	CC2D2A_ENST00000413206.1_Missense_Mutation_p.M281I|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000424120.1_Missense_Mutation_p.M281I|CC2D2A_ENST00000389652.5_Missense_Mutation_p.M232I	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	281					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GGCTGCAGATGGAAAGAGAAA	0.433																																					p.M281I		.											.	CC2D2A-25	0			c.G843T						.						189.0	186.0	187.0					4																	15516455		1943	4149	6092	SO:0001583	missense	57545	exon10			GCAGATGGAAAGA	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.843G>T	4.37:g.15516455G>T	ENSP00000421809:p.Met281Ile	76	1		133	8	NM_001080522	0	0	0	0	0	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.542132	0.27563	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000512702;ENST00000503292;ENST00000389652	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.76	4.92	0.64577	.	0.577879	0.18073	N	0.152552	T	0.11836	0.0288	N	0.08118	0	0.80722	D	1	B;B	0.24132	0.098;0.045	B;B	0.28305	0.088;0.056	T	0.09930	-1.0652	10	0.49607	T	0.09	.	9.1759	0.37112	0.1649:0.0:0.8351:0.0	.	281;232	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	I	281;281;232;232;281;281;232	ENSP00000403465:M281I;ENSP00000398391:M281I;ENSP00000422875:M281I;ENSP00000421809:M281I;ENSP00000374303:M232I	ENSP00000374303:M232I	M	+	3	0	CC2D2A	15125553	0.979000	0.34478	0.867000	0.34043	0.011000	0.07611	1.334000	0.33827	2.726000	0.93360	0.655000	0.94253	ATG	.		0.433	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
FGFBP2	83888	broad.mit.edu;bcgsc.ca	37	4	15964327	15964327	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:15964327C>A	ENST00000259989.6	-	1	532	c.426G>T	c.(424-426)caG>caT	p.Q142H	FGFBP2_ENST00000509331.1_Intron	NM_031950.3	NP_114156.1	Q9BYJ0	FGFP2_HUMAN	fibroblast growth factor binding protein 2	142						extracellular region (GO:0005576)				central_nervous_system(1)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						CAGCCTCAGGCTGCTGGTTGG	0.617																																					p.Q142H		.											.	FGFBP2-22	0			c.G426T						.						79.0	74.0	76.0					4																	15964327		2203	4300	6503	SO:0001583	missense	83888	exon1			CTCAGGCTGCTGG	AB021123	CCDS3419.1	4p15.32	2008-07-16			ENSG00000137441	ENSG00000137441			29451	protein-coding gene	gene with protein product	"""killer-specific secretory protein of 37 kDa"""	607713				11342666, 12322897	Standard	NM_031950		Approved	KSP37	uc003gon.3	Q9BYJ0	OTTHUMG00000128513	ENST00000259989.6:c.426G>T	4.37:g.15964327C>A	ENSP00000259989:p.Gln142His	48	1		56	45	NM_031950	0	0	0	0	0		Missense_Mutation	SNP	ENST00000259989.6	37	CCDS3419.1	.	.	.	.	.	.	.	.	.	.	C	3.994	-0.003847	0.07773	.	.	ENSG00000137441	ENST00000259989	T	0.14640	2.49	2.98	-1.25	0.09405	.	1.640020	0.03929	N	0.284865	T	0.08223	0.0205	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34875	-0.9811	10	0.33141	T	0.24	-0.7762	5.6911	0.17831	0.0:0.3323:0.3812:0.2865	.	142	Q9BYJ0	FGFP2_HUMAN	H	142	ENSP00000259989:Q142H	ENSP00000259989:Q142H	Q	-	3	2	FGFBP2	15573425	0.012000	0.17670	0.019000	0.16419	0.008000	0.06430	-0.241000	0.08940	-0.199000	0.10317	-0.153000	0.13522	CAG	.		0.617	FGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250324.1	NM_031950	
SOD3	6649	hgsc.bcm.edu	37	4	24801354	24801354	+	Silent	SNP	C	C	T	rs8192291	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:24801354C>T	ENST00000382120.3	+	2	416	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L		NM_003102.2	NP_003093.2	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular	71					removal of superoxide radicals (GO:0019430)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	copper ion binding (GO:0005507)|heparin binding (GO:0008201)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			prostate(1)|urinary_tract(1)	2		Breast(46;0.0503)				GTCGGCCACGCTGGACGCCGC	0.726													C|||	994	0.198482	0.0968	0.1585	5008	,	,		11823	0.3512		0.2028	False		,,,				2504	0.2025				p.L71L		.											.	SOD3-90	0			c.C211T						.	C		341,3293		12,317,1488	4.0	5.0	5.0		211	0.7	0.0	4	dbSNP_117	5	1103,6325		63,977,2674	no	coding-synonymous	SOD3	NM_003102.2		75,1294,4162	TT,TC,CC		14.8492,9.3836,13.0537		71/241	24801354	1444,9618	1817	3714	5531	SO:0001819	synonymous_variant	6649	exon2			GCCACGCTGGACG		CCDS3430.1	4p15.2	2012-09-20			ENSG00000109610	ENSG00000109610	1.15.1.1		11181	protein-coding gene	gene with protein product		185490					Standard	NM_003102		Approved	EC-SOD	uc003gqz.3	P08294	OTTHUMG00000128565	ENST00000382120.3:c.211C>T	4.37:g.24801354C>T		0	0		26	18	NM_003102	0	0	0	12	12	Q5U781|Q6FHA2	Silent	SNP	ENST00000382120.3	37	CCDS3430.1																																																																																			C|0.777;T|0.223		0.726	SOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250416.1		
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		8	7	NM_001098634	0	0	0	1	1	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
UGT2B17	7367	broad.mit.edu;bcgsc.ca	37	4	69417567	69417567	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:69417567C>T	ENST00000317746.2	-	4	1110	c.1068G>A	c.(1066-1068)aaG>aaA	p.K356K		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	356					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	GGGGTAACCACTTATACAGTC	0.348																																					p.K356K	Melanoma(18;649 833 28984 37818 38500)	.											.	UGT2B17-91	0			c.G1068A						.						96.0	83.0	87.0					4																	69417567		2089	3919	6008	SO:0001819	synonymous_variant	7367	exon4			TAACCACTTATAC	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.1068G>A	4.37:g.69417567C>T		370	0		321	12	NM_001077	0	0	0	0	0		Silent	SNP	ENST00000317746.2	37	CCDS3523.1																																																																																			.		0.348	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		0	0		5	4	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
NUDT9	53343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88372877	88372877	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:88372877A>T	ENST00000302174.4	+	6	1103	c.779A>T	c.(778-780)gAc>gTc	p.D260V	NUDT9_ENST00000473942.1_Missense_Mutation_p.D210V|NUDT9_ENST00000515371.1_3'UTR	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	260	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TTCAGCCAAGACCACCTAGTG	0.403																																					p.D260V		.											.	NUDT9-90	0			c.A779T						.						94.0	94.0	94.0					4																	88372877		2203	4300	6503	SO:0001583	missense	53343	exon6			GCCAAGACCACCT	AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.779A>T	4.37:g.88372877A>T	ENSP00000303575:p.Asp260Val	58	0		48	35	NM_024047	0	0	0	0	0	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000302174.4	37	CCDS3620.1	.	.	.	.	.	.	.	.	.	.	A	8.847	0.943559	0.18281	.	.	ENSG00000170502	ENST00000302174;ENST00000473942;ENST00000440591	T;T;T	0.14640	2.49;2.49;3.27	5.32	5.32	0.75619	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.530450	0.21374	N	0.075584	T	0.11153	0.0272	N	0.19112	0.55	0.46298	D	0.998978	B;B	0.20164	0.042;0.006	B;B	0.25614	0.062;0.034	T	0.09729	-1.0661	10	0.52906	T	0.07	-18.1714	12.9477	0.58382	1.0:0.0:0.0:0.0	.	260;260	Q96KB3;Q9BW91	.;NUDT9_HUMAN	V	260;210;228	ENSP00000303575:D260V;ENSP00000421811:D210V;ENSP00000410270:D228V	ENSP00000303575:D260V	D	+	2	0	NUDT9	88591901	1.000000	0.71417	0.845000	0.33349	0.196000	0.23810	5.014000	0.64029	2.148000	0.66965	0.477000	0.44152	GAC	.		0.403	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2		
GSTCD	79807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	106746955	106746955	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:106746955G>T	ENST00000515279.1	+	8	1748	c.1528G>T	c.(1528-1530)Gga>Tga	p.G510*	RP11-45L9.1_ENST00000509003.1_RNA|GSTCD_ENST00000394728.3_Nonsense_Mutation_p.G510*|GSTCD_ENST00000394730.3_Nonsense_Mutation_p.G423*|GSTCD_ENST00000360505.5_Nonsense_Mutation_p.G510*|RP11-45L9.1_ENST00000504955.1_RNA|RP11-45L9.1_ENST00000506527.1_RNA|GSTCD_ENST00000515255.1_3'UTR			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	510						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GTTTAATATTGGAGTAAGTAA	0.274																																					p.G510X		.											.	GSTCD-92	0			c.G1528T						.						80.0	80.0	80.0					4																	106746955		1783	4054	5837	SO:0001587	stop_gained	79807	exon8			AATATTGGAGTAA	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1528G>T	4.37:g.106746955G>T	ENSP00000422354:p.Gly510*	121	0		81	48	NM_001031720	0	0	0	0	0	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Nonsense_Mutation	SNP	ENST00000515279.1	37	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	G	39	7.371436	0.98241	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.0865	19.0135	0.92884	0.0:0.0:1.0:0.0	.	.	.	.	X	423;510;510;510	.	ENSP00000353695:G510X	G	+	1	0	GSTCD	106966404	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	9.092000	0.94157	2.568000	0.86640	0.650000	0.86243	GGA	.		0.274	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
ENPEP	2028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	111470691	111470691	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:111470691C>A	ENST00000265162.5	+	16	2575	c.2233C>A	c.(2233-2235)Cgt>Agt	p.R745S		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	745					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AAGGTTACTCCGTTCCTCCGT	0.388																																					p.R745S		.											.	ENPEP-157	0			c.C2233A						.						118.0	117.0	117.0					4																	111470691		2203	4300	6503	SO:0001583	missense	2028	exon16			TTACTCCGTTCCT	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2233C>A	4.37:g.111470691C>A	ENSP00000265162:p.Arg745Ser	120	0		108	33	NM_001977	0	0	0	0	0	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341433	0.81911	.	.	ENSG00000138792	ENST00000265162	T	0.10668	2.85	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.45438	0.1342	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.58154	-0.7686	10	0.87932	D	0	.	19.2627	0.93974	0.0:1.0:0.0:0.0	.	745	Q07075	AMPE_HUMAN	S	745	ENSP00000265162:R745S	ENSP00000265162:R745S	R	+	1	0	ENPEP	111690140	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.653000	0.54446	2.549000	0.85964	0.650000	0.86243	CGT	.		0.388	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	0	0		8	7	NM_152400	0	0	0	3	3	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
MARCH1	55016	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	165118218	165118218	+	Intron	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr4:165118218C>A	ENST00000503008.1	-	2	864				MARCH1_ENST00000514618.1_Intron|MARCH1_ENST00000508725.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				tcctcgccatctacctctcca	0.498																																					p.D216Y		.											.	ANP32C-90	0			c.G646T						.						199.0	158.0	172.0					4																	165118218		2203	4300	6503	SO:0001627	intron_variant	23520	exon1			CGCCATCTACCTC	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85404G>T	4.37:g.165118218C>A		148	0		142	21	NM_012403	0	0	0	0	0	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1																																																																																			.		0.498	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
EXOC3	11336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	446342	446342	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:446342G>C	ENST00000512944.1	+	2	211	c.22G>C	c.(22-24)Gcc>Ccc	p.A8P	EXOC3_ENST00000510441.1_3'UTR|EXOC3_ENST00000315013.5_Missense_Mutation_p.A8P	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	19					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			AGACCGGGAGGCCGTTGCGAC	0.577																																					p.A8P		.											.	EXOC3-90	0			c.G22C						.						82.0	85.0	84.0					5																	446342		2010	4172	6182	SO:0001583	missense	11336	exon2			CGGGAGGCCGTTG	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.22G>C	5.37:g.446342G>C	ENSP00000425587:p.Ala8Pro	101	0		165	12	NM_007277	0	0	4	4	0	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	ENST00000512944.1	37	CCDS54830.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711126	0.89112	.	.	ENSG00000180104	ENST00000512944;ENST00000508022;ENST00000315013;ENST00000340158	T;T	0.18338	2.22;2.22	5.29	4.42	0.53409	.	0.097479	0.64402	N	0.000001	T	0.42449	0.1203	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.42849	-0.9427	10	0.72032	D	0.01	-9.0788	13.5421	0.61681	0.0:0.1687:0.8313:0.0	.	19	O60645	EXOC3_HUMAN	P	8;8;8;18	ENSP00000425587:A8P;ENSP00000323377:A8P	ENSP00000323377:A8P	A	+	1	0	EXOC3	499342	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.453000	0.73488	1.215000	0.43411	0.650000	0.86243	GCC	.		0.577	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000539938.1_5'Flank|NSUN2_ENST00000506139.1_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		7	7	NM_001047	0	0	0	2	2	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35644627	35644627	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:35644627G>T	ENST00000356031.3	+	4	739	c.585G>T	c.(583-585)aaG>aaT	p.K195N	SPEF2_ENST00000509059.1_Splice_Site_p.K195N|SPEF2_ENST00000440995.2_Splice_Site_p.K195N|SPEF2_ENST00000282469.6_Splice_Site_p.K195N	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	195					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATATTGAAAAGGTTCTATAGA	0.313																																					p.K195N		.											.	SPEF2-26	0			c.G585T						.						27.0	28.0	28.0					5																	35644627		2198	4293	6491	SO:0001630	splice_region_variant	79925	exon4			TGAAAAGGTTCTA	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.585+1G>T	5.37:g.35644627G>T		122	0		173	50	NM_024867	0	0	0	0	0	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339326	0.41398	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000440995	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.43	5.43	0.79202	.	0.257580	0.33980	N	0.004367	T	0.28134	0.0694	M	0.68952	2.095	0.80722	D	1	P;P;P	0.46512	0.845;0.779;0.879	B;B;P	0.45829	0.368;0.299;0.494	T	0.01452	-1.1351	10	0.36615	T	0.2	.	18.8285	0.92128	0.0:0.0:1.0:0.0	.	195;195;195	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	N	195	ENSP00000282469:K195N;ENSP00000348314:K195N;ENSP00000421593:K195N;ENSP00000412125:K195N	ENSP00000282469:K195N	K	+	3	2	SPEF2	35680384	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	4.641000	0.61375	2.547000	0.85894	0.650000	0.86243	AAG	.		0.313	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	Missense_Mutation
ZSWIM6	57688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	60831349	60831349	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:60831349G>C	ENST00000252744.5	+	10	2284	c.2284G>C	c.(2284-2286)Gag>Cag	p.E762Q		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	762					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						AATCCATCGGGAGAGCGTTCC	0.428																																					p.E762Q		.											.	.	0			c.G2284C						.						209.0	170.0	182.0					5																	60831349		692	1591	2283	SO:0001583	missense	57688	exon10			CATCGGGAGAGCG	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2284G>C	5.37:g.60831349G>C	ENSP00000252744:p.Glu762Gln	206	0		212	102	NM_020928	0	0	2	3	1		Missense_Mutation	SNP	ENST00000252744.5	37	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039584	0.93630	.	.	ENSG00000130449	ENST00000252744	T	0.53857	0.6	5.16	5.16	0.70880	.	0.050657	0.85682	D	0.000000	T	0.74382	0.3709	M	0.78637	2.42	0.58432	D	0.999999	D	0.76494	0.999	D	0.76071	0.987	T	0.76421	-0.2965	10	0.66056	D	0.02	-12.4192	19.2125	0.93763	0.0:0.0:1.0:0.0	.	762	Q9HCJ5	ZSWM6_HUMAN	Q	762	ENSP00000252744:E762Q	ENSP00000252744:E762Q	E	+	1	0	ZSWIM6	60867106	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.601000	0.98297	2.840000	0.97914	0.655000	0.94253	GAG	.		0.428	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
RGMB	285704	hgsc.bcm.edu	37	5	98109828	98109828	+	Silent	SNP	G	G	A	rs2547973	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:98109828G>A	ENST00000513185.1	+	1	490	c.54G>A	c.(52-54)gaG>gaA	p.E18E	RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000498871.2_RNA|RGMB_ENST00000308234.7_Silent_p.E59E|RGMB-AS1_ENST00000505677.1_RNA|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000515003.1_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	18					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ccgaggttgagcagcgccgca	0.756													G|||	1477	0.294928	0.1672	0.2824	5008	,	,		8223	0.2956		0.3012	False		,,,				2504	0.4693				p.E59E		.											.	.	0			c.G177A						.						1.0	1.0	1.0					5																	98109828		405	1009	1414	SO:0001819	synonymous_variant	285704	exon3			GGTTGAGCAGCGC	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.54G>A	5.37:g.98109828G>A		0	0		7	7	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Silent	SNP	ENST00000513185.1	37																																																																																				G|0.735;A|0.265		0.756	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101755672	101755672	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:101755672C>A	ENST00000506729.1	-	8	1501	c.1330G>T	c.(1330-1332)Gtt>Ttt	p.V444F	SLCO6A1_ENST00000389019.3_Missense_Mutation_p.V382F|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000379810.1_Intron|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.V444F			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	444						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.V444F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AATGTGGAAACAATGACACCT	0.353																																					p.V444F		.											.	SLCO6A1-96	1	Substitution - Missense(1)	lung(1)	c.G1330T						.						59.0	64.0	62.0					5																	101755672		2203	4300	6503	SO:0001583	missense	133482	exon8			TGGAAACAATGAC	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1330G>T	5.37:g.101755672C>A	ENSP00000421339:p.Val444Phe	139	0		126	53	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	9.964	1.223591	0.22457	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019	T;T;T	0.49139	0.79;0.79;0.79	4.81	1.01	0.19927	Major facilitator superfamily domain, general substrate transporter (1);	1.392020	0.04815	N	0.435992	T	0.68778	0.3038	M	0.85777	2.775	0.09310	N	1	D;D	0.60160	0.979;0.987	P;P	0.62885	0.79;0.908	T	0.46952	-0.9154	10	0.87932	D	0	.	7.5794	0.27955	0.0:0.5244:0.0:0.4756	.	382;444	Q86UG4-2;Q86UG4	.;SO6A1_HUMAN	F	444;444;382	ENSP00000421339:V444F;ENSP00000369135:V444F;ENSP00000373671:V382F	ENSP00000369135:V444F	V	-	1	0	SLCO6A1	101783571	0.999000	0.42202	0.054000	0.19295	0.031000	0.12232	0.920000	0.28705	0.182000	0.20032	-0.150000	0.13652	GTT	.		0.353	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
PCDHGB7	56099	hgsc.bcm.edu;broad.mit.edu	37	5	140799203	140799203	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:140799203G>C	ENST00000398594.2	+	1	1777	c.1777G>C	c.(1777-1779)Gcc>Ccc	p.A593P	PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	593	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGGTGGTGGCCGTGGACGC	0.706																																					p.A593P		.											.	PCDHGB7-29	0			c.G1777C						.						31.0	36.0	34.0					5																	140799203		2199	4297	6496	SO:0001583	missense	56099	exon1			GTGGTGGCCGTGG	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1777G>C	5.37:g.140799203G>C	ENSP00000381594:p.Ala593Pro	20	0		100	6	NM_018927	0	0	2	2	0	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.046521	0.75846	.	.	ENSG00000254122	ENST00000398594	T	0.61980	0.06	5.57	5.57	0.84162	Cadherin (4);Cadherin-like (1);	0.000000	0.32687	U	0.005763	D	0.89508	0.6735	H	0.99675	4.695	0.35522	D	0.801546	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95953	0.8956	10	0.87932	D	0	.	19.1659	0.93557	0.0:0.0:1.0:0.0	.	593;593	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	P	593	ENSP00000381594:A593P	ENSP00000381594:A593P	A	+	1	0	PCDHGB7	140779387	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.847000	0.99503	2.619000	0.88677	0.491000	0.48974	GCC	.		0.706	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
KCTD16	57528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	143586513	143586513	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:143586513G>T	ENST00000507359.3	+	2	1327	c.236G>T	c.(235-237)gGa>gTa	p.G79V	KCTD16_ENST00000512467.1_Missense_Mutation_p.G79V	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	79	BTB.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GACAGAGATGGATTCTTGTTC	0.458																																					p.G79V		.											.	KCTD16-137	0			c.G236T						.						55.0	55.0	55.0					5																	143586513		2203	4300	6503	SO:0001583	missense	57528	exon3			GAGATGGATTCTT	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.236G>T	5.37:g.143586513G>T	ENSP00000426548:p.Gly79Val	135	0		127	20	NM_020768	0	0	0	0	0	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505390	0.64410	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.48836	0.8;0.8	5.67	4.8	0.61643	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87017	0.2126	10	0.87932	D	0	.	14.7147	0.69259	0.0695:0.0:0.9305:0.0	.	79	Q68DU8	KCD16_HUMAN	V	79	ENSP00000424151:G79V;ENSP00000426548:G79V	ENSP00000426548:G79V	G	+	2	0	KCTD16	143566706	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	9.807000	0.99171	1.395000	0.46643	0.561000	0.74099	GGA	.		0.458	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
ZNF346	23567	hgsc.bcm.edu	37	5	176449890	176449890	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:176449890G>T	ENST00000358149.3	+	1	194	c.151G>T	c.(151-153)Gcc>Tcc	p.A51S	ZNF346_ENST00000261948.4_Missense_Mutation_p.A51S|ZNF346_ENST00000512315.1_Missense_Mutation_p.A51S|ZNF346_ENST00000503425.1_Missense_Mutation_p.A51S|ZNF346_ENST00000511834.1_Missense_Mutation_p.A51S|ZNF346_ENST00000506693.1_Missense_Mutation_p.A51S|ZNF346_ENST00000503039.1_Missense_Mutation_p.A51S	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346	51					positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGTGTCCGGTGCCCAGCCGGT	0.721																																					p.A51S		.											.	ZNF346-90	0			c.G151T						.						8.0	10.0	9.0					5																	176449890		1993	3951	5944	SO:0001583	missense	23567	exon1			TCCGGTGCCCAGC	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.151G>T	5.37:g.176449890G>T	ENSP00000350869:p.Ala51Ser	41	0		94	5	NM_012279	0	0	3	3	0	B7Z367|Q68CV9|Q6ZMW1	Missense_Mutation	SNP	ENST00000358149.3	37	CCDS4409.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754688	0.49362	.	.	ENSG00000113761	ENST00000358149;ENST00000506693;ENST00000512315;ENST00000503425;ENST00000261948;ENST00000511834;ENST00000503039	T;T;T;T;T;T;T	0.57107	1.0;0.73;0.88;1.0;0.42;1.0;0.42	3.37	-0.496	0.12027	.	1.049750	0.07509	N	0.908625	T	0.49660	0.1570	N	0.19112	0.55	0.25197	N	0.990087	D;B;B;B;B	0.64830	0.994;0.001;0.059;0.006;0.001	D;B;B;B;B	0.70716	0.97;0.001;0.028;0.003;0.001	T	0.40590	-0.9555	10	0.29301	T	0.29	.	2.9139	0.05746	0.3329:0.0:0.4681:0.199	.	51;51;51;51;51	B7Z4J8;B7Z367;Q9UL40-2;B7Z4N4;Q9UL40	.;.;.;.;ZN346_HUMAN	S	51	ENSP00000350869:A51S;ENSP00000423515:A51S;ENSP00000421089:A51S;ENSP00000421212:A51S;ENSP00000261948:A51S;ENSP00000425725:A51S;ENSP00000424495:A51S	ENSP00000261948:A51S	A	+	1	0	ZNF346	176382496	0.989000	0.36119	0.707000	0.30419	0.990000	0.78478	0.422000	0.21296	-0.133000	0.11537	0.561000	0.74099	GCC	.		0.721	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253415.2	NM_012279	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		4	4	NM_001145115	0	0	0	5	5		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
MYLIP	29116	bcgsc.ca	37	6	16145325	16145325	+	Missense_Mutation	SNP	A	A	G	rs9370867	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:16145325A>G	ENST00000356840.3	+	6	1223	c.1025A>G	c.(1024-1026)aAc>aGc	p.N342S	MYLIP_ENST00000349606.4_Missense_Mutation_p.N161S	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	342			N -> S (in dbSNP:rs9370867). {ECO:0000269|PubMed:10593918, ECO:0000269|PubMed:11042152, ECO:0000269|PubMed:15498874, ECO:0000269|Ref.2}.		cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GTTTCAAGAAACAACCAGAGC	0.517													G|||	3856	0.769968	0.9652	0.6945	5008	,	,		22511	0.9435		0.4861	False		,,,				2504	0.6728				p.N342S		.											.	MYLIP-91	0			c.A1025G						.	G	SER/ASN	3906,500	231.7+/-245.5	1738,430,35	100.0	103.0	102.0		1025	3.8	0.0	6	dbSNP_119	102	4094,4506	593.3+/-393.1	967,2160,1173	yes	missense	MYLIP	NM_013262.3	46	2705,2590,1208	GG,GA,AA		47.6047,11.3482,38.4899	benign	342/446	16145325	8000,5006	2203	4300	6503	SO:0001583	missense	29116	exon6			CAAGAAACAACCA	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.1025A>G	6.37:g.16145325A>G	ENSP00000349298:p.Asn342Ser	172	0		201	6	NM_013262	0	0	31	31	0	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Missense_Mutation	SNP	ENST00000356840.3	37	CCDS4536.1	1620	0.7417582417582418	469	0.9532520325203252	239	0.6602209944751382	541	0.9458041958041958	371	0.4894459102902375	G	0.035	-1.312768	0.01331	0.886518	0.476047	ENSG00000007944	ENST00000356840;ENST00000349606	D;T	0.81908	-1.55;1.16	5.65	3.85	0.44370	.	0.514420	0.25666	N	0.029102	T	0.39200	0.1069	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.08868	-1.0701	9	0.02654	T	1	.	9.9368	0.41556	0.1268:0.1148:0.7584:0.0	rs9370867;rs59084742;rs9370867	342	Q8WY64	MYLIP_HUMAN	S	342;161	ENSP00000349298:N342S;ENSP00000008686:N161S	ENSP00000008686:N161S	N	+	2	0	MYLIP	16253304	0.018000	0.18449	0.000000	0.03702	0.446000	0.32137	1.572000	0.36461	0.415000	0.25817	-0.119000	0.15052	AAC	A|0.313;G|0.687		0.517	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043864.1	NM_013262	
KIAA0319	9856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	24581184	24581184	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:24581184C>A	ENST00000378214.3	-	7	1773	c.1249G>T	c.(1249-1251)Gaa>Taa	p.E417*	KIAA0319_ENST00000430948.2_Nonsense_Mutation_p.E372*|KIAA0319_ENST00000535378.1_Nonsense_Mutation_p.E408*|KIAA0319_ENST00000543707.1_Nonsense_Mutation_p.E417*|KIAA0319_ENST00000537886.1_Nonsense_Mutation_p.E417*	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	417	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						ACAAATCCTTCTCCAAAGGCG	0.403											OREG0017229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E417X		.											.	KIAA0319-92	0			c.G1249T						.						149.0	145.0	146.0					6																	24581184		2203	4300	6503	SO:0001587	stop_gained	9856	exon7			ATCCTTCTCCAAA	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1249G>T	6.37:g.24581184C>A	ENSP00000367459:p.Glu417*	72	0	772	50	9	NM_001168377	0	0	0	0	0	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Nonsense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	C	40	8.011795	0.98610	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	.	.	.	4.53	4.53	0.55603	.	0.234260	0.35378	N	0.003243	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-18.7299	17.4492	0.87587	0.0:1.0:0.0:0.0	.	.	.	.	X	417;408;372;417;417	.	ENSP00000367459:E417X	E	-	1	0	KIAA0319	24689163	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.750000	0.55157	2.334000	0.79466	0.655000	0.94253	GAA	.		0.403	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
IER3	8870	hgsc.bcm.edu	37	6	30712154	30712154	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:30712154G>T	ENST00000259874.5	-	1	177	c.142C>A	c.(142-144)Cct>Act	p.P48T	FLOT1_ENST00000470643.1_5'Flank|FLOT1_ENST00000376389.3_5'Flank|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000456573.2_5'Flank|IER3_ENST00000376377.2_Missense_Mutation_p.P48T	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3	48					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						CGCCCGGCAGGGGCCGCTGCG	0.736																																					p.P48T		.											.	IER3-90	0			c.C142A						.						8.0	11.0	10.0					6																	30712154		1201	2470	3671	SO:0001583	missense	8870	exon1			CGGCAGGGGCCGC	AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265	ENST00000259874.5:c.142C>A	6.37:g.30712154G>T	ENSP00000259874:p.Pro48Thr	4	0		26	7	NM_003897	0	0	9	10	1	Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	ENST00000259874.5	37	CCDS4689.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276650	0.40294	.	.	ENSG00000137331	ENST00000259874;ENST00000376377;ENST00000376382	T	0.43688	0.94	4.52	1.73	0.24493	.	0.547984	0.16907	N	0.194628	T	0.10981	0.0268	L	0.34521	1.04	0.09310	N	1	P	0.36909	0.573	B	0.33521	0.165	T	0.12915	-1.0529	10	0.33141	T	0.24	.	6.1815	0.20474	0.3224:0.0:0.6776:0.0	.	48	P46695	IEX1_HUMAN	T	48	ENSP00000259874:P48T	ENSP00000259874:P48T	P	-	1	0	IER3	30820133	0.359000	0.24955	0.003000	0.11579	0.356000	0.29392	0.805000	0.27112	0.164000	0.19529	0.549000	0.68633	CCT	.		0.736	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2		
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		30	30	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
TTBK1	84630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43230667	43230667	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:43230667C>T	ENST00000259750.4	+	13	1648	c.1565C>T	c.(1564-1566)gCc>gTc	p.A522V	TTBK1_ENST00000304139.5_Missense_Mutation_p.A471V	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	522					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GAGCAGGAGGCCCTGAGCAAC	0.622																																					p.A522V		.											.	TTBK1-353	0			c.C1565T						.						77.0	60.0	66.0					6																	43230667		2203	4300	6503	SO:0001583	missense	84630	exon13			AGGAGGCCCTGAG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1565C>T	6.37:g.43230667C>T	ENSP00000259750:p.Ala522Val	351	0		423	72	NM_032538	0	0	0	0	0	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861217	0.71949	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.61627	0.09	5.38	5.38	0.77491	.	0.058713	0.64402	D	0.000002	T	0.44095	0.1277	L	0.38838	1.175	0.40283	D	0.978411	P;P	0.46912	0.884;0.886	B;P	0.45377	0.396;0.478	T	0.50600	-0.8809	10	0.59425	D	0.04	.	16.0488	0.80740	0.0:1.0:0.0:0.0	.	45;522	Q9H6N8;Q5TCY1	.;TTBK1_HUMAN	V	471;522;471	ENSP00000259750:A522V	ENSP00000259750:A522V	A	+	2	0	TTBK1	43338645	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.628000	0.67791	2.532000	0.85374	0.484000	0.47621	GCC	.		0.622	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
PKHD1	5314	broad.mit.edu	37	6	51524024	51524024	+	Missense_Mutation	SNP	C	C	T	rs374441065		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:51524024C>T	ENST00000371117.3	-	61	11175	c.10900G>A	c.(10900-10902)Gtt>Att	p.V3634I		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3634					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CGTTGACCAACTCTTCTATAA	0.443																																					p.V3634I		.											.	PKHD1-603	0			c.G10900A						.	C	ILE/VAL	0,4406		0,0,2203	127.0	126.0	126.0		10900	-0.5	0.0	6		126	1,8599	1.2+/-3.3	0,1,4299	no	missense	PKHD1	NM_138694.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	3634/4075	51524024	1,13005	2203	4300	6503	SO:0001583	missense	5314	exon61			GACCAACTCTTCT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10900G>A	6.37:g.51524024C>T	ENSP00000360158:p.Val3634Ile	148	0		105	3	NM_138694	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	0.883	-0.728189	0.03135	0.0	1.16E-4	ENSG00000170927	ENST00000371117	D	0.85702	-2.02	3.71	-0.522	0.11928	.	1.236620	0.05703	N	0.594556	T	0.59473	0.2196	L	0.44542	1.39	0.09310	N	1	B	0.23442	0.085	B	0.19666	0.026	T	0.42378	-0.9455	10	0.27082	T	0.32	.	3.9764	0.09476	0.5353:0.2522:0.0:0.2125	.	3634	P08F94	PKHD1_HUMAN	I	3634	ENSP00000360158:V3634I	ENSP00000360158:V3634I	V	-	1	0	PKHD1	51631983	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-0.218000	0.09240	-0.034000	0.13713	0.650000	0.86243	GTT	.		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
EYS	346007	broad.mit.edu	37	6	65767590	65767590	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:65767590C>A	ENST00000370621.3	-	13	2580	c.2054G>T	c.(2053-2055)tGt>tTt	p.C685F	EYS_ENST00000503581.1_Missense_Mutation_p.C685F|EYS_ENST00000370616.2_Missense_Mutation_p.C685F			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	685	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATGTGAAGCACACTCATCTAT	0.388																																					p.C685F		.											.	EYS-660	0			c.G2054T						.						226.0	179.0	193.0					6																	65767590		692	1591	2283	SO:0001583	missense	346007	exon13			GAAGCACACTCAT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2054G>T	6.37:g.65767590C>A	ENSP00000359655:p.Cys685Phe	250	0		222	4	NM_001142800	0	0	0	0	0	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	16.38	3.107635	0.56291	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.99992	-12.4;-12.4;-12.4	5.36	1.58	0.23477	.	.	.	.	.	D	0.99988	0.9998	H	0.98701	4.305	0.36560	D	0.872347	P	0.49358	0.923	P	0.49276	0.605	D	0.93514	0.6855	9	0.87932	D	0	.	9.3107	0.37903	0.0:0.7257:0.0:0.2743	.	685	Q5T1H1-1	.	F	685	ENSP00000424243:C685F;ENSP00000359655:C685F;ENSP00000359650:C685F	ENSP00000359650:C685F	C	-	2	0	EYS	65824311	0.006000	0.16342	0.000000	0.03702	0.253000	0.25986	1.214000	0.32419	0.006000	0.14734	0.591000	0.81541	TGT	.		0.388	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
SENP6	26054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76423518	76423518	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:76423518C>T	ENST00000447266.2	+	23	3584	c.3106C>T	c.(3106-3108)Cag>Tag	p.Q1036*	SENP6_ENST00000370010.2_Nonsense_Mutation_p.Q1029*|SENP6_ENST00000541192.1_3'UTR|SENP6_ENST00000370014.3_Nonsense_Mutation_p.Q1036*	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	1036	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				ATATGTATTGCAGTATGTAGA	0.328																																					p.Q1036X		.											.	SENP6-660	0			c.C3106T						.						105.0	98.0	100.0					6																	76423518		1823	4079	5902	SO:0001587	stop_gained	26054	exon23			GTATTGCAGTATG		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.3106C>T	6.37:g.76423518C>T	ENSP00000402527:p.Gln1036*	56	0		75	7	NM_015571	0	0	12	16	4	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Nonsense_Mutation	SNP	ENST00000447266.2	37	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	C	47	13.420929	0.99741	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-2.2467	18.6197	0.91317	0.0:1.0:0.0:0.0	.	.	.	.	X	1029;1036;1036	.	ENSP00000359027:Q1029X	Q	+	1	0	SENP6	76480238	1.000000	0.71417	0.997000	0.53966	0.356000	0.29392	7.400000	0.79949	2.478000	0.83669	0.563000	0.77884	CAG	.		0.328	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
TSPYL4	23270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	116574092	116574092	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:116574092G>C	ENST00000420283.1	-	1	1169	c.1080C>G	c.(1078-1080)gaC>gaG	p.D360E	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	360					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		GAAGGCTGTGGTCTGAAAACC	0.517																																					p.D360E		.											.	.	0			c.C1080G						.						76.0	75.0	75.0					6																	116574092		1906	4137	6043	SO:0001583	missense	23270	exon1			GCTGTGGTCTGAA		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.1080C>G	6.37:g.116574092G>C	ENSP00000410943:p.Asp360Glu	115	0		124	12	NM_021648	0	0	2	2	0	B4DYQ2|O94828|Q96GW8	Missense_Mutation	SNP	ENST00000420283.1	37	CCDS5106.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244603	0.59103	.	.	ENSG00000187189	ENST00000420283	T	0.32023	1.47	3.83	0.934	0.19477	.	.	.	.	.	T	0.20536	0.0494	L	0.58583	1.82	0.42787	D	0.993882	P	0.38048	0.616	P	0.47528	0.549	T	0.07424	-1.0773	9	0.49607	T	0.09	-15.4319	5.5694	0.17188	0.3912:0.0:0.6088:0.0	.	360	Q9UJ04	TSYL4_HUMAN	E	360	ENSP00000410943:D360E	ENSP00000410943:D360E	D	-	3	2	TSPYL4	116680785	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.700000	0.37815	0.175000	0.19841	0.462000	0.41574	GAC	.		0.517	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041934.2		
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.C247G						.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	0	0		5	5	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A240C						.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		0	0		4	4	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271980	132271980	+	Silent	SNP	T	T	G	rs6934749		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:132271980T>G	ENST00000367976.3	-	2	419	c.219A>C	c.(217-219)ccA>ccC	p.P73P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	73	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCGGGTCGCATGGGTCGCGCT	0.716													G|||	5008	1.0	1.0	1.0	5008	,	,		7576	1.0		1.0	False		,,,				2504	1.0				p.P73P	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A219C						.						6.0	8.0	7.0					6																	132271980		2100	4127	6227	SO:0001819	synonymous_variant	1490	exon2			GTCGCATGGGTCG	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.219A>C	6.37:g.132271980T>G		0	0		5	5	NM_001901	0	0	0	41	41	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.716	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
VNN1	8876	broad.mit.edu;bcgsc.ca	37	6	133014263	133014263	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:133014263C>T	ENST00000367928.4	-	4	739	c.726G>A	c.(724-726)ttG>ttA	p.L242L		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	242	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)			NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		ACAAATGTGGCAAAACATTCA	0.433																																					p.L242L		.											.	VNN1-93	0			c.G726A						.						140.0	120.0	126.0					6																	133014263		2203	4300	6503	SO:0001819	synonymous_variant	8876	exon4			ATGTGGCAAAACA	AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.726G>A	6.37:g.133014263C>T		167	1		292	26	NM_004666	0	0	0	0	0	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Silent	SNP	ENST00000367928.4	37	CCDS5159.1																																																																																			.		0.433	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1		
GPR126	57211	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	142729367	142729367	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:142729367G>T	ENST00000230173.6	+	16	2825	c.2349G>T	c.(2347-2349)aaG>aaT	p.K783N	GPR126_ENST00000296932.8_Missense_Mutation_p.K755N|GPR126_ENST00000367608.2_Missense_Mutation_p.K755N|GPR126_ENST00000367609.3_Missense_Mutation_p.K783N	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	783					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		AGAATCTGAAGGATCCTGTTC	0.358																																					p.K783N		.											.	GPR126-91	0			c.G2349T						.						65.0	61.0	62.0					6																	142729367		1815	4077	5892	SO:0001583	missense	57211	exon16			TCTGAAGGATCCT	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.2349G>T	6.37:g.142729367G>T	ENSP00000230173:p.Lys783Asn	198	0		257	15	NM_198569	0	0	0	0	0	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	ENST00000230173.6	37	CCDS47490.1	.	.	.	.	.	.	.	.	.	.	G	6.344	0.431489	0.12045	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.25085	1.83;1.82;1.83;1.83	5.4	1.55	0.23275	.	0.627512	0.15573	N	0.255339	T	0.07548	0.0190	L	0.43152	1.355	0.35059	D	0.761391	P;P;P;B	0.36315	0.547;0.547;0.547;0.411	B;B;B;B	0.36335	0.222;0.222;0.222;0.111	T	0.26155	-1.0111	10	0.22706	T	0.39	.	6.1933	0.20536	0.2841:0.1242:0.5917:0.0	.	755;783;755;783	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	N	783;755;755;783	ENSP00000230173:K783N;ENSP00000356580:K755N;ENSP00000296932:K755N;ENSP00000356581:K783N	ENSP00000230173:K783N	K	+	3	2	GPR126	142771060	1.000000	0.71417	0.818000	0.32626	0.032000	0.12392	1.735000	0.38176	0.055000	0.16094	-0.894000	0.02916	AAG	.		0.358	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
TULP4	56995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	158900810	158900810	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:158900810C>A	ENST00000367097.3	+	7	2411	c.1054C>A	c.(1054-1056)Cac>Aac	p.H352N	TULP4_ENST00000367094.2_Missense_Mutation_p.H352N	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	352					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CTGCTGGGGTCACCGGGATTC	0.572																																					p.H352N		.											.	TULP4-91	0			c.C1054A						.						70.0	62.0	64.0					6																	158900810		2203	4300	6503	SO:0001583	missense	56995	exon7			TGGGGTCACCGGG		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1054C>A	6.37:g.158900810C>A	ENSP00000356064:p.His352Asn	69	0		103	37	NM_020245	0	0	0	0	0	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359885	0.82353	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.15834	2.39;2.39	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.147583	0.64402	N	0.000009	T	0.15349	0.0370	L	0.50333	1.59	0.80722	D	1	D;P;P	0.55385	0.971;0.952;0.888	P;P;B	0.45712	0.491;0.453;0.342	T	0.00972	-1.1495	10	0.42905	T	0.14	-15.8902	19.6786	0.95946	0.0:1.0:0.0:0.0	.	352;352;352	B4E202;Q9NRJ4-2;Q9NRJ4	.;.;TULP4_HUMAN	N	352	ENSP00000356064:H352N;ENSP00000356061:H352N	ENSP00000356061:H352N	H	+	1	0	TULP4	158820798	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.313000	0.78978	2.651000	0.90000	0.561000	0.74099	CAC	.		0.572	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		4	0		12	9	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		0	0		11	6	NM_001080495	0	0	0	1	1	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	0	0		21	9	NM_032172	0	0	2	3	1	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
TWISTNB	221830	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	19738103	19738103	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:19738103G>T	ENST00000222567.5	-	4	923	c.853C>A	c.(853-855)Cag>Aag	p.Q285K		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	285	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						TGAACTTCCTGGTGCTTTTTC	0.428																																					p.Q285K		.											.	TWISTNB-91	0			c.C853A						.						225.0	249.0	241.0					7																	19738103		2203	4299	6502	SO:0001583	missense	221830	exon4			CTTCCTGGTGCTT	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.853C>A	7.37:g.19738103G>T	ENSP00000222567:p.Gln285Lys	46	0		94	5	NM_001002926	0	0	6	8	2	A0PJ45|B7Z724	Missense_Mutation	SNP	ENST00000222567.5	37	CCDS34606.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495268	0.26774	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.63	3.66	0.41972	.	1.220510	0.05234	N	0.510877	T	0.40522	0.1120	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31971	-0.9924	9	0.09843	T	0.71	-3.7987	8.7395	0.34550	0.0:0.1196:0.4258:0.4545	.	285	Q3B726	RPA43_HUMAN	K	285	.	ENSP00000222567:Q285K	Q	-	1	0	TWISTNB	19704628	0.673000	0.27539	0.742000	0.31022	0.898000	0.52572	1.281000	0.33214	1.317000	0.45149	0.484000	0.47621	CAG	.		0.428	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
GPNMB	10457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23296587	23296587	+	Silent	SNP	C	C	T	rs371662186		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:23296587C>T	ENST00000381990.2	+	4	605	c.444C>T	c.(442-444)acC>acT	p.T148T	GPNMB_ENST00000258733.4_Silent_p.T148T|GPNMB_ENST00000539136.1_Silent_p.T49T|GPNMB_ENST00000409458.3_Silent_p.T148T|GPNMB_ENST00000453162.2_Intron	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	148					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			AAAATGGCACCGGCCAAAGCC	0.488																																					p.T148T		.											.	GPNMB-580	0			c.C444T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	132.0	110.0	118.0		444,444	-6.0	0.0	7		118	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GPNMB	NM_001005340.1,NM_002510.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	148/573,148/561	23296587	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10457	exon4			TGGCACCGGCCAA	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.444C>T	7.37:g.23296587C>T		225	0		317	135	NM_002510	0	0	124	239	115	A4D155|Q6UVX1|Q8N1A1	Silent	SNP	ENST00000381990.2	37	CCDS34610.1																																																																																			.		0.488	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
PURB	5814	hgsc.bcm.edu	37	7	44924461	44924461	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:44924461G>T	ENST00000395699.2	-	1	499	c.487C>A	c.(487-489)Ccg>Acg	p.P163T	RP4-673M15.1_ENST00000608450.1_RNA	NM_033224.3	NP_150093.1	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	163	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of myeloid cell differentiation (GO:0045637)|transcription, DNA-templated (GO:0006351)	DNA replication factor A complex (GO:0005662)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)|skin(1)	7						AAgccgcccggcccggggccc	0.701																																					p.P163T		.											.	PURB-90	0			c.C487A						.						3.0	4.0	4.0					7																	44924461		1917	3736	5653	SO:0001583	missense	5814	exon1			CGCCCGGCCCGGG		CCDS5499.1	7p13	2008-07-18			ENSG00000146676	ENSG00000146676			9702	protein-coding gene	gene with protein product		608887				1448097	Standard	NM_033224		Approved	PURBETA	uc003tme.3	Q96QR8	OTTHUMG00000023578	ENST00000395699.2:c.487C>A	7.37:g.44924461G>T	ENSP00000379051:p.Pro163Thr	3	0		21	6	NM_033224	0	0	0	0	0	A4D2L7	Missense_Mutation	SNP	ENST00000395699.2	37	CCDS5499.1	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.388051	0.01194	.	.	ENSG00000146676	ENST00000395699	T	0.30714	1.52	3.55	2.56	0.30785	.	1.020030	0.07879	U	0.969179	T	0.28466	0.0704	N	0.22421	0.69	0.35924	D	0.831995	B	0.25169	0.119	B	0.40228	0.323	T	0.33879	-0.9851	10	0.29301	T	0.29	.	9.0368	0.36293	0.0:0.3657:0.6343:0.0	.	163	Q96QR8	PURB_HUMAN	T	163	ENSP00000379051:P163T	ENSP00000379051:P163T	P	-	1	0	PURB	44890986	0.317000	0.24589	1.000000	0.80357	0.298000	0.27526	1.913000	0.39956	1.967000	0.57214	0.462000	0.41574	CCG	.		0.701	PURB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251332.2	NM_033224	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	47930172	47930172	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:47930172C>A	ENST00000289672.2	-	16	2693	c.2643G>T	c.(2641-2643)gtG>gtT	p.V881V		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	881	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGGACAGGAACACCCGGGTCT	0.562																																					p.V881V		.											.	PKD1L1-145	0			c.G2643T						.						87.0	80.0	82.0					7																	47930172		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon16			CAGGAACACCCGG	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2643G>T	7.37:g.47930172C>A		88	0		139	11	NM_138295	0	0	0	0	0	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																			.		0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PHTF2	57157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	77579101	77579101	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:77579101C>A	ENST00000248550.7	+	16	2142	c.2066C>A	c.(2065-2067)tCa>tAa	p.S689*	PHTF2_ENST00000307305.8_Nonsense_Mutation_p.S651*|PHTF2_ENST00000416283.2_Nonsense_Mutation_p.S655*|PHTF2_ENST00000422959.2_Nonsense_Mutation_p.S655*|PHTF2_ENST00000275575.7_Intron			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	689					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						ACCCTTGGATCAGAAACAAGT	0.333																																					p.S655X		.											.	PHTF2-23	0			c.C1964A						.						94.0	84.0	87.0					7																	77579101		1840	4077	5917	SO:0001587	stop_gained	57157	exon15			TTGGATCAGAAAC	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.2066C>A	7.37:g.77579101C>A	ENSP00000248550:p.Ser689*	114	0		167	9	NM_001127357	0	0	1	1	0	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Nonsense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	C	41	8.596037	0.98879	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000416283;ENST00000248550	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5705	19.3637	0.94453	0.0:1.0:0.0:0.0	.	.	.	.	X	655;655;651;655;689	.	ENSP00000248550:S689X	S	+	2	0	PHTF2	77417037	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.648000	0.89879	0.655000	0.94253	TCA	.		0.333	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
NPTX2	4885	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	98256610	98256610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:98256610G>A	ENST00000265634.3	+	4	1187	c.1022G>A	c.(1021-1023)tGg>tAg	p.W341*		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	341	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CTGGCCCCCTGGCACCCCATC	0.652																																					p.W341X		.											.	NPTX2-515	0			c.G1022A						.						71.0	59.0	63.0					7																	98256610		2203	4300	6503	SO:0001587	stop_gained	4885	exon4			CCCCCTGGCACCC		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1022G>A	7.37:g.98256610G>A	ENSP00000265634:p.Trp341*	105	0		178	17	NM_002523	0	0	5	6	1	A4D267|Q86XV7|Q96G70	Nonsense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	G	37	6.250667	0.97412	.	.	ENSG00000106236	ENST00000265634	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-14.0198	18.4968	0.90867	0.0:0.0:1.0:0.0	.	.	.	.	X	341	.	ENSP00000265634:W341X	W	+	2	0	NPTX2	98094546	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.908000	0.87438	2.682000	0.91365	0.655000	0.94253	TGG	.		0.652	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
FAM185A	222234	bcgsc.ca	37	7	102427889	102427889	+	Missense_Mutation	SNP	C	C	T	rs116082009	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:102427889C>T	ENST00000413034.2	+	7	1039	c.1039C>T	c.(1039-1041)Cgt>Tgt	p.R347C	FAM185A_ENST00000409231.3_Missense_Mutation_p.R230C	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	347										kidney(1)	1						GGCTGAAGTTCGTAAAGATGA	0.403													C|||	590	0.117812	0.1407	0.1542	5008	,	,		19248	0.0119		0.1948	False		,,,				2504	0.091				p.R347C		.											.	.	0			c.C1039T						.						191.0	152.0	164.0					7																	102427889		692	1591	2283	SO:0001583	missense	222234	exon7			GAAGTTCGTAAAG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.1039C>T	7.37:g.102427889C>T	ENSP00000395340:p.Arg347Cys	835	5		1093	108	NM_001145268	0	0	1	1	0	A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	ENST00000413034.2	37	CCDS47676.1	292	0.1336996336996337	64	0.13008130081300814	66	0.18232044198895028	5	0.008741258741258742	157	0.20712401055408972	C	12.82	2.052152	0.36181	.	.	ENSG00000222011	ENST00000432852;ENST00000409231;ENST00000413034	T;T	0.45668	0.89;0.93	4.09	2.16	0.27623	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.13710	-1.0499	8	0.52906	T	0.07	0.6665	6.9447	0.24512	0.0:0.771:0.0:0.229	rs17842496;rs17842496	247;230;347	B4DMG7;Q8N0U4-3;Q8N0U4	.;.;F185A_HUMAN	C	247;230;347	ENSP00000387066:R230C;ENSP00000395340:R347C	ENSP00000387066:R230C	R	+	1	0	FAM185A	102215125	0.000000	0.05858	0.001000	0.08648	0.863000	0.49368	0.422000	0.21296	0.883000	0.36040	0.536000	0.68110	CGT	C|0.859;T|0.141		0.403	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349482.1	NM_001145268	
ZNF277	11179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	111982631	111982631	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:111982631C>A	ENST00000361822.3	+	12	1329	c.1200C>A	c.(1198-1200)acC>acA	p.T400T	AC004112.4_ENST00000411413.1_RNA|AC004112.4_ENST00000431064.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	400					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						ATTTTCCAACCTATGAAAATG	0.353																																					p.T400T		.											.	ZNF277-155	0			c.C1200A						.						75.0	69.0	71.0					7																	111982631		2203	4300	6503	SO:0001819	synonymous_variant	11179	exon12			TCCAACCTATGAA	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.1200C>A	7.37:g.111982631C>A		67	0		93	37	NM_021994	0	0	21	27	6	Q75MZ2|Q75MZ3|Q8WY14	Silent	SNP	ENST00000361822.3	37	CCDS5755.2																																																																																			.		0.353	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	NM_021994	
TMEM229A	730130	broad.mit.edu	37	7	123672457	123672462	+	In_Frame_Del	DEL	GCTGCT	GCTGCT	-	rs71163719|rs374529977|rs566327350|rs72310362	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:123672457_123672462delGCTGCT	ENST00000455783.1	-	1	1061_1066	c.596_601delAGCAGC	c.(595-603)cagcagcgg>cgg	p.QQ199del	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	199						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						GCGCCCCTCCgctgctgctgctgctg	0.757														714	0.142572	0.3026	0.0908	5008	,	,		13703	0.002		0.1282	False		,,,				2504	0.1227				p.199_201del		.											.	.	0			c.596_601del						.			16,422,143,1041		8,0,0,0,177,9,59,56,22,480						-4.0	0.0			3	5,438,299,2868		1,0,0,3,176,3,83,104,88,1347	no	codingComplex	TMEM229A	NM_001136002.1		9,0,0,3,353,12,142,160,110,1827	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		20.554,35.82,25.2867				21,860,442,3909				SO:0001651	inframe_deletion	730130	exon1			CCCTCCGCTGCTG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.596_601delAGCAGC	7.37:g.123672463_123672468delGCTGCT	ENSP00000395244:p.Gln199_Gln200del	3	0		20	0	NM_001136002	0	0	0	0	0	A4D0X6	In_Frame_Del	DEL	ENST00000455783.1	37	CCDS47694.1																																																																																			.		0.757	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	1	0		63	12	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
EXOC4	60412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	133692487	133692487	+	Silent	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:133692487C>A	ENST00000253861.4	+	17	2615	c.2586C>A	c.(2584-2586)atC>atA	p.I862I	EXOC4_ENST00000541309.1_Silent_p.I150I|EXOC4_ENST00000545148.1_Silent_p.I472I|EXOC4_ENST00000539845.1_Silent_p.I761I	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	862					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				TCAGGCGCATCAGTGAGTCTG	0.512																																					p.I862I		.											.	EXOC4-159	0			c.C2586A						.						77.0	64.0	68.0					7																	133692487		2203	4300	6503	SO:0001819	synonymous_variant	60412	exon17			GCGCATCAGTGAG	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2586C>A	7.37:g.133692487C>A		108	0		151	44	NM_021807	0	0	5	10	5	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Silent	SNP	ENST00000253861.4	37	CCDS5829.1																																																																																			.		0.512	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
KLRG2	346689	hgsc.bcm.edu	37	7	139168063	139168063	+	Missense_Mutation	SNP	G	G	A	rs12707447	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:139168063G>A	ENST00000340940.4	-	1	395	c.326C>T	c.(325-327)gCg>gTg	p.A109V	KLRG2_ENST00000393039.2_Missense_Mutation_p.A109V	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	109	Pro-rich.			A -> V (in Ref. 3; EAL24036). {ECO:0000305}.		integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					AGCCCCGGGCGCCTCGCCATT	0.766													G|||	1330	0.265575	0.4675	0.2565	5008	,	,		10831	0.0179		0.3161	False		,,,				2504	0.2025				p.A109V		.											.	KLRG2-90	0			c.C326T						.	G	VAL/ALA	1270,1542		314,642,450	3.0	4.0	4.0		326	1.5	0.1	7	dbSNP_121	4	2136,4112		483,1170,1471	no	missense	KLRG2	NM_198508.2	64	797,1812,1921	AA,AG,GG		34.1869,45.1636,37.5938	benign	109/410	139168063	3406,5654	1406	3124	4530	SO:0001583	missense	346689	exon1			CCGGGCGCCTCGC	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.326C>T	7.37:g.139168063G>A	ENSP00000339356:p.Ala109Val	2	0		9	6	NM_198508	0	0	0	0	0	Q2NL79|Q6ZTV6	Missense_Mutation	SNP	ENST00000340940.4	37	CCDS5854.1	579	0.2651098901098901	245	0.49796747967479676	95	0.26243093922651933	13	0.022727272727272728	226	0.29815303430079154	G	12.57	1.978353	0.34942	0.451636	0.341869	ENSG00000188883	ENST00000340940;ENST00000393039	T;T	0.51574	3.73;0.7	3.44	1.48	0.22813	.	0.520969	0.14130	U	0.339448	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.52463	0.953;0.953	B;B	0.35813	0.211;0.149	T	0.47381	-0.9122	9	0.87932	D	0	-1.9235	9.4134	0.38505	0.0:0.3741:0.6259:0.0	rs12707447	109;109	A4D1S0-2;A4D1S0	.;KLRG2_HUMAN	V	109	ENSP00000339356:A109V;ENSP00000376759:A109V	ENSP00000339356:A109V	A	-	2	0	KLRG2	138818603	0.000000	0.05858	0.100000	0.21137	0.123000	0.20343	0.302000	0.19192	0.110000	0.17919	0.484000	0.47621	GCG	G|0.735;A|0.265		0.766	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508	
TAS2R40	259286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142919418	142919418	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:142919418C>A	ENST00000408947.3	+	1	289	c.247C>A	c.(247-249)Cta>Ata	p.L83I	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	83					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					TTTCAGTCTGCTATTCCGAAT	0.438																																					p.L83I		.											.	TAS2R40-23	0			c.C247A						.						132.0	128.0	130.0					7																	142919418		1913	4140	6053	SO:0001583	missense	259286	exon1			AGTCTGCTATTCC	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.247C>A	7.37:g.142919418C>A	ENSP00000386210:p.Leu83Ile	61	0		70	6	NM_176882	0	0	0	0	0	A4D2I2|Q645W6	Missense_Mutation	SNP	ENST00000408947.3	37	CCDS43662.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941022	0.34283	.	.	ENSG00000221937	ENST00000408947	T	0.40756	1.02	4.56	-1.93	0.07594	.	0.857477	0.09587	U	0.781988	T	0.35770	0.0943	L	0.58669	1.825	0.09310	N	1	B	0.23128	0.08	B	0.31016	0.123	T	0.40553	-0.9557	10	0.30854	T	0.27	.	5.4164	0.16376	0.0:0.3859:0.2409:0.3732	.	83	P59535	T2R40_HUMAN	I	83	ENSP00000386210:L83I	ENSP00000386210:L83I	L	+	1	2	TAS2R40	142629540	0.000000	0.05858	0.000000	0.03702	0.558000	0.35554	-0.568000	0.05909	-0.331000	0.08501	0.655000	0.94253	CTA	.		0.438	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327097.1		
OR2A14	135941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143826247	143826247	+	Silent	SNP	G	G	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:143826247G>A	ENST00000408899.2	+	1	97	c.42G>A	c.(40-42)ccG>ccA	p.P14P		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P14P(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					TCACCTTGCCGCGATTCCAGG	0.517																																					p.P14P		.											.	OR2A14-90	1	Substitution - coding silent(1)	lung(1)	c.G42A						.						101.0	100.0	100.0					7																	143826247		2038	4191	6229	SO:0001819	synonymous_variant	135941	exon1			CTTGCCGCGATTC		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.42G>A	7.37:g.143826247G>A		165	0		187	57	NM_001001659	0	0	0	0	0	Q6IF41|Q8NGT8	Silent	SNP	ENST00000408899.2	37	CCDS43672.1																																																																																			.		0.517	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
OR2A14	135941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143826338	143826338	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:143826338T>G	ENST00000408899.2	+	1	188	c.133T>G	c.(133-135)Ttt>Gtt	p.F45V		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					TGGGGTCATCTTTGGGATTAT	0.507																																					p.F45V		.											.	OR2A14-90	0			c.T133G						.						192.0	189.0	190.0					7																	143826338		2073	4241	6314	SO:0001583	missense	135941	exon1			GTCATCTTTGGGA		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.133T>G	7.37:g.143826338T>G	ENSP00000386137:p.Phe45Val	197	0		276	27	NM_001001659	0	0	0	0	0	Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	T	0.173	-1.069567	0.01918	.	.	ENSG00000221938	ENST00000408899	T	0.00357	7.89	4.18	-3.65	0.04502	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.01505	-0.83	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.09335	-1.0679	9	0.38643	T	0.18	-1.3499	5.7512	0.18148	0.0:0.2711:0.2585:0.4704	.	45	Q96R47	O2A14_HUMAN	V	45	ENSP00000386137:F45V	ENSP00000386137:F45V	F	+	1	0	OR2A14	143457271	0.000000	0.05858	0.006000	0.13384	0.039000	0.13416	-2.184000	0.01254	-0.913000	0.03832	-0.366000	0.07423	TTT	.		0.507	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
ARHGEF5	7984	broad.mit.edu	37	7	144062343	144062343	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:144062343A>T	ENST00000056217.5	+	2	2755	c.2581A>T	c.(2581-2583)Agg>Tgg	p.R861W	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	861					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GTCCAGGGGGAGGAGCAGGAG	0.592																																					p.R861W		.											.	ARHGEF5-229	0			c.A2581T						.						65.0	74.0	71.0					7																	144062343		2201	4298	6499	SO:0001583	missense	7984	exon2			AGGGGGAGGAGCA	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2581A>T	7.37:g.144062343A>T	ENSP00000056217:p.Arg861Trp	331	2		392	9	NM_005435	0	0	0	0	0	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.892564	0.33442	.	.	ENSG00000050327	ENST00000056217	T	0.80566	-1.39	4.05	2.84	0.33178	.	0.352939	0.23012	N	0.052959	T	0.81437	0.4822	L	0.34521	1.04	0.24573	N	0.993913	D	0.76494	0.999	D	0.72982	0.979	T	0.70612	-0.4824	10	0.87932	D	0	-11.7374	7.2598	0.26197	0.7739:0.2261:0.0:0.0	.	861	Q12774	ARHG5_HUMAN	W	861	ENSP00000056217:R861W	ENSP00000056217:R861W	R	+	1	2	ARHGEF5	143693276	0.003000	0.15002	0.219000	0.23793	0.011000	0.07611	0.645000	0.24782	0.583000	0.29574	0.454000	0.30748	AGG	.		0.592	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
C7orf33	202865	bcgsc.ca	37	7	148311375	148311375	+	Missense_Mutation	SNP	G	G	T	rs145413433		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr7:148311375G>T	ENST00000307003.2	+	2	807	c.446G>T	c.(445-447)aGt>aTt	p.S149I		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	149										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			ACAGTGACAAGTTCATACCTA	0.478																																					p.S149I		.											.	C7orf33-90	0			c.G446T						.						128.0	106.0	114.0					7																	148311375		2203	4300	6503	SO:0001583	missense	202865	exon2			TGACAAGTTCATA	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.446G>T	7.37:g.148311375G>T	ENSP00000304071:p.Ser149Ile	142	0		188	9	NM_145304	0	0	0	0	0		Missense_Mutation	SNP	ENST00000307003.2	37	CCDS5890.1	.	.	.	.	.	.	.	.	.	.	G	6.324	0.427789	0.11987	.	.	ENSG00000170279	ENST00000307003	.	.	.	1.88	-1.15	0.09709	.	.	.	.	.	T	0.22437	0.0541	N	0.19112	0.55	0.09310	N	1	P	0.51537	0.946	P	0.50934	0.654	T	0.12578	-1.0542	8	0.87932	D	0	.	2.3867	0.04367	0.3552:0.2997:0.3451:0.0	.	149	Q8WU49	CG033_HUMAN	I	149	.	ENSP00000304071:S149I	S	+	2	0	C7orf33	147942308	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	-0.078000	0.11375	-0.257000	0.09459	0.462000	0.41574	AGT	G|1.000;A|0.000		0.478	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304	
ADCY8	114	hgsc.bcm.edu	37	8	132052342	132052342	+	Missense_Mutation	SNP	C	C	T	rs2228949	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr8:132052342C>T	ENST00000286355.5	-	1	2330	c.238G>A	c.(238-240)Gcg>Acg	p.A80T	ADCY8_ENST00000377928.3_Missense_Mutation_p.A80T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	80			A -> T (in dbSNP:rs2228949).		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGCTGCGGCGCGTGGTGGTTG	0.726										HNSCC(32;0.087)			C|||	90	0.0179712	0.0015	0.0187	5008	,	,		11522	0.0		0.0338	False		,,,				2504	0.0419				p.A80T		.											.	ADCY8-157	0			c.G238A						.	C	THR/ALA	20,3732		0,20,1856	3.0	3.0	3.0		238	4.6	1.0	8	dbSNP_98	3	227,7205		0,227,3489	no	missense	ADCY8	NM_001115.2	58	0,247,5345	TT,TC,CC		3.0544,0.533,2.2085	benign	80/1252	132052342	247,10937	1876	3716	5592	SO:0001583	missense	114	exon1			GCGGCGCGTGGTG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.238G>A	8.37:g.132052342C>T	ENSP00000286355:p.Ala80Thr	0	0		28	21	NM_001115	0	0	0	0	0		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	43	0.019688644688644688	4	0.008130081300813009	8	0.022099447513812154	4	0.006993006993006993	27	0.03562005277044855	C	18.88	3.716491	0.68844	0.00533	0.030544	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.65916	-0.18;-0.18	4.55	4.55	0.56014	.	0.116934	0.38605	N	0.001630	T	0.12817	0.0311	L	0.36672	1.1	0.29715	N	0.839078	B;B	0.32731	0.076;0.382	B;B	0.15052	0.012;0.012	T	0.09596	-1.0667	10	0.13470	T	0.59	.	6.3928	0.21595	0.0:0.7154:0.187:0.0976	rs2228949	80;80	E7EVL1;P40145	.;ADCY8_HUMAN	T	80	ENSP00000286355:A80T;ENSP00000367161:A80T	ENSP00000286355:A80T	A	-	1	0	ADCY8	132121524	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.772000	0.38552	2.383000	0.81215	0.462000	0.41574	GCG	C|0.979;T|0.021		0.726	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
PHF20L1	51105	broad.mit.edu;bcgsc.ca	37	8	133816893	133816893	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr8:133816893T>G	ENST00000395386.2	+	8	1054	c.755T>G	c.(754-756)tTt>tGt	p.F252C	PHF20L1_ENST00000395379.1_Missense_Mutation_p.F252C|PHF20L1_ENST00000220847.7_5'UTR|PHF20L1_ENST00000395376.1_Missense_Mutation_p.F257C|PHF20L1_ENST00000337920.4_Missense_Mutation_p.F226C|PHF20L1_ENST00000395390.2_Missense_Mutation_p.F227C	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	252							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AAGATGGTCTTTCCACAGCCA	0.353																																					p.F252C		.											.	PHF20L1-92	0			c.T755G						.						96.0	89.0	92.0					8																	133816893		2203	4300	6503	SO:0001583	missense	51105	exon8			TGGTCTTTCCACA	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.755T>G	8.37:g.133816893T>G	ENSP00000378784:p.Phe252Cys	197	0		213	8	NM_016018	0	0	7	7	0	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	T	18.97	3.734975	0.69189	.	.	ENSG00000129292	ENST00000395383;ENST00000395379;ENST00000361997;ENST00000395386;ENST00000315808;ENST00000337920;ENST00000395376;ENST00000395382;ENST00000395390;ENST00000395374	T;T;T;T;T;T;T;T	0.48836	0.81;0.82;0.82;1.42;0.8;0.81;0.82;1.42	5.5	5.5	0.81552	.	0.203253	0.45867	D	0.000333	T	0.55609	0.1931	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.998;0.998;0.969	D;D;D;D;P	0.87578	0.966;0.998;0.994;0.965;0.794	T	0.54984	-0.8211	10	0.37606	T	0.19	-9.904	14.7798	0.69756	0.0:0.0:0.0:1.0	.	227;91;252;252;226	F8W9L8;G5E9D0;A8MW92;A8MW92-4;A8MW92-2	.;.;P20L1_HUMAN;.;.	C	256;252;227;252;252;226;257;122;227;91	ENSP00000378781:F256C;ENSP00000378777:F252C;ENSP00000355301:F227C;ENSP00000378784:F252C;ENSP00000324519:F252C;ENSP00000338269:F226C;ENSP00000378775:F257C;ENSP00000378788:F227C	ENSP00000324519:F252C	F	+	2	0	PHF20L1	133886075	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.645000	0.46621	2.098000	0.63641	0.477000	0.44152	TTT	.		0.353	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	139609190	139609190	+	Silent	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr8:139609190G>T	ENST00000303045.6	-	62	4835	c.4389C>A	c.(4387-4389)acC>acA	p.T1463T	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Silent_p.T1443T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1463	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCCGACGCAGGGTTTCCATGG	0.522										HNSCC(7;0.00092)																											p.T1463T		.											.	COL22A1-103	0			c.C4389A						.						147.0	149.0	148.0					8																	139609190		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon62			ACGCAGGGTTTCC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4389C>A	8.37:g.139609190G>T		100	0		101	20	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			.		0.522	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		1	0		11	11	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MAFA	389692	hgsc.bcm.edu	37	8	144511538	144511538	+	Missense_Mutation	SNP	C	C	A	rs62521874	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr8:144511538C>A	ENST00000333480.2	-	1	1038	c.1039G>T	c.(1039-1041)Ggc>Tgc	p.G347C	MAFA_ENST00000528185.1_Intron	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	347					insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			TCGGCCGTGCCCTTGGCCCCG	0.791										HNSCC(29;0.082)			.|||	216	0.043131	0.0015	0.0432	5008	,	,		7958	0.0546		0.0805	False		,,,				2504	0.0491				p.G347C		.											.	MAFA-278	0			c.G1039T						.						1.0	1.0	1.0					8																	144511538		583	1267	1850	SO:0001583	missense	389692	exon1			CCGTGCCCTTGGC	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.1039G>T	8.37:g.144511538C>A	ENSP00000328364:p.Gly347Cys	0	0		5	5	NM_201589	0	0	0	0	0		Missense_Mutation	SNP	ENST00000333480.2	37	CCDS34955.1	117	0.05357142857142857	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	66	0.0870712401055409	c	12.29	1.892291	0.33442	.	.	ENSG00000182759	ENST00000333480	D	0.98329	-4.87	2.95	2.95	0.34219	.	0.473148	0.18433	U	0.141380	T	0.54806	0.1881	N	0.08118	0	0.29259	N	0.871434	D	0.56746	0.977	P	0.49561	0.615	T	0.75476	-0.3304	10	0.37606	T	0.19	.	12.4259	0.55546	0.0:1.0:0.0:0.0	rs62521874	347	Q8NHW3	MAFA_HUMAN	C	347	ENSP00000328364:G347C	ENSP00000328364:G347C	G	-	1	0	MAFA	144582681	0.989000	0.36119	0.957000	0.39632	0.383000	0.30230	2.086000	0.41643	1.183000	0.42943	0.282000	0.19409	GGC	C|0.946;A|0.054		0.791	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381511.2	NM_201589	
C9orf66	157983	hgsc.bcm.edu	37	9	215057	215057	+	Missense_Mutation	SNP	T	T	C	rs481905	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:215057T>C	ENST00000382387.2	-	1	836	c.340A>G	c.(340-342)Aac>Gac	p.N114D	DOCK8_ENST00000453981.1_Intron|DOCK8_ENST00000432829.2_Intron	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	114										central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GCGCGCAGGTTGCGGCCGGAC	0.736													C|||	3213	0.641573	0.705	0.611	5008	,	,		9955	0.7401		0.4811	False		,,,				2504	0.6411				p.N114D		.											.	C9orf66-514	0			c.A340G						.	C	,ASP/ASN	1480,1394		426,628,383	3.0	4.0	4.0		,340	1.6	0.0	9	dbSNP_83	4	2555,3973		602,1351,1311	yes	intron,missense	DOCK8,C9orf66	NM_203447.3,NM_152569.2	,23	1028,1979,1694	CC,CT,TT		39.1391,48.5038,42.9164	,benign	,114/296	215057	4035,5367	1437	3264	4701	SO:0001583	missense	157983	exon1			GCAGGTTGCGGCC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.340A>G	9.37:g.215057T>C	ENSP00000371824:p.Asn114Asp	0	0		6	6	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	1282	0.586996336996337	342	0.6951219512195121	195	0.5386740331491713	381	0.666083916083916	364	0.48021108179419525	C	9.821	1.185669	0.21870	0.514962	0.391391	ENSG00000183784	ENST00000382387	T	0.22539	1.95	2.56	1.6	0.23607	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.47153	P	6.620000000000514E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.20571	-1.0271	8	0.87932	D	0	.	4.3	0.10920	0.0:0.6131:0.2361:0.1509	rs481905;rs58620149	114	Q5T8R8	CI066_HUMAN	D	114	ENSP00000371824:N114D	ENSP00000371824:N114D	N	-	1	0	C9orf66	205057	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.471000	0.06631	-0.029000	0.13827	-0.642000	0.03964	AAC	T|0.413;C|0.587		0.736	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		0	0		38	13	NM_001004125	0	0	2	2	0	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
SPATA31A3	727830	broad.mit.edu;bcgsc.ca	37	9	40702725	40702725	+	Nonsense_Mutation	SNP	G	G	T	rs554911040		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:40702725G>T	ENST00000356699.5	+	4	411	c.382G>T	c.(382-384)Gaa>Taa	p.E128*	RP11-395E19.5_ENST00000432614.1_lincRNA|SPATA31A3_ENST00000463536.1_3'UTR	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	128	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E128*(2)									TGAGGTGGGCGAAAGAGCACC	0.602																																					p.E128X		.											.	.	2	Substitution - Nonsense(2)	kidney(2)	c.G382T						.						13.0	13.0	13.0					9																	40702725		1132	2914	4046	SO:0001587	stop_gained	727830	exon4			GTGGGCGAAAGAG			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.382G>T	9.37:g.40702725G>T	ENSP00000349132:p.Glu128*	969	0		856	50	NM_001083124	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000356699.5	37	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801027	0.31869	.	.	ENSG00000147926	ENST00000356699	.	.	.	2.19	-1.88	0.07713	.	0.593182	0.15064	N	0.282606	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7614	5.8906	0.18911	0.5124:0.0:0.4876:0.0	.	.	.	.	X	128	.	ENSP00000349132:E128X	E	+	1	0	FAM75A3	40692725	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.216000	0.09266	-0.463000	0.06973	-1.750000	0.00680	GAA	.		0.602	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	88918065	88918065	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:88918065C>A	ENST00000375963.3	-	25	4202	c.4030G>T	c.(4030-4032)Gat>Tat	p.D1344Y	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.D1306Y|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.D1108Y|ZCCHC6_ENST00000375957.1_Missense_Mutation_p.D244Y|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.D633Y	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1344					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CAACATCTATCATTTGGGGCC	0.378																																					p.D1344Y		.											.	ZCCHC6-92	0			c.G4030T						.						118.0	124.0	122.0					9																	88918065		2203	4300	6503	SO:0001583	missense	79670	exon25			ATCTATCATTTGG	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.4030G>T	9.37:g.88918065C>A	ENSP00000365130:p.Asp1344Tyr	111	0		125	11	NM_024617	0	0	9	10	1	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420875	0.83559	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375957;ENST00000375963	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	4.86	4.86	0.63082	Zinc finger, CCHC retroviral-type (1);	0.000000	0.85682	D	0.000000	D	0.87317	0.6147	M	0.65498	2.005	0.80722	D	1	P;D;D	0.89917	0.931;1.0;0.97	P;D;P	0.85130	0.645;0.997;0.655	D	0.88373	0.2996	10	0.87932	D	0	-1.7996	18.5424	0.91033	0.0:1.0:0.0:0.0	.	1306;1108;1344	Q5VYS8-6;Q5VYS8-4;Q5VYS8	.;.;TUT7_HUMAN	Y	633;1108;1306;244;1344	ENSP00000277141:D633Y;ENSP00000365127:D1108Y;ENSP00000365128:D1306Y;ENSP00000365124:D244Y;ENSP00000365130:D1344Y	ENSP00000277141:D633Y	D	-	1	0	ZCCHC6	88107885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.285000	0.78660	2.698000	0.92095	0.557000	0.71058	GAT	.		0.378	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
WNK2	65268	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	96025908	96025908	+	Silent	SNP	T	T	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:96025908T>C	ENST00000297954.4	+	14	3471	c.3471T>C	c.(3469-3471)ttT>ttC	p.F1157F	WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000349097.3_Silent_p.F769F|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000395477.2_Silent_p.F1157F|WNK2_ENST00000427277.2_Silent_p.F769F	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1157					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AAGGCGCCTTTGGAGGGGGCA	0.607																																					p.F1157F		.											.	WNK2-765	0			c.T3471C						.						41.0	36.0	38.0					9																	96025908		2199	4295	6494	SO:0001819	synonymous_variant	65268	exon14			CGCCTTTGGAGGG	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.3471T>C	9.37:g.96025908T>C		51	0		74	9	NM_006648	0	0	0	0	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	10.49|10.49	1.364884|1.364884	0.24684|0.24684	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000432730|ENST00000411624	.|.	.|.	.|.	5.32|5.32	1.72|1.72	0.24424|0.24424	.|.	.|.	.|.	.|.	.|.	T|T	0.51822|0.51822	0.1697|0.1697	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	4|4	.|.	.|.	.|.	.|.	5.2519|5.2519	0.15527|0.15527	0.1277:0.2117:0.0:0.6606|0.1277:0.2117:0.0:0.6606	.|.	.|.	.|.	.|.	S|R	1153|761	.|.	.|.	L|W	+|+	2|1	0|0	WNK2|WNK2	95065729|95065729	0.948000|0.948000	0.32251|0.32251	0.705000|0.705000	0.30386|0.30386	0.965000|0.965000	0.64279|0.64279	0.347000|0.347000	0.20014|0.20014	0.110000|0.110000	0.17919|0.17919	-0.383000|-0.383000	0.06682|0.06682	TTG|TGG	.		0.607	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
DBH	1621	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	136518101	136518101	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:136518101G>T	ENST00000393056.2	+	9	1426	c.1414G>T	c.(1414-1416)Gac>Tac	p.D472Y	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	472					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	CAACACAGAAGACCGGGAGCT	0.602																																					p.D472Y		.											.	DBH-516	0			c.G1414T						.						123.0	100.0	108.0					9																	136518101		2203	4300	6503	SO:0001583	missense	1621	exon9			ACAGAAGACCGGG	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1414G>T	9.37:g.136518101G>T	ENSP00000376776:p.Asp472Tyr	249	0		264	23	NM_000787	0	0	0	0	0	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016939	0.35606	.	.	ENSG00000123454	ENST00000393056	T	0.66280	-0.2	4.92	2.8	0.32819	PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.245733	0.45606	D	0.000360	T	0.73410	0.3583	M	0.73598	2.24	0.38203	D	0.940233	D	0.56521	0.976	D	0.64687	0.928	T	0.76862	-0.2802	10	0.87932	D	0	-21.5302	8.5864	0.33660	0.1588:0.0:0.7079:0.1333	.	472	P09172	DOPO_HUMAN	Y	472	ENSP00000376776:D472Y	ENSP00000376776:D472Y	D	+	1	0	DBH	135507922	1.000000	0.71417	0.586000	0.28679	0.222000	0.24845	4.045000	0.57368	1.049000	0.40321	0.491000	0.48974	GAC	.		0.602	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
GLT6D1	360203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	138517976	138517976	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:138517976G>T	ENST00000371763.1	-	4	449	c.196C>A	c.(196-198)Ctg>Atg	p.L66M		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	66					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		TGTTTTTCCAGGACCCGCCTG	0.488																																					p.L66M		.											.	GLT6D1-91	0			c.C196A						.						79.0	82.0	81.0					9																	138517976		1876	4097	5973	SO:0001583	missense	360203	exon4			TTTCCAGGACCCG	AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.196C>A	9.37:g.138517976G>T	ENSP00000360829:p.Leu66Met	123	0		144	51	NM_182974	0	0	0	0	0		Missense_Mutation	SNP	ENST00000371763.1	37	CCDS43900.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809144	0.50421	.	.	ENSG00000204007	ENST00000371763	T	0.02498	4.27	4.18	4.18	0.49190	.	0.000000	0.42294	D	0.000738	T	0.15392	0.0371	M	0.88979	2.995	0.09310	N	1	D	0.76494	0.999	D	0.97110	1.0	T	0.03240	-1.1057	10	0.72032	D	0.01	-25.7749	8.0689	0.30678	0.1095:0.0:0.8904:0.0	.	66	Q7Z4J2	GL6D1_HUMAN	M	66	ENSP00000360829:L66M	ENSP00000360829:L66M	L	-	1	2	GLT6D1	137657797	0.102000	0.21896	0.108000	0.21378	0.013000	0.08279	1.745000	0.38278	2.356000	0.79943	0.609000	0.83330	CTG	.		0.488	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055005.2	NM_182974	
CCDC183	84960	hgsc.bcm.edu	37	9	139694613	139694613	+	Missense_Mutation	SNP	C	C	A	rs35342663	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:139694613C>A	ENST00000338005.6	+	4	465	c.430C>A	c.(430-432)Ctg>Atg	p.L144M	RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA|RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.L174M|KIAA1984_ENST00000371682.3_3'UTR	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		144										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GGAGCTGCGGCTGCTGCAGGT	0.741													C|||	462	0.0922524	0.152	0.0144	5008	,	,		7965	0.1389		0.0219	False		,,,				2504	0.091				p.L144M		.											.	KIAA1984-91	0			c.C430A						.	C	MET/LEU	345,2927		9,327,1300	4.0	4.0	4.0		430	-3.5	0.0	9	dbSNP_126	4	162,7194		2,158,3518	no	missense	KIAA1984	NM_001039374.4	15	11,485,4818	AA,AC,CC		2.2023,10.544,4.7704	benign	144/535	139694613	507,10121	1636	3678	5314	SO:0001583	missense	84960	exon4			CTGCGGCTGCTGC																												ENST00000338005.6:c.430C>A	9.37:g.139694613C>A	ENSP00000338013:p.Leu144Met	3	0		21	11	NM_001039374	0	0	0	0	0	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	155	0.07097069597069597	63	0.12804878048780488	6	0.016574585635359115	71	0.12412587412587413	15	0.01978891820580475	C	8.887	0.953003	0.18431	0.10544	0.022023	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.11604	2.76	4.69	-3.55	0.04639	.	1.415250	0.05927	U	0.634446	T	0.00073	0.0002	N	0.21448	0.665	0.80722	P	0.0	B	0.24368	0.102	B	0.23852	0.049	T	0.40098	-0.9581	9	0.45353	T	0.12	-2.6838	3.6184	0.08086	0.384:0.3008:0.0:0.3152	rs35342663;rs59016673;rs62581420	144	Q5T5S1	K1984_HUMAN	M	144	ENSP00000338013:L144M	ENSP00000338013:L144M	L	+	1	2	KIAA1984	138814434	0.000000	0.05858	0.004000	0.12327	0.449000	0.32228	-3.365000	0.00496	-1.346000	0.02211	-0.384000	0.06662	CTG	C|0.928;A|0.072		0.741	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
FAM157B	100132403	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	141109762	141109762	+	lincRNA	SNP	C	C	T	rs529409527	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr9:141109762C>T	ENST00000446912.2	+	0	163							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CTGCAGGCGGCCCTCATCTAA	0.597																																					p.P131S		.											.	.	0			c.C391T						.						42.0	47.0	45.0					9																	141109762		692	1591	2283			100132403	exon3			AGGCGGCCCTCAT			9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141109762C>T		345	0		373	51	NM_001145249	0	0	0	0	0		Missense_Mutation	SNP	ENST00000446912.2	37																																																																																				.		0.597	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000055378.2	NM_001145249	
AKAP17A	8227	bcgsc.ca	37	X	1713021	1713021	+	Silent	SNP	C	C	T			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:1713021C>T	ENST00000313871.3	+	2	862	c.666C>T	c.(664-666)cgC>cgT	p.R222R	AKAP17A_ENST00000381261.3_Silent_p.R222R	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	222	RRM.				B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						TGCAGTACCGCGAGTACATGG	0.607													c|||	2801	0.559305	0.5832	0.5115	5008	,	,		19903	0.5268		0.5875	False		,,,				2504	0.5654				p.R222R		.											.	AKAP17A-40	0			c.C666T						.			2444,1962		683,1078,442	111.0	102.0	105.0		666	-0.7	0.0	X	dbSNP_134	105	4590,4002		1181,2228,887	no	coding-synonymous	AKAP17A	NM_005088.2		1864,3306,1329	TT,TC,CC		46.5782,44.5302,45.884		222/696	1713021	7034,5964	2203	4296	6499	SO:0001819	synonymous_variant	8227	exon2			GTACCGCGAGTAC	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.666C>T	X.37:g.1713021C>T		156	0		125	6	NM_005088	0	0	20	20	0	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Silent	SNP	ENST00000313871.3	37	CCDS14116.1																																																																																			C|0.453;T|0.547		0.607	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
MAP7D2	256714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	20044071	20044071	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:20044071C>A	ENST00000379651.3	-	8	903		c.e8-1		MAP7D2_ENST00000452324.3_Splice_Site|MAP7D2_ENST00000466145.1_5'Flank|MAP7D2_ENST00000379643.5_Splice_Site|MAP7D2_ENST00000543767.1_Splice_Site|MAP7D2_ENST00000443379.3_Splice_Site	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2						microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						AGTAGCTGTCCTGGAAAACAA	0.473																																					.		.											.	MAP7D2-195	0			c.729-1G>T						.						110.0	109.0	109.0					X																	20044071		2203	4300	6503	SO:0001630	splice_region_variant	256714	exon9			GCTGTCCTGGAAA	BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.885-1G>T	X.37:g.20044071C>A		48	0		87	21	NM_001168467	0	0	0	0	0	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Splice_Site	SNP	ENST00000379651.3	37	CCDS14195.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400348	0.62177	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000452324	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2136	0.73247	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAP7D2	19953992	1.000000	0.71417	0.095000	0.20976	0.700000	0.40528	4.515000	0.60489	2.270000	0.75569	0.594000	0.82650	.	.		0.473	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056001.1	NM_152780	Intron
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382525	24382525	+	IGR	SNP	G	G	C			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:24382525G>C								AC004552.1 (15502 upstream) : PDK3 (100812 downstream)																							tgctcctgccgctgctcctgc	0.617																																					p.A550P		.											.	.	0			c.G1648C						.						5.0	5.0	5.0					X																	24382525		1460	3309	4769	SO:0001628	intergenic_variant	100130302	exon1			CCTGCCGCTGCTC																													X.37:g.24382525G>C		72	0		91	14	NM_001136234	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.617								
CXorf22	170063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	35993875	35993875	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:35993875C>A	ENST00000297866.5	+	15	2624	c.2558C>A	c.(2557-2559)tCt>tAt	p.S853Y		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	853										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GAGCTATCTTCTAATGAGCTA	0.428																																					p.S853Y		.											.	CXorf22-131	0			c.C2558A						.						158.0	135.0	143.0					X																	35993875		2202	4300	6502	SO:0001583	missense	170063	exon15			TATCTTCTAATGA	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2558C>A	X.37:g.35993875C>A	ENSP00000297866:p.Ser853Tyr	90	0		140	18	NM_152632	0	0	0	0	0	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291912	0.23564	.	.	ENSG00000165164	ENST00000297866	T	0.15487	2.42	5.14	2.33	0.28932	.	0.673117	0.15167	N	0.276878	T	0.32376	0.0827	M	0.72118	2.19	0.09310	N	1	D	0.67145	0.996	D	0.63381	0.914	T	0.11891	-1.0569	10	0.62326	D	0.03	-2.6067	5.2603	0.15569	0.1634:0.6511:0.0:0.1855	.	853	Q6ZTR5	CX022_HUMAN	Y	853	ENSP00000297866:S853Y	ENSP00000297866:S853Y	S	+	2	0	CXorf22	35903796	0.001000	0.12720	0.007000	0.13788	0.137000	0.21094	0.719000	0.25881	0.048000	0.15891	0.600000	0.82982	TCT	.		0.428	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
GUCY2F	2986	ucsc.edu;bcgsc.ca	37	X	108696981	108696981	+	Missense_Mutation	SNP	C	C	A	rs2272925	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:108696981C>A	ENST00000218006.2	-	4	1431	c.1140G>T	c.(1138-1140)caG>caT	p.Q380H		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	380			Q -> H (in dbSNP:rs2272925). {ECO:0000269|PubMed:17344846}.		intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TTCTGGAATGCTGAACCAGGC	0.408													C|||	202	0.0535099	0.0998	0.0072	3775	,	,		14944	0.0486		0.006	False		,,,				2504	0.0102				p.Q380H		.											.	GUCY2F-540	0			c.G1140T						.	C	HIS/GLN	498,3337		29,366,74,1237,497	69.0	57.0	61.0		1140	4.2	1.0	X	dbSNP_100	61	4,6724		0,4,0,2424,1872	yes	missense	GUCY2F	NM_001522.2	24	29,370,74,3661,2369	AA,AC,A,CC,C		0.0595,12.9857,4.7524	benign	380/1109	108696981	502,10061	2203	4300	6503	SO:0001583	missense	2986	exon4			GGAATGCTGAACC	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1140G>T	X.37:g.108696981C>A	ENSP00000218006:p.Gln380His	63	0		42	5	NM_001522	0	0	0	0	0	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	37	CCDS14545.1	82	0.04942736588306208	42	0.09051724137931035	1	0.002777777777777778	13	0.023297491039426525	4	0.005277044854881266	C	10.85	1.467877	0.26335	0.129857	5.95E-4	ENSG00000101890	ENST00000218006	D	0.82893	-1.66	4.25	4.25	0.50352	Extracellular ligand-binding receptor (1);	0.428370	0.24564	N	0.037443	T	0.01835	0.0058	N	0.19112	0.55	0.24533	P	0.99410111	B	0.06786	0.001	B	0.13407	0.009	T	0.45977	-0.9224	9	0.37606	T	0.19	.	13.4938	0.61411	0.0:1.0:0.0:0.0	rs2272925;rs52818381;rs2272925	380	P51841	GUC2F_HUMAN	H	380	ENSP00000218006:Q380H	ENSP00000218006:Q380H	Q	-	3	2	GUCY2F	108583637	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.969000	0.29370	2.351000	0.79841	0.513000	0.50165	CAG	C|0.934;A|0.066		0.408	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
SLC25A43	203427	bcgsc.ca	37	X	118587003	118587003	+	Missense_Mutation	SNP	C	C	T	rs3810755	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:118587003C>T	ENST00000217909.7	+	5	1345	c.1001C>T	c.(1000-1002)cCg>cTg	p.P334L	SLC25A43_ENST00000336249.7_3'UTR|SLC25A43_ENST00000488158.1_3'UTR	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	334			P -> L (in dbSNP:rs3810755). {ECO:0000269|PubMed:15489334}.		transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						ACGAGAAAACCGAAGCCTAAA	0.408													T|||	2144	0.567947	0.4478	0.3919	3775	,	,		14788	0.4077		0.4334	False		,,,				2504	0.4427				p.P334L		.											.	SLC25A43-130	0			c.C1001T						.	T	LEU/PRO	2295,1540		601,752,341,279,230	79.0	82.0	81.0		1001	5.2	0.3	X	dbSNP_107	81	3899,2828		822,1197,1058,409,813	yes	missense	SLC25A43	NM_145305.2	98	1423,1949,1399,688,1043	TT,TC,T,CC,C		42.0395,40.1565,41.3558	benign	334/342	118587003	6194,4368	2203	4299	6502	SO:0001583	missense	203427	exon5			GAAAACCGAAGCC	BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.1001C>T	X.37:g.118587003C>T	ENSP00000217909:p.Pro334Leu	94	0		125	8	NM_145305	0	0	8	8	0	O75854|Q8N9L5	Missense_Mutation	SNP	ENST00000217909.7	37	CCDS14577.1	906	0.546112115732369	156	0.42857142857142855	97	0.35661764705882354	145	0.3419811320754717	222	0.40217391304347827	T	4.463	0.085769	0.08583	0.598435	0.579605	ENSG00000077713	ENST00000217909;ENST00000326714	T	0.76316	-1.01	5.24	5.24	0.73138	.	.	.	.	.	T	0.00012	0.0000	N	0.00436	-1.5	0.28831	P	0.897126	B	0.02656	0.0	B	0.01281	0.0	T	0.43909	-0.9362	8	0.06757	T	0.87	0.016	9.5806	0.39486	0.0:0.0832:0.0:0.9168	rs3810755;rs17842216;rs17855482;rs52793991;rs56481507;rs56752420;rs3810755	334	Q8WUT9	S2543_HUMAN	L	334;282	ENSP00000217909:P334L	ENSP00000217909:P334L	P	+	2	0	SLC25A43	118471031	0.914000	0.31030	0.338000	0.25549	0.930000	0.56654	3.893000	0.56243	0.653000	0.30826	-0.314000	0.08810	CCG	0|0.015;T|0.445		0.408	SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058028.1	NM_145305	
PRR32	100130613	broad.mit.edu	37	X	125954964	125954964	+	Missense_Mutation	SNP	C	C	G	rs12835991		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chrX:125954964C>G	ENST00000371125.3	+	2	423	c.343C>G	c.(343-345)Ctg>Gtg	p.L115V		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		115			L -> V (in dbSNP:rs12835991).														CTCTGATGCACTGGCAGGCTG	0.547													C|||	189	0.0500662	0.0227	0.0303	3775	,	,		13540	0.001		0.0706	False		,,,				2504	0.0675				p.L115V		.											.	.	0			c.C343G						.	C	VAL/LEU	51,1158		1,42,7,474,168	31.0	27.0	28.0		343	-0.8	0.0	X	dbSNP_121	28	212,2179		5,135,67,660,724	yes	missense	CXorf64	NM_001122716.1	32	6,177,74,1134,892	GG,GC,G,CC,C		8.8666,4.2184,7.3056	possibly-damaging	115/299	125954964	263,3337	692	1591	2283	SO:0001583	missense	100130613	exon2			GATGCACTGGCAG																												ENST00000371125.3:c.343C>G	X.37:g.125954964C>G	ENSP00000360166:p.Leu115Val	84	1		88	5	NM_001122716	0	0	0	0	0		Missense_Mutation	SNP	ENST00000371125.3	37	CCDS48163.1	90	0.054249547920433995	11	0.02301255230125523	12	0.03389830508474576	0	0.0	36	0.05013927576601671	C	6.120	0.390313	0.11581	0.042184	0.088666	ENSG00000183631	ENST00000371125	T	0.39229	1.09	4.01	-0.763	0.11030	.	0.355410	0.16216	N	0.224251	T	0.01695	0.0054	L	0.32530	0.975	0.80722	P	0.0	D	0.54047	0.964	P	0.55260	0.772	T	0.16247	-1.0409	9	0.40728	T	0.16	-0.2952	7.3865	0.26884	0.0:0.4272:0.0:0.5728	rs12835991	115	B1ATL7	CX064_HUMAN	V	115	ENSP00000360166:L115V	ENSP00000360166:L115V	L	+	1	2	CXorf64	125782645	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-1.032000	0.03574	-0.335000	0.08451	-0.928000	0.02712	CTG	C|0.945;G|0.055		0.547	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058188.1		
CTBP2	1488	hgsc.bcm.edu	37	10	126715159	126715160	+	Intron	INS	-	-	GCCGCAGGCTGGGGCTGCAGG	rs529129641|rs372118432	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr10:126715159_126715160insGCCGCAGGCTGGGGCTGCAGG	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000309035.6_In_Frame_Ins_p.390_390A>ALQPQPAA	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TCTGCAGAGGAGCCGCAGCGCC	0.698														537	0.107228	0.1006	0.2478	5008	,	,		14420	0.0417		0.1093	False		,,,				2504	0.0818				p.A390delinsALQPQPAA		.											.	CTBP2-90	0			c.1170_1171insCCTGCAGCCCCAGCCTGCGGC						.		,,	295,3727		33,229,1749					,,	-1.1	0.0			8	694,7122		93,508,3307	no	coding,intron,intron	CTBP2	NM_022802.2,NM_001329.2,NM_001083914.1	,,	126,737,5056	A1A1,A1R,RR		8.8792,7.3347,8.3545	,,	,,		989,10849				SO:0001627	intron_variant	1488	exon1			CAGAGGAGCCGCA	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12405->CCTGCAGCCCCAGCCTGCGGC	10.37:g.126715159_126715160insGCCGCAGGCTGGGGCTGCAGG		2	1		20	9	NM_022802	0	0	0	0	0	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	In_Frame_Ins	INS	ENST00000337195.5	37	CCDS7643.1																																																																																			.		0.698	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
VTN	7448	hgsc.bcm.edu	37	17	26699367	26699368	+	5'Flank	INS	-	-	C	rs11437594		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr17:26699367_26699368insC	ENST00000226218.4	-	0	0				TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_Frame_Shift_Ins_p.A72fs|VTN_ENST00000536498.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CCTGGCTGCTGCGGCCGTGGGC	0.743													CC|C|CC|deletion	5008	1.0	1.0	1.0	5008	,	,		10362	1.0		1.0	False		,,,				2504	1.0				p.A105fs		.											.	.	0			c.313_314insC						.			2410,14		1203,4,5						0.8	1.0		dbSNP_120	3	4457,19		2225,7,6	no	frameshift	SARM1	NM_015077.2		3428,11,11	A1A1,A1R,RR		0.4245,0.5776,0.4783				6867,33				SO:0001631	upstream_gene_variant	23098	exon2			GCTGCTGCGGCCG	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699368_26699368dupC	Exception_encountered	0	0		12	12	NM_015077	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			-|0.009;C|0.991		0.743	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
CCDC150	284992	hgsc.bcm.edu	37	2	197531518	197531519	+	Frame_Shift_Ins	INS	-	-	A	rs75642251|rs376590781		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr2:197531518_197531519insA	ENST00000389175.4	+	7	973_974	c.838_839insA	c.(838-840)caafs	p.Q280fs	CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	280										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GGCCCAGGAACAAAAAAAAAAA	0.371																																					p.Q280fs		.											.	.	0			c.838_839insA						.																																			SO:0001589	frameshift_variant	284992	exon7			CAGGAACAAAAAA		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.849dupA	2.37:g.197531529_197531529dupA	ENSP00000373827:p.Gln280fs	178	0		216	0	NM_001080539	0	0	0	0	0	Q6P5U6|Q6P663|Q8N8V5	Frame_Shift_Ins	INS	ENST00000389175.4	37	CCDS46478.1																																																																																			.		0.371	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE		.											.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	277	0		228	7	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
ATP13A5	344905	broad.mit.edu	37	3	193042730	193042731	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr3:193042730_193042731insG	ENST00000342358.4	-	14	1713_1714	c.1596_1597insC	c.(1594-1599)agctgcfs	p.C533fs		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	533						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AGAGAGTGGCAGCTGGCCATGG	0.535																																					p.C533fs		.											.	ATP13A5-144	0			c.1597_1598insC						.																																			SO:0001589	frameshift_variant	344905	exon14			AGTGGCAGCTGGC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1597dupC	3.37:g.193042731_193042731dupG	ENSP00000341942:p.Cys533fs	137	0		137	7	NM_198505	0	0	0	0	0	Q6UWS4|Q6ZWL0	Frame_Shift_Ins	INS	ENST00000342358.4	37	CCDS33914.1																																																																																			.		0.535	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
MCC	4163	broad.mit.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082				p.S22delinsGS		.											.	MCC-69	0			c.64_65insGGC						.																																			SO:0001652	inframe_insertion	4163	exon1			TGCCGCTGCCGCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup	11	0		25	8	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	In_Frame_Ins	INS	ENST00000408903.3	37	CCDS43351.1																																																																																			.		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762844	+	Missense_Mutation	DNP	GG	GG	CT	rs2607015|rs2753960|rs67600122	byFrequency	TCGA-OR-A5J8-01A-11D-A29I-10	TCGA-OR-A5J8-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b2182eee-242e-4d38-8d23-aa9ea31e69e9	bcbf3b2d-2175-4d7e-a175-1a4f35149860	g.chr6:31762843_31762844GG>CT	ENST00000375663.3	-	2	591_592	c.151_152CC>AG	c.(151-153)CCc>AGc	p.P51S	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCTA	0.733																																					p.P51S		.											.	VARS-93	0			c.C151A						.																																			SO:0001583	missense	7407	exon2			GAAAGGGAGTCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.151_152delinsCT	6.37:g.31762843_31762844delinsCT	ENSP00000364815:p.Pro51Ser	1	0		8	0	NM_006295	0	0	0	0	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	DNP	ENST00000375663.3	37	CCDS34412.1																																																																																			G|0.721;T|0.279		0.733	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
