#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GABRD	2563	bcgsc.ca	37	1	1957037	1957037	+	Silent	SNP	T	T	C	rs2229110	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:1957037T>C	ENST00000378585.4	+	4	413	c.330T>C	c.(328-330)ggT>ggC	p.G110G		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	110					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGACCCTGGGTCTGGACAGCC	0.617													C|||	2811	0.561302	0.7474	0.5101	5008	,	,		16340	0.3462		0.6809	False		,,,				2504	0.4448				p.G110G		.											.	GABRD-92	0			c.T330C						.	C		3220,1186	414.4+/-336.8	1183,854,166	98.0	97.0	97.0		330	2.5	1.0	1	dbSNP_98	97	5680,2920	455.2+/-363.7	1889,1902,509	no	coding-synonymous	GABRD	NM_000815.4		3072,2756,675	CC,CT,TT		33.9535,26.9178,31.57		110/453	1957037	8900,4106	2203	4300	6503	SO:0001819	synonymous_variant	2563	exon4			CCTGGGTCTGGAC	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.330T>C	1.37:g.1957037T>C		270	0		420	9	NM_000815	0	0	0	0	0	Q8N4N9	Silent	SNP	ENST00000378585.4	37	CCDS36.1																																																																																			T|0.334;C|0.666		0.617	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815	
PEX10	5192	bcgsc.ca	37	1	2338015	2338015	+	Missense_Mutation	SNP	T	T	C	rs34154371	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:2338015T>C	ENST00000447513.2	-	5	888	c.820A>G	c.(820-822)Acc>Gcc	p.T274A	PEX10_ENST00000288774.3_Missense_Mutation_p.T294A|PEX10_ENST00000507596.1_Missense_Mutation_p.T274A|PEX10_ENST00000515760.1_5'Flank	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	274			T -> A (in dbSNP:rs34154371). {ECO:0000269|PubMed:19105186}.		peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		AGGCACAGGGTGCACAGGGGG	0.642													T|||	43	0.00858626	0.0015	0.013	5008	,	,		16987	0.0		0.0229	False		,,,				2504	0.0092				p.T294A	GBM(12;9 508 1649 13619)	.											.	PEX10-90	0			c.A880G	GRCh37	CM090796	PEX10	M	rs34154371	.	T	ALA/THR,ALA/THR	26,4380	31.7+/-61.6	0,26,2177	36.0	39.0	38.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	820,880	5.0	1.0	1	dbSNP_126	38	246,8354	98.1+/-159.7	3,240,4057	yes	missense,missense	PEX10	NM_002617.3,NM_153818.1	58,58	3,266,6234	CC,CT,TT		2.8605,0.5901,2.0913	possibly-damaging,possibly-damaging	274/327,294/347	2338015	272,12734	2203	4300	6503	SO:0001583	missense	5192	exon5			ACAGGGTGCACAG	AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.820A>G	1.37:g.2338015T>C	ENSP00000407922:p.Thr274Ala	12	0		42	34	NM_153818	0	0	2	18	16	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	ENST00000447513.2	37	CCDS44045.1	21	0.009615384615384616	2	0.0040650406504065045	3	0.008287292817679558	0	0.0	16	0.021108179419525065	T	13.95	2.388552	0.42308	0.005901	0.028605	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.84070	-1.8;-1.8;-1.8	5.02	5.02	0.67125	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.146789	0.64402	D	0.000009	T	0.51719	0.1691	N	0.01424	-0.875	0.45762	D	0.998653	D;P	0.56968	0.978;0.954	P;P	0.57911	0.829;0.568	T	0.75560	-0.3275	10	0.40728	T	0.16	-2.7586	13.8991	0.63792	0.0:0.0:0.0:1.0	rs34154371	274;294	O60683;O60683-2	PEX10_HUMAN;.	A	294;274;274	ENSP00000288774:T294A;ENSP00000407922:T274A;ENSP00000424291:T274A	ENSP00000288774:T294A	T	-	1	0	PEX10	2327875	1.000000	0.71417	0.992000	0.48379	0.956000	0.61745	5.632000	0.67819	1.875000	0.54330	0.379000	0.24179	ACC	T|0.984;C|0.016		0.642	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
SPRR3	6707	bcgsc.ca	37	1	152975763	152975763	+	Silent	SNP	C	C	A	rs1977734	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:152975763C>A	ENST00000295367.4	+	2	309	c.267C>A	c.(265-267)ggC>ggA	p.G89G	SPRR3_ENST00000331860.3_Silent_p.G89G|SPRR3_ENST00000542696.1_Silent_p.G89G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	89	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.602													T|||	2627	0.524561	0.5	0.4323	5008	,	,		17476	0.6319		0.5318	False		,,,				2504	0.5051				p.G89G		.											.	SPRR3-45	0			c.C267A						.	C	,	2311,2095		594,1123,486	72.0	60.0	64.0		267,267	1.5	0.0	1	dbSNP_92	64	4670,3928		1279,2112,908	no	coding-synonymous,coding-synonymous	SPRR3	NM_001097589.1,NM_005416.2	,	1873,3235,1394	AA,AC,CC		45.685,47.5488,46.3165	,	89/170,89/170	152975763	6981,6023	2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.267C>A	1.37:g.152975763C>A		131	2		132	6	NM_001097589	0	9	20	29	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			T|0.136;G|0.132;C|0.344;A|0.387		0.602	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
CHIT1	1118	bcgsc.ca	37	1	203186950	203186950	+	Nonsense_Mutation	SNP	C	C	T	rs201320385|rs3831317|rs150192398	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:203186950C>T	ENST00000367229.1	-	10	1107	c.1073G>A	c.(1072-1074)tGg>tAg	p.W358*	CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W339*|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W349*|CHIT1_ENST00000484834.1_5'UTR	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	358					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GTCCAGTGCCCAGACCATGGC	0.632																																					p.W358X		.											.	CHIT1-90	0			c.G1073A						.						60.0	52.0	54.0					1																	203186950		2203	4300	6503	SO:0001587	stop_gained	1118	exon10			AGTGCCCAGACCA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1073G>A	1.37:g.203186950C>T	ENSP00000356198:p.Trp358*	52	0		57	6	NM_003465	0	0	2	2	0	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918897	0.73098	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.57	4.57	0.56435	.	0.000000	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7042	15.2284	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	358;339;349	.	ENSP00000255427:W339X	W	-	2	0	CHIT1	201453573	1.000000	0.71417	0.432000	0.26747	0.080000	0.17528	6.938000	0.75904	2.238000	0.73509	0.563000	0.77884	TGG	C|0.989;T|0.011		0.632	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
IKBKE	9641	bcgsc.ca	37	1	206650065	206650065	+	Silent	SNP	A	A	G	rs41296034	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:206650065A>G	ENST00000367120.3	+	7	958	c.585A>G	c.(583-585)caA>caG	p.Q195Q	IKBKE_ENST00000537984.1_Silent_p.Q110Q	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					AGCCCCAGCAAAAAGCGTTCG	0.617													A|||	90	0.0179712	0.0038	0.0202	5008	,	,		18713	0.0		0.0686	False		,,,				2504	0.002				p.Q195Q		.											.	IKBKE-1061	0			c.A585G						.	A	,,	78,4328	67.6+/-105.2	1,76,2126	84.0	72.0	77.0		330,585,585	-0.9	1.0	1	dbSNP_127	77	759,7841	179.9+/-228.9	33,693,3574	no	coding-synonymous,coding-synonymous,coding-synonymous	IKBKE	NM_001193321.1,NM_001193322.1,NM_014002.3	,,	34,769,5700	GG,GA,AA		8.8256,1.7703,6.4355	,,	110/632,195/658,195/717	206650065	837,12169	2203	4300	6503	SO:0001819	synonymous_variant	9641	exon7			CCAGCAAAAAGCG	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.585A>G	1.37:g.206650065A>G		158	0		177	7	NM_001193322	0	0	0	0	0	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	ENST00000367120.3	37	CCDS30996.1																																																																																			A|0.947;G|0.053		0.617	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		
OR2T11	127077	ucsc.edu;bcgsc.ca	37	1	248789753	248789753	+	Missense_Mutation	SNP	G	G	C	rs28555577	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:248789753G>C	ENST00000330803.2	-	1	738	c.677C>G	c.(676-678)cCc>cGc	p.P226R		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCAGCAGAGGGCATGCGGTG	0.502													c|||	405	0.0808706	0.0234	0.0735	5008	,	,		18667	0.2242		0.0746	False		,,,				2504	0.0225				p.P226R		.											.	OR2T11-69	0			c.C677G						.	C	ARG/PRO	179,3923		42,95,1914	67.0	68.0	68.0		677	-1.1	0.8	1	dbSNP_125	68	800,7670		115,570,3550	yes	missense	OR2T11	NM_001001964.1	103	157,665,5464	CC,CG,GG		9.4451,4.3637,7.7871	benign	226/317	248789753	979,11593	2051	4235	6286	SO:0001583	missense	127077	exon1			GCAGAGGGCATGC	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.677C>G	1.37:g.248789753G>C	ENSP00000328934:p.Pro226Arg	80	0		24	4	NM_001001964	0	0	0	0	0	Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	37	CCDS31122.1	243	0.11126373626373626	23	0.046747967479674794	30	0.08287292817679558	125	0.21853146853146854	65	0.08575197889182058	.	0.004	-2.250424	0.00268	0.043637	0.094451	ENSG00000183130	ENST00000330803	T	0.36520	1.25	4.24	-1.14	0.09741	GPCR, rhodopsin-like superfamily (1);	0.169427	0.28414	N	0.015423	T	0.00012	0.0000	N	0.13235	0.315	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21518	-1.0243	9	0.02654	T	1	.	1.6102	0.02692	0.1172:0.2626:0.2302:0.39	rs28555577	226	Q8NH01	O2T11_HUMAN	R	226	ENSP00000328934:P226R	ENSP00000328934:P226R	P	-	2	0	OR2T11	246856376	0.000000	0.05858	0.783000	0.31826	0.008000	0.06430	-3.596000	0.00420	-0.423000	0.07394	-0.729000	0.03580	CCC	G|0.888;C|0.112		0.502	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964	
OR2T27	403239	bcgsc.ca	37	1	248813280	248813280	+	Silent	SNP	C	C	T	rs116125618	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr1:248813280C>T	ENST00000344889.3	-	1	905	c.906G>A	c.(904-906)caG>caA	p.Q302Q		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q302Q(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCACAACCTTCTGTAGGGCCC	0.448													C|||	424	0.0846645	0.0076	0.0677	5008	,	,		20598	0.2669		0.0746	False		,,,				2504	0.0235				p.Q302Q		.											.	OR2T27-47	1	Substitution - coding silent(1)	stomach(1)	c.G906A						.	C		122,4236		16,90,2073	68.0	72.0	70.0		906	-0.1	0.0	1	dbSNP_132	70	745,7801		69,607,3597	no	coding-synonymous	OR2T27	NM_001001824.1		85,697,5670	TT,TC,CC		8.7175,2.7994,6.7188		302/318	248813280	867,12037	2179	4273	6452	SO:0001819	synonymous_variant	403239	exon1			AACCTTCTGTAGG		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.906G>A	1.37:g.248813280C>T		158	0		69	5	NM_001001824	0	0	0	0	0		Silent	SNP	ENST00000344889.3	37	CCDS31124.1																																																																																			C|0.922;T|0.078		0.448	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
TUBB8	347688	broad.mit.edu	37	10	95170	95170	+	Silent	SNP	C	C	T	rs561104222	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr10:95170C>T	ENST00000309812.4	-	1	71	c.9G>A	c.(7-9)gaG>gaA	p.E3E	TUBB8_ENST00000447903.2_Intron|TUBB8_ENST00000332708.5_Silent_p.E3E|TUBB8_ENST00000413237.3_Intron	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	3					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TGAGCACGATCTCCCTCATGG	0.672													c|||	14	0.00279553	0.0008	0.0029	5008	,	,		14530	0.0		0.004	False		,,,				2504	0.0072				p.E3E	Pancreas(192;2041 3010 9013 18103)	.											.	TUBB8-69	0			c.G9A						.						18.0	16.0	17.0					10																	95170		2196	4294	6490	SO:0001819	synonymous_variant	347688	exon1			CACGATCTCCCTC	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.9G>A	10.37:g.95170C>T		62	0		176	11	NM_177987	0	0	0	0	0	Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	CCDS7051.1																																																																																			.		0.672	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
MYO3A	53904	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	26357698	26357698	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr10:26357698A>G	ENST00000265944.5	+	12	1221	c.1055A>G	c.(1054-1056)aAt>aGt	p.N352S	MYO3A_ENST00000543632.1_Splice_Site_p.N352S	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	352	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTATTGCAGAATACAGTCTCA	0.333																																					p.N352S		.											.	MYO3A-1007	0			c.A1055G						.						85.0	79.0	81.0					10																	26357698		2203	4300	6503	SO:0001630	splice_region_variant	53904	exon12			TGCAGAATACAGT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1054-1A>G	10.37:g.26357698A>G		24	0		30	9	NM_017433	0	0	0	0	0	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.894566	0.33442	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;D	0.86865	-0.52;-2.18	5.55	4.38	0.52667	Myosin head, motor domain (2);	0.087641	0.85682	D	0.000000	D	0.82628	0.5078	L	0.27975	0.815	0.54753	D	0.999989	B;B;B	0.32302	0.313;0.363;0.242	B;B;B	0.39935	0.124;0.183;0.314	T	0.80899	-0.1176	10	0.59425	D	0.04	.	12.5398	0.56163	0.8606:0.1394:0.0:0.0	.	352;352;352	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	S	352	ENSP00000265944:N352S;ENSP00000445909:N352S	ENSP00000265944:N352S	N	+	2	0	MYO3A	26397704	1.000000	0.71417	0.999000	0.59377	0.705000	0.40729	4.585000	0.60977	0.895000	0.36342	0.533000	0.62120	AAT	.		0.333	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	Missense_Mutation
AGAP11	119385	bcgsc.ca	37	10	88768253	88768253	+	RNA	SNP	A	A	G	rs2641563	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr10:88768253A>G	ENST00000444431.1	+	0	2853				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.10_ENST00000451760.1_RNA|RP11-96C23.14_ENST00000444180.3_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										ACCCACGCCCATTTGCAAGCA	0.517													G|||	3962	0.791134	0.8585	0.7522	5008	,	,		17889	0.9325		0.7048	False		,,,				2504	0.6708				p.I82V		.											.	.	0			c.A244G						.	A	VAL/ILE	3640,728		1523,594,67	140.0	152.0	148.0		244	-0.3	0.0	10	dbSNP_100	148	5889,2701		1994,1901,400	no	missense	AGAP11	NM_133447.1	29	3517,2495,467	GG,GA,AA		31.4435,16.6667,26.4624	benign	82/551	88768253	9529,3429	2184	4295	6479			119385	exon12			ACGCCCATTTGCA			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88768253A>G		170	0		215	10	NM_133447	0	0	1	1	0	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	37																																																																																				A|0.215;G|0.785		0.517	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
LGI1	9211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95537350	95537350	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr10:95537350G>T	ENST00000371418.4	+	4	667	c.407G>T	c.(406-408)cGg>cTg	p.R136L	LGI1_ENST00000542308.1_Intron|LGI1_ENST00000371413.3_Missense_Mutation_p.R136L	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	136			R -> W (in ETL1). {ECO:0000269|PubMed:17562837}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				CATACTTTCCGGGGACTAAAG	0.333																																					p.R136L		.											.	LGI1-517	0			c.G407T						.						70.0	64.0	66.0					10																	95537350		2201	4299	6500	SO:0001583	missense	9211	exon4			CTTTCCGGGGACT	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.407G>T	10.37:g.95537350G>T	ENSP00000360472:p.Arg136Leu	65	0		96	32	NM_005097	0	0	0	0	0	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762991	0.89932	.	.	ENSG00000108231	ENST00000371418;ENST00000371413	T;T	0.57273	0.41;0.41	6.07	6.07	0.98685	.	0.127889	0.50627	D	0.000103	T	0.66626	0.2808	L	0.38733	1.17	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.964	T	0.64063	-0.6495	10	0.51188	T	0.08	-9.9499	20.6593	0.99626	0.0:0.0:1.0:0.0	.	136;136	O95970-2;O95970	.;LGI1_HUMAN	L	136	ENSP00000360472:R136L;ENSP00000360467:R136L	ENSP00000360467:R136L	R	+	2	0	LGI1	95527340	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.336000	0.72954	2.885000	0.99019	0.655000	0.94253	CGG	.		0.333	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
CTBP2	1488	ucsc.edu	37	10	126715075	126715075	+	Intron	SNP	T	T	C	rs3781413	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr10:126715075T>C	ENST00000337195.5	-	3	458				CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Silent_p.A418A|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		AATAGGTGGCTGCCGTCTCCA	0.687													C|||	609	0.121605	0.1074	0.2896	5008	,	,		13999	0.0456		0.1352	False		,,,				2504	0.0859				p.A418A		.											.	CTBP2-90	0			c.A1254G						.	C	,,	411,3985		17,377,1804	28.0	26.0	27.0		,,1254	-6.0	0.0	10	dbSNP_107	27	1080,7510		61,958,3276	no	intron,intron,coding-synonymous	CTBP2	NM_001083914.1,NM_001329.2,NM_022802.2	,,	78,1335,5080	CC,CT,TT		12.5728,9.3494,11.4816	,,	,,418/986	126715075	1491,11495	2198	4295	6493	SO:0001627	intron_variant	1488	exon1			GGTGGCTGCCGTC	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12490A>G	10.37:g.126715075T>C		12	2		43	23	NM_022802	0	0	0	0	0	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	ENST00000337195.5	37	CCDS7643.1																																																																																			T|0.892;C|0.108		0.687	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
MUC6	4588	bcgsc.ca	37	11	1017710	1017710	+	Missense_Mutation	SNP	G	G	T	rs113964902		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:1017710G>T	ENST00000421673.2	-	31	5141	c.5091C>A	c.(5089-5091)caC>caA	p.H1697Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1697	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAGGAAGTGTGTGAATGTA	0.552																																					p.H1697Q		.											.	MUC6-23	0			c.C5091A						.	T	GLN/HIS	175,4229	48.2+/-83.0	0,175,2027	827.0	810.0	816.0		5091	-2.9	0.0	11	dbSNP_132	816	52,8538	4.3+/-15.6	0,52,4243	yes	missense	MUC6	NM_005961.2	24	0,227,6270	TT,TG,GG		0.6054,3.9737,1.747	benign	1697/2440	1017710	227,12767	2202	4295	6497	SO:0001583	missense	4588	exon31			GGAAGTGTGTGAA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5091C>A	11.37:g.1017710G>T	ENSP00000406861:p.His1697Gln	652	14		739	28	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.248714	0.00268	0.039737	0.006054	ENSG00000184956	ENST00000421673	T	0.18657	2.2	1.46	-2.91	0.05631	.	.	.	.	.	T	0.01320	0.0043	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13072	-1.0523	9	0.05525	T	0.97	.	3.8678	0.09024	0.2346:0.0:0.4719:0.2935	.	1697	Q6W4X9	MUC6_HUMAN	Q	1697	ENSP00000406861:H1697Q	ENSP00000406861:H1697Q	H	-	3	2	MUC6	1007710	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-7.346000	0.00038	-4.248000	0.00062	-3.681000	0.00024	CAC	G|0.500;T|0.500		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR52E6	390078	broad.mit.edu	37	11	5862278	5862278	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:5862278C>A	ENST00000329322.5	-	1	849	c.850G>T	c.(850-852)Gtt>Ttt	p.V284F	OR52E6_ENST00000379946.2_Missense_Mutation_p.V288F|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGGGAGGAACAACCACATAT	0.413																																					p.V284F		.											.	OR52E6-68	0			c.G850T						.						96.0	98.0	97.0					11																	5862278		2088	4251	6339	SO:0001583	missense	390078	exon1			GAGGAACAACCAC	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.850G>T	11.37:g.5862278C>A	ENSP00000328878:p.Val284Phe	114	0		127	5	NM_001005167	0	0	0	0	0	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	CCDS53597.1	.	.	.	.	.	.	.	.	.	.	C	6.206	0.406197	0.11754	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00281	8.32;8.32	3.45	-0.983	0.10263	GPCR, rhodopsin-like superfamily (1);	0.291697	0.24089	N	0.041647	T	0.00178	0.0005	L	0.52573	1.65	0.09310	N	1	B	0.18610	0.029	B	0.27887	0.084	T	0.43261	-0.9402	10	0.40728	T	0.16	.	3.1582	0.06511	0.3148:0.411:0.0:0.2742	.	284	Q96RD3	O52E6_HUMAN	F	284;288	ENSP00000328878:V284F;ENSP00000369279:V288F	ENSP00000328878:V284F	V	-	1	0	OR52E6	5818854	0.000000	0.05858	0.000000	0.03702	0.398000	0.30690	-3.909000	0.00337	-0.491000	0.06697	0.551000	0.68910	GTT	.		0.413	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
DNHD1	144132	broad.mit.edu	37	11	6569896	6569896	+	Missense_Mutation	SNP	G	G	A	rs11606889	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:6569896G>A	ENST00000527990.2	+	22	7120	c.7120G>A	c.(7120-7122)Gtg>Atg	p.V2374M	DNHD1_ENST00000254579.6_Missense_Mutation_p.V2374M			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2374					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTTGTATGTGGTGGACCTGCT	0.522													G|||	636	0.126997	0.0832	0.1729	5008	,	,		19672	0.0228		0.1829	False		,,,				2504	0.2035				p.V2374M		.											.	DNHD1-24	0			c.G7120A						.	G	MET/VAL	136,1248		8,120,564	59.0	52.0	54.0		7120	4.9	1.0	11	dbSNP_120	54	619,2563		51,517,1023	yes	missense	DNHD1	NM_144666.2	21	59,637,1587	AA,AG,GG		19.4532,9.8266,16.5353	probably-damaging	2374/4754	6569896	755,3811	692	1591	2283	SO:0001583	missense	144132	exon24			TATGTGGTGGACC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.7120G>A	11.37:g.6569896G>A	ENSP00000436180:p.Val2374Met	60	1		47	3	NM_144666	0	0	0	0	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	253	0.11584249084249085	47	0.09552845528455285	50	0.13812154696132597	18	0.03146853146853147	138	0.1820580474934037	G	15.97	2.988476	0.53934	0.098266	0.194532	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.29397	1.57;1.57	5.96	4.95	0.65309	.	.	.	.	.	T	0.00039	0.0001	N	0.14661	0.345	0.39708	P	0.028714000000000017	D	0.63046	0.992	P	0.58077	0.832	T	0.06006	-1.0851	8	0.22706	T	0.39	.	9.6269	0.39757	0.1245:0.0:0.8755:0.0	rs11606889;rs58131910;rs11606889	2374	Q96M86	DNHD1_HUMAN	M	2374	ENSP00000254579:V2374M;ENSP00000436180:V2374M	ENSP00000254579:V2374M	V	+	1	0	DNHD1	6526472	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.820000	0.39032	2.813000	0.96785	0.655000	0.94253	GTG	G|0.887;A|0.113		0.522	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
SAA4	6291	broad.mit.edu	37	11	18257405	18257405	+	Silent	SNP	C	C	A	rs371977487		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:18257405C>A	ENST00000278222.4	-	2	249	c.69G>T	c.(67-69)tcG>tcT	p.S23S	SAA2-SAA4_ENST00000524555.1_RNA	NM_006512.3	NP_006503.2	P35542	SAA4_HUMAN	serum amyloid A4, constitutive	23					acute-phase response (GO:0006953)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(1)|stomach(1)	13						CCTTGAAAAACGAACGCCAGC	0.507																																					p.S101S		.											.	.	0			c.G303T						.						129.0	126.0	127.0					11																	18257405		2199	4293	6492	SO:0001819	synonymous_variant	100528017	exon4			GAAAAACGAACGC	M81349	CCDS7832.1	11p15.1-p14	2008-07-21			ENSG00000148965	ENSG00000148965			10516	protein-coding gene	gene with protein product		104752				8325654	Standard	NM_006512		Approved	C-SAA, CSAA		P35542	OTTHUMG00000166483	ENST00000278222.4:c.69G>T	11.37:g.18257405C>A		137	0		120	5	NM_001199744	0	0	2	2	0	Q6FHJ4	Silent	SNP	ENST00000278222.4	37	CCDS7832.1																																																																																			.		0.507	SAA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389988.1	NM_006512	
TENM4	26011	bcgsc.ca	37	11	78372536	78372536	+	Silent	SNP	G	G	A	rs2277277	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:78372536G>A	ENST00000278550.7	-	33	7971	c.7509C>T	c.(7507-7509)ctC>ctT	p.L2503L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2503					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTGTGTGGATGAGCTCGTAGG	0.527													G|||	1909	0.38119	0.2685	0.428	5008	,	,		20745	0.1895		0.672	False		,,,				2504	0.3988				p.L2503L		.											.	.	0			c.C7509T						.	G		1244,2778		199,846,966	100.0	96.0	98.0		7509	-0.9	0.3	11	dbSNP_100	98	5556,2786		1847,1862,462	no	coding-synonymous	ODZ4	NM_001098816.2		2046,2708,1428	AA,AG,GG		33.3973,30.9299,45.0016		2503/2770	78372536	6800,5564	2011	4171	6182	SO:0001819	synonymous_variant	26011	exon33			GTGGATGAGCTCG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7509C>T	11.37:g.78372536G>A		195	2		194	8	NM_001098816	0	0	1	1	0	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																			G|0.593;A|0.407		0.527	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
MTMR2	8898	hgsc.bcm.edu	37	11	95595266	95595434	+	Splice_Site	DEL	CCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA	CCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA	-	rs369202429|rs150185868|rs200895250|rs376231827|rs185263209|rs371629162|rs193209339|rs571113024|rs200148660|rs566995379|rs116463605	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	CCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA	CCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:95595266_95595434delCCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA	ENST00000346299.5	-	5	698	c.358delTAAGAGTCAGATTAGATTTTTGTATGTACATGAGTGTGTTGTTTGTAGCTAGTTTTGTTCATTTCTGATCATTTCTAATTAAAGCATTTCTGATTAAGATTTTGATCAGCTCTATAATTGGACAGTATTAATTGCTCAGTTTTAATTATTTTTTCTTTCCTTCTTTAGG	c.(358-360)taa>aa	p.*120fs	MTMR2_ENST00000352297.7_Splice_Site_p.*48fs|MTMR2_ENST00000393223.3_Splice_Site_p.*48fs|MTMR2_ENST00000484818.1_5'UTR|MTMR2_ENST00000409459.1_Splice_Site_p.*48fs	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	120	GRAM.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AATGGGGGATCCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTACCCGTTCCAT	0.341																																					p.120_120del		.											.	MTMR2-91	0			c.358_358del						.																																			SO:0001630	splice_region_variant	8898	exon5			GGGGATCCTAAAG	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.358-1TAAGAGTCAGATTAGATTTTTGTATGTACATGAGTGTGTTGTTTGTAGCTAGTTTTGTTCATTTCTGATCATTTCTAATTAAAGCATTTCTGATTAAGATTTTGATCAGCTCTATAATTGGACAGTATTAATTGCTCAGTTTTAATTATTTTTTCTTTCCTTCTTTAGG>-	11.37:g.95595266_95595434delCCTAAAGAAGGAAAGAAAAAATAATTAAAACTGAGCAATTAATACTGTCCAATTATAGAGCTGATCAAAATCTTAATCAGAAATGCTTTAATTAGAAATGATCAGAAATGAACAAAACTAGCTACAAACAACACACTCATGTACATACAAAAATCTAATCTGACTCTTA		48	0		31	0	NM_016156	0	0	0	0	0	A6NN98|Q9UPS9	Frame_Shift_Del	DEL	ENST00000346299.5	37	CCDS8305.1																																																																																			.		0.341	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	Frame_Shift_Del
ZC3H12C	85463	bcgsc.ca	37	11	110035301	110035301	+	Silent	SNP	A	A	G	rs1026607	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr11:110035301A>G	ENST00000278590.3	+	6	1542	c.1491A>G	c.(1489-1491)acA>acG	p.T497T	ZC3H12C_ENST00000528673.1_Silent_p.T498T|ZC3H12C_ENST00000453089.2_Silent_p.T466T	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	497							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GCATAAGGACACAAGTCTACC	0.448													G|||	1222	0.24401	0.3041	0.2248	5008	,	,		23059	0.2004		0.2724	False		,,,				2504	0.1922				p.T497T		.											.	ZC3H12C-68	0			c.A1491G						.	G		1098,2738		170,758,990	108.0	105.0	106.0		1491	-1.1	0.9	11	dbSNP_86	106	2086,6162		248,1590,2286	no	coding-synonymous	ZC3H12C	NM_033390.1		418,2348,3276	GG,GA,AA		25.291,28.6236,26.3489		497/884	110035301	3184,8900	1918	4124	6042	SO:0001819	synonymous_variant	85463	exon6			AAGGACACAAGTC		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1491A>G	11.37:g.110035301A>G		95	0		94	5	NM_033390	0	0	1	1	0	B4DI65|B4DR47	Silent	SNP	ENST00000278590.3	37	CCDS44727.1																																																																																			A|0.729;G|0.271		0.448	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		272	18		348	15	NM_032704	0	1	506	806	299		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
PA2G4	5036	broad.mit.edu;bcgsc.ca	37	12	56504205	56504205	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr12:56504205T>A	ENST00000303305.6	+	8	1071	c.652T>A	c.(652-654)Ttt>Att	p.F218I	RP11-603J24.17_ENST00000548595.1_RNA|PA2G4_ENST00000552766.1_Missense_Mutation_p.F218I	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	218					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			AAAAGCTGAATTTGAGGTACA	0.448																																					p.F218I		.											.	PA2G4-68	0			c.T652A						.						84.0	80.0	81.0					12																	56504205		2203	4300	6503	SO:0001583	missense	5036	exon8			GCTGAATTTGAGG	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.652T>A	12.37:g.56504205T>A	ENSP00000302886:p.Phe218Ile	153	0		251	11	NM_006191	0	0	175	178	3	O43846|Q9UM59	Missense_Mutation	SNP	ENST00000303305.6	37	CCDS8902.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.893886	0.91889	.	.	ENSG00000170515	ENST00000303305;ENST00000552766;ENST00000417031;ENST00000546435;ENST00000548711	T;T	0.74947	-0.89;-0.89	5.07	5.07	0.68467	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	T	0.82079	0.4959	M	0.67569	2.06	0.80722	D	1	D;P;D	0.63046	0.992;0.929;0.99	P;P;P	0.60415	0.846;0.746;0.874	T	0.82388	-0.0482	10	0.42905	T	0.14	.	14.1085	0.65107	0.0:0.0:0.0:1.0	.	218;218;218	F8VRZ3;F8VTY8;Q9UQ80	.;.;PA2G4_HUMAN	I	218;218;247;218;218	ENSP00000302886:F218I;ENSP00000448557:F218I	ENSP00000302886:F218I	F	+	1	0	PA2G4	54790472	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.669000	0.83911	2.040000	0.60383	0.477000	0.44152	TTT	.		0.448	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407767.1	NM_006191	
CCDC62	84660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123273380	123273380	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr12:123273380C>T	ENST00000253079.6	+	5	918	c.574C>T	c.(574-576)Cgt>Tgt	p.R192C	CCDC62_ENST00000392441.4_Missense_Mutation_p.R192C|CCDC62_ENST00000392440.2_Intron|CCDC62_ENST00000537566.1_Intron	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	192					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GCATGCCCTACGTGATGCCAA	0.348																																					p.R192C		.											.	CCDC62-157	0			c.C574T						.						112.0	109.0	110.0					12																	123273380		2203	4300	6503	SO:0001583	missense	84660	exon5			GCCCTACGTGATG		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.574C>T	12.37:g.123273380C>T	ENSP00000253079:p.Arg192Cys	131	0		176	46	NM_201435	0	0	0	0	0	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887280	0.33348	.	.	ENSG00000130783	ENST00000253079;ENST00000392441	T;T	0.33654	1.4;1.4	5.7	3.88	0.44766	.	0.402843	0.22458	N	0.059783	T	0.23249	0.0562	L	0.39633	1.23	0.18873	N	0.999985	P;B	0.41929	0.765;0.432	B;B	0.31191	0.125;0.076	T	0.24693	-1.0153	10	0.72032	D	0.01	-8.5828	7.9179	0.29829	0.0:0.8189:0.0:0.1811	.	192;192	Q6P9F0-2;Q6P9F0	.;CCD62_HUMAN	C	192	ENSP00000253079:R192C;ENSP00000376236:R192C	ENSP00000253079:R192C	R	+	1	0	CCDC62	121839333	0.029000	0.19370	0.016000	0.15963	0.041000	0.13682	1.236000	0.32683	1.422000	0.47177	0.655000	0.94253	CGT	.		0.348	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
NCOR2	9612	ucsc.edu	37	12	124856618	124856618	+	Silent	SNP	A	A	G	rs7961196	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr12:124856618A>G	ENST00000405201.1	-	20	2757	c.2757T>C	c.(2755-2757)gcT>gcC	p.A919A	NCOR2_ENST00000397355.1_Silent_p.A902A|NCOR2_ENST00000404621.1_Silent_p.A901A|NCOR2_ENST00000429285.2_Silent_p.A901A|NCOR2_ENST00000356219.3_Silent_p.A919A|NCOR2_ENST00000404121.2_Silent_p.A472A			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	919					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CACTGCAGGTAGCACTGGAGT	0.677													G|||	1578	0.315096	0.4728	0.2709	5008	,	,		13115	0.0843		0.34	False		,,,				2504	0.3456				p.A919A		.											.	NCOR2-229	0			c.T2757C						.	G	,,	1791,2433		394,1003,715	34.0	43.0	40.0		2703,2703,2757	4.0	1.0	12	dbSNP_116	40	2793,5671		480,1833,1919	no	coding-synonymous,coding-synonymous,coding-synonymous	NCOR2	NM_001077261.3,NM_001206654.1,NM_006312.5	,,	874,2836,2634	GG,GA,AA		32.9986,42.4006,36.1286	,,	901/2459,901/2505,919/2515	124856618	4584,8104	2112	4232	6344	SO:0001819	synonymous_variant	9612	exon22			GCAGGTAGCACTG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.2757T>C	12.37:g.124856618A>G		15	0		58	28	NM_006312	0	0	1	3	2	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			A|0.698;G|0.302		0.677	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
PABPC3	5042	bcgsc.ca	37	13	25671122	25671122	+	Silent	SNP	C	C	T	rs79072440		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr13:25671122C>T	ENST00000281589.3	+	1	823	c.786C>T	c.(784-786)taC>taT	p.Y262Y		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	262	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AACAAATTTACGTTGGTCGAG	0.408																																					p.Y262Y		.											.	PABPC3-72	0			c.C786T						.																																			SO:0001819	synonymous_variant	5042	exon1			AATTTACGTTGGT	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.786C>T	13.37:g.25671122C>T		127	1		125	7	NM_030979	0	0	0	265	265	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																			C|0.999;T|0.001		0.408	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
OR4N2	390429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20295677	20295677	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:20295677C>G	ENST00000315947.1	+	1	70	c.70C>G	c.(70-72)Cag>Gag	p.Q24E	OR4N2_ENST00000568211.1_Missense_Mutation_p.Q24E	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCAAGATATTCAGCTCCTGGT	0.428																																					p.Q24E		.											.	OR4N2-71	0			c.C70G						.						163.0	181.0	175.0					14																	20295677		2203	4300	6503	SO:0001583	missense	390429	exon1			GATATTCAGCTCC		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.70C>G	14.37:g.20295677C>G	ENSP00000319601:p.Gln24Glu	239	0		356	37	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	13.95	2.388684	0.42308	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.00593	6.34;6.34	4.41	4.41	0.53225	.	0.000000	0.46145	D	0.000319	T	0.00906	0.0030	L	0.54863	1.705	0.19300	N	0.99997	P	0.40250	0.709	B	0.40066	0.318	T	0.54417	-0.8297	10	0.45353	T	0.12	-8.0218	14.8767	0.70498	0.0:1.0:0.0:0.0	.	24	Q8NGD1	OR4N2_HUMAN	E	24	ENSP00000452022:Q24E;ENSP00000319601:Q24E	ENSP00000319601:Q24E	Q	+	1	0	OR4N2	19365517	0.070000	0.21116	0.962000	0.40283	0.975000	0.68041	1.774000	0.38573	2.431000	0.82371	0.591000	0.81541	CAG	.		0.428	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
OR4N2	390429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20295722	20295722	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:20295722C>G	ENST00000315947.1	+	1	115	c.115C>G	c.(115-117)Ctc>Gtc	p.L39V	OR4N2_ENST00000568211.1_Missense_Mutation_p.L39V	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L39I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTCATCATCCTCCCTGGAAA	0.443																																					p.L39V		.											.	OR4N2-71	1	Substitution - Missense(1)	lung(1)	c.C115G						.						189.0	217.0	208.0					14																	20295722		2203	4300	6503	SO:0001583	missense	390429	exon1			ATCATCCTCCCTG		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.115C>G	14.37:g.20295722C>G	ENSP00000319601:p.Leu39Val	210	0		260	30	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.710653	0.00712	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.00540	6.7;6.7	4.3	2.27	0.28462	.	0.000000	0.39687	N	0.001282	T	0.00300	0.0009	N	0.12961	0.28	0.25209	N	0.99	B	0.20368	0.044	B	0.17722	0.019	T	0.44314	-0.9336	10	0.02654	T	1	-21.3552	6.2762	0.20981	0.1835:0.7073:0.0:0.1091	.	39	Q8NGD1	OR4N2_HUMAN	V	39	ENSP00000452022:L39V;ENSP00000319601:L39V	ENSP00000319601:L39V	L	+	1	0	OR4N2	19365562	0.000000	0.05858	1.000000	0.80357	0.561000	0.35649	-2.801000	0.00761	1.114000	0.41781	0.591000	0.81541	CTC	.		0.443	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
OR4N2	390429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20295790	20295790	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:20295790C>G	ENST00000315947.1	+	1	183	c.183C>G	c.(181-183)ttC>ttG	p.F61L	OR4N2_ENST00000568211.1_Missense_Mutation_p.F61L	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCTCTATTTCTTTCTGGGCA	0.458																																					p.F61L		.											.	OR4N2-71	0			c.C183G						.						170.0	204.0	193.0					14																	20295790		2203	4298	6501	SO:0001583	missense	390429	exon1			CTATTTCTTTCTG		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.183C>G	14.37:g.20295790C>G	ENSP00000319601:p.Phe61Leu	191	0		213	30	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	13.15	2.152290	0.38021	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.00269	8.37;8.37	4.3	3.4	0.38934	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000096	T	0.00241	0.0007	M	0.78344	2.41	0.26558	N	0.973789	B	0.14805	0.011	B	0.21151	0.033	T	0.27054	-1.0085	10	0.62326	D	0.03	-25.2342	9.9085	0.41390	0.0:0.8955:0.0:0.1045	.	61	Q8NGD1	OR4N2_HUMAN	L	61	ENSP00000452022:F61L;ENSP00000319601:F61L	ENSP00000319601:F61L	F	+	3	2	OR4N2	19365630	0.014000	0.17966	1.000000	0.80357	0.892000	0.51952	-0.409000	0.07160	2.374000	0.81015	0.591000	0.81541	TTC	.		0.458	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
OR4N2	390429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20295819	20295819	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:20295819C>G	ENST00000315947.1	+	1	212	c.212C>G	c.(211-213)gCa>gGa	p.A71G	OR4N2_ENST00000568211.1_Missense_Mutation_p.A71G	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTCCTGGATGCATCCTACTCC	0.488																																					p.A71G		.											.	OR4N2-71	0			c.C212G						.						159.0	187.0	178.0					14																	20295819		2203	4297	6500	SO:0001583	missense	390429	exon1			TGGATGCATCCTA		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.212C>G	14.37:g.20295819C>G	ENSP00000319601:p.Ala71Gly	183	0		240	26	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	15.12	2.738335	0.49045	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.03065	4.06;4.06	4.3	3.4	0.38934	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000184	T	0.04182	0.0116	L	0.55017	1.72	0.25792	N	0.984606	B	0.34264	0.446	B	0.32677	0.15	T	0.27468	-1.0073	10	0.54805	T	0.06	-9.1401	5.8767	0.18832	0.0:0.7889:0.0:0.2111	.	71	Q8NGD1	OR4N2_HUMAN	G	71	ENSP00000452022:A71G;ENSP00000319601:A71G	ENSP00000319601:A71G	A	+	2	0	OR4N2	19365659	0.166000	0.22962	0.999000	0.59377	0.930000	0.56654	3.535000	0.53575	2.374000	0.81015	0.591000	0.81541	GCA	.		0.488	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
OR4N2	390429	hgsc.bcm.edu;bcgsc.ca	37	14	20295862	20295862	+	Silent	SNP	C	C	T	rs139052676	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:20295862C>T	ENST00000315947.1	+	1	255	c.255C>T	c.(253-255)ttC>ttT	p.F85F	OR4N2_ENST00000568211.1_Silent_p.F85F	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGGTGGACTTCCTCTCTGCGA	0.527																																					p.F85F		.											.	OR4N2-71	0			c.C255T						.						148.0	168.0	161.0					14																	20295862		2203	4300	6503	SO:0001819	synonymous_variant	390429	exon1			GGACTTCCTCTCT		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.255C>T	14.37:g.20295862C>T		192	0		232	15	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Silent	SNP	ENST00000315947.1	37	CCDS32022.1																																																																																			C|1.000;G|0.000		0.527	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
C14orf93	60686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23456429	23456429	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:23456429C>T	ENST00000299088.6	-	7	2041	c.1612G>A	c.(1612-1614)Gaa>Aaa	p.E538K	C14orf93_ENST00000406429.2_Missense_Mutation_p.E498K|C14orf93_ENST00000341470.4_Missense_Mutation_p.E498K|RP11-298I3.4_ENST00000557615.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000397379.3_Missense_Mutation_p.E538K|C14orf93_ENST00000397382.4_Missense_Mutation_p.E538K|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000397377.1_Missense_Mutation_p.E358K	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	538						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		AGATTTTATTCATCCTTTTCC	0.468											OREG0022593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E538K		.											.	C14orf93-91	0			c.G1612A						.						49.0	46.0	47.0					14																	23456429		2203	4300	6503	SO:0001583	missense	60686	exon7			TTTATTCATCCTT	AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.1612G>A	14.37:g.23456429C>T	ENSP00000299088:p.Glu538Lys	83	0	763	111	14	NM_021944	0	0	2	2	0	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Missense_Mutation	SNP	ENST00000299088.6	37	CCDS9583.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656471	0.88154	.	.	ENSG00000100802	ENST00000299088;ENST00000341470;ENST00000397379;ENST00000397382;ENST00000397377;ENST00000406429	T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000008	T	0.56171	0.1967	N	0.08118	0	0.41503	D	0.988299	D;D	0.67145	0.996;0.996	D;D	0.77557	0.987;0.99	T	0.66709	-0.5855	10	0.87932	D	0	-29.2612	18.5341	0.91002	0.0:1.0:0.0:0.0	.	538;498	Q9H972;Q9H972-2	CN093_HUMAN;.	K	538;498;538;538;358;498	ENSP00000299088:E538K;ENSP00000341353:E498K;ENSP00000380535:E538K;ENSP00000380538:E538K;ENSP00000380533:E358K;ENSP00000384768:E498K	ENSP00000299088:E538K	E	-	1	0	C14orf93	22526269	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.659000	0.54489	2.676000	0.91093	0.561000	0.74099	GAA	.		0.468	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944	
ADCY4	196883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24799400	24799400	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:24799400C>A	ENST00000310677.4	-	8	1145	c.1032G>T	c.(1030-1032)atG>atT	p.M344I	ADCY4_ENST00000396747.3_Intron|ADCY4_ENST00000418030.2_Missense_Mutation_p.M344I|ADCY4_ENST00000554068.2_Missense_Mutation_p.M344I|ADCY4_ENST00000558563.1_5'Flank	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	344					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		TGTCCAGGCCCATGCGCACGC	0.597																																					p.M344I		.											.	ADCY4-93	0			c.G1032T						.						111.0	85.0	94.0					14																	24799400		2203	4300	6503	SO:0001583	missense	196883	exon8			CAGGCCCATGCGC	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1032G>T	14.37:g.24799400C>A	ENSP00000312126:p.Met344Ile	113	0		127	22	NM_001198592	0	0	2	2	0	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044560	0.93685	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.81247	-1.47;-1.47;-1.47	5.01	5.01	0.66863	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000009	D	0.90393	0.6993	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91737	0.5401	10	0.87932	D	0	.	15.8497	0.78921	0.0:1.0:0.0:0.0	.	344	Q8NFM4	ADCY4_HUMAN	I	344	ENSP00000312126:M344I;ENSP00000452250:M344I;ENSP00000393177:M344I	ENSP00000312126:M344I	M	-	3	0	ADCY4	23869240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.612000	0.88384	0.561000	0.74099	ATG	.		0.597	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
INSM2	84684	broad.mit.edu	37	14	36004658	36004658	+	Silent	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:36004658C>A	ENST00000307169.3	+	1	1411	c.1200C>A	c.(1198-1200)ggC>ggA	p.G400G		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		TGCCTCAGGGCCCCTACACGG	0.682																																					p.G400G		.											.	INSM2-226	0			c.C1200A						.						24.0	30.0	28.0					14																	36004658		2160	4279	6439	SO:0001819	synonymous_variant	84684	exon1			TCAGGGCCCCTAC	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.1200C>A	14.37:g.36004658C>A		16	0		76	7	NM_032594	0	0	0	0	0	A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	ENST00000307169.3	37	CCDS9657.1																																																																																			.		0.682	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1		
PRPF39	55015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45564512	45564512	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:45564512G>C	ENST00000355765.6	+	2	240	c.70G>C	c.(70-72)Gtg>Ctg	p.V24L		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	24					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						TTCAGAGGTAGTGGTAGAACA	0.398																																					p.V24L		.											.	PRPF39-70	0			c.G70C						.						129.0	127.0	128.0					14																	45564512		1968	4159	6127	SO:0001583	missense	55015	exon2			GAGGTAGTGGTAG	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.70G>C	14.37:g.45564512G>C	ENSP00000348010:p.Val24Leu	226	0		239	50	NM_017922	0	0	0	0	0	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	37	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	G	5.874	0.345363	0.11126	.	.	ENSG00000185246	ENST00000355765;ENST00000553605	T	0.43688	0.94	5.35	4.45	0.53987	.	.	.	.	.	T	0.29126	0.0724	N	0.22421	0.69	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.15435	-1.0437	9	0.27785	T	0.31	-11.7116	10.9063	0.47081	0.0885:0.0:0.9115:0.0	.	24	Q86UA1	PRP39_HUMAN	L	24	ENSP00000348010:V24L	ENSP00000348010:V24L	V	+	1	0	PRPF39	44634262	0.978000	0.34361	0.744000	0.31058	0.977000	0.68977	1.681000	0.37618	1.250000	0.43966	0.491000	0.48974	GTG	.		0.398	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
PRKCH	5583	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	61917623	61917623	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:61917623C>G	ENST00000332981.5	+	6	1151	c.766C>G	c.(766-768)Cca>Gca	p.P256A	PRKCH_ENST00000555082.1_Missense_Mutation_p.P95A	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	256					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTACAAAGTGCCAACATTCTG	0.463																																					p.P256A	Melanoma(135;863 1779 8064 14443 26348)	.											.	PRKCH-1063	0			c.C766G						.						175.0	139.0	151.0					14																	61917623		2203	4300	6503	SO:0001583	missense	5583	exon6			AAAGTGCCAACAT	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.766C>G	14.37:g.61917623C>G	ENSP00000329127:p.Pro256Ala	139	1		150	24	NM_006255	0	0	0	0	0	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	C	35	5.483722	0.96307	.	.	ENSG00000027075	ENST00000556778;ENST00000332981;ENST00000555082;ENST00000557585;ENST00000557473	D;D;D;T;D	0.93488	-3.23;-3.23;-3.23;1.12;-1.99	5.79	5.79	0.91817	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.179300	0.39544	N	0.001331	D	0.97173	0.9076	M	0.88570	2.965	0.80722	D	1	D	0.53619	0.961	D	0.63703	0.917	D	0.96949	0.9693	10	0.56958	D	0.05	.	20.0782	0.97758	0.0:1.0:0.0:0.0	.	256	P24723	KPCL_HUMAN	A	95;256;95;95;95	ENSP00000452055:P95A;ENSP00000329127:P256A;ENSP00000450981:P95A;ENSP00000451930:P95A;ENSP00000452528:P95A	ENSP00000329127:P256A	P	+	1	0	PRKCH	60987376	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.794000	0.85869	2.762000	0.94881	0.579000	0.79373	CCA	.		0.463	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
WDR25	79446	bcgsc.ca	37	14	100996312	100996312	+	Silent	SNP	T	T	C	rs13065	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr14:100996312T>C	ENST00000335290.6	+	7	1795	c.1569T>C	c.(1567-1569)taT>taC	p.Y523Y	WDR25_ENST00000557502.1_3'UTR|WDR25_ENST00000554998.1_Silent_p.Y523Y|WDR25_ENST00000402312.3_Silent_p.Y523Y|WDR25_ENST00000542471.2_Silent_p.Y266Y	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	523										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				GCACCACCTATCACCCCGTGC	0.642													C|||	3212	0.641374	0.9705	0.611	5008	,	,		19149	0.6974		0.4155	False		,,,				2504	0.3926				p.Y523Y		.											.	WDR25-90	0			c.T1569C						.	C	,	3873,533	242.1+/-252.3	1710,453,40	82.0	75.0	77.0		1569,1569	0.8	1.0	14	dbSNP_52	77	3368,5232	640.7+/-399.6	670,2028,1602	no	coding-synonymous,coding-synonymous	WDR25	NM_001161476.1,NM_024515.4	,	2380,2481,1642	CC,CT,TT		39.1628,12.0971,44.3257	,	523/545,523/545	100996312	7241,5765	2203	4300	6503	SO:0001819	synonymous_variant	79446	exon7			CACCTATCACCCC	BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.1569T>C	14.37:g.100996312T>C		89	1		200	7	NM_001161476	0	0	23	23	0	A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Silent	SNP	ENST00000335290.6	37	CCDS32157.1																																																																																			T|0.409;C|0.591		0.642	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1	NM_024515	
SPTBN5	51332	broad.mit.edu	37	15	42167249	42167249	+	Silent	SNP	T	T	C	rs62002142	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr15:42167249T>C	ENST00000320955.6	-	23	4520	c.4293A>G	c.(4291-4293)gcA>gcG	p.A1431A		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1431					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTGCTCCTTTGCATCCTGGG	0.602													t|||	12	0.00239617	0.0008	0.0029	5008	,	,		19372	0.0		0.005	False		,,,				2504	0.0041				p.A1396A		.											.	SPTBN5-91	0			c.A4188G						.	T		4,4022		0,4,2009	22.0	24.0	23.0		4188	2.1	0.0	15	dbSNP_129	23	44,8312		0,44,4134	no	coding-synonymous	SPTBN5	NM_016642.2		0,48,6143	CC,CT,TT		0.5266,0.0994,0.3877		1396/3640	42167249	48,12334	2013	4178	6191	SO:0001819	synonymous_variant	51332	exon23			CTCCTTTGCATCC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4293A>G	15.37:g.42167249T>C		50	0		80	4	NM_016642	0	0	0	0	0		Silent	SNP	ENST00000320955.6	37																																																																																				T|0.995;C|0.005		0.602	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		5	5	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ADAMTS17	170691	broad.mit.edu	37	15	100871168	100871168	+	Missense_Mutation	SNP	C	C	T	rs143689354	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr15:100871168C>T	ENST00000268070.4	-	3	647	c.542G>A	c.(541-543)aGg>aAg	p.R181K		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	181						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCATTTGCGCCTGATCAGATG	0.587																																					p.R181K		.											.	ADAMTS17-228	0			c.G542A						.	C	LYS/ARG	0,4406		0,0,2203	130.0	123.0	126.0		542	5.1	1.0	15	dbSNP_134	126	10,8590	7.7+/-29.5	0,10,4290	yes	missense	ADAMTS17	NM_139057.2	26	0,10,6493	TT,TC,CC		0.1163,0.0,0.0769	benign	181/1096	100871168	10,12996	2203	4300	6503	SO:0001583	missense	170691	exon3			TTGCGCCTGATCA	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.542G>A	15.37:g.100871168C>T	ENSP00000268070:p.Arg181Lys	98	0		189	5	NM_139057	0	0	2	2	0	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693894	0.48202	0.0	0.001163	ENSG00000140470	ENST00000268070	T	0.61274	0.12	5.09	5.09	0.68999	.	0.065948	0.53938	D	0.000052	T	0.52125	0.1715	L	0.42245	1.32	0.39940	D	0.974391	P	0.37061	0.58	B	0.37550	0.253	T	0.57923	-0.7727	10	0.48119	T	0.1	.	15.4545	0.75302	0.0:1.0:0.0:0.0	.	181	Q8TE56	ATS17_HUMAN	K	181	ENSP00000268070:R181K	ENSP00000268070:R181K	R	-	2	0	ADAMTS17	98688691	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	1.971000	0.40530	2.351000	0.79841	0.655000	0.94253	AGG	C|0.999;T|0.001		0.587	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
MLST8	64223	ucsc.edu	37	16	2256104	2256104	+	Silent	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr16:2256104C>A	ENST00000569417.1	+	2	372	c.18C>A	c.(16-18)ggC>ggA	p.G6G	MLST8_ENST00000564088.1_Silent_p.G6G|MLST8_ENST00000397124.1_Silent_p.G6G|MLST8_ENST00000301724.10_Silent_p.G6G|MLST8_ENST00000561651.1_3'UTR|MLST8_ENST00000301725.7_Silent_p.G25G|AC009065.3_ENST00000517149.1_RNA|MLST8_ENST00000382450.4_Silent_p.G6G|MLST8_ENST00000565250.1_Silent_p.G6G	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	6					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						CCTCCCCAGGCACGGTGGGCA	0.632																																					p.G6G		.											.	MLST8-392	0			c.C18A						.																																			SO:0001819	synonymous_variant	64223	exon2			CCCAGGCACGGTG		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.18C>A	16.37:g.2256104C>A		115	2		260	4	NM_001199174	0	0	10	15	5	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Silent	SNP	ENST00000569417.1	37	CCDS10462.2																																																																																			.		0.632	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372	
NLRC5	84166	broad.mit.edu;bcgsc.ca	37	16	57101716	57101716	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr16:57101716C>A	ENST00000262510.6	+	36	4700	c.4475C>A	c.(4474-4476)tCc>tAc	p.S1492Y	NLRC5_ENST00000308149.7_Missense_Mutation_p.S1463Y|NLRC5_ENST00000539144.1_Missense_Mutation_p.S1463Y|NLRC5_ENST00000436936.1_Missense_Mutation_p.S1492Y	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1492					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTCCTGCTGTCCCTCTCTGAG	0.522																																					p.S1492Y		.											.	NLRC5-159	0			c.C4475A						.						159.0	136.0	144.0					16																	57101716		2198	4300	6498	SO:0001583	missense	84166	exon35			TGCTGTCCCTCTC	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4475C>A	16.37:g.57101716C>A	ENSP00000262510:p.Ser1492Tyr	127	0		198	7	NM_032206	0	0	13	14	1	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768478	0.31320	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	T;T;T;T	0.52983	2.22;2.22;0.64;2.22	3.86	1.84	0.25277	.	.	.	.	.	T	0.63331	0.2502	M	0.83312	2.635	0.09310	N	1	D	0.89917	1.0	D	0.73708	0.981	T	0.49606	-0.8922	9	0.31617	T	0.26	.	4.6605	0.12639	0.2144:0.6725:0.0:0.113	.	1492	Q86WI3	NLRC5_HUMAN	Y	1492;1463;1492;1463	ENSP00000262510:S1492Y;ENSP00000308886:S1463Y;ENSP00000389739:S1492Y;ENSP00000441727:S1463Y	ENSP00000262510:S1492Y	S	+	2	0	NLRC5	55659217	0.003000	0.15002	0.063000	0.19743	0.489000	0.33432	1.616000	0.36933	0.573000	0.29400	0.453000	0.30009	TCC	.		0.522	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
SPG7	6687	hgsc.bcm.edu	37	16	89574945	89574945	+	Silent	SNP	G	G	A	rs187330648	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr16:89574945G>A	ENST00000268704.2	+	1	135	c.120G>A	c.(118-120)ggG>ggA	p.G40G	SPG7_ENST00000341316.2_Silent_p.G40G	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	40					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CCGGGAGGGGGCGGCCGTACA	0.781													G|||	17	0.00339457	0.0008	0.0043	5008	,	,		9734	0.0		0.0129	False		,,,				2504	0.0				p.G40G		.											.	SPG7-226	0			c.G120A						.						1.0	2.0	1.0					16																	89574945		849	1936	2785	SO:0001819	synonymous_variant	6687	exon1			GAGGGGGCGGCCG	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.120G>A	16.37:g.89574945G>A		0	0		6	6	NM_199367	0	0	1	2	1	O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	ENST00000268704.2	37	CCDS10977.1																																																																																			G|0.979;A|0.021		0.781	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000599026.1_RNA|AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		0	0		6	5	NM_001013672	0	0	0	1	1	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
WDR16	146845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	9501596	9501596	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr17:9501596C>G	ENST00000352665.5	+	5	651	c.582C>G	c.(580-582)atC>atG	p.I194M	WDR16_ENST00000299764.5_Missense_Mutation_p.I204M|WDR16_ENST00000396219.3_Missense_Mutation_p.I126M	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						ATAGAAAAATCTGGCCAACTG	0.328																																					p.I194M		.											.	WDR16-71	0			c.C582G						.						92.0	98.0	96.0					17																	9501596		2203	4300	6503	SO:0001583	missense	146845	exon5			AAAAATCTGGCCA	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.582C>G	17.37:g.9501596C>G	ENSP00000339449:p.Ile194Met	41	0		39	16	NM_145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000352665.5	37	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249276	0.22880	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;D;T	0.91124	2.41;-2.79;4.85	5.25	0.852	0.18995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.140815	0.64402	D	0.000005	T	0.79263	0.4416	L	0.28608	0.87	0.33495	D	0.589226	P;P;B	0.43024	0.492;0.798;0.376	B;B;B	0.40009	0.184;0.316;0.104	T	0.75428	-0.3321	10	0.29301	T	0.29	-26.1415	0.7975	0.01069	0.246:0.3801:0.1286:0.2453	.	204;126;194	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	M	194;126;204	ENSP00000339449:I194M;ENSP00000379521:I126M;ENSP00000299764:I204M	ENSP00000299764:I204M	I	+	3	3	WDR16	9442321	0.836000	0.29430	0.997000	0.53966	0.957000	0.61999	-0.048000	0.11944	0.601000	0.29879	0.561000	0.74099	ATC	.		0.328	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
MYOCD	93649	hgsc.bcm.edu;bcgsc.ca	37	17	12626174	12626174	+	Silent	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr17:12626174A>G	ENST00000343344.4	+	5	264	c.264A>G	c.(262-264)gcA>gcG	p.A88A	MYOCD_ENST00000425538.1_Silent_p.A88A|AC005358.1_ENST00000609971.1_5'Flank|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	88					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTTCCACTGCAGAGAGGTCCA	0.443																																					p.A88A		.											.	MYOCD-93	0			c.A264G						.						124.0	134.0	131.0					17																	12626174		2203	4300	6503	SO:0001819	synonymous_variant	93649	exon5			CACTGCAGAGAGG	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.264A>G	17.37:g.12626174A>G		98	0		61	12	NM_001146312	0	0	0	0	0	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	37	CCDS11163.1																																																																																			.		0.443	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
VTN	7448	hgsc.bcm.edu	37	17	26699121	26699121	+	5'Flank	SNP	G	G	C	rs7212814		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr17:26699121G>C	ENST00000226218.4	-	0	0				SARM1_ENST00000457710.3_5'UTR|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|CTB-96E2.3_ENST00000591482.1_RNA|VTN_ENST00000536498.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGCCCACGGCGGGGCGCCGAG	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		9002	1.0		1.0	False		,,,				2504	1.0				p.R23P		.											.	.	0			c.G68C						.						2.0	2.0	2.0					17																	26699121		1378	3066	4444	SO:0001631	upstream_gene_variant	23098	exon1			CACGGCGGGGCGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699121G>C	Exception_encountered	0	0		6	6	NM_015077	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	2181	0.9986263736263736	490	0.9959349593495935	362	1.0	571	0.9982517482517482	758	1.0	C	4.627	0.116613	0.08881	.	.	ENSG00000004139	ENST00000457710	.	.	.	4.93	3.94	0.45596	.	1.216040	0.06217	N	0.686070	T	0.00012	0.0000	.	.	.	0.45837	P	0.0012929999999999886	.	.	.	.	.	.	T	0.38757	-0.9646	5	0.02654	T	1	0.2642	5.2918	0.15731	0.1514:0.6261:0.1455:0.077	rs7212814	.	.	.	P	23	.	ENSP00000406738:R23P	R	+	2	0	SARM1	23723248	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.263000	0.33004	0.497000	0.27926	-1.514000	0.00941	CGG	G|0.001;C|0.999		0.761	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
CIDEA	1149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	12274230	12274230	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr18:12274230G>A	ENST00000320477.9	+	4	534	c.469G>A	c.(469-471)Gtg>Atg	p.V157M	CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a	157					apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.V191M(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						GATGTACTCCGTGTCCTACGA	0.582																																					p.V157M		.											.	CIDEA-91	1	Substitution - Missense(1)	pancreas(1)	c.G469A						.						136.0	109.0	118.0					18																	12274230		2203	4300	6503	SO:0001583	missense	1149	exon4			TACTCCGTGTCCT	AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.469G>A	18.37:g.12274230G>A	ENSP00000320209:p.Val157Met	114	0		83	12	NM_001279	0	0	0	0	0	B0YIY7|Q6UPR7	Missense_Mutation	SNP	ENST00000320477.9	37	CCDS11856.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529525	0.44969	.	.	ENSG00000176194	ENST00000320477	D	0.81579	-1.51	5.31	5.31	0.75309	.	0.153345	0.44285	D	0.000463	T	0.82213	0.4988	L	0.51853	1.615	0.41004	D	0.984957	D;D	0.76494	0.999;0.999	D;P	0.63597	0.916;0.862	T	0.77659	-0.2505	10	0.10377	T	0.69	-42.3087	9.7044	0.40207	0.1564:0.0:0.8436:0.0	.	191;157	Q8N5P9;O60543	.;CIDEA_HUMAN	M	157	ENSP00000320209:V157M	ENSP00000320209:V157M	V	+	1	0	CIDEA	12264230	0.929000	0.31497	0.948000	0.38648	0.956000	0.61745	1.424000	0.34848	2.499000	0.84300	0.655000	0.94253	GTG	.		0.582	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254599.2	NM_001279	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	50976874	50976874	+	Silent	SNP	G	G	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr18:50976874G>A	ENST00000442544.2	+	23	3850	c.3234G>A	c.(3232-3234)ccG>ccA	p.P1078P	DCC_ENST00000581580.1_Silent_p.P713P	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1078					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCCCAGAGCCGCCAATTGGAC	0.483																																					p.P1078P		.											.	DCC-225	0			c.G3234A						.						83.0	75.0	77.0					18																	50976874		2203	4300	6503	SO:0001819	synonymous_variant	1630	exon23			AGAGCCGCCAATT	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3234G>A	18.37:g.50976874G>A		78	0		65	39	NM_005215	0	0	0	0	0		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																			.		0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
TMEM259	91304	hgsc.bcm.edu	37	19	1010396	1010396	+	Missense_Mutation	SNP	G	G	C	rs77868901	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:1010396G>C	ENST00000356663.3	-	11	1937	c.1816C>G	c.(1816-1818)Ccg>Gcg	p.P606A	TMEM259_ENST00000333175.5_3'UTR	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	606						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P606S(1)									ATGGAGGCCGGGCTAGGCCCG	0.726													N|||	155	0.0309505	0.0136	0.0058	5008	,	,		11720	0.0169		0.0457	False		,,,				2504	0.0716				p.P606A		.											.	.	1	Substitution - Missense(1)	skin(1)	c.C1816G						.		ALA/PRO,	48,3754		0,48,1853	3.0	4.0	4.0		1816,	-0.4	0.0	19	dbSNP_131	4	183,7553		2,179,3687	yes	missense,utr-3	C19orf6	NM_001033026.1,NM_033420.3	27,	2,227,5540	CC,CG,GG		2.3656,1.2625,2.0021	benign,	606/621,	1010396	231,11307	1901	3868	5769	SO:0001583	missense	91304	exon11			AGGCCGGGCTAGG	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1816C>G	19.37:g.1010396G>C	ENSP00000349087:p.Pro606Ala	0	0		25	7	NM_001033026	0	0	0	139	139	O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	37	CCDS32862.1	64	0.029304029304029304	12	0.024390243902439025	2	0.0055248618784530384	9	0.015734265734265736	41	0.05408970976253298	G	10.39	1.338342	0.24253	0.012625	0.023656	ENSG00000182087	ENST00000356663	.	.	.	3.36	-0.399	0.12415	.	0.456049	0.19721	N	0.107600	T	0.01940	0.0061	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.14727	-1.0462	9	0.22109	T	0.4	-0.4483	4.0757	0.09902	0.4474:0.1805:0.3721:0.0	.	606	Q4ZIN3	MBRL_HUMAN	A	606	.	ENSP00000349087:P606A	P	-	1	0	C19orf6	961396	0.005000	0.15991	0.021000	0.16686	0.040000	0.13550	-0.036000	0.12185	-0.082000	0.12640	0.500000	0.49745	CCG	G|0.970;C|0.030		0.726	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
TJP3	27134	hgsc.bcm.edu	37	19	3739077	3739077	+	Missense_Mutation	SNP	C	C	T	rs138219655		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:3739077C>T	ENST00000541714.2	+	13	2038	c.1576C>T	c.(1576-1578)Cgc>Tgc	p.R526C	TJP3_ENST00000539908.2_Missense_Mutation_p.R490C|TJP3_ENST00000262968.9_Missense_Mutation_p.R559C|TJP3_ENST00000382008.3_Missense_Mutation_p.R540C|TJP3_ENST00000589378.1_Missense_Mutation_p.R535C|TJP3_ENST00000587686.1_Missense_Mutation_p.R545C	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	526	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGCGGTGCGCATGGGTCG	0.682																																					p.R535C		.											.	TJP3-92	0			c.C1603T						.	C	CYS/ARG	0,4406		0,0,2203	42.0	41.0	41.0		1675	4.2	1.0	19	dbSNP_134	41	3,8595	3.0+/-9.4	0,3,4296	no	missense	TJP3	NM_014428.1	180	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	559/953	3739077	3,13001	2203	4299	6502	SO:0001583	missense	27134	exon13			GCGGTGCGCATGG	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1576C>T	19.37:g.3739077C>T	ENSP00000439278:p.Arg526Cys	2	0		20	14	NM_001267561	0	0	0	0	0	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	37	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240197	0.79912	0.0	3.49E-4	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.09255	3.0;3.0;3.0;3.0	4.22	4.22	0.49857	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.33614	0.0869	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.12116	-1.0560	10	0.87932	D	0	.	11.1093	0.48223	0.1847:0.8152:0.0:0.0	.	545;559;540;526	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	C	526;490;540;559	ENSP00000439278:R526C;ENSP00000439991:R490C;ENSP00000371438:R540C;ENSP00000262968:R559C	ENSP00000262968:R559C	R	+	1	0	TJP3	3690077	1.000000	0.71417	0.970000	0.41538	0.965000	0.64279	3.612000	0.54142	2.181000	0.69327	0.555000	0.69702	CGC	C|1.000;T|0.000		0.682	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
TJP3	27134	hgsc.bcm.edu	37	19	3739107	3739107	+	Missense_Mutation	SNP	C	C	T	rs35628485	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:3739107C>T	ENST00000541714.2	+	13	2068	c.1606C>T	c.(1606-1608)Cgg>Tgg	p.R536W	TJP3_ENST00000539908.2_Missense_Mutation_p.R500W|TJP3_ENST00000262968.9_Missense_Mutation_p.R569W|TJP3_ENST00000382008.3_Missense_Mutation_p.R550W|TJP3_ENST00000589378.1_Missense_Mutation_p.R545W|TJP3_ENST00000587686.1_Missense_Mutation_p.R555W	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	536	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCAAGAGCGGGGCATCAT	0.662													C|||	10	0.00199681	0.0	0.0058	5008	,	,		16853	0.0		0.006	False		,,,				2504	0.0				p.R545W		.											.	TJP3-92	0			c.C1633T						.	C	TRP/ARG	8,4398	15.5+/-35.6	0,8,2195	50.0	47.0	48.0		1705	4.2	1.0	19	dbSNP_126	48	59,8541	35.9+/-90.5	1,57,4242	yes	missense	TJP3	NM_014428.1	101	1,65,6437	TT,TC,CC		0.686,0.1816,0.5151	probably-damaging	569/953	3739107	67,12939	2203	4300	6503	SO:0001583	missense	27134	exon13			CAAGAGCGGGGCA	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1606C>T	19.37:g.3739107C>T	ENSP00000439278:p.Arg536Trp	2	0		9	7	NM_001267561	0	0	0	0	0	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	37	CCDS32873.2	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	0	0.0	3	0.00395778364116095	C	19.40	3.820431	0.71028	0.001816	0.00686	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	4.22	4.22	0.49857	Src homology-3 domain (3);Variant SH3 (1);	0.130416	0.48767	D	0.000165	T	0.27866	0.0686	M	0.62723	1.935	0.42742	D	0.993742	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.976;0.988;0.996;0.996	T	0.05386	-1.0888	10	0.87932	D	0	.	9.7476	0.40457	0.3299:0.6701:0.0:0.0	rs35628485	555;569;550;536	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	W	536;500;550;569	ENSP00000439278:R536W;ENSP00000439991:R500W;ENSP00000371438:R550W;ENSP00000262968:R569W	ENSP00000262968:R569W	R	+	1	2	TJP3	3690107	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	5.149000	0.64863	2.181000	0.69327	0.555000	0.69702	CGG	C|0.996;T|0.004		0.662	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
CACNA1A	773	hgsc.bcm.edu	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644				p.H2220H		.											.	CACNA1A-67	0			c.T6660C						.		,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773	exon46			CGGGGGATGGTGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G		0	0		21	7	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			A|0.360;G|0.640		0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
DYRK1B	9149	broad.mit.edu	37	19	40316857	40316857	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:40316857C>A	ENST00000593685.1	-	10	1949	c.1481G>T	c.(1480-1482)gGg>gTg	p.G494V	DYRK1B_ENST00000323039.5_Missense_Mutation_p.G494V|DYRK1B_ENST00000430012.2_Missense_Mutation_p.G454V|DYRK1B_ENST00000597639.1_Missense_Mutation_p.G466V|DYRK1B_ENST00000348817.3_Missense_Mutation_p.G466V			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	494	Interaction with RANBP9.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GATAGGGGGCCCAGGGCCCCC	0.622																																					p.G494V		.											.	DYRK1B-337	0			c.G1481T						.						50.0	53.0	52.0					19																	40316857		2203	4300	6503	SO:0001583	missense	9149	exon10			GGGGGCCCAGGGC	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1481G>T	19.37:g.40316857C>A	ENSP00000469863:p.Gly494Val	50	0		79	4	NM_004714	0	0	54	54	0	O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	37	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236630	0.39498	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.57595	0.39;0.42;0.41	4.18	4.18	0.49190	.	0.077143	0.51477	D	0.000082	T	0.32406	0.0828	N	0.19112	0.55	0.80722	D	1	P;P;P	0.39376	0.67;0.541;0.67	B;B;B	0.35550	0.205;0.101;0.205	T	0.09574	-1.0668	10	0.25751	T	0.34	.	9.4552	0.38750	0.212:0.788:0.0:0.0	.	454;494;466	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	V	494;466;454	ENSP00000312789:G494V;ENSP00000221803:G466V;ENSP00000403182:G454V	ENSP00000312789:G494V	G	-	2	0	DYRK1B	45008697	0.995000	0.38212	1.000000	0.80357	0.991000	0.79684	1.960000	0.40422	1.847000	0.53656	0.462000	0.41574	GGG	.		0.622	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	
NR1H2	7376	hgsc.bcm.edu	37	19	50881825	50881825	+	Silent	SNP	G	G	A	rs55817866	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:50881825G>A	ENST00000253727.5	+	6	754	c.519G>A	c.(517-519)caG>caA	p.Q173Q	NR1H2_ENST00000411902.2_Silent_p.Q76Q|NR1H2_ENST00000599105.1_Silent_p.Q173Q|NR1H2_ENST00000598168.1_Silent_p.Q173Q|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000593926.1_Silent_p.Q173Q	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTCGGAAACAGCAGCAGGAGT	0.637																																					p.Q173Q		.											.	NR1H2-186	0			c.G519A						.						38.0	47.0	44.0					19																	50881825		2140	4249	6389	SO:0001819	synonymous_variant	7376	exon6			GAAACAGCAGCAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.519G>A	19.37:g.50881825G>A		47	0		135	7	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																			G|0.903;A|0.097		0.637	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		5	4	NM_001114598	0	0	1	1	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
GPR32	2854	bcgsc.ca	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					p.T332P	Esophageal Squamous(113;152 1581 5732 15840 44398)	.											.	GPR32-91	0			c.A994C						.						66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	2854	exon1			TCTTTGACTTCTG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro	72	2		106	9	NM_001506	0	0	4	4	0	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	.		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
MIR518C	574477	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54210730	54210730	+	RNA	SNP	G	G	C			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr19:54210730G>C	ENST00000384822.1	+	0	0				MIR520C_ENST00000385005.1_RNA|MIR526A1_ENST00000384897.1_RNA	NR_030199.1				microRNA 518c																		TCCTCTAGAGGGAAGCACTTT	0.413																																					.		.											.	.	0			.						.						103.0	93.0	96.0					19																	54210730		1568	3582	5150			574476	.			CTAGAGGGAAGCA			19q13.42	2011-09-12		2008-12-18	ENSG00000207553	ENSG00000207553		"""ncRNAs / Micro RNAs"""	32109	non-coding RNA	RNA, micro				MIRN518C			Standard	NR_030199		Approved	hsa-mir-518c	uc021vac.1				19.37:g.54210730G>C		119	0		203	26	.	0	0	0	0	0		RNA	SNP	ENST00000384822.1	37																																																																																				.		0.413	MIR518C-201	KNOWN	basic	miRNA	miRNA		NR_030199	
PRKD3	23683	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	37543587	37543587	+	Silent	SNP	A	A	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr2:37543587A>T	ENST00000379066.1	-	2	843	c.81T>A	c.(79-81)tcT>tcA	p.S27S	PRKD3_ENST00000477132.1_5'Flank|PRKD3_ENST00000234179.2_Silent_p.S27S			O94806	KPCD3_HUMAN	protein kinase D3	27					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				TTGAACACGGAGAAGCAGCTG	0.483																																					p.S27S	Melanoma(80;621 1355 8613 11814 51767)	.											.	PRKD3-543	0			c.T81A						.						83.0	79.0	80.0					2																	37543587		2203	4300	6503	SO:0001819	synonymous_variant	23683	exon1			ACACGGAGAAGCA	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.81T>A	2.37:g.37543587A>T		126	0		124	10	NM_005813	0	0	0	0	0	D6W587|Q53TR7|Q8NEL8	Silent	SNP	ENST00000379066.1	37	CCDS1789.1																																																																																			.		0.483	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813	
SIX3	6496	hgsc.bcm.edu	37	2	45171842	45171842	+	Silent	SNP	A	A	G	rs338074	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr2:45171842A>G	ENST00000260653.3	+	2	1284	c.942A>G	c.(940-942)gcA>gcG	p.A314A	SIX3-AS1_ENST00000419364.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	314					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGGAGCGCGCAGACACCGGCA	0.697													G|||	4695	0.9375	0.9773	0.9323	5008	,	,		10095	0.9901		0.9165	False		,,,				2504	0.8548				p.A314A		.											.	SIX3-90	0			c.A942G						.	G		4039,129		1959,121,4	18.0	19.0	19.0		942	1.0	1.0	2	dbSNP_129	19	7494,648		3453,588,30	yes	coding-synonymous	SIX3	NM_005413.3		5412,709,34	GG,GA,AA		7.9587,3.095,6.3119		314/333	45171842	11533,777	2084	4071	6155	SO:0001819	synonymous_variant	6496	exon2			GCGCGCAGACACC	AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.942A>G	2.37:g.45171842A>G		0	0		4	4	NM_005413	0	0	0	0	0	D6W5A5|Q53T42	Silent	SNP	ENST00000260653.3	37	CCDS1821.1																																																																																			A|0.059;G|0.941		0.697	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
PRR21	643905	bcgsc.ca	37	2	240982103	240982103	+	Silent	SNP	A	A	G	rs74344384	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr2:240982103A>G	ENST00000408934.1	-	1	296	c.297T>C	c.(295-297)caT>caC	p.H99H		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	99	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGGCATGGACGAAGG	0.617													-|||	1051	0.209864	0.205	0.1715	5008	,	,		18567	0.3651		0.1451	False		,,,				2504	0.1503				p.H99H		.											.	PRR21-70	0			c.T297C						.	A		386,3910		94,198,1856	80.0	79.0	80.0		297	-3.6	0.0	2	dbSNP_131	80	629,7911		201,227,3842	no	coding-synonymous	PRR21	NM_001080835.1		295,425,5698	GG,GA,AA		7.3653,8.9851,7.9074		99/390	240982103	1015,11821	2148	4270	6418	SO:0001819	synonymous_variant	643905	exon1			AGAGGCATGGACG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.297T>C	2.37:g.240982103A>G		123	9		84	30	NM_001080835	0	0	0	0	0		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																			A|0.951;G|0.049		0.617	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
SNPH	9751	hgsc.bcm.edu	37	20	1286662	1286662	+	Silent	SNP	G	G	A	rs62187495	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr20:1286662G>A	ENST00000381873.3	+	6	1685	c.1449G>A	c.(1447-1449)ccG>ccA	p.P483P	SNPH_ENST00000381867.1_Silent_p.P527P	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	483					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)			endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TGAGCCAGCCGAGTCCCAGCC	0.692													G|||	47	0.00938498	0.0076	0.0115	5008	,	,		12878	0.001		0.0189	False		,,,				2504	0.0092				p.P483P		.											.	SNPH-92	0			c.G1449A						.	G		27,2993		0,27,1483	3.0	3.0	3.0		1449	-9.6	0.0	20	dbSNP_129	3	149,6021		1,147,2937	no	coding-synonymous	SNPH	NM_014723.2		1,174,4420	AA,AG,GG		2.4149,0.894,1.9151		483/495	1286662	176,9014	1510	3085	4595	SO:0001819	synonymous_variant	9751	exon6			CCAGCCGAGTCCC		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.1449G>A	20.37:g.1286662G>A		1	0		8	5	NM_014723	0	0	1	1	0	Q8IYI3	Silent	SNP	ENST00000381873.3	37	CCDS13012.1																																																																																			G|0.987;A|0.013		0.692	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723	
PLCB4	5332	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	9353694	9353694	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr20:9353694C>T	ENST00000378493.1	+	9	702	c.687C>T	c.(685-687)atC>atT	p.I229I	PLCB4_ENST00000378501.2_Splice_Site_p.I229I|PLCB4_ENST00000378473.3_Splice_Site_p.I229I|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Splice_Site_p.I229I|PLCB4_ENST00000334005.3_Splice_Site_p.I229I|PLCB4_ENST00000414679.2_Splice_Site_p.I229I			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	229					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TTCTTTTCAGCAATGGAGACA	0.289																																					p.I229I		.											.	PLCB4-274	0			c.C687T						.						71.0	69.0	70.0					20																	9353694		2199	4299	6498	SO:0001630	splice_region_variant	5332	exon10			TTTCAGCAATGGA		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.687-1C>T	20.37:g.9353694C>T		79	1		98	13	NM_182797	0	0	0	0	0	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																			.		0.289	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		Silent
KIF3B	9371	bcgsc.ca	37	20	30915461	30915461	+	Silent	SNP	T	T	C	rs1129012	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr20:30915461T>C	ENST00000375712.3	+	7	2132	c.1965T>C	c.(1963-1965)taT>taC	p.Y655Y	KIF3B_ENST00000418717.2_Silent_p.Y281Y	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	655	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)	p.Y655Y(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AGGCCCGATATAGGGTGAGAA	0.468													T|||	1011	0.201877	0.3313	0.1441	5008	,	,		17700	0.2222		0.1859	False		,,,				2504	0.0634				p.Y655Y		.											.	KIF3B-517	1	Substitution - coding silent(1)	stomach(1)	c.T1965C						.	T		1346,3060	448.3+/-348.6	204,938,1061	93.0	81.0	85.0		1965	-4.2	0.4	20	dbSNP_86	85	1471,7129	281.7+/-295.2	136,1199,2965	no	coding-synonymous	KIF3B	NM_004798.3		340,2137,4026	CC,CT,TT		17.1047,30.5493,21.6592		655/748	30915461	2817,10189	2203	4300	6503	SO:0001819	synonymous_variant	9371	exon7			CCGATATAGGGTG	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1965T>C	20.37:g.30915461T>C		80	0		109	5	NM_004798	0	0	0	0	0	B2RMP4|B4DSR5|E1P5M5	Silent	SNP	ENST00000375712.3	37	CCDS13200.1																																																																																			A|0.000;C|0.216;G|0.000;T|0.784		0.468	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1	NM_004798	
COL20A1	57642	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61957493	61957493	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr20:61957493G>A	ENST00000358894.6	+	30	3548	c.3448G>A	c.(3448-3450)Ggc>Agc	p.G1150S	COL20A1_ENST00000422202.1_Missense_Mutation_p.G1157S|COL20A1_ENST00000326996.6_Missense_Mutation_p.G1182S|COL20A1_ENST00000435874.1_Missense_Mutation_p.G1157S	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	1150	Collagen-like 2.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					TGGACCCCCTGGCCCCAGGGT	0.657																																					p.G1150S		.											.	COL20A1-90	0			c.G3448A						.						49.0	56.0	54.0					20																	61957493		1912	4114	6026	SO:0001583	missense	57642	exon30			CCCCCTGGCCCCA	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3448G>A	20.37:g.61957493G>A	ENSP00000351767:p.Gly1150Ser	74	1		116	27	NM_020882	0	0	0	0	0	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.385025	0.42308	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202;ENST00000415763;ENST00000455906	D;D;D;D;D;D	0.99527	-5.75;-5.75;-6.09;-6.09;-5.75;-5.87	3.73	2.75	0.32379	.	0.000000	0.85682	U	0.000000	D	0.99603	0.9856	H	0.96662	3.86	0.44899	D	0.997912	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98853	1.0759	10	0.72032	D	0.01	.	8.3334	0.32200	0.0:0.0:0.7637:0.2363	.	1157;1150	Q9P218-2;Q9P218	.;COKA1_HUMAN	S	1150;1182;1157;1157;285;140	ENSP00000351767:G1150S;ENSP00000323077:G1182S;ENSP00000408690:G1157S;ENSP00000414753:G1157S;ENSP00000410799:G285S;ENSP00000406345:G140S	ENSP00000323077:G1182S	G	+	1	0	COL20A1	61427937	0.998000	0.40836	0.640000	0.29408	0.045000	0.14185	3.056000	0.49923	0.533000	0.28675	-0.500000	0.04577	GGC	.		0.657	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
COL18A1	80781	hgsc.bcm.edu	37	21	46929331	46929331	+	Missense_Mutation	SNP	C	C	G	rs187670025	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr21:46929331C>G	ENST00000359759.4	+	38	4577	c.4556C>G	c.(4555-4557)cCg>cGg	p.P1519R	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000355480.5_Missense_Mutation_p.P1284R|COL18A1_ENST00000400337.2_Missense_Mutation_p.P1104R|SLC19A1_ENST00000468508.1_5'Flank			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1519	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		AACCCCTACCCGCGGCGGGAG	0.751													C|||	27	0.00539137	0.0	0.0058	5008	,	,		10764	0.0		0.0129	False		,,,				2504	0.0102				p.P1281R		.											.	COL18A1-90	0			c.C3842G						.	C	ARG/PRO,ARG/PRO	3,3107		0,3,1552	3.0	4.0	4.0		3851,3311	4.3	0.0	21		4	53,6967		0,53,3457	no	missense,missense	COL18A1	NM_030582.3,NM_130445.2	103,103	0,56,5009	GG,GC,CC		0.755,0.0965,0.5528	probably-damaging,probably-damaging	1284/1520,1104/1340	46929331	56,10074	1555	3510	5065	SO:0001583	missense	80781	exon39			CCTACCCGCGGCG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4556C>G	21.37:g.46929331C>G	ENSP00000352798:p.Pro1519Arg	0	0		10	4	NM_030582	0	0	14	22	8	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		13|13	0.005952380952380952|0.005952380952380952	2|2	0.0040650406504065045|0.0040650406504065045	4|4	0.011049723756906077|0.011049723756906077	0|0	0.0|0.0	7|7	0.009234828496042216|0.009234828496042216	C|C	11.25|11.25	1.583916|1.583916	0.28268|0.28268	9.65E-4|9.65E-4	0.00755|0.00755	ENSG00000182871|ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220|ENST00000423214	T;T;T;T|.	0.39406|.	1.08;1.08;1.08;1.08|.	4.28|4.28	4.28|4.28	0.50868|0.50868	Collagenase NC10/endostatin (1);|.	0.485149|.	0.21106|.	N|.	0.080068|.	T|T	0.53610|0.53610	0.1807|0.1807	L|L	0.59436|0.59436	1.845|1.845	0.37272|0.37272	D|D	0.907456|0.907456	P;P;P;P|.	0.50272|.	0.933;0.883;0.918;0.918|.	P;B;P;B|.	0.51516|.	0.672;0.4;0.543;0.438|.	T|T	0.63047|0.63047	-0.6724|-0.6724	10|5	0.21540|.	T|.	0.41|.	.|.	9.951|9.951	0.41638|0.41638	0.203:0.797:0.0:0.0|0.203:0.797:0.0:0.0	.|.	1519;1101;1284;1104|.	P39060;D3DSM4;P39060-1;P39060-2|.	COIA1_HUMAN;.;.;.|.	R|G	1104;1104;1284;1519;1519;452|89	ENSP00000383191:P1104R;ENSP00000347665:P1284R;ENSP00000352798:P1519R;ENSP00000339118:P452R|.	ENSP00000339118:P452R|.	P|R	+|+	2|1	0|0	COL18A1|COL18A1	45753759|45753759	0.000000|0.000000	0.05858|0.05858	0.011000|0.011000	0.14972|0.14972	0.014000|0.014000	0.08584|0.08584	0.128000|0.128000	0.15810|0.15810	2.117000|2.117000	0.64856|0.64856	0.542000|0.542000	0.68232|0.68232	CCG|CGC	C|0.994;G|0.006		0.751	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
NEFH	4744	bcgsc.ca	37	22	29885861	29885861	+	Silent	SNP	T	T	C	rs59890097|rs532587474|rs165923	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr22:29885861T>C	ENST00000310624.6	+	4	2265	c.2232T>C	c.(2230-2232)gcT>gcC	p.A744A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	750	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAAGAAGCTAAGTCCCCAG	0.552													C|||	4098	0.818291	0.8699	0.7392	5008	,	,		19904	0.7917		0.7694	False		,,,				2504	0.8824				p.A744A		.											.	NEFH-90	0			c.T2232C	GRCh37	CD991813	NEFH	D	rs165923	.	C		3677,729	300.7+/-286.5	1541,595,67	101.0	101.0	101.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2232	2.5	0.1	22	dbSNP_79	101	6732,1868	328.2+/-318.2	2636,1460,204	no	coding-synonymous	NEFH	NM_021076.3		4177,2055,271	CC,CT,TT		21.7209,16.5456,19.9677		744/1021	29885861	10409,2597	2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			AGAAGCTAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2232T>C	22.37:g.29885861T>C		418	2		210	8	NM_021076	0	0	11	11	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			T|0.192;C|0.808		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
FBXO7	25793	bcgsc.ca	37	22	32875190	32875190	+	Missense_Mutation	SNP	G	G	A	rs11107	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr22:32875190G>A	ENST00000266087.7	+	2	672	c.345G>A	c.(343-345)atG>atA	p.M115I	FBXO7_ENST00000397426.1_Start_Codon_SNP_p.M1I|FBXO7_ENST00000382058.3_Missense_Mutation_p.M36I|FBXO7_ENST00000465418.1_3'UTR	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	115	Important for interaction with PINK1.		M -> I (in dbSNP:rs11107). {ECO:0000269|PubMed:10531035, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:18513678}.		cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGACTAGCATGCAGGATGAAC	0.448													g|||	2441	0.48742	0.4047	0.5663	5008	,	,		17154	0.6915		0.3748	False		,,,				2504	0.4489				p.M115I		.											.	FBXO7-228	0			c.G345A						.	G	ILE/MET,ILE/MET	1640,2766	501.8+/-365.1	307,1026,870	93.0	92.0	92.0		108,345	-3.6	0.0	22	dbSNP_52	92	3202,5398	483.2+/-371.1	572,2058,1670	yes	missense,missense	FBXO7	NM_001033024.1,NM_012179.3	10,10	879,3084,2540	AA,AG,GG		37.2326,37.222,37.229	benign,benign	36/444,115/523	32875190	4842,8164	2203	4300	6503	SO:0001583	missense	25793	exon2			TAGCATGCAGGAT	AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.345G>A	22.37:g.32875190G>A	ENSP00000266087:p.Met115Ile	110	0		80	5	NM_012179	0	0	3	3	0	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	ENST00000266087.7	37	CCDS13907.1	1067	0.48855311355311354	185	0.37601626016260165	193	0.5331491712707183	396	0.6923076923076923	293	0.3865435356200528	g	0.741	-0.776340	0.02951	0.37222	0.372326	ENSG00000100225	ENST00000266087;ENST00000452138;ENST00000382058;ENST00000397426;ENST00000444207	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	4.53	-3.63	0.04529	.	1.881220	0.01957	N	0.043074	T	0.00012	0.0000	N	0.00138	-2.015	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.47368	-0.9123	9	0.37606	T	0.19	0.134	0.4433	0.00489	0.2236:0.1582:0.2575:0.3607	rs11107;rs710174;rs3171628;rs17350295;rs17771677;rs17850310;rs52811518;rs58963810;rs11107	36;115;1	Q9Y3I1-2;Q9Y3I1;Q5TI86	.;FBX7_HUMAN;.	I	115;36;36;1;1	ENSP00000266087:M115I;ENSP00000388547:M36I;ENSP00000371490:M36I;ENSP00000380571:M1I;ENSP00000404388:M1I	ENSP00000266087:M115I	M	+	3	0	FBXO7	31205190	0.000000	0.05858	0.000000	0.03702	0.231000	0.25187	-0.024000	0.12435	-0.629000	0.05575	-0.578000	0.04140	ATG	G|0.577;N|0.000		0.448	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1		
GRM7	2917	bcgsc.ca	37	3	7620789	7620789	+	Silent	SNP	T	T	C	rs1485175	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:7620789T>C	ENST00000357716.4	+	8	2470	c.2196T>C	c.(2194-2196)taT>taC	p.Y732Y	GRM7_ENST00000402647.2_Silent_p.Y732Y|GRM7_ENST00000389336.4_Silent_p.Y732Y|GRM7_ENST00000403881.1_Silent_p.Y732Y|GRM7_ENST00000486284.1_Silent_p.Y732Y|GRM7_ENST00000458641.2_3'UTR	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	732					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TCATAGACTATGATGAACACA	0.423													T|||	2632	0.525559	0.5703	0.5144	5008	,	,		18820	0.4355		0.5835	False		,,,				2504	0.5061				p.Y732Y		.											.	GRM7-526	0			c.T2196C						.	T	,	2528,1878	631.3+/-395.6	723,1082,398	132.0	114.0	120.0		2196,2196	-0.1	1.0	3	dbSNP_88	120	4815,3785	614.9+/-396.3	1334,2147,819	no	coding-synonymous,coding-synonymous	GRM7	NM_000844.3,NM_181874.2	,	2057,3229,1217	CC,CT,TT		44.0116,42.6237,43.5414	,	732/916,732/923	7620789	7343,5663	2203	4300	6503	SO:0001819	synonymous_variant	2917	exon8			AGACTATGATGAA	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2196T>C	3.37:g.7620789T>C		172	1		237	8	NM_000844	0	0	0	0	0	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	37	CCDS43042.1																																																																																			T|0.451;C|0.549		0.423	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
RHOA	387	broad.mit.edu	37	3	49395586	49395586	+	IGR	SNP	G	G	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:49395586G>T	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419783.1_Silent_p.I42I|GPX1_ENST00000419349.1_Silent_p.I42I	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCACATTCTCGATAAGTAGTA	0.711																																					.		.											.	GPX1-68	0			.						.						12.0	14.0	13.0					3																	49395586		1920	4108	6028	SO:0001628	intergenic_variant	2876	.			ATTCTCGATAAGT	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395586G>T		45	0		181	9	.	0	0	109	110	1	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Silent	SNP	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.711	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
DPPA2	151871	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	109027035	109027035	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:109027035T>A	ENST00000478945.1	-	6	748	c.502A>T	c.(502-504)Aga>Tga	p.R168*		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	168					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCTTCTGCTCTCTCATTCATC	0.483																																					p.R168X		.											.	DPPA2-93	0			c.A502T						.						197.0	171.0	180.0					3																	109027035		2203	4300	6503	SO:0001587	stop_gained	151871	exon6			CTGCTCTCTCATT	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.502A>T	3.37:g.109027035T>A	ENSP00000417710:p.Arg168*	117	1		151	37	NM_138815	0	0	0	0	0	Q8WVF0	Nonsense_Mutation	SNP	ENST00000478945.1	37	CCDS2956.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.654309	0.88056	.	.	ENSG00000163530	ENST00000478945	.	.	.	4.11	0.346	0.16017	.	1.674670	0.03187	N	0.172884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	0.357	3.3009	0.06983	0.0:0.2435:0.2098:0.5467	.	.	.	.	X	168	.	ENSP00000417710:R168X	R	-	1	2	DPPA2	110509725	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.053000	0.14184	0.053000	0.16036	-0.501000	0.04562	AGA	.		0.483	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815	
ADPRH	141	broad.mit.edu	37	3	119306669	119306669	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:119306669A>G	ENST00000478399.1	+	4	2423	c.1018A>G	c.(1018-1020)Aca>Gca	p.T340A	ADPRH_ENST00000465513.1_Missense_Mutation_p.T340A|ADPRH_ENST00000357003.3_Missense_Mutation_p.T340A|ADPRH_ENST00000478927.1_Missense_Mutation_p.T340A|ADPRH_ENST00000471850.1_3'UTR			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	340					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		GCTGGAAGAGACAGCTAGGGC	0.438																																					p.T340A	GBM(133;579 1804 5989 9967 40052)	.											.	ADPRH-91	0			c.A1018G						.						76.0	80.0	79.0					3																	119306669		2203	4300	6503	SO:0001583	missense	141	exon5			GAAGAGACAGCTA	L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.1018A>G	3.37:g.119306669A>G	ENSP00000420200:p.Thr340Ala	50	0		58	4	NM_001125	0	0	0	0	0	B2R8H1|D3DN83	Missense_Mutation	SNP	ENST00000478399.1	37	CCDS2990.1	.	.	.	.	.	.	.	.	.	.	A	11.27	1.590092	0.28357	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	6.05	-2.22	0.06952	.	0.740669	0.13604	N	0.375679	T	0.10809	0.0264	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24941	-1.0146	10	0.49607	T	0.09	-3.738	9.271	0.37670	0.2622:0.1364:0.6013:0.0	.	340	P54922	ADPRH_HUMAN	A	340	ENSP00000420200:T340A;ENSP00000417528:T340A;ENSP00000349496:T340A;ENSP00000417430:T340A	ENSP00000349496:T340A	T	+	1	0	ADPRH	120789359	0.076000	0.21285	0.751000	0.31187	0.990000	0.78478	0.288000	0.18939	-0.317000	0.08677	0.528000	0.53228	ACA	.		0.438	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355199.1	NM_001125	
MAATS1	89876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119462961	119462961	+	Missense_Mutation	SNP	G	G	A	rs556802557		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:119462961G>A	ENST00000273390.5	+	14	1897	c.1820G>A	c.(1819-1821)cGg>cAg	p.R607Q	RP11-169N13.4_ENST00000489428.2_RNA	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	443						mitochondrion (GO:0005739)											GAGCGCCAGCGGCGGGTACGA	0.587																																					p.R607Q		.											.	.	0			c.G1820A						.						74.0	70.0	71.0					3																	119462961		2203	4300	6503	SO:0001583	missense	89876	exon14			GCCAGCGGCGGGT	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.1820G>A	3.37:g.119462961G>A	ENSP00000273390:p.Arg607Gln	114	0		134	23	NM_033364	0	0	3	3	0	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	ENST00000273390.5	37	CCDS2994.1	.	.	.	.	.	.	.	.	.	.	G	36	5.844809	0.97016	.	.	ENSG00000183833	ENST00000273390	T	0.60040	0.22	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	M	0.87097	2.86	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.83537	0.0094	10	0.87932	D	0	-12.1194	19.7305	0.96180	0.0:0.0:1.0:0.0	.	443;545;607	Q7Z4T9;Q7Z4T9-3;Q7Z4T9-7	AAT1_HUMAN;.;.	Q	607	ENSP00000273390:R607Q	ENSP00000273390:R607Q	R	+	2	0	C3orf15	120945651	1.000000	0.71417	0.998000	0.56505	0.903000	0.53119	9.184000	0.94893	2.663000	0.90544	0.484000	0.47621	CGG	.		0.587	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
PLXNA1	5361	hgsc.bcm.edu	37	3	126733053	126733053	+	Silent	SNP	C	C	T	rs11719489	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:126733053C>T	ENST00000393409.2	+	11	2439	c.2439C>T	c.(2437-2439)cgC>cgT	p.R813R	PLXNA1_ENST00000251772.4_Silent_p.R790R	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	813					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CGGCCCTGCGCGAGAGCTGCG	0.741													C|||	327	0.0652955	0.0809	0.0793	5008	,	,		11902	0.002		0.1402	False		,,,				2504	0.0225				p.R813R		.											.	PLXNA1-93	0			c.C2439T						.			339,4057		23,293,1882	18.0	21.0	20.0		2439	-4.7	0.9	3	dbSNP_120	20	1112,7424		88,936,3244	no	coding-synonymous	PLXNA1	NM_032242.3		111,1229,5126	TT,TC,CC		13.0272,7.7116,11.2202		813/1897	126733053	1451,11481	2198	4268	6466	SO:0001819	synonymous_variant	5361	exon11			CCTGCGCGAGAGC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2439C>T	3.37:g.126733053C>T		0	0		7	4	NM_032242	0	0	0	0	0		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			C|0.900;T|0.100		0.741	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
COL6A6	131873	bcgsc.ca	37	3	130361856	130361856	+	Missense_Mutation	SNP	G	G	A	rs16830494	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:130361856G>A	ENST00000358511.6	+	30	5247	c.5216G>A	c.(5215-5217)cGa>cAa	p.R1739Q	COL6A6_ENST00000453409.2_Missense_Mutation_p.R1739Q	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1739	Nonhelical region.		R -> Q (in dbSNP:rs16830494).		cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CAGTATGTGCGAGACCGCAGT	0.388													G|||	607	0.121206	0.0461	0.1614	5008	,	,		18958	0.1855		0.0934	False		,,,				2504	0.1564				p.R1739Q		.											.	COL6A6-76	0			c.G5216A						.	G	GLN/ARG	232,3518		5,222,1648	114.0	100.0	104.0		5216	3.1	1.0	3	dbSNP_123	104	803,7421		40,723,3349	yes	missense	COL6A6	NM_001102608.1	43	45,945,4997	AA,AG,GG		9.7641,6.1867,8.6437	probably-damaging	1739/2264	130361856	1035,10939	1875	4112	5987	SO:0001583	missense	131873	exon30			ATGTGCGAGACCG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5216G>A	3.37:g.130361856G>A	ENSP00000351310:p.Arg1739Gln	83	1		86	6	NM_001102608	0	0	0	0	0	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	260	0.11904761904761904	23	0.046747967479674794	58	0.16022099447513813	107	0.18706293706293706	72	0.09498680738786279	G	15.35	2.808812	0.50421	0.061867	0.097641	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.90504	-2.63;-2.68	5.77	3.06	0.35304	.	.	.	.	.	T	0.00637	0.0021	L	0.53249	1.67	0.34767	P	0.26665000000000005	B	0.30193	0.272	B	0.20955	0.032	T	0.32214	-0.9915	8	0.59425	D	0.04	.	9.6965	0.40161	0.2159:0.0:0.7841:0.0	rs16830494;rs56471849;rs16830494	1739	A6NMZ7	CO6A6_HUMAN	Q	1739	ENSP00000351310:R1739Q;ENSP00000399236:R1739Q	ENSP00000351310:R1739Q	R	+	2	0	COL6A6	131844546	0.995000	0.38212	0.990000	0.47175	0.931000	0.56810	1.703000	0.37846	0.387000	0.25024	-0.219000	0.12488	CGA	G|0.887;A|0.113		0.388	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
MUC20	200958	bcgsc.ca	37	3	195453257	195453257	+	Missense_Mutation	SNP	G	G	A	rs3828406	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:195453257G>A	ENST00000447234.2	+	2	1909	c.1783G>A	c.(1783-1785)Gca>Aca	p.A595T	MUC20_ENST00000445522.2_Missense_Mutation_p.A560T|MUC20_ENST00000436408.1_Missense_Mutation_p.A595T|MUC20_ENST00000320736.6_Missense_Mutation_p.A424T	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	595	Involved in oligomerization.|Thr-rich.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CATGGACATCGCAACCAAGGG	0.582																																					p.A424T		.											.	.	0			c.G1270A						.		THR/ALA,THR/ALA	1253,2893		58,1137,878	62.0	60.0	61.0		1165,1270	4.5	0.0	3	dbSNP_107	61	2926,5464		178,2570,1447	no	missense,missense	MUC20	NM_001098516.1,NM_152673.2	58,58	236,3707,2325	AA,AG,GG		34.8749,30.2219,33.336	benign,benign	389/504,424/539	195453257	4179,8357	2073	4195	6268	SO:0001583	missense	200958	exon3			GACATCGCAACCA	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1783G>A	3.37:g.195453257G>A	ENSP00000414350:p.Ala595Thr	212	1		226	9	NM_152673	0	0	3	3	0	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	37		802|802	0.36721611721611724|0.36721611721611724	178|178	0.3617886178861789|0.3617886178861789	124|124	0.3425414364640884|0.3425414364640884	251|251	0.4388111888111888|0.4388111888111888	249|249	0.32849604221635886|0.32849604221635886	A|A	1.905|1.905	-0.452224|-0.452224	0.04540|0.04540	0.302219|0.302219	0.348749|0.348749	ENSG00000176945|ENSG00000176945	ENST00000381954;ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522|ENST00000423938	T;T;T;T|.	0.12361|.	3.1;3.04;3.26;2.69|.	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.826684|.	0.10455|.	N|.	0.672700|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.01048|0.01048	-1.04|-1.04	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.44726|0.44726	-0.9309|-0.9309	9|4	0.02654|.	T|.	1|.	-0.0298|-0.0298	7.0355|7.0355	0.24991|0.24991	0.8978:0.0:0.1022:0.0|0.8978:0.0:0.1022:0.0	rs3828406;rs9870845|rs3828406;rs9870845	424|.	E9PH32|.	.|.	T|H	406;595;424;595;560|6	ENSP00000414350:A595T;ENSP00000325431:A424T;ENSP00000396774:A595T;ENSP00000405629:A560T|.	ENSP00000325431:A424T|.	A|R	+|+	1|2	0|0	MUC20|MUC20	196938928|196938928	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	1.433000|1.433000	0.34947|0.34947	0.859000|0.859000	0.35456|0.35456	-0.375000|-0.375000	0.07067|0.07067	GCA|CGC	G|0.643;A|0.357		0.582	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
PAK2	5062	bcgsc.ca	37	3	196509544	196509544	+	Silent	SNP	T	T	C	rs79361419	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:196509544T>C	ENST00000327134.3	+	2	349	c.27T>C	c.(25-27)gaT>gaC	p.D9D	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	9					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.D9D(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AACTGGAAGATAAGCCTCCAG	0.423																																					p.D9D		.											.	PAK2-957	2	Substitution - coding silent(2)	prostate(2)	c.T27C						.						99.0	104.0	102.0					3																	196509544		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon2			GGAAGATAAGCCT	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.27T>C	3.37:g.196509544T>C		149	3		160	18	NM_002577	0	0	0	0	0	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																			T|0.994;C|0.006		0.423	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PAK2	5062	bcgsc.ca	37	3	196509577	196509577	+	Missense_Mutation	SNP	C	C	G	rs76714248	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr3:196509577C>G	ENST00000327134.3	+	2	382	c.60C>G	c.(58-60)agC>agG	p.S20R	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	20					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GAATGAGCAGCACCATCTTTA	0.443																																					p.S20R		.											.	PAK2-957	0			c.C60G						.						123.0	129.0	127.0					3																	196509577		2203	4300	6503	SO:0001583	missense	5062	exon2			GAGCAGCACCATC	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.60C>G	3.37:g.196509577C>G	ENSP00000314067:p.Ser20Arg	154	4		177	20	NM_002577	0	0	0	0	0	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749766	0.69533	.	.	ENSG00000180370	ENST00000327134	T	0.74737	-0.87	5.21	-3.63	0.04529	.	0.081384	0.85682	D	0.000000	D	0.83115	0.5184	M	0.78456	2.415	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.83597	0.0126	10	0.87932	D	0	.	14.4339	0.67268	0.0:0.6189:0.0:0.3811	.	20	Q13177	PAK2_HUMAN	R	20	ENSP00000314067:S20R	ENSP00000314067:S20R	S	+	3	2	PAK2	197993974	0.899000	0.30636	0.987000	0.45799	0.994000	0.84299	-0.061000	0.11693	-0.583000	0.05921	-0.290000	0.09829	AGC	C|0.982;G|0.018		0.443	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		0	0		15	6	NM_175918	0	0	7	11	4	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389130	1389130	+	Silent	SNP	G	G	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr4:1389130G>A	ENST00000324803.4	+	1	3791	c.831G>A	c.(829-831)ggG>ggA	p.G277G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	277					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G277G(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCGATGTGGGGTGCCCGCCT	0.687																																					p.G277G		.											.	CRIPAK-90	1	Substitution - coding silent(1)	lung(1)	c.G831A						.						154.0	143.0	147.0					4																	1389130		2202	4299	6501	SO:0001819	synonymous_variant	285464	exon1			ATGTGGGGTGCCC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.831G>A	4.37:g.1389130G>A		0	0		99	7	NM_175918	0	0	6	9	3	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			.		0.687	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
ANKRD17	26057	ucsc.edu;bcgsc.ca	37	4	73956553	73956553	+	Silent	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr4:73956553A>G	ENST00000358602.4	-	29	6908	c.6792T>C	c.(6790-6792)tcT>tcC	p.S2264S	ANKRD17_ENST00000509867.2_Silent_p.S2151S|ANKRD17_ENST00000330838.6_Silent_p.S2013S	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2264					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGGCATGAGCAGAAGTAGGGC	0.428																																					p.S2264S		.											.	ANKRD17-234	0			c.T6792C						.						196.0	202.0	200.0					4																	73956553		2203	4300	6503	SO:0001819	synonymous_variant	26057	exon29			ATGAGCAGAAGTA	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6792T>C	4.37:g.73956553A>G		152	2		224	64	NM_032217	0	0	14	17	3	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Silent	SNP	ENST00000358602.4	37	CCDS34004.1																																																																																			.		0.428	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
SDAD1	55153	bcgsc.ca	37	4	76878716	76878716	+	Missense_Mutation	SNP	G	G	C	rs2242471	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr4:76878716G>C	ENST00000356260.5	-	19	1842	c.1724C>G	c.(1723-1725)tCc>tGc	p.S575C	SDAD1_ENST00000513089.1_5'Flank|SDAD1_ENST00000395711.4_Missense_Mutation_p.S538C	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	575			S -> C (in dbSNP:rs2242471). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.		actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CCTCTTCTGGGATTTCCCGGG	0.458													G|||	1397	0.278954	0.2368	0.2089	5008	,	,		19049	0.0734		0.4225	False		,,,				2504	0.4499				p.S575C		.											.	SDAD1-91	0			c.C1724G						.	G	CYS/SER	1104,3302	396.5+/-330.1	135,834,1234	137.0	138.0	138.0		1724	5.2	1.0	4	dbSNP_98	138	3365,5235	500.1+/-375.1	629,2107,1564	yes	missense	SDAD1	NM_018115.2	112	764,2941,2798	CC,CG,GG		39.1279,25.0567,34.3611	possibly-damaging	575/688	76878716	4469,8537	2203	4300	6503	SO:0001583	missense	55153	exon19			TTCTGGGATTTCC	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1724C>G	4.37:g.76878716G>C	ENSP00000348596:p.Ser575Cys	31	0		56	4	NM_018115	0	0	21	21	0	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	ENST00000356260.5	37	CCDS3573.2	552	0.25274725274725274	107	0.21747967479674796	83	0.2292817679558011	37	0.06468531468531469	325	0.4287598944591029	G	17.93	3.509480	0.64522	0.250567	0.391279	ENSG00000198301	ENST00000356260;ENST00000395711	T;D	0.86432	1.89;-2.12	5.15	5.15	0.70609	SDA1 (1);	0.161367	0.56097	D	0.000037	T	0.00012	0.0000	L	0.46157	1.445	0.35218	P	0.22419699999999998	P;P	0.51057	0.941;0.602	P;B	0.49477	0.612;0.312	T	0.00888	-1.1526	9	0.59425	D	0.04	-4.1951	16.483	0.84163	0.0:0.0:1.0:0.0	rs2242471;rs3201420;rs11557433;rs17288280;rs52806783;rs2242471	538;575	E7EW05;Q9NVU7	.;SDA1_HUMAN	C	575;538	ENSP00000348596:S575C;ENSP00000379061:S538C	ENSP00000348596:S575C	S	-	2	0	SDAD1	77097740	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.973000	0.56845	2.581000	0.87130	0.650000	0.86243	TCC	G|0.688;C|0.312		0.458	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115	
PDLIM4	8572	hgsc.bcm.edu	37	5	131607588	131607588	+	Missense_Mutation	SNP	G	G	T	rs4877	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr5:131607588G>T	ENST00000253754.3	+	6	839	c.775G>T	c.(775-777)Ggc>Tgc	p.G259C	PDLIM4_ENST00000379018.3_Intron|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	259	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.		G -> C (in dbSNP:rs4877). {ECO:0000269|Ref.1}.				zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACGCGCTGCGGCCACGGCAT	0.731													G|||	603	0.120407	0.0832	0.0591	5008	,	,		13153	0.2837		0.1034	False		,,,				2504	0.0634				p.G259C		.											.	PDLIM4-91	0			c.G775T						.	G	,CYS/GLY	426,3944		21,384,1780	11.0	14.0	13.0		,775	5.1	1.0	5	dbSNP_52	13	752,7778		38,676,3551	no	intron,missense	PDLIM4	NM_001131027.1,NM_003687.3	,159	59,1060,5331	TT,TG,GG		8.8159,9.7483,9.1318	,benign	,259/331	131607588	1178,11722	2185	4265	6450	SO:0001583	missense	8572	exon6			CGCTGCGGCCACG	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.775G>T	5.37:g.131607588G>T	ENSP00000253754:p.Gly259Cys	1	0		31	17	NM_003687	0	0	0	0	0	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	ENST00000253754.3	37	CCDS4152.1	311	0.1423992673992674	52	0.10569105691056911	28	0.07734806629834254	153	0.2674825174825175	78	0.10290237467018469	G	16.49	3.138895	0.56936	0.097483	0.088159	ENSG00000131435	ENST00000253754	D	0.88124	-2.34	5.09	5.09	0.68999	Zinc finger, LIM-type (5);	0.118294	0.56097	D	0.000033	T	0.00073	0.0002	M	0.86502	2.82	0.09310	P	1.0	B	0.16603	0.018	B	0.22880	0.042	T	0.19679	-1.0298	9	0.59425	D	0.04	-13.8161	13.8019	0.63206	0.0765:0.0:0.9235:0.0	rs4877;rs10613;rs1131322;rs2292258;rs3191126;rs17165851	259	P50479	PDLI4_HUMAN	C	259	ENSP00000253754:G259C	ENSP00000253754:G259C	G	+	1	0	PDLIM4	131635487	0.989000	0.36119	1.000000	0.80357	0.976000	0.68499	1.953000	0.40352	2.359000	0.80004	0.655000	0.94253	GGC	G|0.858;T|0.142		0.731	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		5	5	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHA8	56140	broad.mit.edu;bcgsc.ca	37	5	140221312	140221312	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr5:140221312A>G	ENST00000531613.1	+	1	406	c.406A>G	c.(406-408)Aaa>Gaa	p.K136E	PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.K136E|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	136					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCCGGGTAAAAGACCAAAA	0.532																																					p.K136E		.											.	PCDHA8-92	0			c.A406G						.						99.0	109.0	105.0					5																	140221312		2203	4299	6502	SO:0001583	missense	56140	exon1			CGGGTAAAAGACC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.406A>G	5.37:g.140221312A>G	ENSP00000434655:p.Lys136Glu	147	0		278	8	NM_031856	0	0	0	0	0	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	A	8.598	0.886148	0.17540	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.20069	2.1;2.1	3.72	1.16	0.20824	Cadherin (1);Cadherin-like (1);	0.200837	0.23777	U	0.044677	T	0.10208	0.0250	L	0.33792	1.035	0.09310	N	1	B;B	0.12013	0.001;0.005	B;B	0.14578	0.011;0.01	T	0.38757	-0.9646	10	0.02654	T	1	.	4.0774	0.09911	0.6512:0.0:0.1951:0.1537	.	136;136	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	E	136	ENSP00000434655:K136E;ENSP00000367363:K136E	ENSP00000367363:K136E	K	+	1	0	PCDHA8	140201496	0.006000	0.16342	0.000000	0.03702	0.041000	0.13682	1.328000	0.33758	0.020000	0.15106	-0.394000	0.06481	AAA	.		0.532	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559342	140559342	+	Missense_Mutation	SNP	T	T	C	rs138970173		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr5:140559342T>C	ENST00000239444.2	+	1	1972	c.1727T>C	c.(1726-1728)cTg>cCg	p.L576P	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	576	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCACCGAGCTGGTGCCCCGG	0.701																																					p.L576P		.											.	PCDHB8-131	0			c.T1727C						.						9.0	17.0	14.0					5																	140559342		2133	4184	6317	SO:0001583	missense	56128	exon1			CCGAGCTGGTGCC	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1727T>C	5.37:g.140559342T>C	ENSP00000239444:p.Leu576Pro	3	0		106	9	NM_019120	0	0	28	29	1	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970003	0.53614	.	.	ENSG00000120322	ENST00000239444	T	0.68479	-0.33	4.22	4.22	0.49857	Cadherin-like (1);	.	.	.	.	T	0.80292	0.4596	M	0.75264	2.295	0.58432	D	0.999991	D	0.89917	1.0	D	0.87578	0.998	T	0.82752	-0.0302	9	0.72032	D	0.01	.	13.0554	0.58977	0.0:0.0:0.0:1.0	.	576	Q9UN66	PCDB8_HUMAN	P	576	ENSP00000239444:L576P	ENSP00000239444:L576P	L	+	2	0	PCDHB8	140539526	0.646000	0.27295	1.000000	0.80357	0.704000	0.40688	0.869000	0.27996	1.561000	0.49584	0.248000	0.18094	CTG	T|1.000;C|0.000		0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHB12	56124	hgsc.bcm.edu	37	5	140590139	140590139	+	Missense_Mutation	SNP	G	G	A	rs145232861	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr5:140590139G>A	ENST00000239450.2	+	1	1849	c.1660G>A	c.(1660-1662)Gcc>Acc	p.A554T	PCDHB12_ENST00000541609.1_Missense_Mutation_p.A217T	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	554	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCTGGACGCCAACGACAA	0.711													G|||	11	0.00219649	0.0	0.0014	5008	,	,		16609	0.0		0.0099	False		,,,				2504	0.0				p.A554T		.											.	PCDHB12-93	0			c.G1660A						.	G	THR/ALA	6,4392		0,6,2193	23.0	27.0	26.0		1660	2.5	1.0	5	dbSNP_134	26	29,8559		0,29,4265	no	missense	PCDHB12	NM_018932.3	58	0,35,6458	AA,AG,GG		0.3377,0.1364,0.2695	benign	554/796	140590139	35,12951	2199	4294	6493	SO:0001583	missense	56124	exon1			CTGGACGCCAACG	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1660G>A	5.37:g.140590139G>A	ENSP00000239450:p.Ala554Thr	5	0		267	161	NM_018932	0	0	60	61	1	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	8.941	0.965816	0.18583	0.001364	0.003377	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.03181	4.02;4.02	3.41	2.5	0.30297	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.02533	0.0077	N	0.13352	0.335	0.09310	N	0.999998	B	0.34015	0.435	B	0.23716	0.048	T	0.46442	-0.9191	9	0.40728	T	0.16	.	12.3896	0.55350	0.0:0.481:0.519:0.0	.	554	Q9Y5F1	PCDBC_HUMAN	T	217;554;174	ENSP00000440199:A217T;ENSP00000239450:A554T	ENSP00000239450:A554T	A	+	1	0	PCDHB12	140570323	0.000000	0.05858	0.953000	0.39169	0.995000	0.86356	0.135000	0.15952	0.525000	0.28522	0.485000	0.47835	GCC	G|0.875;A|0.125		0.711	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
C6orf136	221545	hgsc.bcm.edu	37	6	30615260	30615260	+	Intron	SNP	C	C	T	rs3132594	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:30615260C>T	ENST00000376473.5	+	1	231				AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000528347.2_5'Flank|C6orf136_ENST00000293604.6_Silent_p.R84R|C6orf136_ENST00000376471.4_Intron	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GAGGGAGGCGCTGCCGGGCCT	0.746													C|||	292	0.0583067	0.1589	0.0605	5008	,	,		10975	0.004		0.0288	False		,,,				2504	0.0072				p.R84R		.											.	C6orf136-90	0			c.C252T						.						2.0	4.0	3.0					6																	30615260		539	1316	1855	SO:0001627	intron_variant	221545	exon1			GAGGCGCTGCCGG	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+180C>T	6.37:g.30615260C>T		0	0		10	7	NM_001161376	0	0	1	3	2	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	ENST00000376473.5	37	CCDS43443.1																																																																																			C|0.944;T|0.056		0.746	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
C6orf15	29113	bcgsc.ca	37	6	31079994	31079994	+	Missense_Mutation	SNP	C	C	T	rs2233976	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:31079994C>T	ENST00000259870.3	-	2	145	c.142G>A	c.(142-144)Gga>Aga	p.G48R	PSORS1C1_ENST00000259881.9_5'Flank	NM_014070.2	NP_054789.2	Q6UXA7	CF015_HUMAN	chromosome 6 open reading frame 15	48			G -> R (in dbSNP:rs2233976).		extracellular matrix organization (GO:0030198)	interstitial matrix (GO:0005614)	heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.G48R(1)		endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|stomach(1)	17						GAAGGTTGTCCGAGCTGAGGC	0.552													C|||	400	0.0798722	0.0461	0.1455	5008	,	,		18984	0.0387		0.1163	False		,,,				2504	0.0838				p.G48R		.											.	C6orf15-90	1	Substitution - Missense(1)	stomach(1)	c.G142A						.	C	ARG/GLY	240,4088		5,230,1929	127.0	150.0	143.0		142	3.0	0.0	6	dbSNP_98	143	786,7762		49,688,3537	yes	missense	C6orf15	NM_014070.2	125	54,918,5466	TT,TC,CC		9.1951,5.5453,7.9683	probably-damaging	48/326	31079994	1026,11850	2164	4274	6438	SO:0001583	missense	29113	exon2			GTTGTCCGAGCTG	AB031481	CCDS4693.1	6p21	2011-12-12			ENSG00000204542	ENSG00000204542			13927	protein-coding gene	gene with protein product		611401					Standard	NM_014070		Approved	STG	uc003nsk.1	Q6UXA7	OTTHUMG00000031111	ENST00000259870.3:c.142G>A	6.37:g.31079994C>T	ENSP00000259870:p.Gly48Arg	135	0		187	6	NM_014070	0	0	0	0	0	B0S7V8|Q0EFA6|Q2L6G7|Q5SQ81|Q86Z05|Q9UIG3	Missense_Mutation	SNP	ENST00000259870.3	37	CCDS4693.1	194	0.08882783882783883	22	0.044715447154471545	60	0.16574585635359115	20	0.03496503496503497	92	0.12137203166226913	C	15.74	2.921597	0.52653	0.055453	0.091951	ENSG00000204542	ENST00000259870	T	0.06371	3.31	4.81	3.01	0.34805	.	0.288753	0.24886	N	0.034817	T	0.02767	0.0083	L	0.56769	1.78	0.80722	P	0.0	P	0.47409	0.895	B	0.40256	0.324	T	0.37220	-0.9715	9	0.72032	D	0.01	-5.6377	6.5402	0.22377	0.0:0.7202:0.1819:0.0979	rs2233976;rs52800999;rs2233976	48	Q6UXA7	CF015_HUMAN	R	48	ENSP00000259870:G48R	ENSP00000259870:G48R	G	-	1	0	C6orf15	31187973	0.001000	0.12720	0.004000	0.12327	0.010000	0.07245	0.533000	0.23082	0.605000	0.29947	0.549000	0.68633	GGA	C|0.919;T|0.081		0.552	C6orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076184.2	NM_014070	
HLA-B	3106	bcgsc.ca;mdanderson.org	37	6	31324100	31324100	+	Missense_Mutation	SNP	G	G	T	rs1050654	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:31324100G>T	ENST00000412585.2	-	3	491	c.463C>A	c.(463-465)Cgc>Agc	p.R155S		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	155	Alpha-2.		R -> S (in dbSNP:rs1050654).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GTCCAGGAGCGCAGGTCCTCG	0.701									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R155S		.											.	HLA-B-90	0			c.C463A						.						30.0	22.0	24.0					6																	31324100		2099	4187	6286	SO:0001583	missense	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	AGGAGCGCAGGTC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.463C>A	6.37:g.31324100G>T	ENSP00000399168:p.Arg155Ser	31	0		262	56	NM_005514	0	0	384	384	0	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	917	0.4198717948717949	193	0.39227642276422764	166	0.4585635359116022	255	0.4458041958041958	303	0.3997361477572559	N	5.901	0.350341	0.11182	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596;ENST00000434333	T;T	0.00753	5.74;5.74	3.18	-0.322	0.12713	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	3.116210	0.03799	N	0.264097	T	0.00271	0.0008	.	.	.	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.11329	0.004;0.006	T	0.44498	-0.9324	8	0.38643	T	0.18	.	7.8334	0.29355	0.0:0.1263:0.3528:0.5209	rs1050654;rs3176002;rs9266148;rs17839963	155;155	P30480;P01889	1B42_HUMAN;1B07_HUMAN	S	155;34;34;166	ENSP00000399168:R155S;ENSP00000405931:R166S	ENSP00000399168:R155S	R	-	1	0	HLA-B	31432079	0.000000	0.05858	0.063000	0.19743	0.021000	0.10359	-0.271000	0.08572	-0.595000	0.05828	-2.445000	0.00210	CGC	T|0.427;G|0.573		0.701	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-B	3106	broad.mit.edu	37	6	31324604	31324604	+	Frame_Shift_Del	DEL	T	T	-	rs9266179|rs200186034	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:31324604delT	ENST00000412585.2	-	2	232	c.204delA	c.(202-204)agafs	p.R68fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	68	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*8(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GCGGCTCCTCTCTCGGACTCG	0.677									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R68fs		.											.	HLA-B-90	1	Deletion - Frameshift(1)	large_intestine(1)	c.204delA						.			1993,2105		740,513,796	33.0	33.0	33.0			-6.4	0.0	6	dbSNP_118	34	3347,4625		1272,803,1911	no	frameshift	HLA-B	NM_005514.6		2012,1316,2707	A1A1,A1R,RR		41.9844,48.6335,44.2419			31324604	5340,6730	2015	3950	5965	SO:0001589	frameshift_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	CTCCTCTCTCGGA	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.204delA	6.37:g.31324604delT	ENSP00000399168:p.Arg68fs	47	0		174	11	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.677	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
PBX2	5089	hgsc.bcm.edu	37	6	32157639	32157639	+	Silent	SNP	C	C	T	rs169503	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:32157639C>T	ENST00000375050.4	-	1	324	c.54G>A	c.(52-54)ctG>ctA	p.L18L		NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	18					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						TCACCAATCCCAggccccccc	0.786													C|||	838	0.167332	0.2625	0.0908	5008	,	,		6921	0.1369		0.1034	False		,,,				2504	0.1902				p.L18L		.											.	PBX2-91	0			c.G54A						.						5.0	8.0	7.0					6																	32157639		1309	2460	3769	SO:0001819	synonymous_variant	5089	exon1			CAATCCCAGGCCC		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.54G>A	6.37:g.32157639C>T		0	0		11	6	NM_002586	0	0	0	1	1	A2BFJ2	Silent	SNP	ENST00000375050.4	37	CCDS4748.1																																																																																			C|0.874;T|0.126		0.786	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		
CNPY3	10695	hgsc.bcm.edu;broad.mit.edu	37	6	42897358	42897363	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs570105218	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	TGCTGC	TGCTGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:42897358_42897363delTGCTGC	ENST00000372836.4	+	1	421_426	c.50_55delTGCTGC	c.(49-57)ttgctgctg>ttg	p.17_19LLL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_19LLL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgctgct	0.689																																					p.17_19del		.											.	CNPY3-69	1	Deletion - In frame(1)	central_nervous_system(1)	c.50_55del						.																																			SO:0001651	inframe_deletion	10695	exon1			TTCCCTTGCTGCT	U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_55delTGCTGC	6.37:g.42897364_42897369delTGCTGC	ENSP00000361926:p.Leu23_Leu24del	5	0		43	0	NM_006586	0	0	0	0	0	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	ENST00000372836.4	37	CCDS4875.1																																																																																			.		0.689	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040564.1	NM_006586	
HTR1B	3351	bcgsc.ca	37	6	78172260	78172260	+	Silent	SNP	C	C	G	rs6296	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:78172260C>G	ENST00000369947.2	-	1	1230	c.861G>C	c.(859-861)gtG>gtC	p.V287V		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	287					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TGACTTGGTTCACATACACAG	0.577													C|||	1693	0.338059	0.2436	0.4049	5008	,	,		16718	0.5089		0.2634	False		,,,				2504	0.319				p.V287V		.											.	HTR1B-90	0			c.G861C						.	C		987,3419	364.9+/-317.2	124,739,1340	134.0	147.0	143.0		861	4.2	1.0	6	dbSNP_52	143	2257,6343	381.2+/-339.9	311,1635,2354	no	coding-synonymous	HTR1B	NM_000863.1		435,2374,3694	GG,GC,CC		26.2442,22.4013,24.9423		287/391	78172260	3244,9762	2203	4300	6503	SO:0001819	synonymous_variant	3351	exon1			TTGGTTCACATAC	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.861G>C	6.37:g.78172260C>G		34	0		63	4	NM_000863	0	0	2	2	0	Q4VAY7	Silent	SNP	ENST00000369947.2	37	CCDS4986.1																																																																																			C|0.650;G|0.350		0.577	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		0	0		5	5	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	144878365	144878365	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:144878365G>C	ENST00000367545.3	+	49	7207	c.7207G>C	c.(7207-7209)Gag>Cag	p.E2403Q		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2403					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAAACTCCTGGAGGAATATGG	0.453																																					p.E2403Q		.											.	UTRN-95	0			c.G7207C						.						135.0	127.0	129.0					6																	144878365		2203	4300	6503	SO:0001583	missense	7402	exon49			CTCCTGGAGGAAT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.7207G>C	6.37:g.144878365G>C	ENSP00000356515:p.Glu2403Gln	120	0		153	11	NM_007124	0	0	0	0	0	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605127	0.46423	.	.	ENSG00000152818	ENST00000367545	T	0.36340	1.26	5.93	4.08	0.47627	.	0.478241	0.17655	N	0.166529	T	0.11495	0.0280	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.04708	-1.0932	10	0.33141	T	0.24	.	14.7419	0.69461	0.0:0.5642:0.4358:0.0	.	2403	P46939	UTRO_HUMAN	Q	2403	ENSP00000356515:E2403Q	ENSP00000356515:E2403Q	E	+	1	0	UTRN	144920058	0.998000	0.40836	0.991000	0.47740	0.874000	0.50279	3.571000	0.53841	1.470000	0.48102	0.655000	0.94253	GAG	.		0.453	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
ZC3H12D	340152	hgsc.bcm.edu	37	6	149772190	149772190	+	Missense_Mutation	SNP	G	G	A	rs112722576	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:149772190G>A	ENST00000409806.3	-	6	1531	c.1213C>T	c.(1213-1215)Cct>Tct	p.P405S	ZC3H12D_ENST00000389942.5_Missense_Mutation_p.P405S|ZC3H12D_ENST00000416573.2_Missense_Mutation_p.A307V|ZC3H12D_ENST00000498662.1_5'Flank|ZC3H12D_ENST00000542614.1_Missense_Mutation_p.A307V			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	405	Pro-rich. {ECO:0000255}.			P -> S (in Ref. 4; AAI57833). {ECO:0000305}.	negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.P405S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CCGGGCGGAGGCGGGAGGTCG	0.776													G|||	1682	0.335863	0.1619	0.389	5008	,	,		8771	0.7649		0.1412	False		,,,				2504	0.2914				p.P405S		.											.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1213T						.	G	SER/PRO	516,2856		37,442,1207	3.0	5.0	4.0		1213	-1.9	0.0	6	dbSNP_132	4	945,6567		66,813,2877	no	missense	ZC3H12D	NM_207360.2	74	103,1255,4084	AA,AG,GG		12.5799,15.3025,13.4234	benign	405/528	149772190	1461,9423	1686	3756	5442	SO:0001583	missense	340152	exon6			GCGGAGGCGGGAG			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1213C>T	6.37:g.149772190G>A	ENSP00000386616:p.Pro405Ser	0	0		5	5	NM_207360	0	0	0	0	0	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		724|724	0.3315018315018315|0.3315018315018315	94|94	0.1910569105691057|0.1910569105691057	123|123	0.3397790055248619|0.3397790055248619	399|399	0.6975524475524476|0.6975524475524476	108|108	0.1424802110817942|0.1424802110817942	G|G	14.21|14.21	2.466986|2.466986	0.43839|0.43839	0.153025|0.153025	0.125799|0.125799	ENSG00000178199|ENSG00000178199	ENST00000416573;ENST00000542614|ENST00000389942;ENST00000409806	T;T|T;T	0.31247|0.25749	1.53;1.5|1.78;1.78	2.45|2.45	-1.9|-1.9	0.07665|0.07665	.|.	.|.	.|.	.|.	.|.	T|T	0.02193|0.02193	0.0068|0.0068	N|N	0.11427|0.11427	0.14|0.14	0.80722|0.80722	P|P	0.0|0.0	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.04013	0.0|0.001	T|T	0.42085|0.42085	-0.9472|-0.9472	8|8	0.27785|0.06365	T|T	0.31|0.9	1.0E-4|1.0E-4	3.5413|3.5413	0.07812|0.07812	0.5478:0.2181:0.2341:0.0|0.5478:0.2181:0.2341:0.0	.|.	307|405	B7WNU7|A2A288	.|ZC12D_HUMAN	V|S	307|405	ENSP00000408686:A307V;ENSP00000440813:A307V|ENSP00000374592:P405S;ENSP00000386616:P405S	ENSP00000408686:A307V|ENSP00000374592:P405S	A|P	-|-	2|1	0|0	ZC3H12D|ZC3H12D	149813883|149813883	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.563000|0.563000	0.35712|0.35712	0.541000|0.541000	0.23207|0.23207	-0.300000|-0.300000	0.08895|0.08895	0.313000|0.313000	0.20887|0.20887	GCC|CCT	G|0.668;A|0.332		0.776	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
SYNE1	23345	bcgsc.ca	37	6	152576080	152576080	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:152576080C>A	ENST00000367255.5	-	104	20006	c.19405G>T	c.(19405-19407)Gac>Tac	p.D6469Y	SYNE1_ENST00000356820.4_Missense_Mutation_p.D993Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.D6469Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.D6398Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.D6398Y|SYNE1_ENST00000341594.5_Missense_Mutation_p.D6081Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6469					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTACTGAGTCTAGCAAGGAT	0.363										HNSCC(10;0.0054)																											p.D6469Y		.											.	SYNE1-607	0			c.G19405T						.						110.0	100.0	103.0					6																	152576080		2203	4300	6503	SO:0001583	missense	23345	exon104			CTGAGTCTAGCAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19405G>T	6.37:g.152576080C>A	ENSP00000356224:p.Asp6469Tyr	96	0		122	6	NM_182961	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728696	0.69074	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.56776	0.53;0.51;0.44;0.51;0.63;2.56	5.76	4.89	0.63831	.	0.090101	0.47455	D	0.000229	T	0.57592	0.2064	L	0.50333	1.59	0.40338	D	0.979	D;D;D	0.76494	0.998;0.998;0.999	P;P;D	0.68353	0.906;0.906;0.957	T	0.64415	-0.6413	10	0.72032	D	0.01	.	14.8539	0.70319	0.0:0.9311:0.0:0.0689	.	6469;6469;6398	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Y	6469;6398;6469;6398;6081;993	ENSP00000356224:D6469Y;ENSP00000396024:D6398Y;ENSP00000265368:D6469Y;ENSP00000390975:D6398Y;ENSP00000341887:D6081Y;ENSP00000349276:D993Y	ENSP00000265368:D6469Y	D	-	1	0	SYNE1	152617773	1.000000	0.71417	0.967000	0.41034	0.876000	0.50452	5.989000	0.70587	1.451000	0.47736	0.655000	0.94253	GAC	.		0.363	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
FBXO5	26271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	153296478	153296481	+	Frame_Shift_Del	DEL	TAAG	TAAG	-	rs17083348	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	TAAG	TAAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:153296478_153296481delTAAG	ENST00000229758.3	-	2	437_440	c.379_382delCTTA	c.(379-384)cttaatfs	p.LN127fs	FBXO5_ENST00000477822.1_5'Flank|FBXO5_ENST00000367241.3_Frame_Shift_Del_p.LN81fs	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	127					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		TTTGTACTATTAAGTGTCTGTTGC	0.402																																					p.127_128del	NSCLC(121;372 1757 17721 17977 29669)	.											.	FBXO5-658	0			c.379_382del						.																																			SO:0001589	frameshift_variant	26271	exon2			TACTATTAAGTGT	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.379_382delCTTA	6.37:g.153296478_153296481delTAAG	ENSP00000229758:p.Leu127fs	114	0		133	18	NM_012177	0	0	0	0	0	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Frame_Shift_Del	DEL	ENST00000229758.3	37	CCDS5242.1																																																																																			.		0.402	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		6	6	NM_002047	0	0	0	4	4	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
OR2AE1	81392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99473846	99473846	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr7:99473846T>C	ENST00000316368.2	-	1	834	c.811A>G	c.(811-813)Aaa>Gaa	p.K271E		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAACCAACTTTGTTCTGCAAT	0.473																																					p.K271E		.											.	OR2AE1-90	0			c.A811G						.						97.0	101.0	100.0					7																	99473846		2203	4300	6503	SO:0001583	missense	81392	exon1			CAACTTTGTTCTG	AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.811A>G	7.37:g.99473846T>C	ENSP00000313936:p.Lys271Glu	93	0		69	8	NM_001005276	0	0	0	0	0	B2RPD2	Missense_Mutation	SNP	ENST00000316368.2	37	CCDS34696.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.311822	0.23821	.	.	ENSG00000244623	ENST00000316368	T	0.00183	8.6	3.84	2.66	0.31614	GPCR, rhodopsin-like superfamily (1);	0.178984	0.26836	N	0.022259	T	0.00496	0.0016	M	0.81497	2.545	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.37009	-0.9724	10	0.72032	D	0.01	.	8.8911	0.35434	0.0:0.0:0.1892:0.8108	.	271	Q8NHA4	O2AE1_HUMAN	E	271	ENSP00000313936:K271E	ENSP00000313936:K271E	K	-	1	0	OR2AE1	99311782	0.700000	0.27796	0.015000	0.15790	0.058000	0.15608	1.589000	0.36644	0.796000	0.33947	0.405000	0.27470	AAA	.		0.473	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1		
ZC3HC1	51530	ucsc.edu;bcgsc.ca	37	7	129664312	129664312	+	Missense_Mutation	SNP	T	T	C	rs1464890	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr7:129664312T>C	ENST00000358303.4	-	7	895	c.811A>G	c.(811-813)Aca>Gca	p.T271A	RNA5SP245_ENST00000364239.1_RNA|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.T271A|ZC3HC1_ENST00000311873.5_Missense_Mutation_p.T250A|ZC3HC1_ENST00000481503.1_Intron|RP11-306G20.1_ENST00000587038.1_RNA|RP11-306G20.1_ENST00000480018.1_RNA	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	271			T -> A (in dbSNP:rs1464890). {ECO:0000269|PubMed:15489334}.		mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					TGCGAACATGTTATCAGGGAG	0.468													T|||	2384	0.476038	0.1044	0.5648	5008	,	,		20638	0.6696		0.6054	False		,,,				2504	0.5828				p.T271A	Melanoma(115;540 1606 16325 28853 48167)	.											.	ZC3HC1-90	0			c.A811G						.	T	ALA/THR	761,3645	309.1+/-290.9	70,621,1512	70.0	64.0	66.0		811	-0.2	0.6	7	dbSNP_88	66	4803,3797	613.4+/-396.1	1359,2085,856	yes	missense	ZC3HC1	NM_016478.3	58	1429,2706,2368	CC,CT,TT		44.1512,17.2719,42.7803	benign	271/503	129664312	5564,7442	2203	4300	6503	SO:0001583	missense	51530	exon7			AACATGTTATCAG	AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.811A>G	7.37:g.129664312T>C	ENSP00000351052:p.Thr271Ala	55	0		54	5	NM_016478	0	0	20	20	0	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	ENST00000358303.4	37	CCDS34753.1	1095	0.5013736263736264	57	0.11585365853658537	183	0.505524861878453	400	0.6993006993006993	455	0.600263852242744	T	7.909	0.735976	0.15574	0.172719	0.558488	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000311873	T;T;T	0.41065	1.01;1.01;1.01	5.48	-0.152	0.13407	Nuclear-interacting partner of ALK/Rsm1-like (1);	0.116818	0.56097	D	0.000024	T	0.00012	0.0000	L	0.28740	0.885	0.58432	P	1.0000000000287557E-6	B;B	0.13145	0.007;0.004	B;B	0.15870	0.013;0.014	T	0.42396	-0.9454	9	0.10636	T	0.68	-7.2062	2.4402	0.04492	0.1226:0.1454:0.1269:0.6051	rs1464890;rs17655281;rs17850755;rs52836288;rs56503566;rs56696306;rs1464890	271;271	Q86WB0-3;Q86WB0	.;NIPA_HUMAN	A	271;271;250	ENSP00000351052:T271A;ENSP00000353933:T271A;ENSP00000309301:T250A	ENSP00000309301:T250A	T	-	1	0	ZC3HC1	129451548	0.114000	0.22134	0.577000	0.28562	0.193000	0.23685	-0.271000	0.08572	0.344000	0.23847	0.460000	0.39030	ACA	A|0.003;C|0.460		0.468	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349316.1	NM_016478	
TAS2R38	5726	bcgsc.ca	37	7	141672705	141672705	+	Missense_Mutation	SNP	G	G	A	rs1726866	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr7:141672705G>A	ENST00000547270.1	-	1	868	c.785C>T	c.(784-786)gCt>gTt	p.A262V		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	262			A -> V (in dbSNP:rs1726866). {ECO:0000269|PubMed:12379855, ECO:0000269|PubMed:12690205, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15496549, ECO:0000269|Ref.6}.		detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.A262V(1)		NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GATGAAGGCAGCACAGGATGA	0.512													G|||	2131	0.425519	0.3328	0.2853	5008	,	,		20513	0.3244		0.5388	False		,,,				2504	0.638				p.A262V		.											.	TAS2R38-92	1	Substitution - Missense(1)	stomach(1)	c.C785T	GRCh37	CM031369	TAS2R38	M	rs1726866	.	G	VAL/ALA	1504,2902	479.7+/-358.6	257,990,956	65.0	64.0	64.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	785	2.9	0.0	7	dbSNP_89	64	4683,3917	603.1+/-394.6	1267,2149,884	yes	missense	TAS2R38	NM_176817.4	64	1524,3139,1840	AA,AG,GG		45.5465,34.1353,47.5704	benign	262/334	141672705	6187,6819	2203	4300	6503	SO:0001583	missense	5726	exon1			AAGGCAGCACAGG	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.785C>T	7.37:g.141672705G>A	ENSP00000448219:p.Ala262Val	170	0		207	6	NM_176817	0	0	0	0	0	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	37	CCDS34765.1	892	0.4084249084249084	151	0.30691056910569103	123	0.3397790055248619	203	0.3548951048951049	415	0.5474934036939314	G	8.762	0.923749	0.18056	0.341353	0.544535	ENSG00000257138	ENST00000547270	T	0.37058	1.22	4.77	2.94	0.34122	.	0.359425	0.24122	N	0.041347	T	0.00012	0.0000	L	0.55990	1.75	0.80722	P	0.0	B	0.24092	0.097	B	0.30572	0.117	T	0.42103	-0.9471	9	0.56958	D	0.05	.	6.5818	0.22598	0.0973:0.182:0.7207:0.0	rs1726866;rs17712758;rs61111288;rs1726866	262	P59533	T2R38_HUMAN	V	262	ENSP00000448219:A262V	ENSP00000331291:A262V	A	-	2	0	TAS2R38	141319174	0.001000	0.12720	0.001000	0.08648	0.182000	0.23217	0.902000	0.28459	0.712000	0.32039	0.655000	0.94253	GCT	G|0.560;A|0.440		0.512	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3216707	3216707	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr8:3216707G>A	ENST00000520002.1	-	22	3829	c.3274C>T	c.(3274-3276)Cgt>Tgt	p.R1092C	CSMD1_ENST00000537824.1_Missense_Mutation_p.R1091C|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1092C|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1092C|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1091C|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1091C|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1092C			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1092	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTCCACACACGGCGGCCCCCA	0.557																																					p.R1091C		.											.	CSMD1-86	0			c.C3271T						.						70.0	74.0	73.0					8																	3216707		2203	4300	6503	SO:0001583	missense	64478	exon21			ACACACGGCGGCC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3274C>T	8.37:g.3216707G>A	ENSP00000430733:p.Arg1092Cys	68	0		134	23	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.9|20.9	4.074273|4.074273	0.76415|0.76415	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.64991	.|-0.13;-0.13;-0.13;-0.13;-0.13	5.34|5.34	5.34|5.34	0.76211|0.76211	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.83096|0.83096	0.5180|0.5180	M|M	0.92268|0.92268	3.29|3.29	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	D|D	0.86677|0.86677	0.1914|0.1914	5|10	.|0.66056	.|D	.|0.02	.|.	13.9698|13.9698	0.64233|0.64233	0.0:0.0:0.8484:0.1516|0.0:0.0:0.8484:0.1516	.|.	.|1092;1092;1092	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	L|C	571|1092;1092;954;1091;1091;1091	.|ENSP00000383047:R1092C;ENSP00000430733:R1092C;ENSP00000441462:R1091C;ENSP00000446243:R1091C;ENSP00000441675:R1091C	.|ENSP00000320445:R954C	P|R	-|-	2|1	0|0	CSMD1|CSMD1	3204114|3204114	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.283000|4.283000	0.58977|0.58977	2.489000|2.489000	0.83994|0.83994	0.550000|0.550000	0.68814|0.68814	CCG|CGT	.		0.557	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
EGR3	1960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22548147	22548147	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr8:22548147A>T	ENST00000317216.2	-	2	1360	c.1003T>A	c.(1003-1005)Tgc>Agc	p.C335S	EGR3_ENST00000524088.1_5'UTR|EGR3_ENST00000522910.1_Missense_Mutation_p.C297S|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000519492.1_3'UTR	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	335					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		CAGAACTCGCAGGCAAAGGGC	0.632																																					p.C335S		.											.	EGR3-90	0			c.T1003A						.						68.0	64.0	65.0					8																	22548147		2203	4300	6503	SO:0001583	missense	1960	exon2			ACTCGCAGGCAAA	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.1003T>A	8.37:g.22548147A>T	ENSP00000318057:p.Cys335Ser	90	0		313	123	NM_004430	0	0	0	0	0	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Missense_Mutation	SNP	ENST00000317216.2	37	CCDS6033.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.079252	0.76528	.	.	ENSG00000179388	ENST00000317216;ENST00000522910;ENST00000435199	D;D	0.85171	-1.95;-1.95	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92925	0.7749	M	0.87682	2.9	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.87578	0.998;0.998	D	0.93975	0.7253	10	0.87932	D	0	-19.4663	13.7759	0.63053	1.0:0.0:0.0:0.0	.	297;335	E7EW38;Q06889	.;EGR3_HUMAN	S	335;297;176	ENSP00000318057:C335S;ENSP00000430310:C297S	ENSP00000318057:C335S	C	-	1	0	EGR3	22604092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.334000	0.96470	2.135000	0.66039	0.533000	0.62120	TGC	.		0.632	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	NM_004430	
PLEC	5339	hgsc.bcm.edu	37	8	144998514	144998514	+	Silent	SNP	C	C	T	rs75586449	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr8:144998514C>T	ENST00000322810.4	-	31	6163	c.5994G>A	c.(5992-5994)gcG>gcA	p.A1998A	PLEC_ENST00000357649.2_Silent_p.A1865A|PLEC_ENST00000356346.3_Silent_p.A1847A|PLEC_ENST00000398774.2_Silent_p.A1829A|PLEC_ENST00000527096.1_Silent_p.A1884A|PLEC_ENST00000345136.3_Silent_p.A1861A|PLEC_ENST00000354958.2_Silent_p.A1839A|PLEC_ENST00000354589.3_Silent_p.A1861A|PLEC_ENST00000436759.2_Silent_p.A1888A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1998	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCGTTCTCCGCCTCCTTCT	0.726													T|||	349	0.0696885	0.0113	0.1412	5008	,	,		11250	0.0437		0.0358	False		,,,				2504	0.1595				p.A1998A		.											.	PLEC-141	0			c.G5994A						.	T	,,,,,,,	38,3548		0,38,1755	7.0	9.0	8.0		5664,5541,5517,5994,5487,5583,5595,5583	-5.2	0.8	8	dbSNP_131	8	272,7344		2,268,3538	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	2,306,5293	TT,TC,CC		3.5714,1.0597,2.7674	,,,,,,,	1888/4575,1847/4534,1839/4526,1998/4685,1829/4516,1861/4548,1865/4552,1861/4548	144998514	310,10892	1793	3808	5601	SO:0001819	synonymous_variant	5339	exon31			GTTCTCCGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5994G>A	8.37:g.144998514C>T		0	0		5	5	NM_201380	0	0	1	7	6	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.961;T|0.039		0.726	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998793	144998793	+	Silent	SNP	C	C	T	rs186670912	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr8:144998793C>T	ENST00000322810.4	-	31	5884	c.5715G>A	c.(5713-5715)ctG>ctA	p.L1905L	PLEC_ENST00000357649.2_Silent_p.L1772L|PLEC_ENST00000356346.3_Silent_p.L1754L|PLEC_ENST00000398774.2_Silent_p.L1736L|PLEC_ENST00000527096.1_Silent_p.L1791L|PLEC_ENST00000345136.3_Silent_p.L1768L|PLEC_ENST00000354958.2_Silent_p.L1746L|PLEC_ENST00000354589.3_Silent_p.L1768L|PLEC_ENST00000436759.2_Silent_p.L1795L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1905	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTTGCTGGCCAGCAGCACCT	0.711													C|||	14	0.00279553	0.0008	0.0101	5008	,	,		10968	0.0		0.005	False		,,,				2504	0.001				p.L1905L		.											.	PLEC-141	0			c.G5715A						.	C	,,,,,,,	6,3630		0,6,1812	3.0	3.0	3.0		5385,5262,5238,5715,5208,5304,5316,5304	4.0	1.0	8		3	21,7529		0,21,3754	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,27,5566	TT,TC,CC		0.2781,0.165,0.2414	,,,,,,,	1795/4575,1754/4534,1746/4526,1905/4685,1736/4516,1768/4548,1772/4552,1768/4548	144998793	27,11159	1818	3775	5593	SO:0001819	synonymous_variant	5339	exon31			GCTGGCCAGCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5715G>A	8.37:g.144998793C>T		2	0		10	6	NM_201380	0	0	3	9	6	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.997;T|0.003		0.711	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
KIAA1045	23349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34976195	34976195	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr9:34976195C>T	ENST00000242315.3	+	4	693	c.611C>T	c.(610-612)aCg>aTg	p.T204M	KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Missense_Mutation_p.T204M	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	204							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			TATAGCCTCACGGAGACCTTT	0.507																																					p.T204M		.											.	KIAA1045-69	0			c.C611T						.						100.0	101.0	101.0					9																	34976195		1916	4126	6042	SO:0001583	missense	23349	exon4			GCCTCACGGAGAC	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.611C>T	9.37:g.34976195C>T	ENSP00000242315:p.Thr204Met	71	0		79	22	NM_015297	0	0	0	0	0	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	C	2.375	-0.343410	0.05243	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	T;T	0.21932	1.98;1.98	5.2	1.78	0.24846	Zinc finger, FYVE/PHD-type (1);EF-hand-like domain (1);	0.233455	0.41396	N	0.000900	T	0.05777	0.0151	N	0.02247	-0.625	0.28377	N	0.919716	B	0.06786	0.001	B	0.04013	0.001	T	0.39375	-0.9617	10	0.06494	T	0.89	.	5.863	0.18759	0.0:0.3738:0.0:0.6262	.	204	Q9UPV7	K1045_HUMAN	M	204	ENSP00000444138:T204M;ENSP00000242315:T204M	ENSP00000242315:T204M	T	+	2	0	KIAA1045	34966195	1.000000	0.71417	0.437000	0.26809	0.955000	0.61496	2.109000	0.41863	0.195000	0.20347	-0.150000	0.13652	ACG	.		0.507	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
FRMPD1	22844	ucsc.edu;bcgsc.ca	37	9	37745413	37745413	+	Silent	SNP	G	G	A	rs3747541	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr9:37745413G>A	ENST00000539465.1	+	16	3977	c.3384G>A	c.(3382-3384)gaG>gaA	p.E1128E	FRMPD1_ENST00000377765.3_Silent_p.E1128E|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1128						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TTCAGGAGGAGTCTAGGAAGG	0.428													A|||	1935	0.386382	0.5847	0.4193	5008	,	,		20725	0.2024		0.332	False		,,,				2504	0.3405				p.E1128E		.											.	FRMPD1-159	0			c.G3384A						.	A		2298,2108	576.3+/-384.2	614,1070,519	69.0	72.0	71.0		3384	-1.8	0.0	9	dbSNP_107	71	3005,5595	664.5+/-402.2	526,1953,1821	no	coding-synonymous	FRMPD1	NM_014907.2		1140,3023,2340	AA,AG,GG		34.9419,47.8438,40.7735		1128/1579	37745413	5303,7703	2203	4300	6503	SO:0001819	synonymous_variant	22844	exon16			GGAGGAGTCTAGG	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3384G>A	9.37:g.37745413G>A		73	0		65	6	NM_014907	0	0	0	0	0	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	CCDS6612.1																																																																																			G|0.618;A|0.382		0.428	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
SLC34A3	142680	hgsc.bcm.edu	37	9	140130532	140130532	+	Silent	SNP	T	T	C	rs144666114	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr9:140130532T>C	ENST00000538474.1	+	13	1688	c.1464T>C	c.(1462-1464)gcT>gcC	p.A488A	SLC34A3_ENST00000361134.2_Silent_p.A488A	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	488					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCTGGGTGGCTGGGGTCTACC	0.716											OREG0019630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A488A		.											.	SLC34A3-90	0			c.T1464C						.	T	,,	2,4382		0,2,2190	43.0	35.0	37.0		1464,1464,1464	-2.5	0.0	9	dbSNP_134	37	8,8566		0,8,4279	no	coding-synonymous,coding-synonymous,coding-synonymous	SLC34A3	NM_001177316.1,NM_001177317.1,NM_080877.2	,,	0,10,6469	CC,CT,TT		0.0933,0.0456,0.0772	,,	488/600,488/600,488/600	140130532	10,12948	2192	4287	6479	SO:0001819	synonymous_variant	142680	exon13			GGTGGCTGGGGTC	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.1464T>C	9.37:g.140130532T>C		5	0	1654	72	4	NM_001177317	0	0	0	0	0	A2BFA1	Silent	SNP	ENST00000538474.1	37	CCDS7038.1																																																																																			T|1.000;C|0.000		0.716	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1	NM_080877	
ASMTL	8623	broad.mit.edu;bcgsc.ca	37	X	1538001	1538001	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:1538001A>G	ENST00000381317.3	-	10	1284	c.1252T>C	c.(1252-1254)Tac>Cac	p.Y418H	ASMTL_ENST00000416733.2_Missense_Mutation_p.Y342H|ASMTL_ENST00000381333.4_Missense_Mutation_p.Y402H|ASMTL_ENST00000534940.1_Missense_Mutation_p.Y360H	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	418	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTCTGGTAGTACGCATCCTGG	0.667																																					p.Y418H		.											.	ASMTL-62	0			c.T1252C						.						33.0	43.0	39.0					X																	1538001		2090	4208	6298	SO:0001583	missense	8623	exon10			GGTAGTACGCATC	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1252T>C	X.37:g.1538001A>G	ENSP00000370718:p.Tyr418His	75	0		207	10	NM_004192	0	0	1	1	0	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	37	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	a	0.703	-0.790208	0.02884	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	1.88	0.646	0.17789	O-methyltransferase, family 2 (1);	1.368550	0.05157	U	0.497015	T	0.12135	0.0295	N	0.05510	-0.035	0.09310	N	1	B;B;B	0.23128	0.08;0.016;0.02	B;B;B	0.20384	0.029;0.006;0.006	T	0.29701	-1.0003	10	0.18276	T	0.48	.	4.9277	0.13901	0.7034:0.0:0.2966:0.0	.	342;402;418	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	H	342;360;402;418	ENSP00000410578:Y342H;ENSP00000446410:Y360H;ENSP00000370734:Y402H;ENSP00000370718:Y418H	ENSP00000370718:Y418H	Y	-	1	0	ASMTL	1498001	0.000000	0.05858	0.002000	0.10522	0.161000	0.22273	0.179000	0.16840	0.441000	0.26529	0.084000	0.15446	TAC	.		0.667	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
PDK3	5165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24517001	24517001	+	Missense_Mutation	SNP	C	C	T	rs375475050		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:24517001C>T	ENST00000379162.4	+	3	539	c.304C>T	c.(304-306)Cca>Tca	p.P102S	PDK3_ENST00000441463.2_Missense_Mutation_p.P102S|PDK3_ENST00000493226.1_3'UTR	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	102					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CCCTGAGGATCCACAGGTCTT	0.303																																					p.P102S		.											.	PDK3-377	0			c.C304T						.	C	SER/PRO,SER/PRO	2,3833		0,2,1630,571	41.0	44.0	43.0		304,304	6.2	0.9	X		43	0,6728		0,0,2428,1872	no	missense,missense	PDK3	NM_001142386.2,NM_005391.4	74,74	0,2,4058,2443	TT,TC,CC,C		0.0,0.0522,0.0189	benign,benign	102/416,102/407	24517001	2,10561	2203	4300	6503	SO:0001583	missense	5165	exon3			GAGGATCCACAGG	L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.304C>T	X.37:g.24517001C>T	ENSP00000368460:p.Pro102Ser	100	0		133	46	NM_005391	0	0	0	0	0	B4DXG6	Missense_Mutation	SNP	ENST00000379162.4	37	CCDS14212.1	.	.	.	.	.	.	.	.	.	.	C	6.900	0.535617	0.13188	5.22E-4	0.0	ENSG00000067992	ENST00000379162;ENST00000441463	T;T	0.40225	1.04;1.59	6.17	6.17	0.99709	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.487974	0.24841	N	0.035161	T	0.27594	0.0678	N	0.25245	0.725	0.46149	D	0.998896	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.11743	-1.0575	10	0.08837	T	0.75	.	13.0269	0.58821	0.0:0.9254:0.0:0.0746	.	102;102	B4DXG6;Q15120	.;PDK3_HUMAN	S	102	ENSP00000368460:P102S;ENSP00000387536:P102S	ENSP00000368460:P102S	P	+	1	0	PDK3	24426922	0.422000	0.25473	0.933000	0.37362	0.997000	0.91878	1.958000	0.40402	2.618000	0.88619	0.600000	0.82982	CCA	.		0.303	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391	
PCSK1N	27344	hgsc.bcm.edu	37	X	48690749	48690749	+	Silent	SNP	C	C	T	rs11538178		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:48690749C>T	ENST00000218230.5	-	2	217	c.117G>A	c.(115-117)gaG>gaA	p.E39E	PCSK1N_ENST00000478242.1_5'UTR	NM_013271.2	NP_037403.1	Q9UHG2	PCSK1_HUMAN	proprotein convertase subtilisin/kexin type 1 inhibitor	39	ProSAAS(1-180). {ECO:0000250}.				neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)	endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)										GGCCGCGGGGCTCCTGCGGGA	0.682													c|||	1198	0.317351	0.5234	0.0807	3775	,	,		6872	0.1151		0.0666	False		,,,				2504	0.273				p.E39E		.											.	PCSK1N-130	0			c.G117A						.			1039,1413		118,601,202,343,126	2.0	2.0	2.0		117	0.3	0.9	X	dbSNP_120	2	346,4094		11,224,100,1486,898	yes	coding-synonymous	PCSK1N	NM_013271.2		129,825,302,1829,1024	TT,TC,T,CC,C		7.7928,42.3736,20.0958		39/261	48690749	1385,5507	1390	2719	4109	SO:0001819	synonymous_variant	27344	exon2			GCGGGGCTCCTGC	AF181562	CCDS14307.1	Xp11.23	2008-07-28			ENSG00000102109	ENSG00000102109			17301	protein-coding gene	gene with protein product		300399				10632593	Standard	NM_013271		Approved	SAAS	uc004dkz.4	Q9UHG2	OTTHUMG00000034502	ENST00000218230.5:c.117G>A	X.37:g.48690749C>T		0	0		11	11	NM_013271	0	0	0	0	0	Q4VC04	Silent	SNP	ENST00000218230.5	37	CCDS14307.1																																																																																			C|0.762;T|0.238		0.682	PCSK1N-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083444.1	NM_013271	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Start_Codon_Del	DEL	TCCTCGAGGCAGCC	TCCTCGAGGCAGCC	-	rs78182391		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	ENST00000375992.3	-	0	139_152					NM_018159.3	NP_060629.2	Q96G61	NUD11_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 11						inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)	p.?(5)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	9	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.692										HNSCC(48;0.14)				2406	0.637351	0.497	0.4928	3775	,	,		5662	0.4464		0.4553	False		,,,				2504	0.5102					GBM(38;198 791 1498 11752 13599)	.											.	NUDT11-130	5	Unknown(5)	upper_aerodigestive_tract(2)|prostate(1)|breast(1)|central_nervous_system(1)							.			1710,202		758,11,183,87,17						3.0	1.0		dbSNP_131	12	3133,173		1220,1,692,66,40	no	frameshift	NUDT11	NM_018159.3		1978,12,875,153,57	A1A1,A1R,A1,RR,R		5.2329,10.5649,7.1867				4843,375				SO:0001582	initiator_codon_variant	55190	wholegene			ACTTCATCCTCGA	AK001490	CCDS43952.1	Xp11.22-p11.1	2014-05-20			ENSG00000196368	ENSG00000196368		"""Nudix motif containing"""	18011	protein-coding gene	gene with protein product						12105228	Standard	NM_018159		Approved	DIPP3b, FLJ10628, hDIPP3beta	uc010njt.3	Q96G61	OTTHUMG00000021531		X.37:g.51239296_51239309delTCCTCGAGGCAGCC		16	0		149	49	NM_018159	0	0	0	0	0	Q9NVN0	Frame_Shift_Del	DEL	ENST00000375992.3	37	CCDS43952.1																																																																																			.		0.692	NUDT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056579.1		
KIAA1210	57481	broad.mit.edu	37	X	118219366	118219366	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:118219366T>C	ENST00000402510.2	-	12	4827	c.4828A>G	c.(4828-4830)Act>Gct	p.T1610A		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1610										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GGCTCCTTAGTCTCAGCATCG	0.443																																					p.T1610A		.											.	KIAA1210-67	0			c.A4828G						.						165.0	151.0	155.0					X																	118219366		1894	4111	6005	SO:0001583	missense	57481	exon12			CCTTAGTCTCAGC	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4828A>G	X.37:g.118219366T>C	ENSP00000384670:p.Thr1610Ala	60	0		97	4	NM_020721	0	0	0	0	0	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.158|4.158	0.027864|0.027864	0.08054|0.08054	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.10099	.|2.91	5.26|5.26	0.0547|0.0547	0.14311|0.14311	.|.	.|.	.|.	.|.	.|.	T|T	0.06781|0.06781	0.0173|0.0173	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|B	.|0.20261	.|0.043	.|B	.|0.23419	.|0.046	T|T	0.47355|0.47355	-0.9124|-0.9124	5|9	.|0.08179	.|T	.|0.78	.|.	5.8263|5.8263	0.18556|0.18556	0.0:0.2493:0.1339:0.6168|0.0:0.2493:0.1339:0.6168	.|.	.|1610	.|Q9ULL0	.|K1210_HUMAN	G|A	1016|1610	.|ENSP00000384670:T1610A	.|ENSP00000384670:T1610A	D|T	-|-	2|1	0|0	KIAA1210|RP13-347D8.6	118103394|118103394	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.066000|0.066000	0.16364|0.16364	-0.058000|-0.058000	0.11750|0.11750	-0.493000|-0.493000	0.06678|0.06678	-1.384000|-1.384000	0.01168|0.01168	GAC|ACT	.		0.443	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
HLA-B	3106	broad.mit.edu	37	6	31324601	31324602	+	Frame_Shift_Ins	INS	-	-	G	rs41562914|rs41541416|rs9281379	byFrequency	TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr6:31324601_31324602insG	ENST00000412585.2	-	2	234_235	c.206_207insC	c.(205-207)gagfs	p.E69fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	69	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*30(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCCGCGGCTCCTCTCTCGGACT	0.673									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.E69fs		.											.	HLA-B-90	2	Insertion - Frameshift(2)	large_intestine(2)	c.207_208insC						.			1399,160,2559		395,63,546,25,47,983						0.1	0.1		dbSNP_130	35	1793,477,5714		469,110,745,86,195,2387	no	codingComplex	HLA-B	NM_005514.6		864,173,1291,111,242,3370	A1A1,A1A2,A1R,A2A2,A2R,RR		28.4319,37.8582,31.6394				3192,637,8273				SO:0001589	frameshift_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	CGGCTCCTCTCTC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.206_207insC	6.37:g.31324601_31324602insG	ENSP00000399168:p.Glu69fs	48	0		177	9	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Ins	INS	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.673	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
LURAP1L	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	-	GGCGGCGGC	rs3833707|rs139315731		TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chr9:12775861_12775862insGGCGGCGGC	ENST00000319264.3	+	1	842_843	c.147_148insGGCGGCGGC	c.(148-150)ggc>GGCGGCGGCggc	p.50_50G>GGGG	LURAP1L_ENST00000489107.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	53	Gly-rich.							p.G49_G50insGGG(2)|p.G50_G52delGGG(1)									gcggtggtggtggcggcggcgg	0.688																																					p.G49delinsGGGG		.											.	.	3	Insertion - In frame(2)|Deletion - In frame(1)	large_intestine(1)|prostate(1)|central_nervous_system(1)	c.147_148insGGCGGCGGC						.																																			SO:0001652	inframe_insertion	286343	exon1			TGGTGGTGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.157_165dupGGCGGCGGC	9.37:g.12775862_12775870dupGGCGGCGGC	ENSP00000321026:p.GlyGlyGly53dup	6	0		16	9	NM_203403	0	0	0	0	0	Q5VZX7|Q8N923|Q8NCG2	In_Frame_Ins	INS	ENST00000319264.3	37	CCDS6473.1																																																																																			.		0.688	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
FATE1	89885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150884636	150884637	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-OR-A5JC-01A-11D-A29I-10	TCGA-OR-A5JC-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d71931f-ab18-41cb-89e6-1924e9c5df4d	bfb53fdb-f499-4cae-9016-3fcdcc401716	g.chrX:150884636_150884637CC>AA	ENST00000370350.3	+	1	130_131	c.45_46CC>AA	c.(43-48)tcCCtg>tcAAtg	p.L16M		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	16						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					TGGAAATGTCCCTGGCAGAAGA	0.54																																					p.L16M		.											.	FATE1-131	0			c.C46A						.																																			SO:0001583	missense	89885	exon1			ATGTCCCTGGCAG	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	Exception_encountered	X.37:g.150884636_150884637delinsAA	ENSP00000359375:p.Leu16Met	160	0		286	30	NM_033085	0	0	0	0	0		Missense_Mutation	DNP	ENST00000370350.3	37	CCDS14700.1																																																																																			.		0.540	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
