#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	bcgsc.ca	37	1	1268159	1268159	+	Silent	SNP	C	C	T	rs3813210	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:1268159C>T	ENST00000339381.5	+	3	1280	c.1248C>T	c.(1246-1248)ccC>ccT	p.P416P		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	416					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		CAGGCTGCCCCGCGCAGGACC	0.652													c|||	704	0.140575	0.3185	0.1052	5008	,	,		17974	0.0794		0.0487	False		,,,				2504	0.0828				p.P416P		.											.	TAS1R3-22	0			c.C1248T						.	C		1174,3222		153,868,1177	23.0	25.0	24.0		1248	-3.8	0.0	1	dbSNP_107	24	342,8252		12,318,3967	no	coding-synonymous	TAS1R3	NM_152228.1		165,1186,5144	TT,TC,CC		3.9795,26.7061,11.6705		416/853	1268159	1516,11474	2198	4297	6495	SO:0001819	synonymous_variant	83756	exon3			CTGCCCCGCGCAG	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1248C>T	1.37:g.1268159C>T		87	0		129	5	NM_152228	0	0	4	4	0	Q5TA49|Q8NGW9	Silent	SNP	ENST00000339381.5	37	CCDS30556.1																																																																																			C|0.874;T|0.126		0.652	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1		
EVI5	7813	hgsc.bcm.edu	37	1	93091457	93091457	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:93091457G>T	ENST00000370331.1	-	13	1523	c.1514C>A	c.(1513-1515)gCa>gAa	p.A505E	EVI5_ENST00000491940.1_5'UTR|EVI5_ENST00000543509.1_Missense_Mutation_p.A516E|EVI5_ENST00000540033.1_Missense_Mutation_p.A505E	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	505	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CTGAAGCCTTGCAATATTATT	0.348																																					p.A505E		.											.	EVI5-136	0			c.C1514A						.						102.0	96.0	98.0					1																	93091457		2203	4300	6503	SO:0001583	missense	7813	exon13			AGCCTTGCAATAT	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1514C>A	1.37:g.93091457G>T	ENSP00000359356:p.Ala505Glu	109	0		99	5	NM_005665	0	0	0	0	0	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.873853	0.72180	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.36699	1.24;1.24;1.24	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.44993	0.1320	M	0.65498	2.005	0.46586	D	0.999118	D;D	0.69078	0.997;0.992	D;D	0.71184	0.972;0.939	T	0.24012	-1.0172	10	0.22706	T	0.39	-14.0722	13.1954	0.59736	0.0726:0.0:0.9274:0.0	.	516;505	F5H4R0;O60447	.;EVI5_HUMAN	E	505;505;516;204	ENSP00000359356:A505E;ENSP00000440826:A505E;ENSP00000445019:A516E	ENSP00000345500:A204E	A	-	2	0	EVI5	92864045	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	6.154000	0.71826	2.723000	0.93209	0.585000	0.79938	GCA	.		0.348	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
LCE1E	353135	broad.mit.edu	37	1	152760102	152760102	+	Silent	SNP	C	C	A	rs148574694		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:152760102C>A	ENST00000368770.3	+	2	380	c.327C>A	c.(325-327)ggC>ggA	p.G109G	LCE1E_ENST00000368771.1_Silent_p.G109G	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	109	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGAGGGGGCAGCGGCCAGC	0.612																																					p.G109G		.											.	LCE1E-90	0			c.C327A						.	C		1,4353		0,1,2176	40.0	58.0	52.0		327	-4.7	0.0	1	dbSNP_134	52	1,8573		0,1,4286	no	coding-synonymous	LCE1E	NM_178353.1		0,2,6462	AA,AC,CC		0.0117,0.023,0.0155		109/119	152760102	2,12926	2177	4287	6464	SO:0001819	synonymous_variant	353135	exon2			AGGGGGCAGCGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.327C>A	1.37:g.152760102C>A		224	1		185	4	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			C|1.000;A|0.000		0.612	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
SPRR3	6707	ucsc.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		155	0		153	23	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR3	6707	hgsc.bcm.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000331860.3_Silent_p.G81G|SPRR3_ENST00000542696.1_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		.											.	SPRR3-45	1	Substitution - coding silent(1)	prostate(1)	c.T243A						.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		185	0		160	12	NM_001097589	0	0	0	1	1	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
F5	2153	bcgsc.ca	37	1	169510380	169510380	+	Silent	SNP	G	G	A	rs9287090	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:169510380G>A	ENST00000367797.3	-	13	4149	c.3948C>T	c.(3946-3948)ctC>ctT	p.L1316L	F5_ENST00000367796.3_Silent_p.L1321L	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1316	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GCATCTGACCGAGGGCTGGGG	0.498													G|||	1320	0.263578	0.1717	0.3948	5008	,	,		22137	0.248		0.2535	False		,,,				2504	0.3211				p.L1316L		.											.	F5-157	0			c.C3948T						.	G		821,3585	323.2+/-298.0	72,677,1454	249.0	273.0	265.0		3948	-4.7	0.0	1	dbSNP_119	265	2356,6244	393.5+/-344.4	300,1756,2244	no	coding-synonymous	F5	NM_000130.4		372,2433,3698	AA,AG,GG		27.3953,18.6337,24.4272		1316/2225	169510380	3177,9829	2203	4300	6503	SO:0001819	synonymous_variant	2153	exon13			CTGACCGAGGGCT	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3948C>T	1.37:g.169510380G>A		346	2		266	8	NM_000130	0	0	0	0	0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	ENST00000367797.3	37	CCDS1281.1																																																																																			G|0.758;A|0.242		0.498	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
LAMC2	3918	broad.mit.edu	37	1	183206566	183206566	+	Missense_Mutation	SNP	G	G	A	rs146907099		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:183206566G>A	ENST00000264144.4	+	18	2746	c.2681G>A	c.(2680-2682)cGt>cAt	p.R894H	LAMC2_ENST00000493293.1_Missense_Mutation_p.R894H	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	894	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						GAGTTCAAGCGTACACAGAAG	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		20945	0.0		0.0	False		,,,				2504	0.001				p.R894H		.											.	LAMC2-93	0			c.G2681A						.	G	HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	102.0	105.0	104.0		2681,2681	-3.1	0.0	1	dbSNP_134	104	11,8589	8.4+/-32.0	0,11,4289	yes	missense,missense	LAMC2	NM_005562.2,NM_018891.2	29,29	0,13,6490	AA,AG,GG		0.1279,0.0454,0.1	benign,benign	894/1194,894/1112	183206566	13,12993	2203	4300	6503	SO:0001583	missense	3918	exon18			TCAAGCGTACACA	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.2681G>A	1.37:g.183206566G>A	ENSP00000264144:p.Arg894His	426	1		324	6	NM_005562	0	0	4	4	0	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	G	4.632	0.117464	0.08881	4.54E-4	0.001279	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.17528	2.42;2.27	5.49	-3.1	0.05315	.	0.951330	0.08877	N	0.880564	T	0.08447	0.0210	N	0.12961	0.28	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.003	B;B;B	0.06405	0.001;0.001;0.002	T	0.36529	-0.9744	10	0.33940	T	0.23	.	6.7147	0.23296	0.6057:0.0:0.2602:0.1341	.	894;894;894	Q2M1N2;Q13753;Q13753-2	.;LAMC2_HUMAN;.	H	894	ENSP00000432063:R894H;ENSP00000264144:R894H	ENSP00000264144:R894H	R	+	2	0	LAMC2	181473189	0.001000	0.12720	0.003000	0.11579	0.017000	0.09413	-0.333000	0.07894	-0.545000	0.06224	-0.768000	0.03414	CGT	G|0.999;A|0.001		0.428	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	1	0		5	4	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OPTN	10133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13152419	13152419	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr10:13152419T>A	ENST00000378748.3	+	5	674	c.312T>A	c.(310-312)aaT>aaA	p.N104K	OPTN_ENST00000378757.2_Missense_Mutation_p.N104K|OPTN_ENST00000263036.5_Missense_Mutation_p.N104K|OPTN_ENST00000482140.1_Intron|OPTN_ENST00000378764.2_Missense_Mutation_p.N104K|OPTN_ENST00000378752.3_Missense_Mutation_p.N104K|OPTN_ENST00000378747.3_Missense_Mutation_p.N104K	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	104	Interaction with Rab8.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GTCATGAGAATGAGAAATTGA	0.418																																					p.N104K		.											.	OPTN-70	0			c.T312A						.						100.0	115.0	110.0					10																	13152419		2203	4300	6503	SO:0001583	missense	10133	exon4			TGAGAATGAGAAA	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.312T>A	10.37:g.13152419T>A	ENSP00000368022:p.Asn104Lys	287	0		256	25	NM_001008212	0	0	24	26	2	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.774847	0.70107	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000430081;ENST00000378747	D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.98	3.55	0.40652	NF-kappa-B essential modulator NEMO, N-terminal (1);	0.039058	0.85682	D	0.000000	T	0.79941	0.4533	L	0.41961	1.31	0.53005	D	0.999968	P;P	0.44877	0.814;0.845	P;P	0.48654	0.449;0.585	T	0.74674	-0.3586	10	0.07644	T	0.81	-24.2383	7.6892	0.28559	0.0:0.0739:0.1406:0.7855	.	104;104	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	K	104;104;104;104;104;47;104	ENSP00000263036:N104K;ENSP00000368040:N104K;ENSP00000368032:N104K;ENSP00000368027:N104K;ENSP00000368022:N104K;ENSP00000414747:N47K;ENSP00000368021:N104K	ENSP00000263036:N104K	N	+	3	2	OPTN	13192425	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	0.574000	0.23714	1.098000	0.41479	0.533000	0.62120	AAT	.		0.418	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
FAM171A1	221061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15256461	15256461	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr10:15256461G>C	ENST00000378116.4	-	8	1132	c.1126C>G	c.(1126-1128)Ccg>Gcg	p.P376A	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	376						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						ACGGACAGCGGGCCAGGGAAT	0.602																																					p.P376A		.											.	FAM171A1-138	0			c.C1126G						.						47.0	52.0	51.0					10																	15256461		2203	4300	6503	SO:0001583	missense	221061	exon8			ACAGCGGGCCAGG	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1126C>G	10.37:g.15256461G>C	ENSP00000367356:p.Pro376Ala	70	0		87	12	NM_001010924	0	0	0	1	1	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	G	6.152	0.396215	0.11638	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.30448	1.53	4.96	2.96	0.34315	.	0.523549	0.17969	N	0.155929	T	0.20007	0.0481	N	0.22421	0.69	0.09310	N	1	B	0.20671	0.047	B	0.22152	0.038	T	0.17899	-1.0354	10	0.49607	T	0.09	-14.5167	8.2403	0.31656	0.0:0.158:0.6572:0.1848	.	376	Q5VUB5	F1711_HUMAN	A	376;377	ENSP00000367356:P376A	ENSP00000367356:P376A	P	-	1	0	FAM171A1	15296467	.	.	0.069000	0.20011	0.481000	0.33189	.	.	0.530000	0.28619	0.563000	0.77884	CCG	.		0.602	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
MUC2	4583	bcgsc.ca	37	11	1092947	1092947	+	Missense_Mutation	SNP	C	C	A	rs111219026		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:1092947C>A	ENST00000441003.2	+	30	4793	c.4766C>A	c.(4765-4767)aCc>aAc	p.T1589N	MUC2_ENST00000359061.5_Missense_Mutation_p.T1590N|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1589N(2)|p.T1590N(2)|p.T1590I(2)|p.T1589I(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.627																																					p.T1589N		.											.	MUC2-90	8	Substitution - Missense(8)	endometrium(8)	c.C4766A						.						58.0	93.0	81.0					11																	1092947		1850	3386	5236	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4766C>A	11.37:g.1092947C>A	ENSP00000415183:p.Thr1589Asn	209	4		187	10	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.043	0.376346	0.11466	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14516	2.5;2.84	1.75	1.75	0.24633	.	1.843980	0.03632	U	0.238018	T	0.07863	0.0197	.	.	.	0.09310	N	1	P	0.45986	0.87	B	0.31101	0.124	T	0.33189	-0.9878	9	0.27082	T	0.32	.	8.7142	0.34401	0.0:1.0:0.0:0.0	.	1589	E7EUV1	.	N	1589;1590	ENSP00000415183:T1589N;ENSP00000351956:T1590N	ENSP00000351956:T1590N	T	+	2	0	MUC2	1082947	0.034000	0.19679	0.006000	0.13384	0.170000	0.22686	1.835000	0.39181	1.016000	0.39470	0.121000	0.15741	ACC	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093004	1093004	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:1093004C>A	ENST00000441003.2	+	30	4850	c.4823C>A	c.(4822-4824)cCc>cAc	p.P1608H	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accacgacacccatcaccacc	0.632																																					p.P1608H		.											.	MUC2-90	0			c.C4823A						.						61.0	106.0	90.0					11																	1093004		1817	3370	5187	SO:0001583	missense	4583	exon30			CGACACCCATCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4823C>A	11.37:g.1093004C>A	ENSP00000415183:p.Pro1608His	154	0		148	6	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.416	-0.334306	0.05278	.	.	ENSG00000198788	ENST00000441003	T	0.15017	2.46	1.75	0.741	0.18336	.	.	.	.	.	T	0.11452	0.0279	.	.	.	0.09310	N	1	D	0.62365	0.991	B	0.40329	0.326	T	0.20940	-1.0260	8	0.40728	T	0.16	.	5.9581	0.19286	0.0:0.8214:0.0:0.1786	.	1608	E7EUV1	.	H	1608	ENSP00000415183:P1608H	ENSP00000415183:P1608H	P	+	2	0	MUC2	1083004	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.436000	0.21526	0.097000	0.17492	0.121000	0.15741	CCC	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC15	143662	bcgsc.ca	37	11	26587133	26587133	+	Silent	SNP	T	T	C	rs293980	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:26587133T>C	ENST00000455601.2	-	2	391	c.273A>G	c.(271-273)tcA>tcG	p.S91S	MUC15_ENST00000529533.1_Silent_p.S118S|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000527569.1_Silent_p.S118S|ANO3_ENST00000531568.1_Intron|ANO3_ENST00000256737.3_Intron|MUC15_ENST00000436318.2_Silent_p.S118S|MUC15_ENST00000281268.8_Silent_p.S118S	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	91					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						GCTCTGCTGATGAGTTACTGG	0.433													C|||	3344	0.667732	0.7073	0.7954	5008	,	,		19048	0.4772		0.7256	False		,,,				2504	0.6605				p.S118S		.											.	MUC15-92	0			c.A354G						.	C	,,,	3210,1196	418.3+/-338.2	1167,876,160	159.0	143.0	149.0		354,354,,273	-1.7	0.0	11	dbSNP_79	149	6367,2233	379.5+/-339.3	2333,1701,266	no	coding-synonymous,coding-synonymous,intron,coding-synonymous	ANO3,MUC15	NM_001135091.1,NM_001135092.1,NM_031418.2,NM_145650.3	,,,	3500,2577,426	CC,CT,TT		25.9651,27.1448,26.3648	,,,	118/362,118/312,,91/335	26587133	9577,3429	2203	4300	6503	SO:0001819	synonymous_variant	143662	exon3			TGCTGATGAGTTA	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.273A>G	11.37:g.26587133T>C		277	1		253	9	NM_001135092	0	0	0	0	0	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Silent	SNP	ENST00000455601.2	37	CCDS7859.1																																																																																			T|0.311;C|0.689		0.433	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
CKAP5	9793	broad.mit.edu	37	11	46829683	46829683	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:46829683delT	ENST00000529230.1	-	8	922	c.876delA	c.(874-876)aaafs	p.K292fs	CKAP5_ENST00000415402.1_Frame_Shift_Del_p.K292fs|CKAP5_ENST00000354558.3_Frame_Shift_Del_p.K292fs|CKAP5_ENST00000312055.5_Frame_Shift_Del_p.K292fs			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	292					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TCTCTTGCCATTTTTTTGCCT	0.363																																					p.K292fs	Ovarian(4;85 273 2202 4844 13323)	.											.	CKAP5-92	0			c.876delA						.						163.0	173.0	169.0					11																	46829683		2201	4299	6500	SO:0001589	frameshift_variant	9793	exon8			TTGCCATTTTTTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.876delA	11.37:g.46829683delT	ENSP00000432768:p.Lys292fs	17	0		6	2	NM_001008938	0	0	0	0	0	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Frame_Shift_Del	DEL	ENST00000529230.1	37	CCDS31477.1																																																																																			.		0.363	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		0	0		4	4	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
MAP6	4135	bcgsc.ca	37	11	75298797	75298797	+	Silent	SNP	A	A	G	rs1231128	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:75298797A>G	ENST00000304771.3	-	4	2499	c.1749T>C	c.(1747-1749)gaT>gaC	p.D583D	MAP6_ENST00000526689.1_5'Flank|CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526740.1_Silent_p.D254D	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	583	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					TGGGACCTTCATCCTTGACAG	0.522													A|||	1884	0.376198	0.3041	0.5648	5008	,	,		21623	0.2579		0.3161	False		,,,				2504	0.5235				p.D583D	Esophageal Squamous(181;1115 2007 8647 17065 22697)	.											.	MAP6-226	0			c.T1749C						.	A		1262,3138	432.2+/-343.2	192,878,1130	145.0	135.0	139.0		1749	-5.5	0.0	11	dbSNP_87	139	2625,5961	425.0+/-354.8	391,1843,2059	no	coding-synonymous	MAP6	NM_033063.1		583,2721,3189	GG,GA,AA		30.573,28.6818,29.9322		583/814	75298797	3887,9099	2200	4293	6493	SO:0001819	synonymous_variant	4135	exon4			ACCTTCATCCTTG	AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.1749T>C	11.37:g.75298797A>G		336	3		261	8	NM_033063	0	0	25	25	0	A7E2A1|Q6P3T0|Q6ZWB8	Silent	SNP	ENST00000304771.3	37	CCDS31641.1																																																																																			A|0.685;G|0.315		0.522	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383527.1	NM_033063	
EXPH5	23086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	108382838	108382838	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr11:108382838delG	ENST00000265843.4	-	6	3506	c.3396delC	c.(3394-3396)gccfs	p.A1132fs	EXPH5_ENST00000525344.1_Frame_Shift_Del_p.A1125fs|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Frame_Shift_Del_p.A944fs|EXPH5_ENST00000428840.1_Frame_Shift_Del_p.A1056fs	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1132					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCCAGTTGAGGCATGTGGCT	0.473																																					p.A1132fs		.											.	EXPH5-95	0			c.3396delC						.						113.0	117.0	116.0					11																	108382838		2201	4298	6499	SO:0001589	frameshift_variant	23086	exon6			AGTTGAGGCATGT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.3396delC	11.37:g.108382838delG	ENSP00000265843:p.Ala1132fs	98	0		75	22	NM_015065	0	0	0	0	0	Q2KHM1|Q9Y4D6	Frame_Shift_Del	DEL	ENST00000265843.4	37	CCDS8341.1																																																																																			.		0.473	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	84	1		176	5	NM_001256282	0	0	3	3	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000536002.1_Silent_p.P565P|RIMBP2_ENST00000535703.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		2	0		29	5	NM_015347	0	0	1	1	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
ERICH6B	220081	hgsc.bcm.edu	37	13	46170719	46170719	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs201041085|rs375947127	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:46170719C>T	ENST00000298738.2	-	3	586	c.422G>A	c.(421-423)gGg>gAg	p.G141E		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		141	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCCTTCCTTCCCCAGATActc	0.478																																					p.G141E		.											.	FAM194B-68	0			c.G422A						.						142.0	109.0	119.0					13																	46170719		692	1591	2283	SO:0001583	missense	220081	exon3			TCCTTCCCCAGAT																												ENST00000298738.2:c.422G>A	13.37:g.46170719C>T	ENSP00000298738:p.Gly141Glu	52	0		21	4	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	0.404	-0.916852	0.02415	.	.	ENSG00000165837	ENST00000298738	T	0.05649	3.41	2.26	-4.53	0.03462	.	.	.	.	.	T	0.02304	0.0071	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41963	-0.9479	9	0.87932	D	0	1.4605	2.1075	0.03695	0.1253:0.3281:0.1261:0.4206	.	141;141	A2VDI6;Q5W0A0	.;F194B_HUMAN	E	141	ENSP00000298738:G141E	ENSP00000298738:G141E	G	-	2	0	FAM194B	45068720	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.126000	0.03254	-3.171000	0.00225	-1.421000	0.01109	GGG	C|0.909;T|0.091		0.478	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	hgsc.bcm.edu	37	13	46170726	46170726	+	Missense_Mutation	SNP	A	A	G	rs28548352|rs142875900|rs375947127	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:46170726A>G	ENST00000298738.2	-	3	579	c.415T>C	c.(415-417)Tat>Cat	p.Y139H		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		139	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTCCCCAGATActcttcctcc	0.488																																					p.Y139H		.											.	FAM194B-68	0			c.T415C						.						134.0	79.0	95.0					13																	46170726		692	1566	2258	SO:0001583	missense	220081	exon3			CCAGATACTCTTC																												ENST00000298738.2:c.415T>C	13.37:g.46170726A>G	ENSP00000298738:p.Tyr139His	46	0		22	11	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089484	0.07053	.	.	ENSG00000165837	ENST00000298738	T	0.06294	3.32	2.4	-0.599	0.11645	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.27594	0.182;0.071	B;B	0.26310	0.068;0.009	T	0.43925	-0.9361	9	0.87932	D	0	0.4727	0.1132	0.00058	0.3431:0.2385:0.1823:0.236	rs28548352	139;139	A2VDI6;Q5W0A0	.;F194B_HUMAN	H	139	ENSP00000298738:Y139H	ENSP00000298738:Y139H	Y	-	1	0	FAM194B	45068727	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-6.553000	0.00061	0.160000	0.19432	0.358000	0.22013	TAT	.		0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	hgsc.bcm.edu	37	13	46170728	46170728	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs45625342|rs375947127	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:46170728T>C	ENST00000298738.2	-	3	577	c.413A>G	c.(412-414)gAg>gGg	p.E138G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		138	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCCCAGATActcttcctcctc	0.493																																					p.E138G		.											.	FAM194B-68	0			c.A413G						.						131.0	77.0	93.0					13																	46170728		692	1566	2258	SO:0001583	missense	220081	exon3			AGATACTCTTCCT																												ENST00000298738.2:c.413A>G	13.37:g.46170728T>C	ENSP00000298738:p.Glu138Gly	46	0		20	9	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	1.421	-0.572820	0.03882	.	.	ENSG00000165837	ENST00000298738	T	0.06768	3.26	1.57	-3.01	0.05463	.	.	.	.	.	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40608	-0.9554	9	0.87932	D	0	0.9224	6.4617	0.21960	0.0:0.5129:0.0:0.4871	rs45625342	138;138	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	138	ENSP00000298738:E138G	ENSP00000298738:E138G	E	-	2	0	FAM194B	45068729	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.940000	0.28992	-0.743000	0.04784	-1.309000	0.01313	GAG	.		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	hgsc.bcm.edu	37	13	46170735	46170735	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs28460344|rs375947127	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:46170735C>T	ENST00000298738.2	-	3	570	c.406G>A	c.(406-408)Gag>Aag	p.E136K		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TActcttcctcctccagatgc	0.483													C|||	1385	0.276558	0.1362	0.4308	5008	,	,		19628	0.1627		0.494	False		,,,				2504	0.2505				p.E136K		.											.	FAM194B-68	0			c.G406A						.						134.0	78.0	95.0					13																	46170735		692	1565	2257	SO:0001583	missense	220081	exon3			CTTCCTCCTCCAG																												ENST00000298738.2:c.406G>A	13.37:g.46170735C>T	ENSP00000298738:p.Glu136Lys	46	0		18	15	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869929	0.17322	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.1	0.141	0.14811	.	.	.	.	.	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.001	T	0.43015	-0.9417	9	0.87932	D	0	-1.9096	5.6342	0.17528	0.0:0.5396:0.0:0.4604	rs28460344	136;136	A2VDI6;Q5W0A0	.;F194B_HUMAN	K	136	ENSP00000298738:E136K	ENSP00000298738:E136K	E	-	1	0	FAM194B	45068736	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.079000	0.14782	-0.180000	0.10637	-1.380000	0.01176	GAG	.		0.483	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	hgsc.bcm.edu	37	13	46170737	46170737	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs375947127|rs117004691	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:46170737T>C	ENST00000298738.2	-	3	568	c.404A>G	c.(403-405)gAg>gGg	p.E135G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						ctcttcctcctccagatgctc	0.493													T|||	1383	0.276158	0.1362	0.4308	5008	,	,		19669	0.1607		0.494	False		,,,				2504	0.2505				p.E135G		.											.	FAM194B-68	0			c.A404G						.						133.0	77.0	94.0					13																	46170737		692	1565	2257	SO:0001583	missense	220081	exon3			TCCTCCTCCAGAT																												ENST00000298738.2:c.404A>G	13.37:g.46170737T>C	ENSP00000298738:p.Glu135Gly	46	0		19	16	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	8.448	0.852491	0.17106	.	.	ENSG00000165837	ENST00000298738	T	0.06608	3.28	2.24	-2.01	0.07410	.	.	.	.	.	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40534	-0.9558	9	0.87932	D	0	-2.345	6.5075	0.22204	0.0:0.4358:0.0:0.5642	.	135;135	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	135	ENSP00000298738:E135G	ENSP00000298738:E135G	E	-	2	0	FAM194B	45068738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.707000	0.05041	-0.286000	0.09076	-1.636000	0.00776	GAG	.		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
MYCBP2	23077	ucsc.edu;bcgsc.ca	37	13	77837809	77837809	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:77837809A>G	ENST00000544440.2	-	10	1450	c.1433T>C	c.(1432-1434)cTg>cCg	p.L478P	MYCBP2_ENST00000357337.6_Missense_Mutation_p.L478P|MYCBP2_ENST00000407578.2_Missense_Mutation_p.L516P|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTCCTTTTCCAGATCGAATAG	0.318																																					p.L516P		.											.	MYCBP2-236	0			c.T1547C						.						84.0	80.0	81.0					13																	77837809		2203	4299	6502	SO:0001583	missense	23077	exon10			TTTTCCAGATCGA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1433T>C	13.37:g.77837809A>G	ENSP00000444596:p.Leu478Pro	36	0		32	4	NM_015057	0	0	0	0	0		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	A	16.87	3.242809	0.58995	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.28666	1.6;1.6;1.6	5.7	5.7	0.88788	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	0.000000	0.64402	D	0.000011	T	0.41696	0.1170	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.16512	-1.0400	10	0.36615	T	0.2	.	15.9644	0.79956	1.0:0.0:0.0:0.0	.	478	O75592	MYCB2_HUMAN	P	478;516;478	ENSP00000349892:L478P;ENSP00000384288:L516P;ENSP00000444596:L478P	ENSP00000349892:L478P	L	-	2	0	MYCBP2	76735810	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.310000	0.96267	2.172000	0.68678	0.460000	0.39030	CTG	.		0.318	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
ITGBL1	9358	bcgsc.ca	37	13	102227872	102227872	+	Silent	SNP	C	C	T	rs3916912	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr13:102227872C>T	ENST00000376180.3	+	4	780	c.561C>T	c.(559-561)gaC>gaT	p.D187D	ITGBL1_ENST00000376162.3_Silent_p.D94D|ITGBL1_ENST00000545560.2_Silent_p.D46D	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	187	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AATGCATAGACGATGAAACAG	0.348													C|||	665	0.132788	0.2587	0.1081	5008	,	,		17994	0.001		0.1809	False		,,,				2504	0.0665				p.D187D		.											.	ITGBL1-92	0			c.C561T						.	C		953,3453	363.1+/-316.4	102,749,1352	231.0	215.0	221.0		561	-0.7	1.0	13	dbSNP_108	221	1533,7067	289.7+/-299.4	149,1235,2916	no	coding-synonymous	ITGBL1	NM_004791.1		251,1984,4268	TT,TC,CC		17.8256,21.6296,19.1143		187/495	102227872	2486,10520	2203	4300	6503	SO:0001819	synonymous_variant	9358	exon4			CATAGACGATGAA	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.561C>T	13.37:g.102227872C>T		215	0		108	5	NM_004791	0	0	1	1	0	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	ENST00000376180.3	37	CCDS9499.1																																																																																			C|0.831;T|0.169		0.348	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		8	8	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
AKAP13	11214	broad.mit.edu	37	15	86124623	86124623	+	Silent	SNP	A	A	C			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr15:86124623A>C	ENST00000394518.2	+	7	3419	c.3324A>C	c.(3322-3324)atA>atC	p.I1108I	AKAP13_ENST00000361243.2_Silent_p.I1108I|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1108					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAGAGAATATATCACACAACA	0.478																																					p.I1108I	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13-258	0			c.A3324C						.						94.0	88.0	90.0					15																	86124623		2202	4299	6501	SO:0001819	synonymous_variant	11214	exon7			GAATATATCACAC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.3324A>C	15.37:g.86124623A>C		193	0		174	5	NM_007200	0	0	0	0	0	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																			.		0.478	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
CRTC3	64784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91150615	91150615	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr15:91150615A>G	ENST00000268184.6	+	6	486	c.482A>G	c.(481-483)aAt>aGt	p.N161S	CTD-3065B20.3_ENST00000559839.1_RNA|CRTC3_ENST00000558619.1_3'UTR|CRTC3_ENST00000420329.2_Missense_Mutation_p.N161S			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	161					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CTTAGGACCAATTCTGATTCT	0.512			T	MAML2	salivary gland mucoepidermoid																																p.N161S		.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3-393	0			c.A482G						.						110.0	93.0	98.0					15																	91150615		2198	4298	6496	SO:0001583	missense	64784	exon6			GGACCAATTCTGA		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.482A>G	15.37:g.91150615A>G	ENSP00000268184:p.Asn161Ser	56	0		55	10	NM_022769	0	0	0	0	0	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836001	0.50951	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.54675	0.56;0.56	5.95	5.95	0.96441	Transducer of regulated CREB activity, middle domain (1);	0.000000	0.85682	D	0.000000	T	0.61602	0.2360	L	0.48642	1.525	0.52501	D	0.99995	D;D	0.55605	0.972;0.966	P;P	0.61874	0.895;0.832	T	0.57562	-0.7790	10	0.27082	T	0.32	-18.4878	12.8155	0.57663	1.0:0.0:0.0:0.0	.	161;161	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	S	125;161;161	ENSP00000268184:N161S;ENSP00000416573:N161S	ENSP00000268184:N161S	N	+	2	0	CRTC3	88951619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.341000	0.65964	2.279000	0.76181	0.533000	0.62120	AAT	.		0.512	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P|SEZ6L2_ENST00000350527.3_Intron	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	0	0		5	5	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
PITPNA	5306	hgsc.bcm.edu	37	17	1465837	1465837	+	Silent	SNP	C	C	T	rs142675143	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:1465837C>T	ENST00000313486.7	-	1	273	c.18G>A	c.(16-18)gaG>gaA	p.E6E	PITPNA_ENST00000539476.1_Silent_p.E6E	NM_006224.3	NP_006215.1	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	6					axon guidance (GO:0007411)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)|phosphatidylcholine transporter activity (GO:0008525)|phosphatidylinositol transporter activity (GO:0008526)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		ACACTCACTACTCCTTGAGCA	0.801													C|||	50	0.00998403	0.0008	0.0159	5008	,	,		5298	0.0		0.0358	False		,,,				2504	0.002				p.E6E		.											.	PITPNA-227	0			c.G18A						.	C		17,3393		0,17,1688	5.0	5.0	5.0		18	2.6	1.0	17	dbSNP_134	5	222,7468		1,220,3624	no	coding-synonymous	PITPNA	NM_006224.3		1,237,5312	TT,TC,CC		2.8869,0.4985,2.1532		6/271	1465837	239,10861	1705	3845	5550	SO:0001819	synonymous_variant	5306	exon1			TCACTACTCCTTG	M73704	CCDS45563.1	17p13.3	2012-06-29	2003-05-09	2004-09-03	ENSG00000174238	ENSG00000174238			9001	protein-coding gene	gene with protein product		600174	"""phosphotidylinositol transfer protein"""	PITPN		8255295	Standard	NM_006224		Approved	VIB1A	uc021tnf.1	Q00169	OTTHUMG00000177779	ENST00000313486.7:c.18G>A	17.37:g.1465837C>T		0	0		14	4	NM_006224	0	0	0	0	0		Silent	SNP	ENST00000313486.7	37	CCDS45563.1																																																																																			C|0.982;T|0.018		0.801	PITPNA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438927.3		
HIC1	3090	hgsc.bcm.edu	37	17	1960974	1960974	+	Silent	SNP	C	C	T	rs77393586	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:1960974C>T	ENST00000322941.3	+	2	1047	c.1047C>T	c.(1045-1047)cgC>cgT	p.R349R	SMG6_ENST00000573166.1_5'Flank|HIC1_ENST00000399849.3_Silent_p.R330R	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	349					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		GCCGGGAGCGCGGCTCCCCCA	0.776													c|||	720	0.14377	0.2057	0.2824	5008	,	,		6818	0.0496		0.1272	False		,,,				2504	0.0757				p.R349R		.											.	HIC1-135	0			c.C1047T						.		,	305,2047		12,281,883	2.0	3.0	3.0		1047,990	-0.8	0.9	17	dbSNP_131	3	660,5334		34,592,2371	no	coding-synonymous,coding-synonymous	HIC1	NM_001098202.1,NM_006497.3	,	46,873,3254	TT,TC,CC		11.011,12.9677,11.5624	,	349/734,330/715	1960974	965,7381	1176	2997	4173	SO:0001819	synonymous_variant	3090	exon2			GGAGCGCGGCTCC		CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1047C>T	17.37:g.1960974C>T		0	0		8	7	NM_001098202	0	0	1	2	1	D3DTI4	Silent	SNP	ENST00000322941.3	37	CCDS42229.1																																																																																			C|0.839;T|0.161		0.776	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438878.1	NM_006497	
NLRP1	22861	bcgsc.ca	37	17	5436263	5436263	+	Missense_Mutation	SNP	C	C	T	rs2301582	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:5436263C>T	ENST00000572272.1	-	11	3174	c.3175G>A	c.(3175-3177)Gtg>Atg	p.V1059M	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000354411.3_Missense_Mutation_p.V1029M|NLRP1_ENST00000269280.4_Missense_Mutation_p.V1059M|NLRP1_ENST00000577119.1_Missense_Mutation_p.V1029M|NLRP1_ENST00000262467.5_Missense_Mutation_p.V1063M|NLRP1_ENST00000345221.3_Missense_Mutation_p.V1059M			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1059			V -> M (in dbSNP:rs2301582).		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GGAGAAGGCACGCACAAGAGT	0.607													C|||	923	0.184305	0.0787	0.3573	5008	,	,		17458	0.0228		0.3738	False		,,,				2504	0.1759				p.V1063M		.											.	NLRP1-274	0			c.G3187A						.	C	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	567,3839	254.6+/-260.1	35,497,1671	89.0	78.0	82.0		3187,3175,3175,3085,3085	0.8	0.0	17	dbSNP_100	82	3421,5179	504.5+/-376.2	664,2093,1543	yes	missense,missense,missense,missense,missense	NLRP1	NM_001033053.2,NM_014922.4,NM_033004.3,NM_033006.3,NM_033007.3	21,21,21,21,21	699,2590,3214	TT,TC,CC		39.7791,12.8688,30.6628	benign,benign,benign,benign,benign	1063/1376,1059/1430,1059/1474,1029/1444,1029/1400	5436263	3988,9018	2203	4300	6503	SO:0001583	missense	22861	exon11			AAGGCACGCACAA	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3175G>A	17.37:g.5436263C>T	ENSP00000460475:p.Val1059Met	130	0		135	5	NM_001033053	0	0	2	2	0	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	464	0.21245421245421245	46	0.09349593495934959	123	0.3397790055248619	16	0.027972027972027972	279	0.36807387862796836	C	8.966	0.971710	0.18736	0.128688	0.397791	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.71817	-0.6;-0.6;-0.58;-0.48;-0.58	3.94	0.836	0.18891	.	1.178250	0.06625	N	0.758189	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;P;P;P;P;B	0.42039	0.434;0.769;0.769;0.658;0.769;0.095	B;B;B;B;B;B	0.24701	0.055;0.037;0.037;0.017;0.037;0.01	T	0.17653	-1.0362	9	0.49607	T	0.09	.	6.2112	0.20630	0.1028:0.3672:0.53:0.0	rs2301582;rs17765850;rs52830015;rs56943859;rs2301582	325;1029;1029;1059;1059;1063	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	M	1063;1063;1059;1029;1059;325	ENSP00000442029:V1063M;ENSP00000262467:V1063M;ENSP00000269280:V1059M;ENSP00000346390:V1029M;ENSP00000324366:V1059M	ENSP00000262467:V1063M	V	-	1	0	NLRP1	5376987	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.977000	0.03782	0.255000	0.21593	-0.236000	0.12185	GTG	C|0.738;T|0.261		0.607	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
MYO18A	399687	bcgsc.ca	37	17	27413578	27413578	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:27413578G>T	ENST00000527372.1	-	39	5910	c.5730C>A	c.(5728-5730)agC>agA	p.S1910R	MYO18A_ENST00000354329.4_Missense_Mutation_p.S1910R|MYO18A_ENST00000533112.1_Missense_Mutation_p.S1873R|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000531253.1_Missense_Mutation_p.S1910R|TIAF1_ENST00000408971.2_5'UTR	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1910					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CAGCCTCCAGGCTTTCTAGAT	0.557																																					p.S1910R	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A-22	0			c.C5730A						.						33.0	32.0	32.0					17																	27413578		1947	4137	6084	SO:0001583	missense	399687	exon39			CTCCAGGCTTTCT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5730C>A	17.37:g.27413578G>T	ENSP00000437073:p.Ser1910Arg	64	0		72	4	NM_078471	0	0	1	1	0	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.078945|4.078945	0.76528|0.76528	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000527859|ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105	.|D;D;D;D	.|0.88586	.|-2.27;-2.4;-2.28;-2.27	5.6|5.6	-8.25|-8.25	0.01025|0.01025	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90490|0.90490	0.7021|0.7021	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.98;0.999;0.999;0.99	.|P;D;D;P	.|0.80764	.|0.731;0.994;0.952;0.743	D|D	0.89870|0.89870	0.4022|0.4022	5|10	.|0.72032	.|D	.|0.01	.|.	19.8775|19.8775	0.96884|0.96884	0.2299:0.0:0.7701:0.0|0.2299:0.0:0.7701:0.0	.|.	.|1513;1873;1910;1910	.|F8W6Y3;Q92614-3;Q92614-4;Q92614	.|.;.;.;MY18A_HUMAN	D|R	173|1910;1873;1873;1910;1910;806;806;1513;191	.|ENSP00000346291:S1910R;ENSP00000435932:S1873R;ENSP00000434228:S1910R;ENSP00000437073:S1910R	.|ENSP00000346291:S1910R	A|S	-|-	2|3	0|2	MYO18A|MYO18A	24437704|24437704	0.957000|0.957000	0.32711|0.32711	0.595000|0.595000	0.28798|0.28798	0.955000|0.955000	0.61496|0.61496	0.088000|0.088000	0.14979|0.14979	-1.505000|-1.505000	0.01807|0.01807	-0.768000|-0.768000	0.03414|0.03414	GCC|AGC	.		0.557	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
NPTX1	4884	hgsc.bcm.edu	37	17	78449948	78449948	+	Missense_Mutation	SNP	C	C	T	rs144443274	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:78449948C>T	ENST00000306773.4	-	1	456	c.299G>A	c.(298-300)gGc>gAc	p.G100D	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	100					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			ccgggcctcgccggcTCCGGG	0.721													C|||	393	0.0784744	0.0091	0.098	5008	,	,		6949	0.0238		0.173	False		,,,				2504	0.1176				p.G100D		.											.	NPTX1-90	0			c.G299A						.	C	ASP/GLY	146,4108		4,138,1985	11.0	15.0	14.0		299	2.1	1.0	17	dbSNP_134	14	1445,6809		128,1189,2810	no	missense	NPTX1	NM_002522.3	94	132,1327,4795	TT,TC,CC		17.5067,3.4321,12.7199	benign	100/433	78449948	1591,10917	2127	4127	6254	SO:0001583	missense	4884	exon1			GCCTCGCCGGCTC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.299G>A	17.37:g.78449948C>T	ENSP00000307549:p.Gly100Asp	0	0		16	11	NM_002522	0	0	0	0	0	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	196	0.08974358974358974	6	0.012195121951219513	42	0.11602209944751381	10	0.017482517482517484	138	0.1820580474934037	C	14.35	2.508706	0.44660	0.034321	0.175067	ENSG00000171246	ENST00000306773	T	0.10382	2.88	3.44	2.11	0.27256	.	0.738536	0.13049	N	0.417861	T	0.00012	0.0000	N	0.14661	0.345	0.34958	P	0.24807100000000004	P	0.43287	0.802	B	0.35413	0.202	T	0.37174	-0.9717	9	0.15066	T	0.55	-13.6643	4.112	0.10063	0.0:0.5355:0.2155:0.249	.	100	Q15818	NPTX1_HUMAN	D	100	ENSP00000307549:G100D	ENSP00000307549:G100D	G	-	2	0	NPTX1	76064543	0.996000	0.38824	0.994000	0.49952	0.971000	0.66376	1.864000	0.39469	1.482000	0.48325	0.484000	0.47621	GGC	C|0.910;T|0.090		0.721	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
ANKRD30B	374860	bcgsc.ca	37	18	14779969	14779969	+	Missense_Mutation	SNP	C	C	G	rs9675365	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr18:14779969C>G	ENST00000358984.4	+	11	1611	c.1431C>G	c.(1429-1431)ttC>ttG	p.F477L	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.F477L	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	477			F -> L (in dbSNP:rs9675365).					p.F477L(2)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ATCAGATGTTCCCATCAGAAT	0.279													C|||	2332	0.465655	0.4773	0.4265	5008	,	,		15526	0.4187		0.5159	False		,,,				2504	0.4744				p.F477L		.											.	ANKRD30B-24	2	Substitution - Missense(2)	prostate(2)	c.C1431G						.						167.0	153.0	157.0					18																	14779969		692	1591	2283	SO:0001583	missense	374860	exon11			GATGTTCCCATCA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1431C>G	18.37:g.14779969C>G	ENSP00000351875:p.Phe477Leu	58	0		45	4	NM_001145029	0	0	0	0	0	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	1018	0.4661172161172161	231	0.4695121951219512	157	0.43370165745856354	240	0.4195804195804196	390	0.5145118733509235	N	12.12	1.843849	0.32606	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.39406	1.08;1.4	1.69	-2.4	0.06583	.	.	.	.	.	T	0.00012	0.0000	L	0.47716	1.5	0.80722	P	0.0	B	0.30584	0.286	B	0.22753	0.041	T	0.48547	-0.9026	8	0.07990	T	0.79	.	0.2761	0.00238	0.3065:0.2974:0.1877:0.2084	rs9675365;rs52827349;rs59076177;rs9675365	477	F8WAG3	.	L	477	ENSP00000351875:F477L;ENSP00000399031:F477L	ENSP00000351875:F477L	F	+	3	2	ANKRD30B	14769969	0.988000	0.35896	0.000000	0.03702	0.155000	0.21991	0.095000	0.15127	-0.611000	0.05709	0.297000	0.19635	TTC	C|0.546;G|0.454		0.279	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		0	0		5	4	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
CTDP1	9150	bcgsc.ca	37	18	77473086	77473086	+	Silent	SNP	G	G	A	rs599554	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr18:77473086G>A	ENST00000299543.7	+	7	1125	c.978G>A	c.(976-978)acG>acA	p.T326T	CTDP1_ENST00000075430.7_Silent_p.T326T	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	326	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		TCCAGGGCACGGGTGATATGA	0.448													G|||	1046	0.208866	0.3147	0.2205	5008	,	,		15472	0.1389		0.175	False		,,,				2504	0.1646				p.T326T		.											.	CTDP1-90	0			c.G978A						.	G	,,	1272,3134	435.3+/-344.3	200,872,1131	77.0	74.0	75.0		621,978,978	-9.6	0.0	18	dbSNP_83	75	1463,7135	278.0+/-293.2	134,1195,2970	no	coding-synonymous,coding-synonymous,coding-synonymous	CTDP1	NM_001202504.1,NM_004715.4,NM_048368.3	,,	334,2067,4101	AA,AG,GG		17.0156,28.8697,21.032	,,	207/843,326/962,326/868	77473086	2735,10269	2203	4299	6502	SO:0001819	synonymous_variant	9150	exon7			GGGCACGGGTGAT	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.978G>A	18.37:g.77473086G>A		114	0		105	5	NM_004715	0	0	2	2	0	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Silent	SNP	ENST00000299543.7	37	CCDS12017.1																																																																																			A|0.215;C|0.003		0.448	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000536472.1_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000313093.2_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		10	10	NM_019112	0	0	0	8	8	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
SIPA1L3	23094	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38696869	38696869	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:38696869A>G	ENST00000222345.6	+	22	5844	c.5335A>G	c.(5335-5337)Aag>Gag	p.K1779E		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1779					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CAGGGAGAAGAAGGAGCTCTG	0.687																																					p.K1779E		.											.	SIPA1L3-91	0			c.A5335G						.						21.0	26.0	24.0					19																	38696869		2186	4270	6456	SO:0001583	missense	23094	exon22			GAGAAGAAGGAGC	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.5335A>G	19.37:g.38696869A>G	ENSP00000222345:p.Lys1779Glu	211	2		485	55	NM_015073	0	0	3	3	0	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.251493	0.59212	.	.	ENSG00000105738	ENST00000222345	T	0.78126	-1.15	4.62	3.61	0.41365	.	0.330988	0.28964	N	0.013573	T	0.68897	0.3051	L	0.43152	1.355	0.33569	D	0.598344	B	0.09022	0.002	B	0.10450	0.005	T	0.71411	-0.4601	10	0.87932	D	0	-35.126	9.0397	0.36309	0.9111:0.0:0.0889:0.0	.	1779	O60292	SI1L3_HUMAN	E	1779	ENSP00000222345:K1779E	ENSP00000222345:K1779E	K	+	1	0	SIPA1L3	43388709	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.071000	0.57556	0.811000	0.34303	0.454000	0.30748	AAG	.		0.687	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		1	0		15	8	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
DHX34	9704	broad.mit.edu	37	19	47883158	47883160	+	In_Frame_Del	DEL	GGA	GGA	-	rs533574046|rs539350022	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:47883158_47883160delGGA	ENST00000328771.4	+	14	3247_3249	c.2898_2900delGGA	c.(2896-2901)ctggag>ctg	p.E971del		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	971					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		AGCAGCAGCTGGAGGAGGAGGAG	0.66																																					p.966_967del		.											.	DHX34-231	0			c.2898_2900del						.																																			SO:0001651	inframe_deletion	9704	exon14			GCAGCTGGAGGAG	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.2898_2900delGGA	19.37:g.47883167_47883169delGGA	ENSP00000331907:p.Glu971del	251	0		531	6	NM_014681	0	0	0	0	0	B4DMY8	In_Frame_Del	DEL	ENST00000328771.4	37	CCDS12700.1																																																																																			.		0.660	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
HRC	3270	hgsc.bcm.edu	37	19	49657751	49657751	+	Silent	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:49657751A>G	ENST00000252825.4	-	1	930	c.744T>C	c.(742-744)gaT>gaC	p.D248D	HRC_ENST00000595625.1_Silent_p.D248D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	248	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.D248D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		catcatcatcatcgtcatctt	0.507																																					p.D248D	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	1	Substitution - coding silent(1)	large_intestine(1)	c.T744C						.						132.0	95.0	107.0					19																	49657751		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			ATCATCATCGTCA		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.744T>C	19.37:g.49657751A>G		72	0		128	13	NM_002152	0	0	1	1	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			A|0.998;G|0.002		0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
KLK11	11012	bcgsc.ca	37	19	51530741	51530741	+	Missense_Mutation	SNP	C	C	G	rs61752567	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:51530741C>G	ENST00000594768.1	-	1	218	c.33G>C	c.(31-33)aaG>aaC	p.K11N	KLK11_ENST00000453757.3_5'Flank|KLK11_ENST00000594458.1_5'Flank|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000600362.1_5'Flank|KLK11_ENST00000319720.7_Intron|KLK11_ENST00000391804.3_Intron	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	11						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		TGCCCGATGACTTCCAGTCCC	0.607													C|||	261	0.0521166	0.0734	0.0648	5008	,	,		17689	0.0		0.0805	False		,,,				2504	0.0389				p.K11N		.											.	KLK11-650	0			c.G33C						.	C	,,ASN/LYS	307,4099	166.5+/-197.7	16,275,1912	92.0	93.0	92.0		,,33	1.7	0.1	19	dbSNP_129	92	707,7893	174.2+/-224.5	24,659,3617	yes	intron,intron,missense	KLK11	NM_001167605.1,NM_006853.2,NM_144947.1	,,94	40,934,5529	GG,GC,CC		8.2209,6.9678,7.7964	,,possibly-damaging	,,11/283	51530741	1014,11992	2203	4300	6503	SO:0001583	missense	11012	exon1			CGATGACTTCCAG	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.33G>C	19.37:g.51530741C>G	ENSP00000473047:p.Lys11Asn	105	0		140	5	NM_144947	0	0	0	0	0	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	CCDS12818.1	125	0.05723443223443223	36	0.07317073170731707	26	0.0718232044198895	0	0.0	63	0.08311345646437995	c	10.13	1.265469	0.23136	0.069678	0.082209	ENSG00000167757	ENST00000319756	D	0.88277	-2.36	2.76	1.71	0.24356	.	.	.	.	.	T	0.17662	0.0424	N	0.22421	0.69	0.18873	N	0.999988	P	0.48162	0.906	B	0.38056	0.264	T	0.49360	-0.8948	9	0.48119	T	0.1	.	4.9789	0.14155	0.0:0.8224:0.0:0.1776	rs61752567	11	Q9UBX7	KLK11_HUMAN	N	11	ENSP00000324414:K11N	ENSP00000324414:K11N	K	-	3	2	KLK11	56222553	0.008000	0.16893	0.051000	0.19133	0.137000	0.21094	0.546000	0.23284	0.694000	0.31654	0.467000	0.42956	AAG	C|0.927;G|0.073		0.607	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	NM_006853	
FPR1	2357	broad.mit.edu	37	19	52249473	52249473	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:52249473C>G	ENST00000595042.1	-	3	916	c.775G>C	c.(775-777)Gtg>Ctg	p.V259L	FPR1_ENST00000304748.4_Missense_Mutation_p.V259L	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	259					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	AGGGCCACCACCTGATATGGG	0.498																																					p.V259L		.											.	FPR1-524	0			c.G775C						.						71.0	61.0	64.0					19																	52249473		2203	4300	6503	SO:0001583	missense	2357	exon3			CCACCACCTGATA	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.775G>C	19.37:g.52249473C>G	ENSP00000471493:p.Val259Leu	135	0		182	5	NM_001193306	0	0	2	2	0	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	ENST00000595042.1	37	CCDS12839.1	.	.	.	.	.	.	.	.	.	.	.	0.021	-1.419216	0.01136	.	.	ENSG00000171051	ENST00000304748	T	0.72282	-0.64	3.55	-4.32	0.03688	GPCR, rhodopsin-like superfamily (1);	0.718085	0.12766	N	0.440915	T	0.35393	0.0930	N	0.03115	-0.41	0.19300	N	0.999975	B	0.09022	0.002	B	0.15870	0.014	T	0.42344	-0.9457	10	0.02654	T	1	.	8.1277	0.31008	0.0:0.4114:0.3838:0.2049	.	259	P21462	FPR1_HUMAN	L	259	ENSP00000302707:V259L	ENSP00000302707:V259L	V	-	1	0	FPR1	56941285	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-1.798000	0.01747	-0.705000	0.05035	-0.903000	0.02851	GTG	.		0.498	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
NLRP4	147945	bcgsc.ca	37	19	56369593	56369593	+	Silent	SNP	T	T	C	rs421810	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr19:56369593T>C	ENST00000301295.6	+	3	1256	c.834T>C	c.(832-834)gcT>gcC	p.A278A	NLRP4_ENST00000587891.1_Silent_p.A203A|NLRP4_ENST00000346986.5_Silent_p.A278A	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	278	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGCTCATCGCTATCAAACCCG	0.552													C|||	2661	0.53135	0.4523	0.4841	5008	,	,		16520	0.6657		0.4274	False		,,,				2504	0.6401				p.A278A		.											.	NLRP4-216	0			c.T834C						.	C		1956,2450	618.8+/-393.2	434,1088,681	68.0	75.0	72.0		834	-8.2	0.0	19	dbSNP_80	72	3589,5011	627.5+/-398.0	754,2081,1465	no	coding-synonymous	NLRP4	NM_134444.4		1188,3169,2146	CC,CT,TT		41.7326,44.394,42.6342		278/995	56369593	5545,7461	2203	4300	6503	SO:0001819	synonymous_variant	147945	exon3			CATCGCTATCAAA	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.834T>C	19.37:g.56369593T>C		124	0		116	5	NM_134444	0	0	0	0	0	Q86W87|Q96AY6	Silent	SNP	ENST00000301295.6	37	CCDS12936.1																																																																																			T|0.546;C|0.454		0.552	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	0	0		7	7	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TMEM247	388946	bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	225	3		471	49	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
ANKRD30BL	554226	bcgsc.ca	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																					.		.											.	.	0			.						.						27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824	.			CAGACAGGAGGGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		35	2		133	41	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.500;C|0.500		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
SCRN3	79634	ucsc.edu	37	2	175292599	175292599	+	Missense_Mutation	SNP	T	T	G	rs74729826	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:175292599T>G	ENST00000272732.6	+	8	1333	c.1251T>G	c.(1249-1251)aaT>aaG	p.N417K	SCRN3_ENST00000409673.3_Missense_Mutation_p.N410K|SCRN3_ENST00000548921.1_3'UTR	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	417							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			ATCAGTCAAATTTATCAGTCA	0.323																																					p.N417K		.											.	SCRN3-91	0			c.T1251G						.						69.0	65.0	66.0					2																	175292599		2203	4295	6498	SO:0001583	missense	79634	exon8			GTCAAATTTATCA	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.1251T>G	2.37:g.175292599T>G	ENSP00000272732:p.Asn417Lys	187	0		145	24	NM_024583	0	0	2	2	0	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	37	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.422932	0.62733	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.08458	3.09;3.1	5.63	4.48	0.54585	.	0.577730	0.18418	N	0.141839	T	0.03871	0.0109	N	0.08118	0	0.09310	N	0.999994	B;B	0.28713	0.22;0.047	B;B	0.25140	0.058;0.024	T	0.43940	-0.9360	9	.	.	.	.	6.8696	0.24113	0.1929:0.0699:0.0:0.7372	.	410;417	B4DI11;Q0VDG4	.;SCRN3_HUMAN	K	410;417	ENSP00000387142:N410K;ENSP00000272732:N417K	.	N	+	3	2	SCRN3	175000845	0.498000	0.26075	0.915000	0.36163	0.813000	0.45954	0.405000	0.21015	0.974000	0.38366	0.533000	0.62120	AAT	T|0.842;G|0.157		0.323	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
SNED1	25992	hgsc.bcm.edu	37	2	242011084	242011084	+	Missense_Mutation	SNP	T	T	C	rs17440466	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:242011084T>C	ENST00000310397.8	+	25	3683	c.3683T>C	c.(3682-3684)cTg>cCg	p.L1228P	MTERFD2_ENST00000464344.2_5'Flank|SNED1_ENST00000401884.1_Missense_Mutation_p.L1228P|SNED1_ENST00000342631.6_Missense_Mutation_p.L1228P|SNED1_ENST00000405547.3_Missense_Mutation_p.L1228P	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1228			L -> P (in dbSNP:rs17440466).		cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGCCGGAGCTGCGCCTGCTC	0.726													T|||	550	0.109824	0.0227	0.0821	5008	,	,		7723	0.1885		0.171	False		,,,				2504	0.1033				p.L1228P		.											.	SNED1-72	0			c.T3683C						.	T	PRO/LEU	148,3636		7,134,1751	5.0	6.0	6.0		3683	4.4	1.0	2	dbSNP_123	6	1058,6892		57,944,2974	no	missense	SNED1	NM_001080437.1	98	64,1078,4725	CC,CT,TT		13.3082,3.9112,10.2778	probably-damaging	1228/1414	242011084	1206,10528	1892	3975	5867	SO:0001583	missense	25992	exon25			CGGAGCTGCGCCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3683T>C	2.37:g.242011084T>C	ENSP00000308893:p.Leu1228Pro	2	0		20	7	NM_001080437	0	0	10	12	2	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	255	0.11675824175824176	17	0.034552845528455285	27	0.07458563535911603	105	0.18356643356643357	106	0.13984168865435356	T	13.43	2.236189	0.39498	0.039112	0.133082	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.83992	-1.72;-1.79;-1.76;-1.72	4.36	4.36	0.52297	.	0.000000	0.34025	N	0.004340	T	0.01156	0.0038	M	0.67953	2.075	0.09310	P	0.99999566469	D;D;D;D	0.76494	0.992;0.996;0.999;0.96	P;D;D;P	0.83275	0.857;0.918;0.996;0.613	T	0.33904	-0.9850	9	0.37606	T	0.19	.	11.3537	0.49602	0.0:0.0:0.0:1.0	rs17440466;rs17440466	1228;1228;1228;1228	Q8TER0-3;Q8TER0-5;B5MEF5;Q8TER0	.;.;.;SNED1_HUMAN	P	1228	ENSP00000384871:L1228P;ENSP00000386007:L1228P;ENSP00000308893:L1228P;ENSP00000342992:L1228P	ENSP00000308893:L1228P	L	+	2	0	SNED1	241659757	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	1.160000	0.31761	1.727000	0.51537	0.383000	0.25322	CTG	T|0.877;C|0.123		0.726	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	847	17		867	26	.	0	0	26	26	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
CDH4	1002	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60427870	60427870	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr20:60427870A>G	ENST00000360469.5	+	6	881	c.793A>G	c.(793-795)Atc>Gtc	p.I265V	CDH4_ENST00000543233.1_Missense_Mutation_p.I191V	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	265	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CGACCTGTACATCTACGTCAT	0.587																																					p.I265V		.											.	CDH4-282	0			c.A793G						.						189.0	144.0	159.0					20																	60427870		2203	4300	6503	SO:0001583	missense	1002	exon6			CTGTACATCTACG	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.793A>G	20.37:g.60427870A>G	ENSP00000353656:p.Ile265Val	237	1		444	69	NM_001794	0	0	0	0	0	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028185	0.35797	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.56941	0.43;0.43	4.76	4.76	0.60689	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.052748	0.64402	D	0.000001	T	0.45337	0.1337	L	0.45581	1.43	0.80722	D	1	B	0.22414	0.069	B	0.18871	0.023	T	0.34825	-0.9813	9	.	.	.	.	14.2636	0.66102	1.0:0.0:0.0:0.0	.	265	P55283	CADH4_HUMAN	V	265;173;191	ENSP00000353656:I265V;ENSP00000443301:I191V	.	I	+	1	0	CDH4	59861265	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	9.009000	0.93606	1.786000	0.52430	0.459000	0.35465	ATC	.		0.587	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
RSPH14	27156	bcgsc.ca	37	22	23482483	23482483	+	Missense_Mutation	SNP	G	G	A	rs35211242	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr22:23482483G>A	ENST00000216036.4	-	2	321	c.125C>T	c.(124-126)aCg>aTg	p.T42M	RTDR1_ENST00000406876.1_Missense_Mutation_p.T42M	NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		42			T -> M (in dbSNP:rs35211242). {ECO:0000269|PubMed:10607907}.							breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		TTTCTGCCTCGTCTGGAGGTC	0.562													G|||	413	0.0824681	0.0182	0.0879	5008	,	,		18478	0.0387		0.1471	False		,,,				2504	0.1442				p.T42M		.											.	RTDR1-516	0			c.C125T						.	G	MET/THR	159,4247	107.3+/-145.7	4,151,2048	159.0	121.0	134.0		125	3.9	0.1	22	dbSNP_126	134	1340,7260	262.1+/-284.2	99,1142,3059	yes	missense	RTDR1	NM_014433.2	81	103,1293,5107	AA,AG,GG		15.5814,3.6087,11.5254	probably-damaging	42/349	23482483	1499,11507	2203	4300	6503	SO:0001583	missense	27156	exon2			TGCCTCGTCTGGA																												ENST00000216036.4:c.125C>T	22.37:g.23482483G>A	ENSP00000216036:p.Thr42Met	149	0		123	7	NM_014433	0	0	0	0	0		Missense_Mutation	SNP	ENST00000216036.4	37	CCDS13803.1	174	0.07967032967032966	6	0.012195121951219513	32	0.08839779005524862	24	0.04195804195804196	112	0.14775725593667546	G	13.37	2.218034	0.39201	0.036087	0.155814	ENSG00000100218	ENST00000216036;ENST00000452757;ENST00000406876	T;T;T	0.52754	2.19;0.65;2.19	4.91	3.89	0.44902	Armadillo-like helical (1);Armadillo-type fold (1);	0.202525	0.40302	N	0.001127	T	0.00496	0.0016	M	0.78801	2.425	0.23923	P	0.99645841	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.21109	-1.0255	9	0.49607	T	0.09	-11.896	10.8955	0.47021	0.0924:0.0:0.9076:0.0	rs35211242;rs62220915	63;42	B7Z5X4;Q9UHP6	.;RTDR1_HUMAN	M	42;2;42	ENSP00000216036:T42M;ENSP00000391552:T2M;ENSP00000385567:T42M	ENSP00000216036:T42M	T	-	2	0	RTDR1	21812483	0.994000	0.37717	0.054000	0.19295	0.039000	0.13416	2.293000	0.43558	1.214000	0.43395	0.561000	0.74099	ACG	G|0.894;A|0.106		0.562	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
ASPHD2	57168	bcgsc.ca	37	22	26830285	26830285	+	Missense_Mutation	SNP	A	A	G	rs34902186	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr22:26830285A>G	ENST00000215906.5	+	2	1142	c.704A>G	c.(703-705)aAt>aGt	p.N235S		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	235			N -> S (in dbSNP:rs34902186).		peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						TACTTGGTCAATCAGGGGGTT	0.522													A|||	132	0.0263578	0.0045	0.049	5008	,	,		20675	0.0		0.0795	False		,,,				2504	0.0123				p.N235S		.											.	ASPHD2-69	0			c.A704G						.	A	SER/ASN	65,4341	59.3+/-96.0	0,65,2138	109.0	101.0	104.0		704	3.5	0.9	22	dbSNP_126	104	811,7789	188.0+/-235.1	36,739,3525	yes	missense	ASPHD2	NM_020437.4	46	36,804,5663	GG,GA,AA		9.4302,1.4753,6.7354	benign	235/370	26830285	876,12130	2203	4300	6503	SO:0001583	missense	57168	exon2			TGGTCAATCAGGG	AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.704A>G	22.37:g.26830285A>G	ENSP00000215906:p.Asn235Ser	252	0		136	7	NM_020437	0	0	1	1	0	B2RCH3|Q7L0W3|Q9NSN3	Missense_Mutation	SNP	ENST00000215906.5	37	CCDS13834.2	85	0.03891941391941392	4	0.008130081300813009	15	0.04143646408839779	0	0.0	66	0.0870712401055409	A	11.37	1.618941	0.28801	0.014753	0.094302	ENSG00000128203	ENST00000215906	T	0.41400	1.0	4.82	3.49	0.39957	.	0.100911	0.64402	N	0.000003	T	0.00936	0.0031	L	0.34521	1.04	0.21325	P	0.999723184	B	0.12630	0.006	B	0.17722	0.019	T	0.13845	-1.0494	9	0.08179	T	0.78	-20.537	8.0309	0.30465	0.8759:0.0:0.1241:0.0	rs34902186	235	Q6ICH7	ASPH2_HUMAN	S	235	ENSP00000215906:N235S	ENSP00000215906:N235S	N	+	2	0	ASPHD2	25160285	1.000000	0.71417	0.942000	0.38095	0.982000	0.71751	4.499000	0.60380	0.656000	0.30886	0.455000	0.32223	AAT	A|0.946;G|0.054		0.522	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320422.1	NM_020437	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
OR5H6	79295	broad.mit.edu	37	3	97983207	97983207	+	Missense_Mutation	SNP	G	G	C	rs137937308	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr3:97983207G>C	ENST00000383696.2	+	1	120	c.79G>C	c.(79-81)Gag>Cag	p.E27Q	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ATTGCTGACAGAGTTTGTTCT	0.403													G|||	7	0.00139776	0.0	0.0	5008	,	,		21408	0.0		0.005	False		,,,				2504	0.002				p.E27Q		.											.	OR5H6-137	0			c.G79C						.	G	GLN/GLU	3,4403		0,3,2200	159.0	162.0	161.0		79	1.3	0.2	3	dbSNP_134	161	38,8562		0,38,4262	yes	missense	OR5H6	NM_001005479.1	29	0,41,6462	CC,CG,GG		0.4419,0.0681,0.3152	possibly-damaging	27/326	97983207	41,12965	2203	4300	6503	SO:0001583	missense	79295	exon1			CTGACAGAGTTTG	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.79G>C	3.37:g.97983207G>C	ENSP00000373196:p.Glu27Gln	150	0		165	3	NM_001005479	0	0	0	0	0	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	CCDS33800.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	-	9.757	1.169122	0.21621	6.81E-4	0.004419	ENSG00000230301	ENST00000383696	T	0.01126	5.3	2.19	1.28	0.21552	.	0.703971	0.12221	N	0.488363	T	0.01730	0.0055	M	0.69463	2.115	0.09310	N	1	B	0.26975	0.165	B	0.23275	0.045	T	0.38457	-0.9660	10	0.66056	D	0.02	.	6.6494	0.22953	0.1628:0.0:0.8372:0.0	.	27	Q8NGV6	OR5H6_HUMAN	Q	27	ENSP00000373196:E27Q	ENSP00000373196:E27Q	E	+	1	0	OR5H6	99465897	0.004000	0.15560	0.160000	0.22671	0.257000	0.26127	1.329000	0.33770	0.251000	0.21505	0.194000	0.17425	GAG	G|0.997;C|0.003		0.403	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
LRRC58	116064	hgsc.bcm.edu	37	3	120068022	120068022	+	Silent	SNP	C	C	G	rs6770482	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr3:120068022C>G	ENST00000295628.3	-	1	164	c.69G>C	c.(67-69)gtG>gtC	p.V23V	RP11-174O3.3_ENST00000494869.1_RNA	NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	23										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		TCTCGGTGGACACGCTGAGGC	0.741													C|||	1050	0.209665	0.3933	0.2968	5008	,	,		12008	0.0962		0.0755	False		,,,				2504	0.1544				p.V23V		.											.	.	0			c.G69C						.	C		576,2498		28,520,989	2.0	2.0	2.0		69	4.5	1.0	3	dbSNP_116	2	392,6042		8,376,2833	no	coding-synonymous	LRRC58	NM_001099678.1		36,896,3822	GG,GC,CC		6.0926,18.7378,10.1809		23/372	120068022	968,8540	1537	3217	4754	SO:0001819	synonymous_variant	116064	exon1			GGTGGACACGCTG	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.69G>C	3.37:g.120068022C>G		0	0		5	5	NM_001099678	0	0	0	0	0		Silent	SNP	ENST00000295628.3	37	CCDS46892.1																																																																																			C|0.826;G|0.174		0.741	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
TNIP2	79155	hgsc.bcm.edu	37	4	2757800	2757800	+	Missense_Mutation	SNP	G	G	C	rs74548850	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:2757800G>C	ENST00000315423.7	-	1	303	c.217C>G	c.(217-219)Cgc>Ggc	p.R73G	TNIP2_ENST00000510267.1_5'UTR|TNIP2_ENST00000503235.1_Missense_Mutation_p.R73G	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCCGGAAGCGCGCAACCTGC	0.756													G|||	210	0.0419329	0.025	0.0447	5008	,	,		6355	0.0288		0.0408	False		,,,				2504	0.0777				p.R73G		.											.	TNIP2-90	0			c.C217G						.	G	GLY/ARG	60,3592		0,60,1766	5.0	7.0	6.0		217	2.8	1.0	4	dbSNP_131	6	267,7455		4,259,3598	no	missense	TNIP2	NM_024309.3	125	4,319,5364	CC,CG,GG		3.4577,1.6429,2.875	probably-damaging	73/430	2757800	327,11047	1826	3861	5687	SO:0001583	missense	79155	exon1			GGAAGCGCGCAAC	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.217C>G	4.37:g.2757800G>C	ENSP00000321203:p.Arg73Gly	0	0		17	9	NM_024309	0	0	0	0	0		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	94	0.04304029304029304	17	0.034552845528455285	18	0.049723756906077346	18	0.03146853146853147	41	0.05408970976253298	G	19.51	3.841781	0.71488	0.016429	0.034577	ENSG00000168884	ENST00000315423;ENST00000503235	T;T	0.48522	0.82;0.81	3.62	2.75	0.32379	.	0.480578	0.20050	N	0.100314	T	0.14399	0.0348	M	0.65975	2.015	0.27856	N	0.940558	D;P	0.62365	0.991;0.481	P;B	0.52217	0.693;0.071	T	0.11299	-1.0593	10	0.23302	T	0.38	-8.2753	9.2129	0.37328	0.0:0.0:0.7823:0.2177	.	73;73	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	G	73	ENSP00000321203:R73G;ENSP00000426314:R73G	ENSP00000321203:R73G	R	-	1	0	TNIP2	2727598	0.882000	0.30256	1.000000	0.80357	0.927000	0.56198	1.083000	0.30815	0.689000	0.31550	0.498000	0.49722	CGC	G|0.957;C|0.043		0.756	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
DOK7	285489	hgsc.bcm.edu	37	4	3495095	3495095	+	Missense_Mutation	SNP	G	G	A	rs9684786	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:3495095G>A	ENST00000340083.5	+	7	1447	c.1382G>A	c.(1381-1383)gGc>gAc	p.G461D	DOK7_ENST00000389653.2_Missense_Mutation_p.G461D|DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	461			G -> D (in dbSNP:rs9684786). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:22661499}.		neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCCCCCCAGGGCAGCGAGGCC	0.736													.|||	979	0.195487	0.1301	0.2536	5008	,	,		12640	0.126		0.1859	False		,,,				2504	0.3241				p.G461D		.											.	DOK7-91	0			c.G1382A						.	G	,ASP/GLY	491,3733		21,449,1642	5.0	7.0	6.0		,1382	2.6	0.0	4	dbSNP_119	6	1533,6777		146,1241,2768	no	utr-3,missense	DOK7	NM_001164673.1,NM_173660.4	,94	167,1690,4410	AA,AG,GG		18.4477,11.6241,16.1481	,possibly-damaging	,461/505	3495095	2024,10510	2112	4155	6267	SO:0001583	missense	285489	exon7			CCCAGGGCAGCGA	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1382G>A	4.37:g.3495095G>A	ENSP00000344432:p.Gly461Asp	0	0		14	11	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	361	0.1652930402930403	71	0.1443089430894309	89	0.24585635359116023	60	0.1048951048951049	141	0.18601583113456466	G	11.67	1.708532	0.30322	0.116241	0.184477	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.65364	-0.15;-0.05	3.45	2.59	0.31030	.	0.256266	0.35096	N	0.003451	T	0.00039	0.0001	L	0.60455	1.87	0.80722	P	0.0	B;P;B	0.40731	0.192;0.728;0.005	B;P;B	0.44359	0.066;0.447;0.001	T	0.03706	-1.1011	9	0.51188	T	0.08	-7.7911	11.2519	0.49031	0.0:0.0:0.8164:0.1835	rs9684786;rs17846359;rs17859395	461;323;461	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	D	461	ENSP00000374304:G461D;ENSP00000344432:G461D	ENSP00000344432:G461D	G	+	2	0	DOK7	3464893	1.000000	0.71417	0.010000	0.14722	0.077000	0.17291	2.742000	0.47434	0.667000	0.31107	0.555000	0.69702	GGC	G|0.834;A|0.166		0.736	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
WDR1	9948	broad.mit.edu	37	4	10084680	10084680	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:10084680delC	ENST00000499869.2	-	10	1355	c.1162delG	c.(1162-1164)gtgfs	p.V388fs	WDR1_ENST00000382451.2_Frame_Shift_Del_p.V248fs|WDR1_ENST00000382452.2_Frame_Shift_Del_p.V388fs|WDR1_ENST00000502702.1_Frame_Shift_Del_p.V248fs|WDR1_ENST00000515743.1_5'UTR			O75083	WDR1_HUMAN	WD repeat domain 1	388					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GTGTACCGCACGGTGTCGTCC	0.637																																					p.V388fs		.											.	WDR1-48	0			c.1162delG						.						51.0	60.0	57.0					4																	10084680		2130	4227	6357	SO:0001589	frameshift_variant	9948	exon10			ACCGCACGGTGTC	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1162delG	4.37:g.10084680delC	ENSP00000427687:p.Val388fs	184	0		285	7	NM_017491	0	0	0	0	0	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Frame_Shift_Del	DEL	ENST00000499869.2	37	CCDS54740.1																																																																																			.		0.637	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
BEND4	389206	broad.mit.edu;bcgsc.ca	37	4	42145732	42145732	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:42145732T>A	ENST00000502486.1	-	3	1346	c.767A>T	c.(766-768)tAc>tTc	p.Y256F	BEND4_ENST00000504360.1_Missense_Mutation_p.Y252F	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	256										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						CGAGAGCAGGTAATTTTGTAG	0.468																																					p.Y256F		.											.	BEND4-90	0			c.A767T						.						99.0	101.0	100.0					4																	42145732		1905	4119	6024	SO:0001583	missense	389206	exon3			AGCAGGTAATTTT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.767A>T	4.37:g.42145732T>A	ENSP00000421169:p.Tyr256Phe	129	1		149	6	NM_001159547	0	0	0	0	0	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	37	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.427973	0.83667	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.65533	0.2700	L	0.27053	0.805	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.80764	0.994;0.985;0.994	T	0.70059	-0.4976	9	0.87932	D	0	-16.4146	15.6591	0.77169	0.0:0.0:0.0:1.0	.	178;256;256	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	F	127;256;252	.	ENSP00000412495:Y127F	Y	-	2	0	BEND4	41840489	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	7.698000	0.84413	2.111000	0.64477	0.533000	0.62120	TAC	.		0.468	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
DSPP	1834	bcgsc.ca	37	4	88537126	88537126	+	Silent	SNP	C	C	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:88537126C>T	ENST00000282478.7	+	4	3345	c.3312C>T	c.(3310-3312)gaC>gaT	p.D1104D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1104D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1104	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcgacagcagcgata	0.542																																					p.D1104D		.											.	DSPP-90	0			c.C3312T						.						13.0	18.0	17.0					4																	88537126		1133	2209	3342	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3312C>T	4.37:g.88537126C>T		252	6		498	63	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PKD2	5311	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88996821	88996821	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr4:88996821A>G	ENST00000508588.1	+	10	1531	c.1136A>G	c.(1135-1137)aAt>aGt	p.N379S	PKD2_ENST00000237596.2_Missense_Mutation_p.N961S|PKD2_ENST00000502363.1_Missense_Mutation_p.N379S|PKD2_ENST00000511337.1_3'UTR			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GCAGGTGGAAATGGGAGTTCT	0.483																																					p.N961S		.											.	PKD2-91	0			c.A2882G						.						193.0	152.0	166.0					4																	88996821		2203	4300	6503	SO:0001583	missense	5311	exon15			GTGGAAATGGGAG	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.1136A>G	4.37:g.88996821A>G	ENSP00000427131:p.Asn379Ser	83	0		137	31	NM_000297	0	0	4	5	1	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000508588.1	37		.	.	.	.	.	.	.	.	.	.	A	11.18	1.561731	0.27915	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	T;D;D	0.91521	-0.24;-2.86;-2.86	5.3	2.83	0.33086	.	0.317447	0.34046	N	0.004309	D	0.83041	0.5168	L	0.38531	1.155	0.37954	D	0.932762	B	0.17852	0.024	B	0.12156	0.007	T	0.73720	-0.3894	10	0.30854	T	0.27	-11.8095	6.8795	0.24164	0.6386:0.2879:0.0734:0.0	.	961	Q13563	PKD2_HUMAN	S	961;379;379	ENSP00000237596:N961S;ENSP00000427131:N379S;ENSP00000425289:N379S	ENSP00000237596:N961S	N	+	2	0	PKD2	89215845	0.981000	0.34729	0.160000	0.22671	0.724000	0.41520	2.307000	0.43682	0.316000	0.23135	0.477000	0.44152	AAT	.		0.483	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363253.2	NM_000297	
ZNF131	7690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43161449	43161449	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr5:43161449C>T	ENST00000399534.1	+	5	514	c.470C>T	c.(469-471)tCa>tTa	p.S157L	ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000509156.1_Missense_Mutation_p.S157L|ZNF131_ENST00000505606.2_Missense_Mutation_p.S157L|ZNF131_ENST00000509634.1_Missense_Mutation_p.S157L|ZNF131_ENST00000306938.4_Missense_Mutation_p.S157L			P52739	ZN131_HUMAN	zinc finger protein 131	157					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						ATCACTGAGTCATTGCCATCT	0.408																																					p.S157L		.											.	ZNF131-90	0			c.C470T						.						114.0	103.0	106.0					5																	43161449		1879	4122	6001	SO:0001583	missense	7690	exon5			CTGAGTCATTGCC	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.470C>T	5.37:g.43161449C>T	ENSP00000382450:p.Ser157Leu	160	0		228	51	NM_003432	0	0	2	2	0	B4DRL3|Q6PIF0	Missense_Mutation	SNP	ENST00000399534.1	37		.	.	.	.	.	.	.	.	.	.	C	17.64	3.439856	0.63067	.	.	ENSG00000172262	ENST00000515326;ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.18	5.18	0.71444	.	0.131313	0.52532	D	0.000067	T	0.63343	0.2503	N	0.19112	0.55	0.53005	D	0.999969	B;P	0.36909	0.278;0.573	B;B	0.36666	0.057;0.23	T	0.62964	-0.6742	10	0.30078	T	0.28	-6.1519	18.6914	0.91585	0.0:1.0:0.0:0.0	.	157;157	P52739;P52739-2	ZN131_HUMAN;.	L	157	ENSP00000422079:S157L;ENSP00000426504:S157L;ENSP00000305804:S157L;ENSP00000382450:S157L;ENSP00000423945:S157L;ENSP00000421246:S157L	ENSP00000305804:S157L	S	+	2	0	ZNF131	43197206	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.592000	0.67543	2.429000	0.82318	0.650000	0.86243	TCA	.		0.408	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432	
PCDHB10	56126	mdanderson.org	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		8	0		31	15	NM_018930	0	0	44	46	2	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHB13	56123	hgsc.bcm.edu	37	5	140595625	140595625	+	Missense_Mutation	SNP	G	G	A	rs2910005	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr5:140595625G>A	ENST00000341948.4	+	1	2117	c.1930G>A	c.(1930-1932)Gtc>Atc	p.V644I		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGCTGGTCAAGGACAA	0.711													G|||	602	0.120208	0.1036	0.0937	5008	,	,		15211	0.0933		0.1421	False		,,,				2504	0.1667				p.V644I		.											.	PCDHB13-93	0			c.G1930A						.						13.0	15.0	14.0					5																	140595625		1563	3249	4812	SO:0001583	missense	56123	exon1			GTGCTGGTCAAGG	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1930G>A	5.37:g.140595625G>A	ENSP00000345491:p.Val644Ile	5	0		57	25	NM_018933	0	0	131	134	3	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	263	0.12042124542124542	52	0.10569105691056911	43	0.11878453038674033	53	0.09265734265734266	115	0.1517150395778364	-	23.4	4.405720	0.83230	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.23552	1.9	3.3	3.3	0.37823	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00300	0.0009	M	0.63843	1.955	0.27033	P	0.9641952	D	0.71674	0.998	D	0.63283	0.913	T	0.09314	-1.0680	8	0.72032	D	0.01	.	14.5914	0.68368	0.0:0.0:1.0:0.0	rs2910005	644	Q9Y5F0	PCDBD_HUMAN	I	644;644;590	ENSP00000345491:V644I	ENSP00000345491:V644I	V	+	1	0	PCDHB13	140575809	1.000000	0.71417	0.701000	0.30321	0.791000	0.44710	9.501000	0.97979	1.576000	0.49790	0.298000	0.19748	GTC	G|0.500;A|0.500		0.711	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		0	0		8	8	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	1	0		10	7	NM_001135111	0	0	1	1	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		1	0		6	6	NM_000287	0	0	0	0	0	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
PTCHD4	442213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	47976553	47976553	+	Missense_Mutation	SNP	C	C	T	rs191919500		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr6:47976553C>T	ENST00000339488.4	-	2	757	c.724G>A	c.(724-726)Gtg>Atg	p.V242M	PTCHD4_ENST00000543600.1_Missense_Mutation_p.V225M	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	242	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.					integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AGGATCAGCACGAGGCTCACC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		19074	0.001		0.0	False		,,,				2504	0.0				p.V242M		.											.	.	0			c.G724A						.						70.0	72.0	72.0					6																	47976553		2039	4206	6245	SO:0001583	missense	442213	exon2			TCAGCACGAGGCT		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.724G>A	6.37:g.47976553C>T	ENSP00000341914:p.Val242Met	204	0		182	43	NM_001013732	0	0	0	0	0	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	C|C	10.91|10.91	1.484826|1.484826	0.26598|0.26598	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000398738|ENST00000339488;ENST00000543600	.|D;D	.|0.93307	.|-3.2;-3.2	6.16|6.16	3.37|3.37	0.38596|0.38596	.|Sterol-sensing domain (1);	.|0.277575	.|0.36591	.|N	.|0.002515	T|T	0.75838|0.75838	0.3904|0.3904	N|N	0.14661|0.14661	0.345|0.345	0.40204|0.40204	D|D	0.977557|0.977557	.|B;B	.|0.17268	.|0.02;0.021	.|B;B	.|0.18871	.|0.023;0.018	T|T	0.72279|0.72279	-0.4340|-0.4340	5|10	.|0.49607	.|T	.|0.09	.|.	5.3307|5.3307	0.15930|0.15930	0.0:0.5563:0.1477:0.296|0.0:0.5563:0.1477:0.296	.|.	.|242;225	.|Q6ZW05;B0QZ29	.|CF138_HUMAN;.	H|M	241|242;225	.|ENSP00000341914:V242M;ENSP00000439864:V225M	.|ENSP00000341914:V242M	R|V	-|-	2|1	0|0	C6orf138|C6orf138	48084512|48084512	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.871000|0.871000	0.50021|0.50021	1.336000|1.336000	0.33850|0.33850	0.905000|0.905000	0.36596|0.36596	0.650000|0.650000	0.86243|0.86243	CGT|GTG	C|0.999;T|0.000		0.562	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	1	0		6	5	NM_002047	0	0	2	3	1	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	1	0		8	8	NM_194284	0	0	0	3	3	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
KAT6A	7994	hgsc.bcm.edu	37	8	41798484	41798484	+	Missense_Mutation	SNP	C	C	T	rs376411038		TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr8:41798484C>T	ENST00000396930.3	-	16	3458	c.2915G>A	c.(2914-2916)cGc>cAc	p.R972H	KAT6A_ENST00000406337.1_Missense_Mutation_p.R972H|KAT6A_ENST00000265713.2_Missense_Mutation_p.R972H	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	972					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R972H(1)									CTCACTGTAGCGACGGGGCAG	0.597																																					p.R972H		.											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2915A						.						103.0	102.0	102.0					8																	41798484		2203	4300	6503	SO:0001583	missense	7994	exon16			CTGTAGCGACGGG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2915G>A	8.37:g.41798484C>T	ENSP00000380136:p.Arg972His	55	0		73	3	NM_001099412	0	0	1	1	0	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	6.798	0.516344	0.12944	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.60299	0.2;0.2;0.2	5.56	4.67	0.58626	.	0.387081	0.24796	N	0.035522	T	0.40222	0.1108	N	0.12182	0.205	0.28542	N	0.912036	P	0.49358	0.923	B	0.39660	0.306	T	0.32107	-0.9919	10	0.41790	T	0.15	-2.6719	15.7778	0.78236	0.1374:0.8626:0.0:0.0	.	972	Q92794	KAT6A_HUMAN	H	972;972;972;552	ENSP00000265713:R972H;ENSP00000385888:R972H;ENSP00000380136:R972H	ENSP00000265713:R972H	R	-	2	0	KAT6A	41917641	1.000000	0.71417	0.394000	0.26270	0.001000	0.01503	3.026000	0.49689	1.318000	0.45170	-0.188000	0.12872	CGC	.		0.597	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		7	6	NM_201380	0	0	1	5	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	MAF1_ENST00000534585.1_5'Flank|MAF1_ENST00000532522.1_5'Flank|SHARPIN_ENST00000533948.1_Intron|MAF1_ENST00000322428.5_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		0	0		4	4	NM_030974	0	0	0	10	10	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
PTPRD	5789	broad.mit.edu	37	9	8485823	8485823	+	Silent	SNP	C	C	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr9:8485823C>T	ENST00000381196.4	-	25	3537	c.2994G>A	c.(2992-2994)acG>acA	p.T998T	PTPRD_ENST00000356435.5_Silent_p.T998T|PTPRD_ENST00000540109.1_Silent_p.T998T|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Silent_p.T985T|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000358503.5_Silent_p.T976T|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000397606.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	998	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCCCTTTGCTCGTATGAGCAC	0.493										TSP Lung(15;0.13)																											p.T998T		.											.	PTPRD-912	0			c.G2994A						.						102.0	89.0	94.0					9																	8485823		2203	4300	6503	SO:0001819	synonymous_variant	5789	exon28			TTTGCTCGTATGA	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2994G>A	9.37:g.8485823C>T		145	1		155	6	NM_002839	0	0	0	0	0	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	CCDS43786.1																																																																																			.		0.493	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
CRB2	286204	hgsc.bcm.edu	37	9	126135831	126135831	+	Silent	SNP	T	T	C	rs7848449	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr9:126135831T>C	ENST00000373631.3	+	10	3022	c.3021T>C	c.(3019-3021)gcT>gcC	p.A1007A	CRB2_ENST00000373629.2_Silent_p.A675A|CRB2_ENST00000359999.3_Silent_p.A1007A	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1007	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TCCTGCTGGCTGAGAACTTCA	0.766													C|||	691	0.137979	0.2436	0.1383	5008	,	,		8285	0.0556		0.0944	False		,,,				2504	0.1247				p.A1007A		.											.	CRB2-91	0			c.T3021C						.	C		511,2581		46,419,1081	6.0	6.0	6.0		3021	-6.8	0.9	9	dbSNP_116	6	457,5659		17,423,2618	no	coding-synonymous	CRB2	NM_173689.5		63,842,3699	CC,CT,TT		7.4722,16.5265,10.5126		1007/1286	126135831	968,8240	1546	3058	4604	SO:0001819	synonymous_variant	286204	exon10			GCTGGCTGAGAAC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3021T>C	9.37:g.126135831T>C		0	0		14	5	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Silent	SNP	ENST00000373631.3	37	CCDS6852.2																																																																																			T|0.886;C|0.114		0.766	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
PPP6C	5537	broad.mit.edu	37	9	127951863	127951863	+	Intron	SNP	G	G	A	rs466994	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr9:127951863G>A	ENST00000373547.4	-	1	175				PPP6C_ENST00000373546.3_Intron|PPP6C_ENST00000415905.1_Intron|PPP6C_ENST00000451402.1_Silent_p.F45F	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit						G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						CTGGAGAAAGGAAgggccggc	0.697													G|||	2279	0.455072	0.4682	0.3473	5008	,	,		12046	0.5417		0.4513	False		,,,				2504	0.4284				p.F45F		.											.	PPP6C-227	0			c.C135T						.						8.0	13.0	11.0					9																	127951863		685	1565	2250	SO:0001627	intron_variant	5537	exon1			AGAAAGGAAGGGC	AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.75+59C>T	9.37:g.127951863G>A		22	0		35	3	NM_001123355	0	0	0	0	0	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Silent	SNP	ENST00000373547.4	37	CCDS6861.1																																																																																			G|0.563;A|0.437		0.697	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	
SSX1	6756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48123217	48123217	+	Splice_Site	SNP	A	A	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chrX:48123217A>T	ENST00000376919.3	+	6	467	c.331A>T	c.(331-333)Atc>Ttc	p.I111F		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	111		Breakpoint for translocation to form the SSXT-SSX1 fusion protein.			regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						CATTATAAAGATCATGCCCAA	0.423			T	SS18	synovial sarcoma																																p.I111F	Esophageal Squamous(175;994 1982 2214 6527 18857)	.		Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	.	SSX1-522	0			c.A331T						.						173.0	166.0	168.0					X																	48123217		2203	4299	6502	SO:0001630	splice_region_variant	6756	exon6			ATAAAGATCATGC	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.331-1A>T	X.37:g.48123217A>T		169	0		210	29	NM_005635	0	0	0	0	0	A3KN76|Q08AJ2|Q5JQ64	Missense_Mutation	SNP	ENST00000376919.3	37	CCDS14290.1	.	.	.	.	.	.	.	.	.	.	N	10.15	1.270287	0.23221	.	.	ENSG00000126752	ENST00000376919	T	0.06849	3.25	1.31	-2.55	0.06288	.	.	.	.	.	T	0.10380	0.0254	L	0.60455	1.87	0.09310	N	0.999992	D	0.54772	0.968	P	0.47673	0.554	T	0.09596	-1.0667	8	.	.	.	.	5.3581	0.16073	0.6181:0.0:0.3819:0.0	.	111	Q16384	SSX1_HUMAN	F	111	ENSP00000366118:I111F	.	I	+	1	0	SSX1	48008161	0.373000	0.25073	0.000000	0.03702	0.001000	0.01503	-0.009000	0.12765	-0.950000	0.03659	-0.591000	0.04113	ATC	.		0.423	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056485.1	NM_005635	Missense_Mutation
ZC3H12B	340554	broad.mit.edu	37	X	64719018	64719018	+	Silent	SNP	G	G	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chrX:64719018G>T	ENST00000338957.4	+	3	955	c.888G>T	c.(886-888)gtG>gtT	p.V296V	ZC3H12B_ENST00000423889.3_Silent_p.V285V	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	296							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCATCATTGTGTCCAATGATA	0.443																																					p.V296V		.											.	ZC3H12B-131	0			c.G888T						.						128.0	117.0	121.0					X																	64719018		1908	4108	6016	SO:0001819	synonymous_variant	340554	exon3			CATTGTGTCCAAT	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.888G>T	X.37:g.64719018G>T		101	0		138	4	NM_001010888	0	0	0	0	0	B2RTQ3|E9PAJ6|Q5H9C0	Silent	SNP	ENST00000338957.4	37	CCDS48131.2																																																																																			.		0.443	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334	
SPIRE2	84501	broad.mit.edu	37	16	89916879	89916880	+	In_Frame_Ins	INS	-	-	GAG	rs146569219|rs377330880	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr16:89916879_89916880insGAG	ENST00000378247.3	+	3	499_500	c.456_457insGAG	c.(457-459)gag>GAGgag	p.153_153E>EE	SPIRE2_ENST00000393062.2_In_Frame_Ins_p.153_153E>EE|SPIRE2_ENST00000564878.1_3'UTR	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	153	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACGGGGGTCCCGAGGAGGAGGA	0.728														371	0.0740815	0.0038	0.0245	5008	,	,		12494	0.2679		0.0606	False		,,,				2504	0.0184				p.P152delinsPE		.											.	SPIRE2-90	0			c.456_457insGAG						.																																			SO:0001652	inframe_insertion	84501	exon3			GGGTCCCGAGGAG	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.469_471dupGAG	16.37:g.89916886_89916888dupGAG	ENSP00000367494:p.Glu157dup	10	0		66	12	NM_032451	0	0	0	0	0	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	In_Frame_Ins	INS	ENST00000378247.3	37	CCDS32516.1																																																																																			-|0.923;GAG|0.077		0.728	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
ABCA5	23461	broad.mit.edu	37	17	67302911	67302912	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr17:67302911_67302912insT	ENST00000392676.3	-	6	806_807	c.742_743insA	c.(742-744)atafs	p.I248fs	ABCA5_ENST00000588877.1_Frame_Shift_Ins_p.I248fs|ABCA5_ENST00000392677.2_Frame_Shift_Ins_p.I248fs			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	248					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.I248L(1)|p.I248fs*1(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	AAATTCTTTTATTTTTTTTTCT	0.243																																					p.I248fs		.											.	ABCA5-93	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|lung(1)	c.743_744insA						.																																			SO:0001589	frameshift_variant	23461	exon6			TCTTTTATTTTTT	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.743dupA	17.37:g.67302920_67302920dupT	ENSP00000376443:p.Ile248fs	14	0		7	2	NM_172232	0	0	0	0	0	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Frame_Shift_Ins	INS	ENST00000392676.3	37	CCDS11685.1																																																																																			.		0.243	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
EML6	400954	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	55074739	55074740	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr2:55074739_55074740insT	ENST00000356458.6	+	8	1686_1687	c.1166_1167insT	c.(1165-1170)tctttcfs	p.SF389fs	RNU7-81P_ENST00000516698.1_RNA	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	389						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						AAGGACGGCTCTTTCATTGTTC	0.48																																					p.S389fs		.											.	.	0			c.1166_1167insT						.																																			SO:0001589	frameshift_variant	400954	exon8			ACGGCTCTTTCAT		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1169dupT	2.37:g.55074742_55074742dupT	ENSP00000348842:p.Ser389fs	83	0		102	20	NM_001039753	0	0	0	0	0	A8MUB5|B6ZDG7	Frame_Shift_Ins	INS	ENST00000356458.6	37	CCDS46286.1																																																																																			.		0.480	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-OR-A5JI-01A-11D-A29I-10	TCGA-OR-A5JI-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e3635255-1c8d-4532-b4ff-00d04a20ff79	6477b685-8285-40b9-ab7a-8faf6afd602e	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D|KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	0	0		4	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
