#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GNB1	2782	broad.mit.edu	37	1	1737963	1737963	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:1737963G>T	ENST00000378609.4	-	6	549	c.218C>A	c.(217-219)gCc>gAc	p.A73D		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	73					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		ATCCTGCGAGGCACTGACGAG	0.493																																					p.A73D		.											.	GNB1-227	0			c.C218A						.						88.0	75.0	79.0					1																	1737963		2203	4300	6503	SO:0001583	missense	2782	exon6			TGCGAGGCACTGA	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.218C>A	1.37:g.1737963G>T	ENSP00000367872:p.Ala73Asp	110	0		117	5	NM_002074	0	1	76	77	0	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	ENST00000378609.4	37	CCDS34.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341586	0.61073	.	.	ENSG00000078369	ENST00000378609;ENST00000378606;ENST00000434686;ENST00000439272;ENST00000437146	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.000000	0.85682	D	0.000000	D	0.86234	0.5884	H	0.96175	3.78	0.80722	D	1	D	0.65815	0.995	D	0.73708	0.981	D	0.90182	0.4243	10	0.87932	D	0	-20.3228	18.734	0.91748	0.0:0.0:1.0:0.0	.	73	P62873	GBB1_HUMAN	D	73;73;73;60;73	ENSP00000367872:A73D;ENSP00000392765:A73D;ENSP00000399741:A60D;ENSP00000416651:A73D	ENSP00000367869:A73D	A	-	2	0	GNB1	1727823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.491000	0.97954	2.669000	0.90835	0.655000	0.94253	GCC	.		0.493	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
PDPN	10630	broad.mit.edu	37	1	13933776	13933776	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:13933776G>T	ENST00000509009.1	+	2	205	c.161G>T	c.(160-162)cGc>cTc	p.R54L	PDPN_ENST00000376061.4_Missense_Mutation_p.R17L|PDPN_ENST00000513143.1_Missense_Mutation_p.R17L|PDPN_ENST00000475043.1_Missense_Mutation_p.R17L|PDPN_ENST00000376057.4_Missense_Mutation_p.R135L|PDPN_ENST00000294489.6_Missense_Mutation_p.R135L|PDPN_ENST00000487038.1_Missense_Mutation_p.R17L					podoplanin											endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		AGCGAAGACCGCTATAAGTCT	0.498																																					p.R135L		.											.	PDPN-516	0			c.G404T						.						75.0	70.0	72.0					1																	13933776		2203	4300	6503	SO:0001583	missense	10630	exon2			AAGACCGCTATAA	AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.161G>T	1.37:g.13933776G>T	ENSP00000422977:p.Arg54Leu	112	0		100	3	NM_006474	0	0	5	5	0		Missense_Mutation	SNP	ENST00000509009.1	37		.	.	.	.	.	.	.	.	.	.	G	2.290	-0.362762	0.05103	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85	4.16	-3.37	0.04898	.	1.514050	0.03857	N	0.273274	T	0.06917	0.0176	N	0.00841	-1.15	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.0	T	0.15867	-1.0422	10	0.30078	T	0.28	-3.7547	1.9406	0.03345	0.1475:0.5587:0.1333:0.1605	.	59;17;135;135	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	L	135;135;126;54;17;17;17;17	ENSP00000294489:R135L;ENSP00000365225:R135L;ENSP00000426302:R126L;ENSP00000422977:R54L;ENSP00000365229:R17L;ENSP00000425304:R17L;ENSP00000427537:R17L;ENSP00000426063:R17L	ENSP00000294489:R135L	R	+	2	0	PDPN	13806363	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.423000	0.07034	-0.662000	0.05338	-1.175000	0.01729	CGC	.		0.498	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367736.1	NM_006474	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		15	15	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
EPHA10	284656	hgsc.bcm.edu	37	1	38227086	38227086	+	Missense_Mutation	SNP	A	A	T	rs4653328	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:38227086A>T	ENST00000373048.4	-	3	840	c.841T>A	c.(841-843)Ttc>Atc	p.F281I	EPHA10_ENST00000427468.2_Missense_Mutation_p.F281I|EPHA10_ENST00000319637.6_Missense_Mutation_p.F281I	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	281			F -> I (in dbSNP:rs4653328). {ECO:0000269|PubMed:17344846}.		ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCTTCGCAGAAGTCACCACGC	0.667													T|||	1769	0.353235	0.4402	0.3012	5008	,	,		11536	0.4831		0.2833	False		,,,				2504	0.2106				p.F281I		.											.	EPHA10-1246	0			c.T841A						.	T	ILE/PHE,ILE/PHE	1706,2604		311,1084,760	59.0	63.0	62.0		841,841	-1.5	0.8	1	dbSNP_111	62	2269,6083		305,1659,2212	yes	missense,missense	EPHA10	NM_001099439.1,NM_173641.2	21,21	616,2743,2972	TT,TA,AA		27.1671,39.5824,31.3931	benign,benign	281/1009,281/296	38227086	3975,8687	2155	4176	6331	SO:0001583	missense	284656	exon3			CGCAGAAGTCACC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.841T>A	1.37:g.38227086A>T	ENSP00000362139:p.Phe281Ile	0	0		15	6	NM_001099439	0	0	0	0	0	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	785	0.35943223443223443	208	0.42276422764227645	97	0.26795580110497236	252	0.4405594405594406	228	0.3007915567282322	T	7.996	0.754258	0.15778	0.395824	0.271671	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	D;D;T	0.97279	-4.32;-4.32;4.58	4.23	-1.55	0.08558	.	0.934531	0.08818	N	0.889212	T	0.00012	0.0000	N	0.01352	-0.895	0.09310	P	0.999999624185	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.26121	-1.0112	9	0.25751	T	0.34	.	3.9977	0.09566	0.3304:0.2198:0.0:0.4498	rs4653328;rs52814760;rs4653328	281;281	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	I	281	ENSP00000397746:F281I;ENSP00000362139:F281I;ENSP00000316395:F281I	ENSP00000316395:F281I	F	-	1	0	EPHA10	37999673	0.003000	0.15002	0.803000	0.32268	0.397000	0.30659	-0.342000	0.07801	-0.327000	0.08551	-1.255000	0.01485	TTC	A|0.665;T|0.335		0.667	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
KCNQ4	9132	bcgsc.ca	37	1	41288017	41288017	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:41288017G>T	ENST00000347132.5	+	8	1155	c.1073G>T	c.(1072-1074)aGc>aTc	p.S358I	KCNQ4_ENST00000509682.2_Missense_Mutation_p.S358I|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	358					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	ACCGATATGAGCCGGGCCTAC	0.652																																					p.S358I		.											.	KCNQ4-90	0			c.G1073T						.						78.0	71.0	74.0					1																	41288017		2203	4300	6503	SO:0001583	missense	9132	exon8			ATATGAGCCGGGC	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1073G>T	1.37:g.41288017G>T	ENSP00000262916:p.Ser358Ile	41	0		59	4	NM_004700	0	0	0	0	0	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.46|14.46	2.542765|2.542765	0.45280|0.45280	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000443478|ENST00000347132;ENST00000509682	.|D;D	.|0.98958	.|-5.27;-5.13	4.34|4.34	3.42|3.42	0.39159|0.39159	.|.	.|0.272984	.|0.47852	.|D	.|0.000217	D|D	0.97626|0.97626	0.9222|0.9222	L|L	0.56199|0.56199	1.76|1.76	0.50632|0.50632	D|D	0.999886|0.999886	.|P;D	.|0.54397	.|0.563;0.966	.|B;P	.|0.50440	.|0.233;0.641	D|D	0.96857|0.96857	0.9629|0.9629	5|10	.|0.87932	.|D	.|0	-22.9784|-22.9784	9.9624|9.9624	0.41704|0.41704	0.1004:0.0:0.8996:0.0|0.1004:0.0:0.8996:0.0	.|.	.|358;358	.|P56696-2;P56696	.|.;KCNQ4_HUMAN	D|I	253|358	.|ENSP00000262916:S358I;ENSP00000423756:S358I	.|ENSP00000262916:S358I	E|S	+|+	3|2	2|0	KCNQ4|KCNQ4	41060604|41060604	0.883000|0.883000	0.30277|0.30277	0.985000|0.985000	0.45067|0.45067	0.992000|0.992000	0.81027|0.81027	1.215000|1.215000	0.32431|0.32431	1.053000|1.053000	0.40415|0.40415	0.561000|0.561000	0.74099|0.74099	GAG|AGC	.		0.652	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	TCTEX1D4_ENST00000372200.1_Silent_p.V171V|BTBD19_ENST00000409335.2_5'Flank|BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000453418.1_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		0	0		17	9	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
FOXD3	27022	hgsc.bcm.edu	37	1	63788951	63788951	+	Silent	SNP	C	C	A	rs2274187	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:63788951C>A	ENST00000371116.2	+	1	222	c.222C>A	c.(220-222)ccC>ccA	p.P74P	RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	74					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						CTCAGCCGCCCCACCAGCAGC	0.781													c|||	590	0.117812	0.0136	0.1873	5008	,	,		7772	0.1617		0.1829	False		,,,				2504	0.0971				p.P74P	Pancreas(68;276 1750 11966 31252)	.											.	FOXD3-226	0			c.C222A						.						3.0	5.0	4.0					1																	63788951		1601	3141	4742	SO:0001819	synonymous_variant	27022	exon1			GCCGCCCCACCAG	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.222C>A	1.37:g.63788951C>A		0	0		24	14	NM_012183	0	0	0	0	0	Q9BYM2|Q9UDD1	Silent	SNP	ENST00000371116.2	37	CCDS624.1																																																																																			C|0.842;A|0.158		0.781	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
WNT2B	7482	hgsc.bcm.edu	37	1	113051909	113051909	+	Missense_Mutation	SNP	G	G	A	rs36006679	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:113051909G>A	ENST00000369684.4	+	1	510	c.25G>A	c.(25-27)Gaa>Aaa	p.E9K	WNT2B_ENST00000256640.5_Intron|WNT2B_ENST00000369686.5_Intron	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	9					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGTGCGGAGGAAGCTGCGCA	0.756													g|||	22	0.00439297	0.0008	0.0086	5008	,	,		11463	0.0		0.0129	False		,,,				2504	0.002				p.E9K		.											.	WNT2B-524	0			c.G25A						.		,LYS/GLU	13,3671		0,13,1829	5.0	6.0	5.0		,25	3.0	1.0	1	dbSNP_126	5	83,7005		0,83,3461	no	intron,missense	WNT2B	NM_004185.3,NM_024494.2	,56	0,96,5290	AA,AG,GG		1.171,0.3529,0.8912	,benign	,9/392	113051909	96,10676	1842	3544	5386	SO:0001583	missense	7482	exon1			GCGGAGGAAGCTG	AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.25G>A	1.37:g.113051909G>A	ENSP00000358698:p.Glu9Lys	1	0		24	10	NM_024494	0	0	0	0	0	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	37	CCDS847.1	10	0.004578754578754579	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	6	0.0079155672823219	g	16.81	3.226158	0.58668	0.003529	0.01171	ENSG00000134245	ENST00000369684	T	0.74842	-0.88	3.92	3.0	0.34707	.	34.200400	0.00550	N	0.000256	T	0.37100	0.0991	N	0.08118	0	0.26313	N	0.977798	B	0.06786	0.001	B	0.01281	0.0	T	0.21655	-1.0239	10	0.41790	T	0.15	.	8.7348	0.34521	0.1091:0.0:0.8909:0.0	rs36006679	9	Q93097	WNT2B_HUMAN	K	9	ENSP00000358698:E9K	ENSP00000358698:E9K	E	+	1	0	WNT2B	112853432	0.835000	0.29415	0.997000	0.53966	0.938000	0.57974	1.601000	0.36773	0.983000	0.38602	0.457000	0.33378	GAA	G|0.995;A|0.005		0.756	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	NM_004185	
GON4L	54856	broad.mit.edu	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000437809.1_Silent_p.E1528E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																					p.E1528E		.											.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.G4584A						.						35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856	exon22			TTCTTCCTCCTCT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T		36	0		31	5	NM_001037533	0	0	6	6	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GON4L	54856	broad.mit.edu	37	1	155733257	155733257	+	Silent	SNP	T	T	C	rs607834	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:155733257T>C	ENST00000368331.1	-	22	4620	c.4572A>G	c.(4570-4572)ccA>ccG	p.P1524P	GON4L_ENST00000271883.5_Silent_p.P1524P|GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000437809.1_Silent_p.P1524P	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1524	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P1524P(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cctcttcttctGGCTCAGAGT	0.488																																					p.P1524P		.											.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.A4572G						.						33.0	32.0	33.0					1																	155733257		1912	4128	6040	SO:0001819	synonymous_variant	54856	exon22			TTCTTCTGGCTCA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4572A>G	1.37:g.155733257T>C		35	0		32	6	NM_001037533	0	0	1	1	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				T|0.054;C|0.946		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
F5	2153	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169526030	169526030	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:169526030A>G	ENST00000367797.3	-	6	1007	c.806T>C	c.(805-807)aTt>aCt	p.I269T	F5_ENST00000546081.1_Missense_Mutation_p.I132T|F5_ENST00000367796.3_Missense_Mutation_p.I269T	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	269	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GTTGAAATGAATGGAGAATAA	0.512																																					p.I269T		.											.	F5-157	0			c.T806C						.						122.0	100.0	107.0					1																	169526030		2203	4300	6503	SO:0001583	missense	2153	exon6			AAATGAATGGAGA	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.806T>C	1.37:g.169526030A>G	ENSP00000356771:p.Ile269Thr	82	1		75	12	NM_000130	0	0	0	0	0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.782776	0.90282	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99129	-5.46;-5.46;-5.46	6.07	6.07	0.98685	Cupredoxin (2);	0.280633	0.40908	D	0.000985	D	0.98551	0.9516	M	0.83223	2.63	0.28853	N	0.895957	D	0.53619	0.961	P	0.47206	0.541	D	0.99236	1.0883	9	0.72032	D	0.01	-18.317	16.6277	0.84984	1.0:0.0:0.0:0.0	.	269	P12259	FA5_HUMAN	T	269;269;132	ENSP00000356771:I269T;ENSP00000356770:I269T;ENSP00000439664:I132T	ENSP00000356770:I269T	I	-	2	0	F5	167792654	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.923000	0.92808	2.330000	0.79161	0.528000	0.53228	ATT	.		0.512	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	0	0		31	21	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
KCTD3	51133	hgsc.bcm.edu	37	1	215741053	215741053	+	Missense_Mutation	SNP	T	T	G	rs2275768	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr1:215741053T>G	ENST00000259154.4	+	1	319	c.25T>G	c.(25-27)Ttc>Gtc	p.F9V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	9			F -> V (in dbSNP:rs2275768). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTGCGGCAGCTTCCCCGCGGC	0.761													T|||	1459	0.291334	0.0605	0.2291	5008	,	,		8959	0.4276		0.2853	False		,,,				2504	0.5133				p.F9V		.											.	KCTD3-93	0			c.T25G						.	T	VAL/PHE	232,2814		17,198,1308	3.0	5.0	5.0		25	1.6	0.8	1	dbSNP_100	5	1189,4951		136,917,2017	no	missense	KCTD3	NM_016121.3	50	153,1115,3325	GG,GT,TT		19.3648,7.6165,15.4692	benign	9/816	215741053	1421,7765	1523	3070	4593	SO:0001583	missense	51133	exon1			GGCAGCTTCCCCG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.25T>G	1.37:g.215741053T>G	ENSP00000259154:p.Phe9Val	1	0		19	8	NM_016121	0	0	1	2	1	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	595	0.2724358974358974	34	0.06910569105691057	93	0.2569060773480663	249	0.4353146853146853	219	0.28891820580474936	T	10.24	1.294537	0.23564	0.076165	0.193648	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.36520	1.25	2.8	1.63	0.23807	.	0.611401	0.14267	U	0.330439	T	0.00012	0.0000	L	0.27053	0.805	0.50813	P	1.0900000000002574E-4	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.001	T	0.48115	-0.9063	9	0.23891	T	0.37	-7.5445	6.7109	0.23276	0.0:0.2267:0.0:0.7733	rs2275768;rs17845401;rs17858259	9;9	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	9	ENSP00000259154:F9V	ENSP00000259154:F9V	F	+	1	0	KCTD3	213807676	0.045000	0.20229	0.833000	0.33012	0.447000	0.32167	0.628000	0.24522	0.293000	0.22520	0.254000	0.18369	TTC	T|0.721;G|0.279		0.761	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
GPRIN2	9721	ucsc.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		.											.	GPRIN2-90	0			c.G721A						.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	94	0		94	14	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.639;A|0.361		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
LIPM	340654	broad.mit.edu	37	10	90580144	90580144	+	Silent	SNP	C	C	T	rs10788615	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:90580144C>T	ENST00000404743.4	+	9	1325	c.1158C>T	c.(1156-1158)caC>caT	p.H386H	LIPM_ENST00000539337.1_Silent_p.H346H|ANKRD22_ENST00000476963.1_5'Flank	NM_001128215.1	NP_001121687.1	Q5VYY2	LIPM_HUMAN	lipase, family member M	386					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)|skin(1)	7						AATGGGCTCACGTGGATTTCA	0.493													c|||	1480	0.295527	0.0598	0.3141	5008	,	,		21390	0.4375		0.336	False		,,,				2504	0.4131				p.H386H		.											.	LIPM-69	0			c.C1158T						.	T	,	136,1248		6,124,562	178.0	142.0	153.0		1158,	-6.2	0.3	10	dbSNP_120	153	1002,2180		164,674,753	yes	coding-synonymous,utr-3	ANKRD22,LIPM	NM_001128215.1,NM_144590.2	,	170,798,1315	TT,TC,CC		31.4896,9.8266,24.9233	,	386/424,	90580144	1138,3428	692	1591	2283	SO:0001819	synonymous_variant	340654	exon9			GGCTCACGTGGAT		CCDS44457.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000173239	ENSG00000173239			23455	protein-coding gene	gene with protein product		613923	"""lipase-like, ab-hydrolase domain containing 3"""	LIPL3			Standard	NM_001128215		Approved	bA304I5.1	uc009xtm.1	Q5VYY2	OTTHUMG00000018698	ENST00000404743.4:c.1158C>T	10.37:g.90580144C>T		179	2		143	5	NM_001128215	0	0	0	0	0	A6PVS3|B2RXK7|B5MCR3	Silent	SNP	ENST00000404743.4	37	CCDS44457.1																																																																																			C|0.706;N|0.000		0.493	LIPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049261.3	XM_291663	
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	0	0		4	4	NM_182765	0	0	0	0	0	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
METTL10	399818	hgsc.bcm.edu	37	10	126480361	126480361	+	Silent	SNP	C	C	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:126480361C>G	ENST00000368836.2	-	1	78	c.42G>C	c.(40-42)gcG>gcC	p.A14A	RP11-12J10.3_ENST00000494792.1_5'Flank	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	14							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		CCGACCGCGCCGCCACCGCAG	0.726																																					p.A14A		.											.	METTL10-22	0			c.G42C						.						8.0	10.0	9.0					10																	126480361		2107	4132	6239	SO:0001819	synonymous_variant	399818	exon1			CCGCGCCGCCACC		CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.42G>C	10.37:g.126480361C>G		6	0		115	30	NM_212554	0	0	4	5	1	A8MPY7	Silent	SNP	ENST00000368836.2	37	CCDS31307.1																																																																																			.		0.726	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050884.1	NM_212554	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219036	134219036	+	Silent	SNP	G	G	A	rs11817589	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:134219036G>A	ENST00000305233.5	+	2	1091	c.1032G>A	c.(1030-1032)gaG>gaA	p.E344E	PWWP2B_ENST00000368609.4_Silent_p.E344E	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	344										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GGGACAGCGAGCACGAGCCCG	0.726													G|||	516	0.103035	0.1241	0.0908	5008	,	,		12864	0.0813		0.0875	False		,,,				2504	0.1217				p.E344E		.											.	PWWP2B-90	0			c.G1032A						.	G	,	353,3895		15,323,1786	15.0	19.0	18.0		1032,1032	4.5	0.0	10	dbSNP_120	18	549,7817		13,523,3647	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	28,846,5433	AA,AG,GG		6.5623,8.3098,7.1508	,	344/500,344/591	134219036	902,11712	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CAGCGAGCACGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1032G>A	10.37:g.134219036G>A		0	0		15	12	NM_001098637	0	0	10	10	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.909;A|0.091		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		0	0		17	13	NM_001098637	0	0	8	8	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KRTAP5-5	439915	broad.mit.edu	37	11	1651189	1651192	+	Frame_Shift_Del	DEL	CCGG	CCGG	-			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:1651189_1651192delCCGG	ENST00000399676.2	+	1	157_160	c.119_122delCCGG	c.(118-123)tccggcfs	p.SG40fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	40						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtggctccggctgtggaggc	0.716																																					p.40_41del		.											.	KRTAP5-5-23	0			c.119_122del						.																																			SO:0001589	frameshift_variant	439915	exon1			GTGGCTCCGGCTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.119_122delCCGG	11.37:g.1651189_1651192delCCGG	ENSP00000382584:p.Ser40fs	49	0		152	7	NM_001001480	0	0	0	0	0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.716	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
KRTAP5-5	439915	bcgsc.ca	37	11	1651241	1651241	+	Silent	SNP	A	A	C			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:1651241A>C	ENST00000399676.2	+	1	209	c.171A>C	c.(169-171)ggA>ggC	p.G57G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	57						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		gctgtgggggatgtggctccg	0.682																																					p.G57G		.											.	KRTAP5-5-23	0			c.A171C						.						47.0	59.0	55.0					11																	1651241		2188	4272	6460	SO:0001819	synonymous_variant	439915	exon1			TGGGGGATGTGGC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.171A>C	11.37:g.1651241A>C		108	1		121	16	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000252898.7_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	0	0		22	18	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341365	6341365	+	Silent	SNP	C	C	T	rs11544764	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:6341365C>T	ENST00000303927.3	-	1	512	c.342G>A	c.(340-342)ggG>ggA	p.G114G	PRKCDBP_ENST00000530979.1_Silent_p.G114G	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	114					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCACCAGCAGCCCGTGGTTGG	0.706													C|||	433	0.0864617	0.0416	0.0951	5008	,	,		13993	0.1438		0.1064	False		,,,				2504	0.0613				p.G114G		.											.	PRKCDBP-115	0			c.G342A						.	C		206,4012		7,192,1910	8.0	8.0	8.0		342	2.4	1.0	11	dbSNP_120	8	902,7436		53,796,3320	no	coding-synonymous	PRKCDBP	NM_145040.2		60,988,5230	TT,TC,CC		10.8179,4.8838,8.8245		114/262	6341365	1108,11448	2109	4169	6278	SO:0001819	synonymous_variant	112464	exon1			CAGCAGCCCGTGG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.342G>A	11.37:g.6341365C>T		1	0		6	6	NM_145040	0	1	6	107	100		Silent	SNP	ENST00000303927.3	37	CCDS7762.1																																																																																			C|0.902;T|0.098		0.706	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341397	6341397	+	Missense_Mutation	SNP	C	C	T	rs10839551	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:6341397C>T	ENST00000303927.3	-	1	480	c.310G>A	c.(310-312)Gcc>Acc	p.A104T	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.A104T	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	104			A -> T (in dbSNP:rs10839551).		cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGCACCTGGGCTGCGCGGCGC	0.692													C|||	28	0.00559105	0.0	0.0115	5008	,	,		14865	0.0		0.0179	False		,,,				2504	0.002				p.A104T		.											.	PRKCDBP-115	0			c.G310A						.	C	THR/ALA	22,4208		0,22,2093	6.0	7.0	7.0		310	3.8	1.0	11	dbSNP_120	7	180,8078		1,178,3950	no	missense	PRKCDBP	NM_145040.2	58	1,200,6043	TT,TC,CC		2.1797,0.5201,1.6176	possibly-damaging	104/262	6341397	202,12286	2115	4129	6244	SO:0001583	missense	112464	exon1			CCTGGGCTGCGCG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.310G>A	11.37:g.6341397C>T	ENSP00000307292:p.Ala104Thr	0	0		6	6	NM_145040	0	0	7	129	122		Missense_Mutation	SNP	ENST00000303927.3	37	CCDS7762.1	22	0.010073260073260074	0	0.0	7	0.019337016574585635	0	0.0	15	0.01978891820580475	C	22.8	4.340378	0.81911	0.005201	0.021797	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.60171	0.21;0.21	4.71	3.76	0.43208	.	0.237121	0.35349	N	0.003280	T	0.30792	0.0776	L	0.55481	1.735	0.29445	N	0.858862	P	0.40476	0.718	B	0.35971	0.215	T	0.44406	-0.9330	10	0.35671	T	0.21	-12.8243	9.9364	0.41554	0.0:0.7749:0.2251:0.0	rs10839551;rs10839551	104	Q969G5	PRDBP_HUMAN	T	104	ENSP00000307292:A104T;ENSP00000432047:A104T	ENSP00000307292:A104T	A	-	1	0	PRKCDBP	6297973	0.655000	0.27376	1.000000	0.80357	0.877000	0.50540	2.038000	0.41184	2.442000	0.82660	0.563000	0.77884	GCC	C|0.990;T|0.010		0.692	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000426618.2_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		0	0		8	5	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	0	0		22	21	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751604	+	Frame_Shift_Del	DEL	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	rs200788398|rs34153015|rs11292200|rs201940118|rs11292199	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1128_1147	c.990_1009delTGGCCCTTCGGCGTGCAGCT	c.(988-1011)cctggcccttcggcgtgcagcttgfs	p.GPSACSL331fs	B3GNT6_ENST00000354301.5_Splice_Site_p.WPFGVQL330fs|B3GNT6_ENST00000421061.1_Splice_Site_p.IGPSACS209fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.686																																					p.330_336del		.											.	.	0			c.989_1006del						.																																			SO:0001589	frameshift_variant	192134	exon4			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.990_1009delTGGCCCTTCGGCGTGCAGCT	11.37:g.76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Gly331fs	0	0		32	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.686	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
MTNR1B	4544	hgsc.bcm.edu	37	11	92702962	92702962	+	Missense_Mutation	SNP	G	G	A	rs8192552	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr11:92702962G>A	ENST00000257068.2	+	1	77	c.71G>A	c.(70-72)gGg>gAg	p.G24E		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	24			G -> E (in dbSNP:rs8192552). {ECO:0000269|PubMed:10696804}.		G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	GGCTGGTCGGGGGCTGGCAGC	0.726													G|||	325	0.0648962	0.1044	0.0461	5008	,	,		10938	0.004		0.0666	False		,,,				2504	0.0859				p.G24E		.											.	MTNR1B-522	0			c.G71A						.	G	GLU/GLY	330,3956		18,294,1831	9.0	11.0	10.0		71	0.1	0.0	11	dbSNP_117	10	595,7775		22,551,3612	no	missense	MTNR1B	NM_005959.3	98	40,845,5443	AA,AG,GG		7.1087,7.6995,7.3088	benign	24/363	92702962	925,11731	2143	4185	6328	SO:0001583	missense	4544	exon1			GGTCGGGGGCTGG	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.71G>A	11.37:g.92702962G>A	ENSP00000257068:p.Gly24Glu	1	0		27	15	NM_005959	0	0	0	0	0		Missense_Mutation	SNP	ENST00000257068.2	37	CCDS8290.1	116|116	0.05311355311355311|0.05311355311355311	49|49	0.09959349593495935|0.09959349593495935	22|22	0.06077348066298342|0.06077348066298342	0|0	0.0|0.0	45|45	0.059366754617414245|0.059366754617414245	G|G	10.83|10.83	1.462149|1.462149	0.26248|0.26248	0.076995|0.076995	0.071087|0.071087	ENSG00000134640|ENSG00000134640	ENST00000257068|ENST00000528076	T|.	0.72835|.	-0.69|.	4.36|4.36	0.122|0.122	0.14702|0.14702	.|.	0.861769|0.861769	0.09894|0.09894	N|N	0.742000|0.742000	T|T	0.00784|0.00784	0.0026|0.0026	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	P|P	0.0|0.0	B|.	0.11235|.	0.004|.	B|.	0.08055|.	0.003|.	T|T	0.21280|0.21280	-1.0250|-1.0250	9|6	0.30854|0.87932	T|D	0.27|0	-7.7002|-7.7002	4.9023|4.9023	0.13781|0.13781	0.3457:0.1574:0.497:0.0|0.3457:0.1574:0.497:0.0	rs8192552|rs8192552	24|.	P49286|.	MTR1B_HUMAN|.	E|R	24|5	ENSP00000257068:G24E|.	ENSP00000257068:G24E|ENSP00000433573:G5R	G|G	+|+	2|1	0|0	MTNR1B|MTNR1B	92342610|92342610	0.069000|0.069000	0.21087|0.21087	0.003000|0.003000	0.11579|0.11579	0.002000|0.002000	0.02628|0.02628	0.676000|0.676000	0.25247|0.25247	0.266000|0.266000	0.21894|0.21894	-0.384000|-0.384000	0.06662|0.06662	GGG|GGG	G|0.942;A|0.058		0.726	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		
APOLD1	81575	hgsc.bcm.edu	37	12	12939892	12939892	+	Missense_Mutation	SNP	G	G	A	rs4763876	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr12:12939892G>A	ENST00000326765.6	+	2	216	c.146G>A	c.(145-147)cGg>cAg	p.R49Q	APOLD1_ENST00000356591.4_Missense_Mutation_p.R18Q	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	49	Arg-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		GACGCGCTGCGGCGCTTCCAG	0.771													G|||	290	0.0579073	0.0038	0.1527	5008	,	,		11940	0.0278		0.0736	False		,,,				2504	0.0787				p.R49Q		.											.	APOLD1-91	0			c.G146A						.	G	GLN/ARG,GLN/ARG	17,1923		1,15,954	1.0	1.0	1.0		146,53	4.9	1.0	12	dbSNP_111	1	243,4437		1,241,2098	no	missense,missense	APOLD1	NM_001130415.1,NM_030817.2	43,43	2,256,3052	AA,AG,GG		5.1923,0.8763,3.9275	probably-damaging,probably-damaging	49/280,18/249	12939892	260,6360	970	2340	3310	SO:0001583	missense	81575	exon2			CGCTGCGGCGCTT	AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.146G>A	12.37:g.12939892G>A	ENSP00000324277:p.Arg49Gln	0	0		9	6	NM_001130415	0	0	0	0	0	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	37	CCDS44833.1	125	0.05723443223443223	3	0.006097560975609756	45	0.12430939226519337	16	0.027972027972027972	61	0.08047493403693931	G	21.6	4.179961	0.78564	0.008763	0.051923	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.01347	4.99;4.99	4.94	4.94	0.65067	.	0.080970	0.50627	U	0.000113	T	0.00039	0.0001	L	0.32530	0.975	0.34201	P	0.32682599999999995	P;P	0.47910	0.82;0.902	B;B	0.42959	0.21;0.403	T	0.55829	-0.8079	9	0.56958	D	0.05	-17.5552	9.1508	0.36962	0.1061:0.0:0.8939:0.0	rs4763876	18;49	A0AVN6;Q96LR9	.;APLD1_HUMAN	Q	49;18	ENSP00000324277:R49Q;ENSP00000348998:R18Q	ENSP00000324277:R49Q	R	+	2	0	APOLD1	12831159	0.996000	0.38824	0.995000	0.50966	0.635000	0.38103	2.225000	0.42954	2.454000	0.82982	0.579000	0.79373	CGG	G|0.943;A|0.057		0.771	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
ARNTL2	56938	bcgsc.ca	37	12	27553566	27553566	+	Missense_Mutation	SNP	A	A	G	rs1037921	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr12:27553566A>G	ENST00000266503.5	+	10	1037	c.1019A>G	c.(1018-1020)aAc>aGc	p.N340S	ARNTL2_ENST00000261178.5_Missense_Mutation_p.N292S|RP11-165P7.1_ENST00000500498.2_RNA|ARNTL2_ENST00000542388.1_Missense_Mutation_p.N255S|ARNTL2_ENST00000544915.1_Missense_Mutation_p.N306S|ARNTL2_ENST00000311001.5_Missense_Mutation_p.N326S|ARNTL2_ENST00000546179.1_Missense_Mutation_p.N303S|ARNTL2_ENST00000395901.2_Missense_Mutation_p.N303S			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	340			N -> S (in dbSNP:rs1037921).		circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					AAGAAAGACAACAGTAATTTT	0.383													A|||	164	0.0327476	0.0242	0.0115	5008	,	,		15831	0.001		0.0537	False		,,,				2504	0.0706				p.N340S		.											.	ARNTL2-92	0			c.A1019G						.	A	SER/ASN	106,4300	82.4+/-120.9	0,106,2097	110.0	112.0	111.0		1019	0.4	0.0	12	dbSNP_86	111	415,8185	130.2+/-188.1	7,401,3892	yes	missense	ARNTL2	NM_020183.3	46	7,507,5989	GG,GA,AA		4.8256,2.4058,4.0058	benign	340/637	27553566	521,12485	2203	4300	6503	SO:0001583	missense	56938	exon10			AAGACAACAGTAA	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.1019A>G	12.37:g.27553566A>G	ENSP00000266503:p.Asn340Ser	85	0		98	6	NM_020183	0	0	3	3	0	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	37	CCDS8712.1	68|68	0.031135531135531136|0.031135531135531136	16|16	0.032520325203252036|0.032520325203252036	7|7	0.019337016574585635|0.019337016574585635	0|0	0.0|0.0	45|45	0.059366754617414245|0.059366754617414245	A|A	0.021|0.021	-1.431239|-1.431239	0.01117|0.01117	0.024058|0.024058	0.048256|0.048256	ENSG00000029153|ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000546179;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388|ENST00000457040	T;T;T;T;T;T;T|.	0.05649|.	3.58;3.57;3.41;3.57;3.58;3.58;3.57|.	3.59|3.59	0.4|0.4	0.16331|0.16331	.|.	0.461885|.	0.25280|.	N|.	0.031806|.	T|T	0.00695|0.00695	0.0023|0.0023	N|N	0.00197|0.00197	-1.87|-1.87	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|.	0.06786|.	0.001;0.0;0.001;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.06405|.	0.002;0.0;0.002;0.002;0.001;0.0|.	T|T	0.33854|0.33854	-0.9852|-0.9852	10|5	0.07813|.	T|.	0.8|.	.|.	11.1064|11.1064	0.48205|0.48205	0.1307:0.0:0.8693:0.0|0.1307:0.0:0.8693:0.0	rs1037921;rs17414198;rs52796079;rs57238219;rs1037921|rs1037921;rs17414198;rs52796079;rs57238219;rs1037921	303;306;303;292;326;340|.	F5H402;Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1|.	.;.;.;.;.;BMAL2_HUMAN|.	S|A	306;303;303;326;292;340;255|292	ENSP00000442438:N306S;ENSP00000379238:N303S;ENSP00000438545:N303S;ENSP00000312247:N326S;ENSP00000261178:N292S;ENSP00000266503:N340S;ENSP00000445836:N255S|.	ENSP00000261178:N292S|.	N|T	+|+	2|1	0|0	ARNTL2|ARNTL2	27444833|27444833	0.991000|0.991000	0.36638|0.36638	0.001000|0.001000	0.08648|0.08648	0.916000|0.916000	0.54674|0.54674	3.930000|3.930000	0.56522|0.56522	-0.050000|-0.050000	0.13356|0.13356	-0.250000|-0.250000	0.11733|0.11733	AAC|ACA	A|0.963;G|0.037		0.383	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
FOXN4	121643	hgsc.bcm.edu	37	12	109719559	109719559	+	Missense_Mutation	SNP	C	C	T	rs61741949	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr12:109719559C>T	ENST00000299162.5	-	9	1051	c.947G>A	c.(946-948)cGc>cAc	p.R316H	FOXN4_ENST00000355216.1_Missense_Mutation_p.R136H	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	316					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						TTTGCCGGGGCGCCGGCAGCT	0.677													C|||	12	0.00239617	0.0	0.0029	5008	,	,		14376	0.0		0.008	False		,,,				2504	0.002				p.R316H		.											.	FOXN4-227	0			c.G947A						.	C	HIS/ARG	7,4293		0,7,2143	12.0	13.0	13.0		947	4.3	1.0	12	dbSNP_129	13	58,8398		0,58,4170	yes	missense	FOXN4	NM_213596.2	29	0,65,6313	TT,TC,CC		0.6859,0.1628,0.5096	possibly-damaging	316/518	109719559	65,12691	2150	4228	6378	SO:0001583	missense	121643	exon9			CCGGGGCGCCGGC	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.947G>A	12.37:g.109719559C>T	ENSP00000299162:p.Arg316His	7	0		35	13	NM_213596	0	0	0	0	0	Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	CCDS9126.2	12	0.005494505494505495	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	8	0.010554089709762533	C	15.05	2.717367	0.48622	0.001628	0.006859	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.95103	-3.61;-3.21	5.29	4.34	0.51931	.	0.197970	0.45361	D	0.000366	D	0.89118	0.6624	M	0.64997	1.995	0.38214	D	0.940559	P;P	0.40083	0.702;0.702	B;B	0.34038	0.174;0.174	D	0.90640	0.4574	10	0.40728	T	0.16	-14.0518	13.6075	0.62056	0.0:0.7211:0.2789:0.0	.	316;316	A6H901;Q96NZ1	.;FOXN4_HUMAN	H	136;316	ENSP00000347354:R136H;ENSP00000299162:R316H	ENSP00000299162:R316H	R	-	2	0	FOXN4	108203942	0.993000	0.37304	0.999000	0.59377	0.921000	0.55340	2.568000	0.45965	2.639000	0.89480	0.555000	0.69702	CGC	C|0.994;T|0.006		0.677	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735	
CCDC42B	387885	broad.mit.edu	37	12	113589762	113589762	+	Silent	SNP	A	A	G	rs61738692	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr12:113589762A>G	ENST00000335621.6	+	2	96	c.96A>G	c.(94-96)gtA>gtG	p.V32V		NM_001144872.1	NP_001138344.1	A6NFT4	CC42B_HUMAN	coiled-coil domain containing 42B	32																	TCCCACCAGTACTGCGTCTCC	0.582													G|||	134	0.0267572	0.0091	0.0447	5008	,	,		16985	0.0		0.0815	False		,,,				2504	0.0092				p.V32V		.											.	.	0			c.A96G						.	G		26,1358		0,26,666	51.0	44.0	46.0		96	1.6	0.0	12	dbSNP_129	46	174,3008		6,162,1423	no	coding-synonymous	CCDC42B	NM_001144872.1		6,188,2089	GG,GA,AA		5.4683,1.8786,4.3802		32/309	113589762	200,4366	692	1591	2283	SO:0001819	synonymous_variant	387885	exon2			ACCAGTACTGCGT		CCDS44983.1	12q24.13	2014-07-31			ENSG00000186710	ENSG00000186710			37100	protein-coding gene	gene with protein product						23569216	Standard	NM_001144872		Approved	MIA2	uc010sys.2	A6NFT4	OTTHUMG00000169655	ENST00000335621.6:c.96A>G	12.37:g.113589762A>G		62	1		93	4	NM_001144872	0	0	0	0	0		Silent	SNP	ENST00000335621.6	37	CCDS44983.1																																																																																			A|0.959;G|0.041		0.582	CCDC42B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405303.1	NM_001144872	
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	124345570	124345570	+	Missense_Mutation	SNP	C	C	T	rs372604094		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr12:124345570C>T	ENST00000409039.3	+	38	6432	c.6407C>T	c.(6406-6408)aCg>aTg	p.T2136M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2136	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T728M(1)|p.T2136M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTTGGGCTGACGACAAAGTTG	0.483																																					p.T2136M		.											.	DNAH10-95	2	Substitution - Missense(2)	large_intestine(2)	c.C6407T						.	T	MET/THR	0,3788		0,0,1894	76.0	75.0	75.0		6407	2.0	0.1	12		75	1,8231		0,1,4115	no	missense	DNAH10	NM_207437.3	81	0,1,6009	TT,TC,CC		0.0121,0.0,0.0083	benign	2136/4472	124345570	1,12019	1894	4116	6010	SO:0001583	missense	196385	exon38			GGCTGACGACAAA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6407C>T	12.37:g.124345570C>T	ENSP00000386770:p.Thr2136Met	105	0		124	8	NM_207437	0	0	0	0	0	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	T	5.742	0.321349	0.10845	0.0	1.21E-4	ENSG00000197653	ENST00000409039	T	0.39592	1.07	5.59	1.99	0.26369	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.569325	0.15863	N	0.240912	T	0.36193	0.0958	L	0.50919	1.6	0.09310	N	1	B	0.19200	0.034	B	0.22880	0.042	T	0.26950	-1.0088	10	0.46703	T	0.11	.	9.3607	0.38195	0.0:0.2687:0.0:0.7313	.	2136	Q8IVF4	DYH10_HUMAN	M	2136	ENSP00000386770:T2136M	ENSP00000386770:T2136M	T	+	2	0	DNAH10	122911523	0.996000	0.38824	0.063000	0.19743	0.382000	0.30200	2.814000	0.48010	-0.113000	0.11958	-1.062000	0.02293	ACG	.		0.483	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
C14orf39	317761	bcgsc.ca	37	14	60903757	60903757	+	Missense_Mutation	SNP	G	G	A	rs1254319	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr14:60903757G>A	ENST00000321731.3	-	18	1729	c.1570C>T	c.(1570-1572)Ctt>Ttt	p.L524F		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	524				L -> F (in Ref. 1; BAC05253). {ECO:0000305}.	multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		GGCTTCTCAAGTAAGTTTCCT	0.299													A|||	2338	0.466853	0.5182	0.2406	5008	,	,		16553	0.6944		0.3012	False		,,,				2504	0.4939				p.L524F		.											.	C14orf39-94	0			c.C1570T						.	A	PHE/LEU	2181,2225	580.0+/-385.0	541,1099,563	102.0	114.0	110.0		1570	4.0	1.0	14	dbSNP_87	110	2535,6063	688.6+/-404.3	362,1811,2126	yes	missense	C14orf39	NM_174978.2	22	903,2910,2689	AA,AG,GG		29.4836,49.5007,36.2658	benign	524/588	60903757	4716,8288	2203	4299	6502	SO:0001583	missense	317761	exon18			TCTCAAGTAAGTT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1570C>T	14.37:g.60903757G>A	ENSP00000324920:p.Leu524Phe	145	0		110	5	NM_174978	0	0	0	0	0	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	954	0.4368131868131868	243	0.49390243902439024	107	0.2955801104972376	385	0.6730769230769231	219	0.28891820580474936	A	0.031	-1.331798	0.01298	0.495007	0.294836	ENSG00000179008	ENST00000321731	T	0.15372	2.43	5.17	4.03	0.46877	.	0.103898	0.43260	N	0.000594	T	0.00012	0.0000	N	0.00104	-2.125	0.39087	P	0.03897099999999998	B	0.02656	0.0	B	0.01281	0.0	T	0.43278	-0.9401	9	0.02654	T	1	-4.4151	8.9267	0.35646	0.8474:0.0:0.1526:0.0	rs1254319;rs57641575;rs1254319	524	Q8N1H7	S6OS1_HUMAN	F	524	ENSP00000324920:L524F	ENSP00000324920:L524F	L	-	1	0	C14orf39	59973510	1.000000	0.71417	0.998000	0.56505	0.458000	0.32498	4.268000	0.58883	0.307000	0.22880	-1.266000	0.01441	CTT	G|0.588;A|0.412		0.299	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
ALDH6A1	4329	hgsc.bcm.edu;bcgsc.ca	37	14	74534125	74534125	+	Missense_Mutation	SNP	G	G	T	rs562588562		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr14:74534125G>T	ENST00000553458.1	-	8	1098	c.1000C>A	c.(1000-1002)Cca>Aca	p.P334T	AC005484.5_ENST00000492026.1_RNA|CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_Missense_Mutation_p.P51T|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.P321T	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	334					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		ACCAGCTCTGGCAGCCACTTC	0.527																																					p.P334T		.											.	ALDH6A1-90	0			c.C1000A						.						74.0	73.0	73.0					14																	74534125		2203	4300	6503	SO:0001583	missense	4329	exon8			GCTCTGGCAGCCA	M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.1000C>A	14.37:g.74534125G>T	ENSP00000450436:p.Pro334Thr	91	0		69	4	NM_005589	0	0	11	12	1	B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	ENST00000553458.1	37	CCDS9826.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337885	0.60963	.	.	ENSG00000119711	ENST00000553458;ENST00000350259;ENST00000555126	D;D;D	0.90788	-2.73;-2.73;-2.73	5.5	4.61	0.57282	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.101231	0.64402	N	0.000001	D	0.91573	0.7338	M	0.78801	2.425	0.80722	D	1	B;B	0.23735	0.09;0.09	B;B	0.32724	0.151;0.151	D	0.90385	0.4391	10	0.62326	D	0.03	.	15.9755	0.80060	0.0:0.0:0.8646:0.1354	.	321;334	B4DFS8;Q02252	.;MMSA_HUMAN	T	334;321;51	ENSP00000450436:P334T;ENSP00000342564:P321T;ENSP00000452081:P51T	ENSP00000342564:P334T	P	-	1	0	ALDH6A1	73603878	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.792000	0.85828	1.549000	0.49425	0.655000	0.94253	CCA	.		0.527	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412309.1		
RIN3	79890	hgsc.bcm.edu	37	14	93154540	93154540	+	Silent	SNP	C	C	T	rs71461983|rs570458246|rs68153141|rs71698059	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr14:93154540C>T	ENST00000216487.7	+	10	3060	c.2901C>T	c.(2899-2901)ggC>ggT	p.G967G	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	967	Poly-Gly.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				ACGGTGGTGGCGGCGGCGGCG	0.736													-|||	66	0.0131789	0.0068	0.0159	5008	,	,		9928	0.0099		0.0298	False		,,,				2504	0.0061				p.G967G		.											.	RIN3-522	0			c.C2901T						.						5.0	7.0	7.0					14																	93154540		1961	3940	5901	SO:0001819	synonymous_variant	79890	exon10			TGGTGGCGGCGGC	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.2901C>T	14.37:g.93154540C>T		2	0		73	38	NM_024832	0	0	25	41	16	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Silent	SNP	ENST00000216487.7	37	CCDS32144.1																																																																																			C|0.974;T|0.026		0.736	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
LGMN	5641	bcgsc.ca	37	14	93170993	93170993	+	Silent	SNP	C	C	T	rs9791	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr14:93170993C>T	ENST00000393218.2	-	14	1588	c.1251G>A	c.(1249-1251)ccG>ccA	p.P417P	LGMN_ENST00000557434.1_Silent_p.P360P|LGMN_ENST00000555699.1_Intron|LGMN_ENST00000334869.4_Silent_p.P417P	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	417					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		ACCTGTGAAGCGGATACGGCT	0.473													C|||	1412	0.281949	0.2678	0.5519	5008	,	,		20858	0.0754		0.4245	False		,,,				2504	0.1759				p.P417P		.											.	LGMN-91	0			c.G1251A						.	C	,	1264,3142	432.6+/-343.3	185,894,1124	188.0	179.0	182.0		1251,1251	-10.0	0.0	14	dbSNP_52	182	3540,5060	514.7+/-378.4	722,2096,1482	no	coding-synonymous,coding-synonymous	LGMN	NM_001008530.2,NM_005606.6	,	907,2990,2606	TT,TC,CC		41.1628,28.6882,36.9368	,	417/434,417/434	93170993	4804,8202	2203	4300	6503	SO:0001819	synonymous_variant	5641	exon13			GTGAAGCGGATAC	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.1251G>A	14.37:g.93170993C>T		218	1		221	10	NM_005606	0	0	0	0	0	O00123|Q86TV2|Q86TV3|Q9BTY1	Silent	SNP	ENST00000393218.2	37	CCDS9904.1																																																																																			C|0.681;T|0.319		0.473	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606	
CEP170B	283638	ucsc.edu	37	14	105349388	105349388	+	Silent	SNP	A	A	C	rs2028414	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr14:105349388A>C	ENST00000414716.3	+	8	822	c.594A>C	c.(592-594)ccA>ccC	p.P198P	CEP170B_ENST00000453495.1_Silent_p.P199P|CEP170B_ENST00000556508.1_Silent_p.P128P|CEP170B_ENST00000418279.1_Silent_p.P128P	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	198						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CCAAGGGACCAGTGCAGCAGG	0.672													g|||	2589	0.516973	0.5174	0.5865	5008	,	,		12916	0.2302		0.669	False		,,,				2504	0.6063				p.P198P		.											.	.	0			c.A594C						.		,	2039,1829		591,857,486	5.0	7.0	7.0		594,384	-5.3	0.0	14	dbSNP_94	7	5324,2774		1859,1606,584	no	coding-synonymous,coding-synonymous	KIAA0284	NM_001112726.2,NM_015005.2	,	2450,2463,1070	CC,CA,AA		34.2554,47.2854,38.4673	,	198/1555,128/1520	105349388	7363,4603	1934	4049	5983	SO:0001819	synonymous_variant	283638	exon8			GGGACCAGTGCAG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.594A>C	14.37:g.105349388A>C		10	0		53	19	NM_001112726	0	0	0	0	0	Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	37	CCDS45175.1																																																																																			A|0.511;C|0.489		0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
PHGR1	644844	hgsc.bcm.edu	37	15	40648372	40648372	+	Silent	SNP	T	T	C	rs12900982		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr15:40648372T>C	ENST00000448599.2	+	4	173	c.117T>C	c.(115-117)ggT>ggC	p.G39G	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	39	Gly-rich.																CCCACCATGGTCCAGGGCCCT	0.776																																					p.G39G		.											.	.	0			c.T117C						.						1.0	2.0	2.0					15																	40648372		356	1106	1462	SO:0001819	synonymous_variant	644844	exon3			CCATGGTCCAGGG		CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.117T>C	15.37:g.40648372T>C		4	0		31	14	NM_001145643	0	0	0	0	0		Silent	SNP	ENST00000448599.2	37	CCDS45225.1																																																																																			T|0.839;C|0.161		0.776	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418450.1	NM_001145643	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	NME3_ENST00000219302.3_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		7	5	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		14	14	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599659	88599659	+	Missense_Mutation	SNP	G	G	T	rs71395304	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:88599659G>T	ENST00000319555.3	+	10	1615	c.1293G>T	c.(1291-1293)aaG>aaT	p.K431N	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	431					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		TGGACAGAAAGGCCCTGGCCG	0.721													G|||	612	0.122204	0.0091	0.1398	5008	,	,		9175	0.3294		0.0915	False		,,,				2504	0.0808				p.K431N	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.G1293T						.	G	ASN/LYS	61,3871		0,61,1905	4.0	5.0	4.0		1293	-1.2	0.1	16	dbSNP_130	4	544,7434		10,524,3455	yes	missense	ZFPM1	NM_153813.2	94	10,585,5360	TT,TG,GG		6.8188,1.5514,5.0798	probably-damaging	431/1007	88599659	605,11305	1966	3989	5955	SO:0001583	missense	161882	exon10			CAGAAAGGCCCTG	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1293G>T	16.37:g.88599659G>T	ENSP00000326630:p.Lys431Asn	0	0		25	25	NM_153813	0	0	0	0	0		Missense_Mutation	SNP	ENST00000319555.3	37	CCDS32502.1	308	0.14102564102564102	9	0.018292682926829267	49	0.13535911602209943	192	0.3356643356643357	58	0.07651715039577836	G	10.12	1.262467	0.23051	0.015514	0.068188	ENSG00000179588	ENST00000319555	T	0.08008	3.14	3.39	-1.17	0.09648	.	1.163550	0.06454	U	0.728227	T	0.00012	0.0000	L	0.60455	1.87	0.40357	P	0.02080599999999999	D	0.69078	0.997	P	0.57911	0.829	T	0.41161	-0.9524	9	0.42905	T	0.14	-7.9024	6.4423	0.21856	0.5249:0.0:0.4751:0.0	.	431	Q8IX07	FOG1_HUMAN	N	431	ENSP00000326630:K431N	ENSP00000326630:K431N	K	+	3	2	ZFPM1	87127160	0.522000	0.26266	0.089000	0.20774	0.599000	0.36880	0.335000	0.19806	-0.105000	0.12132	0.289000	0.19496	AAG	G|0.858;T|0.142		0.721	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		17	14	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		17	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		16	14	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		15	14	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	C17orf97_ENST00000360127.6_Silent_p.L17L|AC108004.3_ENST00000466740.2_RNA|AC108004.3_ENST00000599026.1_RNA			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		0	0		28	18	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
PRPF8	10594	hgsc.bcm.edu	37	17	1553040	1553040	+	IGR	SNP	C	C	T	rs200942821	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:1553040C>T	ENST00000572621.1	-	0	7445				RILP_ENST00000301336.6_Missense_Mutation_p.G20E|PRPF8_ENST00000575116.1_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CGATGCCGACCCCGCGGCCTC	0.756													C|||	2	0.000399361	0.0	0.0014	5008	,	,		10667	0.0		0.001	False		,,,				2504	0.0				p.G20E		.											.	RILP-91	0			c.G59A						.		GLU/GLY	0,3554		0,0,1777	4.0	6.0	5.0		59	2.6	0.7	17		5	8,7568		0,8,3780	yes	missense	RILP	NM_031430.2	98	0,8,5557	TT,TC,CC		0.1056,0.0,0.0719	probably-damaging	20/402	1553040	8,11122	1777	3788	5565	SO:0001628	intergenic_variant	83547	exon1			GCCGACCCCGCGG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553		17.37:g.1553040C>T		0	0		10	5	NM_031430	0	0	0	1	1	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	18.90	3.722227	0.68959	0.0	0.001056	ENSG00000167705	ENST00000301336	T	0.30714	1.52	4.71	2.64	0.31445	.	0.474604	0.20255	N	0.095987	T	0.17959	0.0431	L	0.29908	0.895	0.09310	N	1	B	0.24963	0.115	B	0.23419	0.046	T	0.15838	-1.0423	10	0.21540	T	0.41	-1.6255	5.5927	0.17309	0.1218:0.6173:0.1774:0.0835	.	20	Q96NA2	RILP_HUMAN	E	20	ENSP00000301336:G20E	ENSP00000301336:G20E	G	-	2	0	RILP	1499790	0.313000	0.24554	0.652000	0.29579	0.135000	0.20990	1.374000	0.34283	0.965000	0.38133	0.186000	0.17326	GGG	.		0.756	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
PRPF8	10594	broad.mit.edu	37	17	1583078	1583078	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:1583078G>T	ENST00000572621.1	-	8	1379	c.1114C>A	c.(1114-1116)Ccg>Acg	p.P372T	PRPF8_ENST00000304992.6_Missense_Mutation_p.P372T			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	372					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCATCATCCGGCAATGGTTCC	0.507																																					p.P372T		.											.	PRPF8-525	0			c.C1114A						.						131.0	134.0	133.0					17																	1583078		2203	4300	6503	SO:0001583	missense	10594	exon9			CATCCGGCAATGG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1114C>A	17.37:g.1583078G>T	ENSP00000460348:p.Pro372Thr	108	0		83	2	NM_006445	0	0	3	3	0	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835020	0.71373	.	.	ENSG00000174231	ENST00000304992	T	0.79141	-1.24	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.71962	0.3402	L	0.44542	1.39	0.80722	D	1	B	0.21905	0.062	B	0.15484	0.013	T	0.65940	-0.6046	10	0.15066	T	0.55	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	372	Q6P2Q9	PRP8_HUMAN	T	372	ENSP00000304350:P372T	ENSP00000304350:P372T	P	-	1	0	PRPF8	1529828	1.000000	0.71417	0.972000	0.41901	0.989000	0.77384	9.835000	0.99442	2.769000	0.95229	0.655000	0.94253	CCG	.		0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		5	5	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
GIT1	28964	bcgsc.ca	37	17	27904711	27904711	+	Silent	SNP	G	G	A	rs11080105	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:27904711G>A	ENST00000225394.3	-	10	1181	c.933C>T	c.(931-933)gcC>gcT	p.A311A	RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000394869.3_Silent_p.A320A|GIT1_ENST00000579937.1_Silent_p.A311A|GIT1_ENST00000581348.1_Silent_p.A320A	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	311	ARHGEF6-binding. {ECO:0000250}.|PTK2/FAK1-binding. {ECO:0000250}.				regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		GGAAGGGCACGGCACTGCGCT	0.642													G|||	1933	0.385982	0.0673	0.3876	5008	,	,		17951	0.6845		0.4284	False		,,,				2504	0.4642				p.A320A	Colon(81;41 1719 20078 35068)	.											.	GIT1-251	0			c.C960T						.	G	,	570,3836	254.6+/-260.1	40,490,1673	116.0	100.0	105.0		960,933	-8.7	0.9	17	dbSNP_120	105	3702,4898	528.6+/-381.4	807,2088,1405	no	coding-synonymous,coding-synonymous	GIT1	NM_001085454.1,NM_014030.3	,	847,2578,3078	AA,AG,GG		43.0465,12.9369,32.8464	,	320/771,311/762	27904711	4272,8734	2203	4300	6503	SO:0001819	synonymous_variant	28964	exon11			GGGCACGGCACTG	AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.933C>T	17.37:g.27904711G>A		143	1		106	6	NM_001085454	0	0	11	11	0	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Silent	SNP	ENST00000225394.3	37	CCDS11250.1																																																																																			G|0.638;A|0.362		0.642	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1	NM_014030	
KRTAP4-3	85290	ucsc.edu;bcgsc.ca	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		.											.	KRTAP4-3-22	0			c.A92T						.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	168	3		225	42	NM_033187	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
SDK2	54549	broad.mit.edu	37	17	71386527	71386527	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:71386527C>A	ENST00000392650.3	-	29	4091	c.4091G>T	c.(4090-4092)gGc>gTc	p.G1364V	SDK2_ENST00000388726.3_Missense_Mutation_p.G1364V	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1364	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G1364V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGGCTTGAGGCCCGTGGCTGT	0.647																																					p.G1364V		.											.	SDK2-24	1	Substitution - Missense(1)	lung(1)	c.G4091T						.						53.0	36.0	42.0					17																	71386527		2202	4300	6502	SO:0001583	missense	54549	exon29			TTGAGGCCCGTGG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4091G>T	17.37:g.71386527C>A	ENSP00000376421:p.Gly1364Val	120	3		137	9	NM_001144952	0	0	0	0	0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730660	0.48939	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.62232	0.04;0.04;0.04	5.2	5.2	0.72013	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.220962	0.47455	D	0.000221	T	0.81758	0.4890	M	0.91406	3.205	0.80722	D	1	P;P;P	0.37985	0.598;0.613;0.559	B;P;P	0.56648	0.426;0.803;0.703	D	0.84091	0.0390	10	0.59425	D	0.04	.	14.0134	0.64511	0.0:0.8484:0.1516:0.0	.	1364;1364;1364	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	V	988;1364;1364;540;1364	ENSP00000376421:G1364V;ENSP00000373378:G1364V;ENSP00000407098:G540V	ENSP00000324967:G1364V	G	-	2	0	SDK2	68898122	0.020000	0.18652	0.997000	0.53966	0.109000	0.19521	1.021000	0.30040	2.430000	0.82344	0.561000	0.74099	GGC	.		0.647	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
NPTX1	4884	hgsc.bcm.edu	37	17	78449948	78449948	+	Missense_Mutation	SNP	C	C	T	rs144443274	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr17:78449948C>T	ENST00000306773.4	-	1	456	c.299G>A	c.(298-300)gGc>gAc	p.G100D	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	100					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			ccgggcctcgccggcTCCGGG	0.721													C|||	393	0.0784744	0.0091	0.098	5008	,	,		6949	0.0238		0.173	False		,,,				2504	0.1176				p.G100D		.											.	NPTX1-90	0			c.G299A						.	C	ASP/GLY	146,4108		4,138,1985	11.0	15.0	14.0		299	2.1	1.0	17	dbSNP_134	14	1445,6809		128,1189,2810	no	missense	NPTX1	NM_002522.3	94	132,1327,4795	TT,TC,CC		17.5067,3.4321,12.7199	benign	100/433	78449948	1591,10917	2127	4127	6254	SO:0001583	missense	4884	exon1			GCCTCGCCGGCTC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.299G>A	17.37:g.78449948C>T	ENSP00000307549:p.Gly100Asp	0	0		18	12	NM_002522	0	0	0	0	0	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	196	0.08974358974358974	6	0.012195121951219513	42	0.11602209944751381	10	0.017482517482517484	138	0.1820580474934037	C	14.35	2.508706	0.44660	0.034321	0.175067	ENSG00000171246	ENST00000306773	T	0.10382	2.88	3.44	2.11	0.27256	.	0.738536	0.13049	N	0.417861	T	0.00012	0.0000	N	0.14661	0.345	0.34958	P	0.24807100000000004	P	0.43287	0.802	B	0.35413	0.202	T	0.37174	-0.9717	9	0.15066	T	0.55	-13.6643	4.112	0.10063	0.0:0.5355:0.2155:0.249	.	100	Q15818	NPTX1_HUMAN	D	100	ENSP00000307549:G100D	ENSP00000307549:G100D	G	-	2	0	NPTX1	76064543	0.996000	0.38824	0.994000	0.49952	0.971000	0.66376	1.864000	0.39469	1.482000	0.48325	0.484000	0.47621	GGC	C|0.910;T|0.090		0.721	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	T	-	rs11571510|rs557543525|rs202189171	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr18:3452223delT	ENST00000330513.5	+	1	549	c.246delT	c.(244-246)cctfs	p.P85fs	TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000577543.1_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	85					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P83fs*51(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													T|T|-|deletion	1280	0.255591	0.3419	0.2349	5008	,	,		10884	0.0109		0.4304	False		,,,				2504	0.226				p.P82fs		.											.	TGIF1-227	1	Deletion - Frameshift(1)	large_intestine(1)	c.246delT						.						10.0	11.0	10.0					18																	3452223		2031	3818	5849	SO:0001589	frameshift_variant	7050	exon1			CCCCCCTCCTCCA	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.246delT	18.37:g.3452223delT	ENSP00000327959:p.Pro85fs	6	0		47	18	NM_170695	0	0	0	0	0	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Del	DEL	ENST00000330513.5	37	CCDS11834.1																																																																																			.		0.766	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000585159.1_Silent_p.P25P	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		0	0		9	9	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
POLRMT	5442	hgsc.bcm.edu	37	19	621561	621561	+	Missense_Mutation	SNP	C	C	A	rs10421235	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:621561C>A	ENST00000588649.2	-	10	2221	c.2137G>T	c.(2137-2139)Gtg>Ttg	p.V713L	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	713					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCCAGCACGCGCCCGTTG	0.741													C|||	677	0.135184	0.2254	0.0461	5008	,	,		10089	0.0764		0.0258	False		,,,				2504	0.2495				p.V713L		.											.	POLRMT-92	0			c.G2137T						.	C	LEU/VAL	447,3185		14,419,1383	4.0	3.0	3.0		2137	2.1	0.5	19	dbSNP_119	3	143,6993		2,139,3427	no	missense	POLRMT	NM_005035.3	32	16,558,4810	AA,AC,CC		2.0039,12.3073,5.4792	benign	713/1231	621561	590,10178	1816	3568	5384	SO:0001583	missense	5442	exon10			CCAGCACGCGCCC		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.2137G>T	19.37:g.621561C>A	ENSP00000465759:p.Val713Leu	0	0		27	13	NM_005035	0	0	3	5	2	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	179	0.08195970695970696	98	0.1991869918699187	23	0.06353591160220995	41	0.07167832167832168	17	0.022427440633245383	.	1.831	-0.469877	0.04445	0.123073	0.020039	ENSG00000099821	ENST00000215591	T	0.41400	1.0	4.38	2.07	0.26955	DNA-directed RNA polymerase, helix hairpin domain (1);	0.337088	0.28971	N	0.013545	T	0.00039	0.0001	L	0.28274	0.84	0.40284	P	0.021571000000000007	B	0.21520	0.057	B	0.21708	0.036	T	0.23226	-1.0194	9	0.10636	T	0.68	-21.1616	7.9361	0.29931	0.0:0.4845:0.4232:0.0923	rs10421235	713	O00411	RPOM_HUMAN	L	713	ENSP00000215591:V713L	ENSP00000215591:V713L	V	-	1	0	POLRMT	572561	0.015000	0.18098	0.490000	0.27465	0.466000	0.32739	0.069000	0.14552	0.409000	0.25649	0.455000	0.32223	GTG	C|0.918;A|0.082		0.741	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
PLPPR3	79948	hgsc.bcm.edu	37	19	813220	813220	+	Missense_Mutation	SNP	T	T	C	rs351994	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:813220T>C	ENST00000520876.3	-	8	1585	c.1507A>G	c.(1507-1509)Acg>Gcg	p.T503A	LPPR3_ENST00000359894.2_Missense_Mutation_p.T531A|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		503						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										CCGGCCCCCGTCTGCGCGCCC	0.781													t|||	1480	0.295527	0.6687	0.2378	5008	,	,		6132	0.0456		0.1809	False		,,,				2504	0.2076				p.T531A		.											.	.	0			c.A1591G						.		ALA/THR	929,1563		175,579,492	3.0	4.0	3.0		1591	3.2	0.0	19	dbSNP_79	3	716,5684		57,602,2541	no	missense	LPPR3	NM_024888.1	58	232,1181,3033	CC,CT,TT		11.1875,37.2793,18.4998	benign	531/747	813220	1645,7247	1246	3200	4446	SO:0001583	missense	0	exon7			CCCCCGTCTGCGC																												ENST00000520876.3:c.1507A>G	19.37:g.813220T>C	ENSP00000430297:p.Thr503Ala	0	0		6	6	NM_024888	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	37	CCDS58636.1	544	0.2490842490842491	314	0.6382113821138211	79	0.21823204419889503	23	0.04020979020979021	128	0.16886543535620052	t	0.011	-1.724891	0.00694	0.372793	0.111875	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876	T;T	0.21191	2.02;2.02	3.16	3.16	0.36331	.	0.447280	0.20568	N	0.089784	T	0.00012	0.0000	N	0.04959	-0.14	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.42649	-0.9439	9	0.02654	T	1	0.0067	10.0419	0.42164	0.0:0.8946:0.0:0.1054	rs351994	504;503;531	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	A	504;531;503	ENSP00000352962:T531A;ENSP00000430297:T503A	ENSP00000300947:T504A	T	-	1	0	AC006273.1	764220	0.346000	0.24844	0.022000	0.16811	0.404000	0.30871	1.300000	0.33436	0.640000	0.30582	-0.764000	0.03450	ACG	T|0.751;C|0.249		0.781	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		5	5	NM_005224	0	0	0	3	3	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000453954.2_Silent_p.G352G|TCF3_ENST00000344749.5_Silent_p.G436G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		2	0		17	14	NM_003200	0	0	9	9	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S|TCF3_ENST00000344749.5_Silent_p.S434S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		1	0		18	14	NM_003200	0	0	6	6	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619348	1619348	+	Silent	SNP	G	G	A	rs386805766|rs1052696	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:1619348G>A	ENST00000262965.5	-	15	1637	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.G380G|TCF3_ENST00000588136.1_Silent_p.G431G|TCF3_ENST00000453954.2_Silent_p.G347G|TCF3_ENST00000344749.5_Silent_p.G431G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACATGGGGCCGGTGAAAC	0.736			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	536	0.107029	0.0371	0.0432	5008	,	,		13774	0.254		0.0706	False		,,,				2504	0.1329				p.G431G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1293T						.	G	,	155,4211		3,149,2031	13.0	15.0	14.0		1293,1293	-0.6	0.1	19	dbSNP_86	14	512,7976		18,476,3750	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	21,625,5781	AA,AG,GG		6.032,3.5502,5.189	,	431/652,431/655	1619348	667,12187	2183	4244	6427	SO:0001819	synonymous_variant	6929	exon15			CATGGGGCCGGTG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1293C>T	19.37:g.1619348G>A		1	0		16	12	NM_003200	0	0	8	8	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.903;A|0.097		0.736	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619350	1619350	+	Missense_Mutation	SNP	C	C	T	rs386805766|rs1052692	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:1619350C>T	ENST00000262965.5	-	15	1635	c.1291G>A	c.(1291-1293)Ggc>Agc	p.G431S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Missense_Mutation_p.G380S|TCF3_ENST00000588136.1_Missense_Mutation_p.G431S|TCF3_ENST00000453954.2_Missense_Mutation_p.G347S|TCF3_ENST00000344749.5_Missense_Mutation_p.G431S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATGGGGCCGGTGAAACCT	0.741			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	564	0.11262	0.056	0.0476	5008	,	,		13830	0.254		0.0716	False		,,,				2504	0.1319				p.G431S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.G1291A						.	C	SER/GLY,SER/GLY	215,4155		5,205,1975	13.0	15.0	14.0		1291,1291	-0.7	0.0	19	dbSNP_86	14	530,7974		19,492,3741	yes	missense,missense	TCF3	NM_001136139.2,NM_003200.3	56,56	24,697,5716	TT,TC,CC		6.2324,4.9199,5.7869	benign,benign	431/652,431/655	1619350	745,12129	2185	4252	6437	SO:0001583	missense	6929	exon15			TGGGGCCGGTGAA	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1291G>A	19.37:g.1619350C>T	ENSP00000262965:p.Gly431Ser	1	0		16	12	NM_003200	0	0	8	8	0	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	CCDS12074.1	219	0.10027472527472528	18	0.036585365853658534	14	0.03867403314917127	142	0.24825174825174826	45	0.059366754617414245	C	11.78	1.740783	0.30865	0.049199	0.062324	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423	T;T;T	0.57907	0.37;0.37;0.37	4.29	-0.72	0.11195	.	0.354219	0.29342	N	0.012425	T	0.00012	0.0000	L	0.48260	1.515	0.80722	P	0.0	B;P;B;B	0.38827	0.304;0.649;0.048;0.085	B;B;B;B	0.26416	0.056;0.069;0.014;0.011	T	0.18999	-1.0319	9	0.23891	T	0.37	-16.7082	4.654	0.12608	0.1526:0.572:0.0:0.2754	rs1052692;rs3170423	431;431;380;368	P15923-2;P15923;Q2TB39;Q6PJU3	.;TFE2_HUMAN;.;.	S	431;431;431;380	ENSP00000262965:G431S;ENSP00000344375:G431S;ENSP00000378813:G380S	ENSP00000262965:G431S	G	-	1	0	TCF3	1570350	0.000000	0.05858	0.031000	0.17742	0.007000	0.05969	-1.118000	0.03280	0.264000	0.21851	-0.258000	0.10820	GGC	C|0.901;T|0.099		0.741	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
DOT1L	84444	hgsc.bcm.edu	37	19	2220170	2220170	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:2220170G>T	ENST00000398665.3	+	23	2791	c.2755G>T	c.(2755-2757)Ggt>Tgt	p.G919C		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	919					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAAGCAGATTGGTGCTAATGC	0.642																																					p.G919C		.											.	DOT1L-132	0			c.G2755T						.						51.0	59.0	57.0					19																	2220170		2035	4176	6211	SO:0001583	missense	84444	exon23			CAGATTGGTGCTA	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2755G>T	19.37:g.2220170G>T	ENSP00000381657:p.Gly919Cys	102	0		80	4	NM_032482	0	0	4	4	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.962105|3.962105	0.74016|0.74016	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|.	0.27256|.	1.68|.	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	0.269957|.	0.31709|.	N|.	0.007183|.	T|T	0.71409|0.71409	0.3336|0.3336	M|M	0.61703|0.61703	1.905|1.905	0.39183|0.39183	D|D	0.96281|0.96281	D;D|.	0.76494|.	0.999;0.996|.	D;P|.	0.63957|.	0.92;0.875|.	T|T	0.73414|0.73414	-0.3990|-0.3990	10|5	0.87932|.	D|.	0|.	-7.4362|-7.4362	16.4679|16.4679	0.84090|0.84090	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	919;919|.	Q8TEK3;Q8TEK3-2|.	DOT1L_HUMAN;.|.	C|F	919|705	ENSP00000381657:G919C|.	ENSP00000221482:G919C|.	G|L	+|+	1|3	0|2	DOT1L|DOT1L	2171170|2171170	1.000000|1.000000	0.71417|0.71417	0.543000|0.543000	0.28128|0.28128	0.949000|0.949000	0.60115|0.60115	2.492000|2.492000	0.45311|0.45311	2.122000|2.122000	0.65172|0.65172	0.462000|0.462000	0.41574|0.41574	GGT|TTG	.		0.642	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
PLIN5	440503	hgsc.bcm.edu	37	19	4531658	4531658	+	Silent	SNP	G	G	A	rs138772557	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:4531658G>A	ENST00000381848.3	-	3	317	c.237C>T	c.(235-237)ctC>ctT	p.L79L	CTB-50L17.14_ENST00000586020.1_3'UTR	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	79	Essential for lipid droplet targeting. {ECO:0000250}.|Interaction with LIPE. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GCAGGTGCTCGAGCAGCGGCT	0.716													G|||	33	0.00658946	0.0	0.0014	5008	,	,		14487	0.001		0.0099	False		,,,				2504	0.0215				p.L79L		.											.	PLIN5-22	0			c.C237T						.	G		5,4039		0,5,2017	4.0	8.0	7.0		237	-2.3	0.8	19	dbSNP_134	7	45,8015		0,45,3985	no	coding-synonymous	PLIN5	NM_001013706.2		0,50,6002	AA,AG,GG		0.5583,0.1236,0.4131		79/464	4531658	50,12054	2022	4030	6052	SO:0001819	synonymous_variant	440503	exon3			GTGCTCGAGCAGC	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.237C>T	19.37:g.4531658G>A		7	0		104	54	NM_001013706	0	0	1	1	0	A2RRC1|Q6ZS68	Silent	SNP	ENST00000381848.3	37	CCDS42473.1																																																																																			G|0.998;A|0.002		0.716	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
OR7G1	125962	bcgsc.ca	37	19	9225685	9225685	+	Missense_Mutation	SNP	T	T	C	rs2195951	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:9225685T>C	ENST00000541538.1	-	1	754	c.755A>G	c.(754-756)tAt>tGt	p.Y252C	OR7G1_ENST00000293614.1_Missense_Mutation_p.Y252C	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	252			Y -> C (in dbSNP:rs2195951).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						AGCTGTCCCATAGAACAAGGA	0.453													T|||	1690	0.33746	0.5953	0.1354	5008	,	,		18925	0.3254		0.1918	False		,,,				2504	0.2945				p.Y252C		.											.	OR7G1-70	0			c.A755G						.	T	CYS/TYR	2314,2092	603.3+/-390.1	591,1132,480	99.0	95.0	97.0		755	2.6	0.6	19	dbSNP_96	97	1490,7110	281.7+/-295.2	125,1240,2935	yes	missense	OR7G1	NM_001005192.2	194	716,2372,3415	CC,CT,TT		17.3256,47.4807,29.248	probably-damaging	252/312	9225685	3804,9202	2203	4300	6503	SO:0001583	missense	125962	exon1			GTCCCATAGAACA		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.755A>G	19.37:g.9225685T>C	ENSP00000444134:p.Tyr252Cys	112	0		82	4	NM_001005192	0	0	0	0	0	Q6IFJ5|Q96RA1	Missense_Mutation	SNP	ENST00000541538.1	37	CCDS32898.2	647	0.29624542124542125	286	0.5813008130081301	44	0.12154696132596685	180	0.3146853146853147	137	0.18073878627968337	t	9.824	1.186540	0.21870	0.525193	0.173256	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.41758	0.99;0.99	3.78	2.63	0.31362	GPCR, rhodopsin-like superfamily (1);	0.227928	0.22228	U	0.062851	T	0.00012	0.0000	M	0.93016	3.37	0.80722	P	0.0	P	0.35944	0.529	B	0.40477	0.33	T	0.47774	-0.9091	9	0.72032	D	0.01	.	7.687	0.28546	0.2556:0.0:0.0:0.7444	rs2195951;rs52813886;rs61268819;rs2195951	252	Q8NGA0	OR7G1_HUMAN	C	252	ENSP00000293614:Y252C;ENSP00000444134:Y252C	ENSP00000293614:Y252C	Y	-	2	0	OR7G1	9086685	0.000000	0.05858	0.570000	0.28473	0.291000	0.27294	-0.114000	0.10757	1.700000	0.51204	0.410000	0.27636	TAT	T|0.690;C|0.310		0.453	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1		
KLF1	10661	hgsc.bcm.edu	37	19	12996500	12996500	+	Missense_Mutation	SNP	A	A	G	rs2072596	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:12996500A>G	ENST00000264834.4	-	2	584	c.544T>C	c.(544-546)Ttc>Ctc	p.F182L	CTD-2265O21.7_ENST00000592400.1_RNA	NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	182	Pro-rich.		F -> L (in dbSNP:rs2072596).		cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCGCGGGAAGTAGCCACCC	0.756													A|||	248	0.0495208	0.0893	0.0418	5008	,	,		11213	0.0169		0.0487	False		,,,				2504	0.0358				p.F182L		.											.	KLF1-90	0			c.T544C						.	A	LEU/PHE	63,1723		0,63,830	1.0	2.0	1.0		544	4.2	0.3	19	dbSNP_96	1	89,4453		0,89,2182	no	missense	KLF1	NM_006563.3	22	0,152,3012	GG,GA,AA		1.9595,3.5274,2.402	benign	182/363	12996500	152,6176	893	2271	3164	SO:0001583	missense	10661	exon2			GCGGGAAGTAGCC	U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.544T>C	19.37:g.12996500A>G	ENSP00000264834:p.Phe182Leu	2	0		6	5	NM_006563	0	0	0	0	0	Q6PIJ5|Q92899	Missense_Mutation	SNP	ENST00000264834.4	37	CCDS12285.1	118	0.05402930402930403	57	0.11585365853658537	14	0.03867403314917127	13	0.022727272727272728	34	0.044854881266490766	A	12.97	2.096307	0.36952	0.035274	0.019595	ENSG00000105610	ENST00000264834	T	0.11277	2.79	4.25	4.25	0.50352	.	0.321368	0.22866	N	0.054687	T	0.00109	0.0003	L	0.29908	0.895	0.80722	P	0.0	P	0.42409	0.779	B	0.37989	0.262	T	0.34104	-0.9842	9	0.10111	T	0.7	.	11.3611	0.49644	1.0:0.0:0.0:0.0	rs2072596	182	Q13351	KLF1_HUMAN	L	182	ENSP00000264834:F182L	ENSP00000264834:F182L	F	-	1	0	KLF1	12857500	0.001000	0.12720	0.341000	0.25589	0.086000	0.17979	0.988000	0.29616	1.786000	0.52430	0.459000	0.35465	TTC	A|0.946;G|0.054		0.756	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451794.1	NM_006563	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
GGN	199720	hgsc.bcm.edu	37	19	38876464	38876464	+	Missense_Mutation	SNP	C	C	G	rs11083455	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:38876464C>G	ENST00000334928.6	-	3	1570	c.1438G>C	c.(1438-1440)Gca>Cca	p.A480P	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	480	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			gcaggggctgcggtgggagcc	0.756													G|||	1149	0.229433	0.1437	0.2522	5008	,	,		9781	0.4514		0.1074	False		,,,				2504	0.226				p.A480P		.											.	GGN-90	0			c.G1438C						.	G	PRO/ALA	210,3338		0,210,1564	3.0	4.0	3.0		1438	2.6	0.0	19	dbSNP_120	3	369,6773		3,363,3205	no	missense	GGN	NM_152657.3	27	3,573,4769	GG,GC,CC		5.1666,5.9188,5.4163	benign	480/653	38876464	579,10111	1774	3571	5345	SO:0001583	missense	199720	exon3			GGGCTGCGGTGGG	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1438G>C	19.37:g.38876464C>G	ENSP00000334940:p.Ala480Pro	0	0		10	4	NM_152657	0	0	0	0	0	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	461	0.21108058608058608	72	0.14634146341463414	65	0.17955801104972377	262	0.458041958041958	62	0.08179419525065963	G	1.972	-0.436347	0.04636	0.059188	0.051666	ENSG00000179168	ENST00000334928	.	.	.	3.69	2.63	0.31362	.	0.580033	0.13105	N	0.413421	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47649	-0.9101	8	0.09843	T	0.71	0.5499	9.8256	0.40910	0.0:0.4094:0.5906:0.0	rs11083455;rs60130214	397;480	Q86UU5-2;Q86UU5	.;GGN_HUMAN	P	480	.	ENSP00000334940:A480P	A	-	1	0	GGN	43568304	0.365000	0.25006	0.001000	0.08648	0.091000	0.18340	0.603000	0.24149	0.245000	0.21373	-0.371000	0.07208	GCA	C|0.789;G|0.211		0.756	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	FBXO17_ENST00000595329.1_Silent_p.P14P|CTC-360G5.8_ENST00000599996.1_5'Flank|SARS2_ENST00000448145.2_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		4	0		19	6	NM_148169	0	0	6	11	5	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		0	0		18	11	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
KCNA7	3743	hgsc.bcm.edu	37	19	49575618	49575618	+	Silent	SNP	A	A	G	rs71352730	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:49575618A>G	ENST00000221444.1	-	1	580	c.225T>C	c.(223-225)ggT>ggC	p.G75G		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	75					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GCAGCCGCCCACCGGACTGGT	0.731													a|||	708	0.141374	0.2837	0.1398	5008	,	,		7174	0.0486		0.0875	False		,,,				2504	0.1012				p.G75G	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7-90	0			c.T225C						.			790,3356		66,658,1349	9.0	12.0	11.0		225	-0.4	1.0	19	dbSNP_130	11	613,7491		29,555,3468	no	coding-synonymous	KCNA7	NM_031886.2		95,1213,4817	GG,GA,AA		7.5642,19.0545,11.4531		75/457	49575618	1403,10847	2073	4052	6125	SO:0001819	synonymous_variant	3743	exon1			CCGCCCACCGGAC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.225T>C	19.37:g.49575618A>G		3	0		13	8	NM_031886	0	0	0	0	0	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																			A|0.868;G|0.132		0.731	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		9	9	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
SSC5D	284297	hgsc.bcm.edu	37	19	56000809	56000809	+	Silent	SNP	C	C	T	rs142097230	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:56000809C>T	ENST00000389623.6	+	3	164	c.141C>T	c.(139-141)gaC>gaT	p.D47D	SSC5D_ENST00000587166.1_Silent_p.D47D	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	47	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						TGTGTGATGACGGCTGGGACC	0.761													c|||	42	0.00838658	0.0	0.0202	5008	,	,		10658	0.0		0.0229	False		,,,				2504	0.0051				p.D47D		.											.	.	0			c.C141T						.						4.0	6.0	6.0					19																	56000809		641	1523	2164	SO:0001819	synonymous_variant	284297	exon3			TGATGACGGCTGG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.141C>T	19.37:g.56000809C>T		0	0		32	21	NM_001195267	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																			C|0.989;T|0.011		0.761	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
SSC5D	284297	hgsc.bcm.edu	37	19	56000896	56000896	+	Silent	SNP	G	G	T	rs62130160	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:56000896G>T	ENST00000389623.6	+	3	251	c.228G>T	c.(226-228)ggG>ggT	p.G76G	SSC5D_ENST00000587166.1_Silent_p.G76G	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	76	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCTTCTTCGGGGAGGGGGCAG	0.741													g|||	476	0.0950479	0.031	0.1153	5008	,	,		11955	0.0139		0.1849	False		,,,				2504	0.1585				p.G76G		.											.	.	0			c.G228T						.						5.0	9.0	7.0					19																	56000896		668	1532	2200	SO:0001819	synonymous_variant	284297	exon3			CTTCGGGGAGGGG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.228G>T	19.37:g.56000896G>T		0	0		4	4	NM_001195267	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																			G|0.897;T|0.103		0.741	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		14	13	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
TPO	7173	hgsc.bcm.edu	37	2	1481155	1481155	+	Missense_Mutation	SNP	G	G	T	rs2280132	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:1481155G>T	ENST00000345913.4	+	8	1208	c.1117G>T	c.(1117-1119)Gcg>Tcg	p.A373S	TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.A373S|TPO_ENST00000329066.4_Missense_Mutation_p.A373S|TPO_ENST00000346956.3_Missense_Mutation_p.A373S|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.A373S|TPO_ENST00000382198.1_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	373			A -> S (in dbSNP:rs2280132). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACGCGCGCCTGCGGCCTGTGC	0.771													G|||	2044	0.408147	0.3177	0.4856	5008	,	,		9068	0.5228		0.4463	False		,,,				2504	0.318				p.A373S		.											.	TPO-332	0			c.G1117T						.	G	SER/ALA,SER/ALA,SER/ALA,SER/ALA,SER/ALA,	871,1881		188,495,693	2.0	3.0	2.0		1117,1117,1117,1117,1117,	-1.3	0.1	2	dbSNP_100	2	2717,3349		737,1243,1053	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	99,99,99,99,99,	925,1738,1746	TT,TG,GG		44.7906,31.6497,40.6895	benign,benign,benign,benign,benign,	373/934,373/934,373/877,373/877,373/890,	1481155	3588,5230	1376	3033	4409	SO:0001583	missense	7173	exon8			GCGCCTGCGGCCT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1117G>T	2.37:g.1481155G>T	ENSP00000318820:p.Ala373Ser	0	0		9	9	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	929	0.42536630036630035	143	0.29065040650406504	171	0.4723756906077348	272	0.4755244755244755	343	0.4525065963060686	G	0.605	-0.827268	0.02734	0.316497	0.447906	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000536482;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	4.81	-1.27	0.09347	.	0.467870	0.21205	N	0.078413	T	0.00012	0.0000	N	0.00873	-1.125	0.44627	P	0.002395000000000036	B;B;B	0.12013	0.004;0.004;0.005	B;B;B	0.15052	0.007;0.007;0.012	T	0.32402	-0.9908	9	0.05959	T	0.93	-5.0846	2.1535	0.03806	0.1057:0.1783:0.3533:0.3627	rs2280132	373;373;373	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	S	373;373;373;57;373;373;302	ENSP00000337263:A373S;ENSP00000318820:A373S;ENSP00000263886:A373S;ENSP00000329869:A373S;ENSP00000371636:A373S;ENSP00000405788:A302S	ENSP00000329869:A373S	A	+	1	0	TPO	1460162	0.000000	0.05858	0.089000	0.20774	0.308000	0.27856	0.173000	0.16724	-0.259000	0.09432	0.460000	0.39030	GCG	G|0.569;T|0.431		0.771	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	1	0		7	7	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		5	5	NM_001256478	0	0	0	4	4	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
NT5C1B	93034	hgsc.bcm.edu	37	2	18766156	18766156	+	Nonsense_Mutation	SNP	G	G	T	rs61742596	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:18766156G>T	ENST00000359846.2	-	5	604	c.527C>A	c.(526-528)tCg>tAg	p.S176*	NT5C1B_ENST00000460052.1_5'Flank|NT5C1B_ENST00000304081.4_Nonsense_Mutation_p.S116*|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000600945.1_Nonsense_Mutation_p.S176*|NT5C1B-RDH14_ENST00000532967.1_Nonsense_Mutation_p.S176*	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	176	Pro-rich.|Ser-rich.				nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TGGCTGGAGCGAGGGCTGCCC	0.721													G|||	205	0.0409345	0.0023	0.1225	5008	,	,		12349	0.0625		0.0447	False		,,,				2504	0.0092				p.S193X		.											.	NT5C1B-47	0			c.C578A						.	G	stop/SER,stop/SER,stop/SER,stop/SER,stop/SER,stop/SER,stop/SER	28,4122		1,26,2048	10.0	17.0	15.0		527,476,578,533,353,527,347	3.3	0.3	2	dbSNP_129	15	368,7750		13,342,3704	no	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	NT5C1B,NT5C1B-RDH14	NM_001002006.2,NM_001199086.1,NM_001199087.1,NM_001199088.1,NM_001199103.1,NM_001199104.1,NM_033253.3	,,,,,,	14,368,5752	TT,TG,GG		4.5331,0.6747,3.2279	,,,,,,	176/611,159/594,193/628,178/613,118/651,176/603,116/551	18766156	396,11872	2075	4059	6134	SO:0001587	stop_gained	93034	exon5			TGGAGCGAGGGCT	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.527C>A	2.37:g.18766156G>T	ENSP00000352904:p.Ser176*	1	0		16	12	NM_001199087	0	0	0	0	0	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Nonsense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	111	0.050824175824175824	4	0.008130081300813009	30	0.08287292817679558	38	0.06643356643356643	39	0.051451187335092345	G	18.93	3.728402	0.69074	0.006747	0.045331	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	.	.	.	4.15	3.26	0.37387	.	3.553780	0.01074	N	0.004867	.	.	.	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3183	6.8928	0.24238	0.1236:0.0:0.8764:0.0	.	.	.	.	X	176;118;116;176;193	.	ENSP00000305979:S116X	S	-	2	0	NT5C1B-RDH14;NT5C1B	18629637	0.438000	0.25602	0.345000	0.25642	0.048000	0.14542	2.099000	0.41767	2.246000	0.74042	0.563000	0.77884	TCG	G|0.950;T|0.050		0.721	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	50	4		182	52	NM_001145054	0	0	1	1	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
TTC31	64427	bcgsc.ca	37	2	74717206	74717206	+	Missense_Mutation	SNP	C	C	T	rs202055795	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:74717206C>T	ENST00000233623.5	+	3	191	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	TTC31_ENST00000410003.1_Missense_Mutation_p.R62W|TTC31_ENST00000463189.1_Intron|TTC31_ENST00000442235.2_Intron	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	62										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						GGGCCTGCACCGGATCCATGT	0.667													C|||	9	0.00179712	0.0008	0.0	5008	,	,		12929	0.0079		0.0	False		,,,				2504	0.0				p.R62W		.											.	TTC31-90	0			c.C184T						.	C	TRP/ARG	1,3927		0,1,1963	24.0	26.0	25.0		184	0.6	0.4	2		25	2,8306		0,2,4152	yes	missense	TTC31	NM_022492.4	101	0,3,6115	TT,TC,CC		0.0241,0.0255,0.0245	probably-damaging	62/520	74717206	3,12233	1964	4154	6118	SO:0001583	missense	64427	exon3			CTGCACCGGATCC	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.184C>T	2.37:g.74717206C>T	ENSP00000233623:p.Arg62Trp	189	3		136	6	NM_022492	0	0	6	6	0	Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	ENST00000233623.5	37	CCDS42701.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703686	0.30232	2.55E-4	2.41E-4	ENSG00000115282	ENST00000410003;ENST00000435361;ENST00000441635;ENST00000233623	T;T	0.52754	0.65;0.65	3.9	0.601	0.17529	.	1.173640	0.06385	N	0.715979	T	0.36608	0.0973	L	0.36672	1.1	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.37126	-0.9719	10	0.87932	D	0	.	5.2958	0.15751	0.0:0.5139:0.0:0.4861	.	62	Q49AM3	TTC31_HUMAN	W	62	ENSP00000387213:R62W;ENSP00000233623:R62W	ENSP00000233623:R62W	R	+	1	2	TTC31	74570714	0.000000	0.05858	0.418000	0.26571	0.997000	0.91878	-0.812000	0.04496	0.259000	0.21709	0.561000	0.74099	CGG	.		0.667	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	
ATOH8	84913	hgsc.bcm.edu	37	2	85981761	85981761	+	Missense_Mutation	SNP	T	T	C	rs17851881	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:85981761T>C	ENST00000306279.3	+	1	745	c.449T>C	c.(448-450)cTg>cCg	p.L150P		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	150	Pro-rich.		L -> P (in dbSNP:rs17851881). {ECO:0000269|PubMed:12419857, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGCCGGGTCTGCGTCCTCGC	0.786													T|||	2860	0.571086	0.4758	0.6383	5008	,	,		10130	0.7421		0.6093	False		,,,				2504	0.4366				p.L150P		.											.	ATOH8-90	0			c.T449C						.	T	PRO/LEU	1790,1646		523,744,451	5.0	7.0	6.0		449	2.5	0.8	2	dbSNP_123	6	3836,2834		1197,1442,696	no	missense	ATOH8	NM_032827.6	98	1720,2186,1147	CC,CT,TT		42.4888,47.9045,44.3301	possibly-damaging	150/322	85981761	5626,4480	1718	3335	5053	SO:0001583	missense	84913	exon1			CGGGTCTGCGTCC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.449T>C	2.37:g.85981761T>C	ENSP00000304676:p.Leu150Pro	0	0		4	4	NM_032827	0	0	0	0	0	Q504S2|Q659B0	Missense_Mutation	SNP	ENST00000306279.3	37	CCDS1985.1	1347	0.6167582417582418	233	0.4735772357723577	232	0.6408839779005525	433	0.756993006993007	449	0.5923482849604221	T	13.11	2.140335	0.37825	0.520955	0.575112	ENSG00000168874	ENST00000306279	D	0.94650	-3.48	3.6	2.45	0.29901	.	0.166402	0.23793	N	0.044509	T	0.00012	0.0000	N	0.24115	0.695	0.26047	P	0.9815344	B;B	0.10296	0.003;0.001	B;B	0.08055	0.002;0.003	T	0.45352	-0.9267	9	0.72032	D	0.01	-10.2738	5.5522	0.17097	0.0:0.126:0.0:0.874	rs17851881	150;150	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	P	150	ENSP00000304676:L150P	ENSP00000304676:L150P	L	+	2	0	ATOH8	85835272	0.913000	0.31002	0.756000	0.31282	0.353000	0.29299	1.683000	0.37638	0.758000	0.33059	0.374000	0.22700	CTG	T|0.382;C|0.618		0.786	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
CD8B	926	hgsc.bcm.edu	37	2	87088964	87088964	+	Silent	SNP	A	A	G	rs62146888	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:87088964A>G	ENST00000390655.6	-	1	83	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD8B_ENST00000331469.2_Silent_p.L9L|AC111200.1_ENST00000441646.1_5'Flank|CD8B_ENST00000431506.2_Silent_p.L9L|CD8B_ENST00000393761.2_Silent_p.L9L|CD8B_ENST00000393759.2_Silent_p.L9L|CD8B_ENST00000349455.3_Silent_p.L9L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	9					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TGCGCGGCCAAGAGGAGCCAC	0.756													G|||	2559	0.510982	0.6626	0.3862	5008	,	,		7474	0.5427		0.4672	False		,,,				2504	0.407				p.L9L		.											.	CD8B-92	0			c.T25C						.						1.0	1.0	1.0					2																	87088964		543	1520	2063	SO:0001819	synonymous_variant	926	exon1			CGGCCAAGAGGAG		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.25T>C	2.37:g.87088964A>G		1	0		4	4	NM_004931	0	0	0	1	1	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			A|0.476;G|0.524		0.756	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
TEKT4	150483	hgsc.bcm.edu	37	2	95539855	95539855	+	Splice_Site	SNP	T	T	G	rs201662522	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:95539855T>G	ENST00000295201.4	+	3	850		c.e3+2		AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4						cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCAAGAGAGGTGGGCCCCAGC	0.682																																					.		.											.	TEKT4-155	0			c.713+2T>G						.						56.0	54.0	55.0					2																	95539855		2203	4300	6503	SO:0001630	splice_region_variant	150483	exon3			GAGAGGTGGGCCC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.713+2T>G	2.37:g.95539855T>G		126	0		122	10	NM_144705	0	0	0	1	1		Splice_Site	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	13.70	2.316724	0.40996	.	.	ENSG00000163060	ENST00000295201	.	.	.	2.24	2.24	0.28232	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0143	0.30372	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TEKT4	94903582	1.000000	0.71417	0.603000	0.28903	0.057000	0.15508	4.740000	0.62087	0.779000	0.33543	0.254000	0.18369	.	T|0.970;G|0.030		0.682	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	Intron
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	0	0		6	4	NM_173647	0	0	1	2	1	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		14	14	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
RAB3GAP1	22930	ucsc.edu	37	2	135926240	135926240	+	Silent	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:135926240G>T	ENST00000264158.8	+	24	2878	c.2835G>T	c.(2833-2835)gtG>gtT	p.V945V	RAB3GAP1_ENST00000539493.1_Silent_p.V901V|RAB3GAP1_ENST00000442034.1_Silent_p.V952V|RAB3GAP1_ENST00000487003.1_3'UTR|ZRANB3_ENST00000412849.1_Intron	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	945					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		GCACCACTGTGCCGCGCCCTG	0.537																																					p.V952V		.											.	RAB3GAP1-92	0			c.G2856T						.						101.0	100.0	101.0					2																	135926240		2203	4300	6503	SO:0001819	synonymous_variant	22930	exon25			CACTGTGCCGCGC	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2835G>T	2.37:g.135926240G>T		74	2		130	4	NM_001172435	0	0	33	41	8	A6H8Z3|C9J837|Q659F5|Q8TBB4	Silent	SNP	ENST00000264158.8	37	CCDS33294.1																																																																																			.		0.537	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
SP5	389058	hgsc.bcm.edu	37	2	171572937	171572937	+	Missense_Mutation	SNP	A	A	T	rs199988182	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:171572937A>T	ENST00000375281.3	+	2	382	c.220A>T	c.(220-222)Acc>Tcc	p.T74S	SP5_ENST00000487037.1_3'UTR|AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	74					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCACCCGTGGACCGCCGACAT	0.751																																					p.T74S		.											.	SP5-90	0			c.A220T						.	A	SER/THR	1,4053		0,1,2026	9.0	11.0	10.0		220	4.4	0.9	2		10	17,8135		0,17,4059	no	missense	SP5	NM_001003845.2	58	0,18,6085	TT,TA,AA		0.2085,0.0247,0.1475	benign	74/399	171572937	18,12188	2027	4076	6103	SO:0001583	missense	389058	exon2			CCGTGGACCGCCG		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.220A>T	2.37:g.171572937A>T	ENSP00000364430:p.Thr74Ser	2	0		14	9	NM_001003845	0	0	0	0	0		Missense_Mutation	SNP	ENST00000375281.3	37	CCDS33322.1	.	.	.	.	.	.	.	.	.	.	A	6.702	0.498175	0.12762	2.47E-4	0.002085	ENSG00000204335	ENST00000375281	T	0.07114	3.22	4.43	4.43	0.53597	.	0.056914	0.64402	D	0.000002	T	0.04272	0.0118	N	0.11789	0.175	0.43047	D	0.994643	B	0.21452	0.056	B	0.12837	0.008	T	0.19031	-1.0318	10	0.05525	T	0.97	.	12.6812	0.56922	1.0:0.0:0.0:0.0	.	74	Q6BEB4	SP5_HUMAN	S	74	ENSP00000364430:T74S	ENSP00000364430:T74S	T	+	1	0	SP5	171281183	0.997000	0.39634	0.881000	0.34555	0.944000	0.59088	3.472000	0.53114	1.651000	0.50673	0.379000	0.24179	ACC	A|0.994;T|0.006		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
ACSL3	2181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	223782837	223782837	+	Silent	SNP	C	C	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:223782837C>T	ENST00000357430.3	+	6	1161	c.630C>T	c.(628-630)atC>atT	p.I210I	ACSL3_ENST00000392066.3_Silent_p.I210I|AC097461.4_ENST00000446709.1_RNA	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	210					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TGACCAACATCATTACTAGTA	0.378			T	ETV1	prostate																																p.I210I		.		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	.	ACSL3-228	0			c.C630T						.						142.0	142.0	142.0					2																	223782837		2203	4300	6503	SO:0001819	synonymous_variant	2181	exon5			CAACATCATTACT	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.630C>T	2.37:g.223782837C>T		56	0		81	13	NM_203372	0	0	4	5	1	Q60I92|Q8IUM9	Silent	SNP	ENST00000357430.3	37	CCDS2455.1																																																																																			.		0.378	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
ALPPL2	251	hgsc.bcm.edu	37	2	233274475	233274475	+	Missense_Mutation	SNP	C	C	A	rs56080708	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:233274475C>A	ENST00000295453.3	+	11	1544	c.1492C>A	c.(1492-1494)Cgc>Agc	p.R498S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CCTGGCGCCCCGCGCCGGCAC	0.731													c|||	477	0.0952476	0.0514	0.062	5008	,	,		10169	0.2133		0.0785	False		,,,				2504	0.0736				p.R498S		.											.	ALPPL2-91	0			c.C1492A						.	C	SER/ARG	328,4022		17,294,1864	12.0	16.0	15.0		1492	1.2	0.0	2	dbSNP_129	15	716,7764		55,606,3579	no	missense	ALPPL2	NM_031313.2	110	72,900,5443	AA,AC,CC		8.4434,7.5402,8.1372	benign	498/533	233274475	1044,11786	2175	4240	6415	SO:0001583	missense	251	exon11			GCGCCCCGCGCCG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1492C>A	2.37:g.233274475C>A	ENSP00000295453:p.Arg498Ser	0	0		25	12	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	231	0.10576923076923077	28	0.056910569105691054	21	0.058011049723756904	120	0.2097902097902098	62	0.08179419525065963	c	0.762	-0.768825	0.02974	0.075402	0.084434	ENSG00000163286	ENST00000295453	D	0.95412	-3.7	2.17	1.24	0.21308	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.00271	0.0008	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.42327	-0.9458	9	0.06236	T	0.91	.	4.2075	0.10495	0.3616:0.5075:0.0:0.1308	rs56080708;rs61730276	498	P10696	PPBN_HUMAN	S	498	ENSP00000295453:R498S	ENSP00000295453:R498S	R	+	1	0	ALPPL2	232982719	0.000000	0.05858	0.020000	0.16555	0.076000	0.17211	-0.511000	0.06321	0.233000	0.21120	0.205000	0.17691	CGC	C|0.901;A|0.099		0.731	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
ESPNL	339768	hgsc.bcm.edu	37	2	239009336	239009336	+	Silent	SNP	G	G	A	rs61744770	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr2:239009336G>A	ENST00000343063.3	+	1	539	c.276G>A	c.(274-276)gaG>gaA	p.E92E	ESPNL_ENST00000409169.1_Silent_p.E92E	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	92										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TGGTCCGCGAGGGGGGCTGCG	0.721													G|||	1076	0.214856	0.0325	0.3012	5008	,	,		12159	0.1359		0.4761	False		,,,				2504	0.2127				p.E92E		.											.	ESPNL-69	0			c.G276A						.	G		217,3027		15,187,1420	2.0	3.0	3.0		276	-8.2	0.0	2	dbSNP_129	3	2420,4680		417,1586,1547	no	coding-synonymous	ESPNL	NM_194312.2		432,1773,2967	AA,AG,GG		34.0845,6.6893,25.493		92/1006	239009336	2637,7707	1622	3550	5172	SO:0001819	synonymous_variant	339768	exon1			CCGCGAGGGGGGC	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.276G>A	2.37:g.239009336G>A		0	0		5	5	NM_194312	0	0	0	0	0	Q66K27|Q6ZVG1|Q8IVU2	Silent	SNP	ENST00000343063.3	37	CCDS2525.1																																																																																			G|0.739;A|0.261		0.721	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		0	0		13	13	NM_004609	0	0	0	3	3	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
FASTKD5	60493	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	3128060	3128060	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:3128060T>C	ENST00000380266.3	-	2	1978	c.1657A>G	c.(1657-1659)Atg>Gtg	p.M553V	UBOX5_ENST00000217173.2_Intron|UBOX5_ENST00000348031.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	553					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						TTTGAATTCATATCCTTCTCT	0.458																																					p.M553V		.											.	FASTKD5-90	0			c.A1657G						.						53.0	58.0	57.0					20																	3128060		2203	4300	6503	SO:0001583	missense	60493	exon2			AATTCATATCCTT	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.1657A>G	20.37:g.3128060T>C	ENSP00000369618:p.Met553Val	89	0		96	5	NM_021826	0	0	15	15	0	Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	ENST00000380266.3	37	CCDS13048.1	.	.	.	.	.	.	.	.	.	.	T	6.869	0.529724	0.13127	.	.	ENSG00000215251	ENST00000380266	T	0.42513	0.97	5.25	5.25	0.73442	FAST kinase-like protein, subdomain 2 (1);	0.178534	0.48767	D	0.000172	T	0.36908	0.0984	L	0.54323	1.7	0.38513	D	0.948512	B	0.30326	0.276	B	0.23574	0.047	T	0.28459	-1.0043	10	0.17369	T	0.5	.	15.4575	0.75327	0.0:0.0:0.0:1.0	.	553	Q7L8L6	FAKD5_HUMAN	V	553	ENSP00000369618:M553V	ENSP00000369618:M553V	M	-	1	0	FASTKD5	3076060	1.000000	0.71417	0.998000	0.56505	0.518000	0.34316	3.089000	0.50183	2.113000	0.64589	0.402000	0.26972	ATG	.		0.458	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron|RP11-119B16.2_ENST00000451507.1_RNA	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		5	5	NM_153638	0	0	0	1	1	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
MROH8	140699	bcgsc.ca	37	20	35783494	35783494	+	Missense_Mutation	SNP	T	T	C	rs1615246	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:35783494T>C	ENST00000400441.3	-	9	1045	c.1046A>G	c.(1045-1047)aAg>aGg	p.K349R	MROH8_ENST00000217333.8_Intron|MROH8_ENST00000441008.2_Missense_Mutation_p.K335R			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	243																	GGATAGGCACTTCAGAACTTG	0.522													T|||	2177	0.434704	0.354	0.4899	5008	,	,		19144	0.4891		0.4076	False		,,,				2504	0.4765				.		.											.	.	0			.						.	T	ARG/LYS,ARG/LYS,	1353,2575		241,871,852	127.0	123.0	124.0		1047,1047,	4.3	1.0	20	dbSNP_89	124	3440,4864		683,2074,1395	no	missense,missense,intron	C20orf132	NM_152503.4,NM_213631.1,NM_213632.1	26,26,	924,2945,2247	CC,CT,TT		41.4258,34.445,39.1841	benign,benign,	359/1053,359/609,	35783494	4793,7439	1964	4152	6116	SO:0001583	missense	140699	.			AGGCACTTCAGAA	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1046A>G	20.37:g.35783494T>C	ENSP00000383291:p.Lys349Arg	98	0		92	4	.	0	0	0	0	0	Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37		909|909	0.41620879120879123|0.41620879120879123	167|167	0.3394308943089431|0.3394308943089431	163|163	0.45027624309392267|0.45027624309392267	276|276	0.4825174825174825|0.4825174825174825	303|303	0.3997361477572559|0.3997361477572559	T|T	11.52|11.52	1.662166|1.662166	0.29515|0.29515	0.34445|0.34445	0.414258|0.414258	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441|ENST00000343811;ENST00000400440	T;T|.	0.04275|.	3.66;3.66|.	5.57|5.57	4.29|4.29	0.51040|0.51040	.|.	0.349670|.	0.28252|.	N|.	0.016035|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.20401|0.20401	0.57|0.57	0.37548|0.37548	P|P	0.08142000000000005|0.08142000000000005	B;B|.	0.31318|.	0.096;0.319|.	B;B|.	0.26416|.	0.021;0.069|.	T|T	0.49163|0.49163	-0.8968|-0.8968	9|4	0.10377|.	T|.	0.69|.	-16.456|-16.456	5.7499|5.7499	0.18140|0.18140	0.0:0.144:0.0:0.856|0.0:0.144:0.0:0.856	rs1615246;rs3762210;rs17181305;rs56619979;rs58184941;rs1615246|rs1615246;rs3762210;rs17181305;rs56619979;rs58184941;rs1615246	349;359|.	E7ETR9;Q6PF12|.	.;.|.	R|G	335;349|376;380	ENSP00000392144:K335R;ENSP00000383291:K349R|.	ENSP00000383291:K349R|.	K|S	-|-	2|1	0|0	C20orf132|C20orf132	35216908|35216908	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.524000|0.524000	0.34500|0.34500	2.380000|2.380000	0.44327|0.44327	2.253000|2.253000	0.74438|0.74438	0.533000|0.533000	0.62120|0.62120	AAG|AGT	T|0.572;C|0.428		0.522	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		0	0		19	12	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		0	0		5	5	NM_052951	0	0	0	2	2	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
OGFR	11054	hgsc.bcm.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																					p.E556K		.											.	OGFR-68	1	Substitution - Missense(1)	skin(1)	c.G1666A						.						6.0	11.0	9.0					20																	61444633		1936	3778	5714	SO:0001583	missense	11054	exon7			CCAGCCGAGAGCC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	0	0		28	8	NM_007346	0	0	245	245	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	.		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	0	0		26	9	NM_007346	0	0	243	244	1	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	4	0		16	6	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		4	0		17	7	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-7	386675	broad.mit.edu	37	21	46020669	46020670	+	Frame_Shift_Del	DEL	AG	AG	-	rs36208679|rs60739860		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr21:46020669_46020670delAG	ENST00000380102.2	+	1	173_174	c.148_149delAG	c.(148-150)agcfs	p.S50fs	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	50	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CTGCGCCCCCAGCTGCTGCGCC	0.703																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.																																			SO:0001589	frameshift_variant	386675	.			GCCCCCAGCTGCT	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.148_149delAG	21.37:g.46020669_46020670delAG	ENSP00000369445:p.Ser50fs	21	0		91	10	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.703	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
MRPL40	64976	hgsc.bcm.edu	37	22	19422330	19422330	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr22:19422330G>T	ENST00000333130.3	+	3	862	c.209G>T	c.(208-210)aGg>aTg	p.R70M	HIRA_ENST00000541063.1_Intron|MRPL40_ENST00000443660.1_3'UTR|HIRA_ENST00000546308.1_Intron	NM_003776.2	NP_003767.2	Q9NQ50	RM40_HUMAN	mitochondrial ribosomal protein L40	70					anatomical structure morphogenesis (GO:0009653)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					CGCTTGAAAAGGAAGATCCGA	0.353																																					p.R70M		.											.	MRPL40-90	0			c.G209T						.						94.0	98.0	97.0					22																	19422330		2203	4300	6503	SO:0001583	missense	64976	exon3			TGAAAAGGAAGAT	AB051624	CCDS13760.1	22q11.2	2012-09-13	2002-11-13		ENSG00000185608	ENSG00000185608		"""Mitochondrial ribosomal proteins / large subunits"""	14491	protein-coding gene	gene with protein product		605089	"""nuclear localization signal deleted in velocardiofacial syndrome"""	NLVCF		9790763, 11543634	Standard	NM_003776		Approved	MRP-L22	uc002zpg.3	Q9NQ50	OTTHUMG00000150136	ENST00000333130.3:c.209G>T	22.37:g.19422330G>T	ENSP00000333401:p.Arg70Met	66	0		69	4	NM_003776	0	0	112	112	0	B3KVZ7|O95134	Missense_Mutation	SNP	ENST00000333130.3	37	CCDS13760.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.666755	0.67814	.	.	ENSG00000185608	ENST00000333130	T	0.44482	0.92	4.3	3.26	0.37387	.	0.049799	0.85682	D	0.000000	T	0.39835	0.1093	L	0.29908	0.895	0.35284	D	0.78156	P	0.52577	0.954	P	0.52109	0.69	T	0.53422	-0.8441	10	0.87932	D	0	-21.1141	9.2637	0.37627	0.9116:0.0:0.0884:0.0	.	70	Q9NQ50	RM40_HUMAN	M	70	ENSP00000333401:R70M	ENSP00000333401:R70M	R	+	2	0	MRPL40	17802330	1.000000	0.71417	0.996000	0.52242	0.874000	0.50279	2.990000	0.49401	0.809000	0.34255	-0.471000	0.05019	AGG	.		0.353	MRPL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316491.2	NM_003776	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		0	0		7	7	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		7	7	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	0	0		9	6	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
CRIPAK	285464	bcgsc.ca	37	4	1388817	1388817	+	Missense_Mutation	SNP	C	C	G	rs200606324	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:1388817C>G	ENST00000324803.4	+	1	3478	c.518C>G	c.(517-519)cCa>cGa	p.P173R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	173					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGTGGAGTG	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		18475	0.0992		0.0378	False		,,,				2504	0.271				p.P173R		.											.	CRIPAK-90	0			c.C518G						.						192.0	130.0	151.0					4																	1388817		2194	4201	6395	SO:0001583	missense	285464	exon1			CGTGCCCATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.518C>G	4.37:g.1388817C>G	ENSP00000323978:p.Pro173Arg	43	0		182	32	NM_175918	0	0	90	90	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	c	1.909	-0.451230	0.04572	.	.	ENSG00000179979	ENST00000324803	T	0.19250	2.16	1.25	0.276	0.15663	Post-SET domain (1);	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40079	-0.9582	9	0.17369	T	0.5	.	4.4738	0.11726	0.0:0.5796:0.2425:0.1779	.	173	Q8N1N5	CRPAK_HUMAN	R	173	ENSP00000323978:P173R	ENSP00000323978:P173R	P	+	2	0	CRIPAK	1378817	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.368000	0.07543	-0.338000	0.08413	-1.976000	0.00459	CCA	CATGT|0.500;GACGC|0.500		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	46	1		180	25	NM_175918	0	0	89	89	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
DOK7	285489	hgsc.bcm.edu	37	4	3495095	3495095	+	Missense_Mutation	SNP	G	G	A	rs9684786	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:3495095G>A	ENST00000340083.5	+	7	1447	c.1382G>A	c.(1381-1383)gGc>gAc	p.G461D	DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000389653.2_Missense_Mutation_p.G461D	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	461			G -> D (in dbSNP:rs9684786). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:22661499}.		neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCCCCCCAGGGCAGCGAGGCC	0.736													.|||	979	0.195487	0.1301	0.2536	5008	,	,		12640	0.126		0.1859	False		,,,				2504	0.3241				p.G461D		.											.	DOK7-91	0			c.G1382A						.	G	,ASP/GLY	491,3733		21,449,1642	5.0	7.0	6.0		,1382	2.6	0.0	4	dbSNP_119	6	1533,6777		146,1241,2768	no	utr-3,missense	DOK7	NM_001164673.1,NM_173660.4	,94	167,1690,4410	AA,AG,GG		18.4477,11.6241,16.1481	,possibly-damaging	,461/505	3495095	2024,10510	2112	4155	6267	SO:0001583	missense	285489	exon7			CCCAGGGCAGCGA	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1382G>A	4.37:g.3495095G>A	ENSP00000344432:p.Gly461Asp	0	0		21	14	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	361	0.1652930402930403	71	0.1443089430894309	89	0.24585635359116023	60	0.1048951048951049	141	0.18601583113456466	G	11.67	1.708532	0.30322	0.116241	0.184477	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.65364	-0.15;-0.05	3.45	2.59	0.31030	.	0.256266	0.35096	N	0.003451	T	0.00039	0.0001	L	0.60455	1.87	0.80722	P	0.0	B;P;B	0.40731	0.192;0.728;0.005	B;P;B	0.44359	0.066;0.447;0.001	T	0.03706	-1.1011	9	0.51188	T	0.08	-7.7911	11.2519	0.49031	0.0:0.0:0.8164:0.1835	rs9684786;rs17846359;rs17859395	461;323;461	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	D	461	ENSP00000374304:G461D;ENSP00000344432:G461D	ENSP00000344432:G461D	G	+	2	0	DOK7	3464893	1.000000	0.71417	0.010000	0.14722	0.077000	0.17291	2.742000	0.47434	0.667000	0.31107	0.555000	0.69702	GGC	G|0.834;A|0.166		0.736	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	6	0		62	11	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228456	4228456	+	Silent	SNP	G	G	T	rs73191872		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:4228456G>T	ENST00000296358.4	-	1	160	c.136C>A	c.(136-138)Cgg>Agg	p.R46R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACAccgccccgccggggggcc	0.736																																					p.R46R		.											.	OTOP1-92	0			c.C136A						.						4.0	4.0	4.0					4																	4228456		1989	3880	5869	SO:0001819	synonymous_variant	133060	exon1			CGCCCCGCCGGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.136C>A	4.37:g.4228456G>T		8	0		75	20	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228472	4228472	+	Silent	SNP	T	T	C	rs76810534		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:4228472T>C	ENST00000296358.4	-	1	144	c.120A>G	c.(118-120)gaA>gaG	p.E40E		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	40				E -> K (in Ref. 1; AAI30431/AAI30433). {ECO:0000305}.	biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gggccggggATTCCGGGGACC	0.756																																					p.E40E		.											.	OTOP1-92	0			c.A120G						.						3.0	4.0	4.0					4																	4228472		1916	3754	5670	SO:0001819	synonymous_variant	133060	exon1			CGGGGATTCCGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.120A>G	4.37:g.4228472T>C		6	0		49	14	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.756	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank|TADA2B_ENST00000512388.1_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		0	0		4	4	NM_153376	0	0	0	1	1	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CXCL3	2921	hgsc.bcm.edu	37	4	74904296	74904296	+	Missense_Mutation	SNP	G	G	T	rs182216932	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:74904296G>T	ENST00000296026.4	-	1	110	c.33C>A	c.(31-33)agC>agA	p.S11R	CXCL3_ENST00000511669.1_5'UTR	NM_002090.2	NP_002081.2	P19876	CXCL3_HUMAN	chemokine (C-X-C motif) ligand 3	11					immune response (GO:0006955)|inflammatory response (GO:0006954)|neutrophil chemotaxis (GO:0030593)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			central_nervous_system(1)|endometrium(1)	2	Breast(15;0.00612)		all cancers(17;0.00273)|Lung(101;0.196)			GCCGGGGATTGCTGGGGGCGG	0.771													G|||	277	0.0553115	0.0242	0.0303	5008	,	,		9459	0.1637		0.005	False		,,,				2504	0.0552				p.S11R		.											.	CXCL3-514	0			c.C33A						.	G	ARG/SER	68,3530		0,68,1731	5.0	10.0	9.0		33	-0.1	0.0	4		9	65,7223		0,65,3579	no	missense	CXCL3	NM_002090.2	110	0,133,5310	TT,TG,GG		0.8919,1.8899,1.2218	possibly-damaging	11/108	74904296	133,10753	1799	3644	5443	SO:0001583	missense	2921	exon1			GGGATTGCTGGGG	M36821	CCDS34007.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000163734		"""Endogenous ligands"""	4604	protein-coding gene	gene with protein product		139111	"""GRO3 oncogene"""	GRO3		2217207	Standard	NM_002090		Approved	SCYB3, GROg, MIP-2b, CINC-2b	uc003hhl.3	P19876		ENST00000296026.4:c.33C>A	4.37:g.74904296G>T	ENSP00000296026:p.Ser11Arg	0	0		21	13	NM_002090	0	0	35	35	0	Q4W5H9	Missense_Mutation	SNP	ENST00000296026.4	37	CCDS34007.1	127	0.05815018315018315	16	0.032520325203252036	11	0.03038674033149171	90	0.15734265734265734	10	0.013192612137203167	G	13.25	2.182591	0.38511	0.018899	0.008919	ENSG00000163734	ENST00000296026	T	0.31510	1.49	1.82	-0.0991	0.13625	.	1.487590	0.03690	N	0.246945	T	0.00109	0.0003	L	0.33485	1.01	0.80722	P	0.0	P	0.50943	0.94	P	0.44860	0.462	T	0.03922	-1.0992	9	0.30854	T	0.27	.	2.9737	0.05930	0.1918:0.2947:0.5134:0.0	.	11	P19876	CXCL3_HUMAN	R	11	ENSP00000296026:S11R	ENSP00000296026:S11R	S	-	3	2	CXCL3	75123160	0.003000	0.15002	0.001000	0.08648	0.032000	0.12392	0.974000	0.29436	-0.055000	0.13244	0.306000	0.20318	AGC	G|0.942;T|0.058		0.771	CXCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362721.1		
ADH1A	124	ucsc.edu	37	4	100203572	100203572	+	Silent	SNP	C	C	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:100203572C>T	ENST00000209668.2	-	6	872	c.759G>A	c.(757-759)gaG>gaA	p.E253E	RP11-696N14.1_ENST00000500358.2_RNA|RP11-696N14.1_ENST00000506160.1_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	253					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	CCTTTAGCACCTCCTGGATGG	0.463																																					p.E253E		.											.	ADH1A-227	0			c.G759A						.						352.0	350.0	351.0					4																	100203572		2203	4300	6503	SO:0001819	synonymous_variant	124	exon6			TAGCACCTCCTGG	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.759G>A	4.37:g.100203572C>T		293	6		334	12	NM_000667	2	0	1	551	548	A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	CCDS3648.1																																																																																			.		0.463	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
RAPGEF2	9693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	160252876	160252876	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:160252876C>G	ENST00000264431.4	+	9	1606	c.1187C>G	c.(1186-1188)cCt>cGt	p.P396R		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	396	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143, ECO:0000305}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CGAGAAGCTCCTTTGCCTTTT	0.428																																					p.P396R		.											.	RAPGEF2-637	0			c.C1187G						.						142.0	133.0	136.0					4																	160252876		1889	4096	5985	SO:0001583	missense	9693	exon9			AAGCTCCTTTGCC	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1187C>G	4.37:g.160252876C>G	ENSP00000264431:p.Pro396Arg	182	0		146	47	NM_014247	0	0	2	5	3	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528612	0.85706	.	.	ENSG00000109756	ENST00000264431	T	0.17691	2.26	5.39	5.39	0.77823	PDZ/DHR/GLGF (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	L	0.42632	1.34	0.80722	D	1	P	0.38167	0.621	P	0.52031	0.688	T	0.00970	-1.1496	10	0.44086	T	0.13	.	19.1678	0.93563	0.0:1.0:0.0:0.0	.	396	Q9Y4G8	RPGF2_HUMAN	R	396	ENSP00000264431:P396R	ENSP00000264431:P396R	P	+	2	0	RAPGEF2	160472326	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	7.818000	0.86416	2.535000	0.85469	0.467000	0.42956	CCT	.		0.428	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
PDLIM3	27295	broad.mit.edu;bcgsc.ca	37	4	186456520	186456520	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr4:186456520G>T	ENST00000284770.5	-	1	142	c.69C>A	c.(67-69)ttC>ttA	p.F23L	PDLIM3_ENST00000284771.6_Missense_Mutation_p.F23L|PDLIM3_ENST00000284767.5_Missense_Mutation_p.F23L	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	23	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		AAGGCTGGTTGAAGTCTATGC	0.672																																					p.F23L		.											.	PDLIM3-92	0			c.C69A						.						46.0	49.0	48.0					4																	186456520		2203	4300	6503	SO:0001583	missense	27295	exon1			CTGGTTGAAGTCT	AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.69C>A	4.37:g.186456520G>T	ENSP00000284770:p.Phe23Leu	278	0		336	14	NM_001257963	0	0	2	2	0	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	ENST00000284770.5	37	CCDS3844.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611807	0.66558	.	.	ENSG00000154553	ENST00000284770;ENST00000284771;ENST00000284767	T;T;T	0.26223	1.75;1.75;1.75	5.56	2.38	0.29361	PDZ/DHR/GLGF (4);	0.047434	0.85682	D	0.000000	T	0.33556	0.0867	M	0.70787	2.145	0.58432	D	0.999996	D;P;B	0.54964	0.969;0.516;0.052	P;B;B	0.51193	0.662;0.187;0.082	T	0.10222	-1.0639	10	0.87932	D	0	-14.814	6.1372	0.20239	0.2321:0.0:0.6161:0.1518	.	23;23;23	Q53GG5-3;Q53GG5-2;Q53GG5	.;.;PDLI3_HUMAN	L	23	ENSP00000284770:F23L;ENSP00000284771:F23L;ENSP00000284767:F23L	ENSP00000284767:F23L	F	-	3	2	PDLIM3	186693514	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.358000	0.59442	0.681000	0.31386	0.555000	0.69702	TTC	.		0.672	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360499.2	NM_014476	
NSUN2	54888	hgsc.bcm.edu	37	5	6633042	6633042	+	Silent	SNP	C	C	T	rs10062086	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:6633042C>T	ENST00000264670.6	-	1	362	c.51G>A	c.(49-51)gaG>gaA	p.E17E	SRD5A1_ENST00000537411.1_5'Flank|NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000538824.1_5'Flank|NSUN2_ENST00000506139.1_Silent_p.E17E|SRD5A1_ENST00000274192.5_5'Flank	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	17					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCTCCGCGTCCTCCGGCCGCT	0.781													C|||	1385	0.276558	0.2829	0.3905	5008	,	,		9693	0.1587		0.3917	False		,,,				2504	0.1902				p.E17E		.											.	NSUN2-91	0			c.G51A						.						2.0	3.0	2.0					5																	6633042		1293	2804	4097	SO:0001819	synonymous_variant	54888	exon1			CGCGTCCTCCGGC	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.51G>A	5.37:g.6633042C>T		0	0		4	4	NM_017755	0	0	0	1	1	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			C|0.687;T|0.313		0.781	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000539938.1_5'Flank|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		4	4	NM_001047	0	0	0	3	3	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
ADAMTS6	11174	hgsc.bcm.edu;bcgsc.ca	37	5	64468661	64468661	+	5'UTR	SNP	G	G	A			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:64468661G>A	ENST00000314351.5	-	0	744							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CGCCTTACCTGGCCCCAGTCT	0.557																																					p.Q1029X		.											.	ADAMTS6-226	0			c.C3085T						.						71.0	69.0	70.0					5																	64468661		2203	4300	6503	SO:0001623	5_prime_UTR_variant	11174	exon23			TTACCTGGCCCCA	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-578C>T	5.37:g.64468661G>A		84	0		71	6	NM_197941	0	0	0	0	0	Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Nonsense_Mutation	SNP	ENST00000314351.5	37		.	.	.	.	.	.	.	.	.	.	G	48	14.263330	0.99787	.	.	ENSG00000049192	ENST00000381055	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	19.5135	0.95154	0.0:0.0:1.0:0.0	.	.	.	.	X	1029	.	ENSP00000370443:Q1029X	Q	-	1	0	ADAMTS6	64504417	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.476000	0.97823	2.622000	0.88805	0.650000	0.86243	CAG	.		0.557	ADAMTS6-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000157334.2	NM_197941	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB-AS1_ENST00000498871.2_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		7	7	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797105	128797105	+	Silent	SNP	G	G	A	rs72663400	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:128797105G>A	ENST00000274487.4	+	2	529	c.384G>A	c.(382-384)ggG>ggA	p.G128G	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	128	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATCCAGCGGGGCTGCCGCCT	0.796													G|||	947	0.189097	0.1846	0.1268	5008	,	,		6055	0.3313		0.1103	False		,,,				2504	0.1738				p.G128G		.											.	ADAMTS19-295	0			c.G384A						.	G		185,1469		5,175,647	1.0	1.0	1.0		384	-0.3	0.9	5	dbSNP_130	1	240,3160		6,228,1466	no	coding-synonymous	ADAMTS19	NM_133638.3		11,403,2113	AA,AG,GG		7.0588,11.185,8.4092		128/1208	128797105	425,4629	827	1700	2527	SO:0001819	synonymous_variant	171019	exon2			CAGCGGGGCTGCC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.384G>A	5.37:g.128797105G>A		1	0		8	5	NM_133638	0	0	0	0	0		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			G|0.815;A|0.185		0.796	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140222697	140222697	+	Silent	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:140222697G>T	ENST00000531613.1	+	1	1791	c.1791G>T	c.(1789-1791)gtG>gtT	p.V597V	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.V597V|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	597	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCGCAGTGGACGCCGACT	0.692																																					p.V597V		.											.	PCDHA8-92	0			c.G1791T						.						72.0	73.0	73.0					5																	140222697		2197	4265	6462	SO:0001819	synonymous_variant	56140	exon1			CGCAGTGGACGCC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1791G>T	5.37:g.140222697G>T		90	0		283	44	NM_031856	0	0	0	0	0	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.		0.692	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHB7	56129	broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		.											.	PCDHB7-95	1	Substitution - coding silent(1)	lung(1)	c.G1578T						.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		149	0		430	13	NM_018940	0	0	14	24	10	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHB10	56126	broad.mit.edu	37	5	140574170	140574175	+	In_Frame_Del	DEL	AGGCCG	AGGCCG	-	rs58244182|rs140613424|rs140393827	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:140574170_140574175delAGGCCG	ENST00000239446.4	+	1	2229_2234	c.2045_2050delAGGCCG	c.(2044-2052)caggccgag>cag	p.AE683del		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	683					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCAGGCCCAGGCCGAGGCCGACTT	0.704														2124	0.424121	0.4372	0.4971	5008	,	,		11585	0.5347		0.3658	False		,,,				2504	0.3006				p.682_684del		.											.	PCDHB10-92	0			c.2045_2050del						.			851,2755		246,359,1198						2.2	0.0		dbSNP_129	38	1442,5672		362,718,2477	no	coding	PCDHB10	NM_018930.3		608,1077,3675	A1A1,A1R,RR		20.2699,23.5996,21.3899				2293,8427				SO:0001651	inframe_deletion	56126	exon1			AGGCCCAGGCCGA	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2045_2050delAGGCCG	5.37:g.140574176_140574181delAGGCCG	ENSP00000239446:p.Ala683_Glu684del	10	0		66	10	NM_018930	0	0	0	0	0	Q96T99	In_Frame_Del	DEL	ENST00000239446.4	37	CCDS4252.1																																																																																			-|0.750;GGCCGA|0.250		0.704	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
HK3	3101	bcgsc.ca	37	5	176318043	176318043	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr5:176318043G>A	ENST00000292432.5	-	4	500	c.409C>T	c.(409-411)Cag>Tag	p.Q137*		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	137	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTACCTGCTGGCCAGCACCC	0.627																																					p.Q137X		.											.	HK3-294	0			c.C409T						.						51.0	52.0	52.0					5																	176318043		2203	4299	6502	SO:0001587	stop_gained	3101	exon4			CCTGCTGGCCAGC		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.409C>T	5.37:g.176318043G>A	ENSP00000292432:p.Gln137*	94	3		79	29	NM_002115	0	0	0	0	0	Q8N1E7	Nonsense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	34	5.372776	0.95923	.	.	ENSG00000160883	ENST00000292432	.	.	.	4.96	4.96	0.65561	.	0.000000	0.52532	D	0.000074	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-21.7178	13.7779	0.63066	0.0:0.1549:0.8451:0.0	.	.	.	.	X	137	.	ENSP00000292432:Q137X	Q	-	1	0	HK3	176250649	0.106000	0.21978	1.000000	0.80357	0.949000	0.60115	0.411000	0.21115	2.460000	0.83146	0.561000	0.74099	CAG	.		0.627	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
HLA-B	3106	hgsc.bcm.edu	37	6	31323953	31323960	+	Frame_Shift_Del	DEL	CCAGCTTG	CCAGCTTG	-	rs113893121|rs151341334|rs151341333|rs1131279|rs137854786|rs1131275|rs1131285	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	CCAGCTTG	CCAGCTTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:31323953_31323960delCCAGCTTG	ENST00000412585.2	-	3	631_638	c.603_610delCAAGCTGG	c.(601-612)gacaagctggagfs	p.DKL201fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	201	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCAGCGCGCTCCAGCTTGTCCTTCCCGT	0.654									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.201_204del		.											.	HLA-B-90	0			c.603_610del						.																																			SO:0001589	frameshift_variant	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	CGCGCTCCAGCTT	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.603_610delCAAGCTGG	6.37:g.31323953_31323960delCCAGCTTG	ENSP00000399168:p.Asp201fs	39	0		64	0	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.654	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
VARS	7407	hgsc.bcm.edu	37	6	31762803	31762803	+	Silent	SNP	G	G	A			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:31762803G>A	ENST00000375663.3	-	2	632	c.192C>T	c.(190-192)ccC>ccT	p.P64P	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	64					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	AGAGCCCACCGGGCCCCTGCT	0.751																																					p.P64P		.											.	VARS-93	0			c.C192T						.						7.0	11.0	10.0					6																	31762803		1255	2317	3572	SO:0001819	synonymous_variant	7407	exon2			CCCACCGGGCCCC	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.192C>T	6.37:g.31762803G>A		1	0		18	8	NM_006295	0	0	3	5	2	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Silent	SNP	ENST00000375663.3	37	CCDS34412.1																																																																																			.		0.751	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
SLC35B2	347734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44222996	44222996	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:44222996C>T	ENST00000393812.3	-	4	889	c.746G>A	c.(745-747)gGg>gAg	p.G249E	SLC35B2_ENST00000393810.1_3'UTR|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000538577.1_Missense_Mutation_p.G156E|SLC35B2_ENST00000537814.1_Missense_Mutation_p.G116E|SLC35B2_ENST00000495706.1_5'UTR	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	249					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CATGCTGACCCCAATGGAGAT	0.557																																					p.G249E		.											.	SLC35B2-91	0			c.G746A						.						68.0	67.0	67.0					6																	44222996		2203	4300	6503	SO:0001583	missense	347734	exon4			CTGACCCCAATGG	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.746G>A	6.37:g.44222996C>T	ENSP00000377401:p.Gly249Glu	147	0		162	33	NM_178148	0	0	18	18	0	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	37	CCDS34462.1	.	.	.	.	.	.	.	.	.	.	c	35	5.514971	0.96402	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	D;D;D	0.86230	-2.09;-2.09;-2.09	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.95900	0.8665	H	0.96720	3.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97149	0.9830	10	0.87932	D	0	-4.2793	19.0958	0.93251	0.0:1.0:0.0:0.0	.	156;249	F5H7Y9;Q8TB61	.;S35B2_HUMAN	E	249;116;156;249	ENSP00000377401:G249E;ENSP00000440340:G116E;ENSP00000443845:G156E	ENSP00000342455:G249E	G	-	2	0	SLC35B2	44330974	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	7.802000	0.85969	2.533000	0.85409	0.538000	0.68166	GGG	.		0.557	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369756.3_Silent_p.G120G|FAM46A_ENST00000369754.3_Silent_p.G58G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		.											.	FAM46A-90	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	6.37:g.82461742G>A		24	0		76	6	NM_017633	0	0	0	0	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		0	0		16	16	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
LAMA4	3910	hgsc.bcm.edu	37	6	112460964	112460964	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:112460964G>T	ENST00000230538.7	-	23	3497	c.3100C>A	c.(3100-3102)Cca>Aca	p.P1034T	LAMA4_ENST00000424408.2_Missense_Mutation_p.P1027T|LAMA4_ENST00000522006.1_Missense_Mutation_p.P1027T|LAMA4_ENST00000389463.4_Missense_Mutation_p.P1027T	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1034	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CGGGCACATGGCACTGATGTG	0.423																																					p.P1034T		.											.	LAMA4-140	0			c.C3100A						.						114.0	111.0	112.0					6																	112460964		2203	4300	6503	SO:0001583	missense	3910	exon23			CACATGGCACTGA		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3100C>A	6.37:g.112460964G>T	ENSP00000230538:p.Pro1034Thr	105	0		79	4	NM_001105206	0	0	0	0	0	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486693	0.84854	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.15017	2.46;2.47;2.47;2.47	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);Laminin G domain (1);	0.048263	0.85682	D	0.000000	T	0.41419	0.1158	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.45234	-0.9275	10	0.87932	D	0	.	19.2521	0.93929	0.0:0.0:1.0:0.0	.	1034;1027	Q16363;Q16363-2	LAMA4_HUMAN;.	T	1034;1027;1027;1027	ENSP00000230538:P1034T;ENSP00000429488:P1027T;ENSP00000374114:P1027T;ENSP00000416470:P1027T	ENSP00000230538:P1034T	P	-	1	0	LAMA4	112567657	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.551000	0.90678	2.542000	0.85734	0.655000	0.94253	CCA	.		0.423	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
MAP7	9053	hgsc.bcm.edu	37	6	136682172	136682172	+	Missense_Mutation	SNP	G	G	A	rs2076190	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:136682172G>A	ENST00000354570.3	-	12	2082	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W	MAP7_ENST00000438100.2_Missense_Mutation_p.R543W|MAP7_ENST00000432797.2_Missense_Mutation_p.R412W|MAP7_ENST00000454590.1_Missense_Mutation_p.R580W|MAP7_ENST00000544465.1_Missense_Mutation_p.R543W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	558			R -> W (in dbSNP:rs2076190). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GCCTCCTCCCGCTCGCGCAGC	0.761													G|||	3864	0.771565	0.7156	0.8026	5008	,	,		9294	0.6736		0.8459	False		,,,				2504	0.8497				p.R588W		.											.	MAP7-90	0			c.C1762T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	3211,1131		1187,837,147	7.0	8.0	8.0		1738,1762,1627,1738,1627,1561,1390,1234,1234,1672	2.8	1.0	6	dbSNP_96	8	7130,1264		3035,1060,102	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	101,101,101,101,101,101,101,101,101,101	4222,1897,249	AA,AG,GG		15.0584,26.0479,18.805	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	580/772,588/780,543/735,580/772,543/735,521/713,464/656,412/604,412/604,558/750	136682172	10341,2395	2171	4197	6368	SO:0001583	missense	9053	exon12			CCTCCCGCTCGCG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1672C>T	6.37:g.136682172G>A	ENSP00000346581:p.Arg558Trp	0	0		23	23	NM_001198609	1	0	0	2	1	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	1644	0.7527472527472527	337	0.6849593495934959	282	0.7790055248618785	382	0.6678321678321678	643	0.8482849604221636	G	14.45	2.539239	0.45176	0.739521	0.849416	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	4.89	2.78	0.32641	.	0.296091	0.22491	N	0.059376	T	0.35189	0.0923	M	0.82517	2.595	0.26264	P	0.9785292	D;D;D;D;D;D	0.76494	0.995;0.994;0.995;0.999;0.998;0.998	P;P;P;P;P;P	0.60886	0.751;0.636;0.751;0.809;0.809;0.88	T	0.38779	-0.9645	9	0.52906	T	0.07	-5.3629	10.9226	0.47174	0.0:0.0:0.3457:0.6543	rs2076190;rs2230172;rs6928528	543;543;580;464;521;558	B7Z290;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;MAP7_HUMAN	W	558;580;543;543;412;464	ENSP00000346581:R558W;ENSP00000414712:R580W;ENSP00000445737:R543W;ENSP00000400790:R543W;ENSP00000414879:R412W	ENSP00000344217:R464W	R	-	1	2	MAP7	136723865	0.441000	0.25626	0.960000	0.40013	0.620000	0.37586	1.543000	0.36147	0.988000	0.38734	0.555000	0.69702	CGG	G|0.243;A|0.757		0.761	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
GRM1	2911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	146678777	146678777	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:146678777A>G	ENST00000282753.1	+	5	1784	c.1549A>G	c.(1549-1551)Agt>Ggt	p.S517G	GRM1_ENST00000392299.2_Missense_Mutation_p.S517G|GRM1_ENST00000361719.2_Missense_Mutation_p.S517G|GRM1_ENST00000355289.4_Missense_Mutation_p.S517G|GRM1_ENST00000492807.2_Missense_Mutation_p.S517G|GRM1_ENST00000507907.1_Missense_Mutation_p.S517G			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	517					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GATGAACAAGAGTGGAGTGGT	0.468																																					p.S517G		.											.	GRM1-1080	0			c.A1549G						.						164.0	130.0	141.0					6																	146678777		2203	4300	6503	SO:0001583	missense	2911	exon6			AACAAGAGTGGAG	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1549A>G	6.37:g.146678777A>G	ENSP00000282753:p.Ser517Gly	192	0		202	24	NM_000838	0	0	0	0	0	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.910384	0.52439	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88741	-2.38;-2.42;-2.42;-2.38;-2.41;-2.42	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.87573	0.6211	L	0.61218	1.895	0.80722	D	1	P;D;P	0.53885	0.486;0.963;0.486	B;P;B	0.50082	0.205;0.63;0.205	D	0.87078	0.2164	10	0.37606	T	0.19	.	15.57	0.76326	1.0:0.0:0.0:0.0	.	517;517;517	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	G	517	ENSP00000354896:S517G;ENSP00000376119:S517G;ENSP00000424095:S517G;ENSP00000282753:S517G;ENSP00000347437:S517G;ENSP00000425599:S517G	ENSP00000282753:S517G	S	+	1	0	GRM1	146720470	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	8.930000	0.92872	2.081000	0.62600	0.533000	0.62120	AGT	.		0.468	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		0	0		5	5	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
USP42	84132	hgsc.bcm.edu	37	7	6193565	6193565	+	Missense_Mutation	SNP	A	A	G	rs199569334	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr7:6193565A>G	ENST00000306177.5	+	15	2538	c.2380A>G	c.(2380-2382)Atg>Gtg	p.M794V		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	794	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CTGGGAGGCCATGGCCGTCGC	0.721													A|||	2	0.000399361	0.0	0.0	5008	,	,		11260	0.0		0.002	False		,,,				2504	0.0				p.M794V		.											.	USP42-659	0			c.A2380G						.	A	VAL/MET	2,3542		0,2,1770	9.0	11.0	11.0		2380	-9.4	0.0	7		11	12,7846		0,12,3917	no	missense	USP42	NM_032172.2	21	0,14,5687	GG,GA,AA		0.1527,0.0564,0.1228	benign	794/1317	6193565	14,11388	1772	3929	5701	SO:0001583	missense	84132	exon15			GAGGCCATGGCCG	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2380A>G	7.37:g.6193565A>G	ENSP00000301962:p.Met794Val	0	0		20	7	NM_032172	0	0	0	1	1	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	4	0.0018315018315018315	0	0.0	0	0.0	2	0.0034965034965034965	2	0.002638522427440633	A	5.754	0.323484	0.10900	5.64E-4	0.001527	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.11385	2.78;3.2	5.46	-9.35	0.00633	.	1.382410	0.04376	N	0.359974	T	0.02610	0.0079	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26503	-1.0101	10	0.05620	T	0.96	.	6.3886	0.21574	0.3064:0.0982:0.4972:0.0982	.	794;794	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	V	794;640	ENSP00000301962:M794V;ENSP00000408217:M640V	ENSP00000301962:M794V	M	+	1	0	USP42	6160090	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.241000	0.01196	-2.897000	0.00313	-1.426000	0.01102	ATG	A|0.998;G|0.002		0.721	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	1	0		28	5	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
MFHAS1	9258	hgsc.bcm.edu	37	8	8750467	8750467	+	Silent	SNP	A	A	G	rs1062988	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:8750467A>G	ENST00000276282.6	-	1	688	c.102T>C	c.(100-102)ctT>ctC	p.L34L	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	34										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		cggcggcggTAAGCGTGAGCT	0.741													G|||	814	0.16254	0.3419	0.1196	5008	,	,		8355	0.001		0.1521	False		,,,				2504	0.1278				p.L34L	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.T102C						.	G		875,3021		81,713,1154	4.0	4.0	4.0		102	2.3	1.0	8	dbSNP_86	4	854,6846		52,750,3048	no	coding-synonymous	MFHAS1	NM_004225.2		133,1463,4202	GG,GA,AA		11.0909,22.4589,14.9103		34/1053	8750467	1729,9867	1948	3850	5798	SO:0001819	synonymous_variant	9258	exon1			GGCGGTAAGCGTG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.102T>C	8.37:g.8750467A>G		0	0		12	5	NM_004225	0	0	0	0	0	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																			A|0.857;G|0.143		0.741	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
SDR16C5	195814	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	57221513	57221513	+	Missense_Mutation	SNP	C	C	G	rs140271354		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:57221513C>G	ENST00000303749.3	-	4	1176	c.539G>C	c.(538-540)gGa>gCa	p.G180A	SDR16C5_ENST00000522671.1_Missense_Mutation_p.G180A|SDR16C5_ENST00000396721.2_Missense_Mutation_p.G136A	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	180					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						TCCACTTAATCCAGCTGAACT	0.328																																					p.G180A		.											.	SDR16C5-92	0			c.G539C						.						112.0	105.0	107.0					8																	57221513		2203	4300	6503	SO:0001583	missense	195814	exon4			CTTAATCCAGCTG		CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.539G>C	8.37:g.57221513C>G	ENSP00000307607:p.Gly180Ala	49	0		70	5	NM_138969	0	0	0	0	0	B4DGK2|Q330K3|Q8TDV9|Q96LX1	Missense_Mutation	SNP	ENST00000303749.3	37	CCDS6167.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357042	0.82243	.	.	ENSG00000170786	ENST00000396721;ENST00000303749;ENST00000522671;ENST00000538514	D;D;T	0.90844	-2.74;-2.74;0.56	5.9	5.9	0.94986	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93844	0.8031	L	0.49699	1.58	0.80722	D	1	D;D;P	0.64830	0.963;0.994;0.763	D;P;P	0.65573	0.936;0.787;0.714	D	0.92876	0.6319	10	0.46703	T	0.11	.	20.2704	0.98474	0.0:1.0:0.0:0.0	.	136;180;180	Q8N3Y7-2;G3V145;Q8N3Y7	.;.;RDHE2_HUMAN	A	136;180;180;180	ENSP00000379947:G136A;ENSP00000307607:G180A;ENSP00000431010:G180A	ENSP00000307607:G180A	G	-	2	0	SDR16C5	57384067	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.673000	0.83973	2.793000	0.96121	0.591000	0.81541	GGA	C|1.000;T|0.000		0.328	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378235.1	NM_138969	
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	0	0		26	10	NM_152414	0	0	1	4	3		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	E2F5_ENST00000418930.2_Silent_p.A44A|RP11-219B4.7_ENST00000562577.1_RNA|RP11-219B4.3_ENST00000520129.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA|E2F5_ENST00000256117.5_Silent_p.A44A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		0	0		9	9	NM_001083588	0	0	0	0	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
ESRP1	54845	bcgsc.ca	37	8	95655596	95655596	+	Silent	SNP	T	T	C	rs72676907	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:95655596T>C	ENST00000433389.2	+	3	517	c.327T>C	c.(325-327)gaT>gaC	p.D109D	ESRP1_ENST00000423620.2_Silent_p.D109D|ESRP1_ENST00000358397.5_Silent_p.D109D|ESRP1_ENST00000454170.2_Silent_p.D109D	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	109					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TCTGTACTGATGGGCAGCTTC	0.468													T|||	323	0.0644968	0.0053	0.0735	5008	,	,		19201	0.002		0.1968	False		,,,				2504	0.0665				p.D109D		.											.	ESRP1-94	0			c.T327C						.	T	,,,,	127,3771		4,119,1826	110.0	106.0	107.0		327,327,327,327,327	-2.6	0.9	8	dbSNP_130	107	1501,6773		135,1231,2771	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ESRP1	NM_001034915.2,NM_001122825.1,NM_001122826.1,NM_001122827.1,NM_017697.3	,,,,	139,1350,4597	CC,CT,TT		18.1412,3.2581,13.375	,,,,	109/678,109/609,109/660,109/605,109/682	95655596	1628,10544	1949	4137	6086	SO:0001819	synonymous_variant	54845	exon3			TACTGATGGGCAG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.327T>C	8.37:g.95655596T>C		139	1		127	6	NM_001122827	0	0	0	0	0	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Silent	SNP	ENST00000433389.2	37	CCDS47897.1																																																																																			T|0.887;C|0.113		0.468	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		12	12	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		16	16	NM_213605	0	0	0	3	3		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
DMRT1	1761	hgsc.bcm.edu	37	9	841971	841971	+	Missense_Mutation	SNP	T	T	A	rs3739583	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr9:841971T>A	ENST00000382276.3	+	1	282	c.133T>A	c.(133-135)Tcg>Acg	p.S45T	DMRT1_ENST00000569227.1_5'Flank	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	45			S -> T (in dbSNP:rs3739583). {ECO:0000269|PubMed:10332030, ECO:0000269|PubMed:10857744, ECO:0000269|PubMed:16617334}.		cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		GGCCAGCGGCTCGAGCGCCGG	0.756													T|||	1125	0.224641	0.0923	0.2017	5008	,	,		10887	0.4722		0.1223	False		,,,				2504	0.2699				p.S45T		.											.	DMRT1-515	0			c.T133A						.	T	THR/SER	381,3479		16,349,1565	4.0	5.0	5.0		133	-1.9	0.0	9	dbSNP_107	5	945,6747		48,849,2949	no	missense	DMRT1	NM_021951.2	58	64,1198,4514	AA,AT,TT		12.2855,9.8705,11.4785	benign	45/374	841971	1326,10226	1930	3846	5776	SO:0001583	missense	1761	exon1			AGCGGCTCGAGCG	AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.133T>A	9.37:g.841971T>A	ENSP00000371711:p.Ser45Thr	1	0		13	7	NM_021951	0	0	0	0	0	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Missense_Mutation	SNP	ENST00000382276.3	37	CCDS6442.1	482	0.2206959706959707	65	0.13211382113821138	69	0.19060773480662985	259	0.4527972027972028	89	0.11741424802110818	t	3.227	-0.158317	0.06544	0.098705	0.122855	ENSG00000137090	ENST00000451501;ENST00000382276	T	0.18338	2.22	3.29	-1.87	0.07737	.	4.016930	0.01046	N	0.004398	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.16166	0.016	B	0.12156	0.007	T	0.46816	-0.9164	9	0.11485	T	0.65	.	2.6176	0.04907	0.219:0.1045:0.4923:0.1842	rs3739583;rs3739583	45	Q9Y5R6	DMRT1_HUMAN	T	45	ENSP00000371711:S45T	ENSP00000371711:S45T	S	+	1	0	DMRT1	831971	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.700000	0.05081	-0.232000	0.09811	0.454000	0.30748	TCG	T|0.317;A|0.683		0.756	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051489.2	NM_021951	
OMD	4958	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	95179219	95179219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr9:95179219A>G	ENST00000375550.4	-	2	897	c.622T>C	c.(622-624)Ttt>Ctt	p.F208L	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	208					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						ATTTTGGCAAAGATTTTGTCT	0.378			T	USP6	aneurysmal bone cysts																																p.F208L		.		Dom	yes		9	9q22.31	4958	osteomodulin		M	.	OMD-206	0			c.T622C						.						104.0	102.0	103.0					9																	95179219		2203	4300	6503	SO:0001583	missense	4958	exon2			TGGCAAAGATTTT	AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.622T>C	9.37:g.95179219A>G	ENSP00000364700:p.Phe208Leu	62	0		69	6	NM_005014	0	0	0	0	0	Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	37	CCDS6696.1	.	.	.	.	.	.	.	.	.	.	a	6.379	0.438128	0.12104	.	.	ENSG00000127083	ENST00000375550	T	0.03889	3.77	5.41	0.395	0.16304	.	0.299857	0.27253	N	0.020211	T	0.04861	0.0131	L	0.55481	1.735	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43180	-0.9407	10	0.18276	T	0.48	-4.5185	8.6377	0.33959	0.6313:0.0:0.3687:0.0	.	208	Q99983	OMD_HUMAN	L	208	ENSP00000364700:F208L	ENSP00000364700:F208L	F	-	1	0	OMD	94219040	0.610000	0.26983	0.066000	0.19879	0.974000	0.67602	1.003000	0.29809	0.080000	0.16959	-0.361000	0.07541	TTT	.		0.378	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014	
GPR144	347088	hgsc.bcm.edu	37	9	127215336	127215336	+	Silent	SNP	G	G	A	rs144326848	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr9:127215336G>A	ENST00000334810.1	+	4	360	c.360G>A	c.(358-360)ctG>ctA	p.L120L				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	120					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						CCGCCGTGCTGGTGTTCGACG	0.687													G|||	11	0.00219649	0.0	0.0014	5008	,	,		11135	0.0		0.0099	False		,,,				2504	0.0				p.L120L		.											.	.	0			c.G360A						.						4.0	7.0	6.0					9																	127215336		652	1515	2167	SO:0001819	synonymous_variant	347088	exon4			CGTGCTGGTGTTC	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.360G>A	9.37:g.127215336G>A		1	0		17	13	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Silent	SNP	ENST00000334810.1	37	CCDS48016.1																																																																																			G|0.997;A|0.003		0.687	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
NUP214	8021	broad.mit.edu	37	9	134074122	134074122	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr9:134074122G>T	ENST00000359428.5	+	29	5385	c.5241G>T	c.(5239-5241)caG>caT	p.Q1747H	NUP214_ENST00000483497.2_Missense_Mutation_p.Q573H|NUP214_ENST00000411637.2_Missense_Mutation_p.Q1737H|NUP214_ENST00000451030.1_Missense_Mutation_p.Q1748H			P35658	NU214_HUMAN	nucleoporin 214kDa	1747	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CCTTCAGTCAGCCTGGGTTCA	0.587			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.Q1747H	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.G5241T						.						104.0	86.0	92.0					9																	134074122		2203	4300	6503	SO:0001583	missense	8021	exon29			CAGTCAGCCTGGG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.5241G>T	9.37:g.134074122G>T	ENSP00000352400:p.Gln1747His	100	1		106	3	NM_005085	0	0	13	13	0	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173334	0.57584	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605;ENST00000483497	T;T;T;T	0.44083	1.19;0.93;0.93;0.93	5.81	3.97	0.46021	.	0.000000	0.42053	D	0.000778	T	0.42494	0.1205	N	0.08118	0	0.49389	D	0.999786	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.998;0.998	D;D;D;P;P	0.85130	0.997;0.994;0.994;0.891;0.891	T	0.46105	-0.9215	10	0.51188	T	0.08	-12.9848	11.9744	0.53083	0.1438:0.0:0.8562:0.0	.	573;1176;1341;1737;1747	B7ZAV2;F5H131;Q5JUP9;P35658-4;P35658	.;.;.;.;NU214_HUMAN	H	1747;1737;1748;1726;1341;1176;573	ENSP00000352400:Q1747H;ENSP00000396576:Q1737H;ENSP00000405014:Q1748H;ENSP00000436793:Q573H	ENSP00000352400:Q1747H	Q	+	3	2	NUP214	133063943	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	3.829000	0.55760	0.786000	0.33708	-0.448000	0.05591	CAG	.		0.587	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
NAP1L2	4674	broad.mit.edu	37	X	72433664	72433666	+	In_Frame_Del	DEL	TCC	TCC	-	rs369450592		TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chrX:72433664_72433666delTCC	ENST00000373517.3	-	1	1018_1020	c.663_665delGGA	c.(661-666)gaggac>gac	p.E221del	NAP1L2_ENST00000536638.1_In_Frame_Del_p.E79del	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	221	Glu-rich (acidic).				nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					CTCAATGTCGtcctcctcctcct	0.424														95	0.0251656	0.0272	0.0173	3775	,	,		14422	0.0069		0.0089	False		,,,				2504	0.0317				p.221_222del		.											.	NAP1L2-130	0			c.663_665del						.																																			SO:0001651	inframe_deletion	4674	exon1			ATGTCGTCCTCCT	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.663_665delGGA	X.37:g.72433673_72433675delTCC	ENSP00000362616:p.Glu221del	207	0		215	8	NM_021963	0	0	0	0	0	B2RE61|B4E161|Q8TAN6	In_Frame_Del	DEL	ENST00000373517.3	37	CCDS14423.1																																																																																			.		0.424	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1	NM_021963	
EIF3J	8669	hgsc.bcm.edu	37	15	44829394	44829395	+	Start_Codon_Ins	INS	-	-	GGCGGCGGC	rs560378535	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr15:44829394_44829395insGGCGGCGGC	ENST00000535391.1	+	0	14_15				EIF3J_ENST00000261868.5_Start_Codon_Ins|EIF3J-AS1_ENST00000313807.4_lincRNA|EIF3J_ENST00000424492.3_Start_Codon_Ins					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		CGGCTCGAGATggcggcggcgg	0.723														9	0.00179712	0.0015	0.0043	5008	,	,		9718	0.0		0.001	False		,,,				2504	0.0031				p.M1delinsMAAA		.											.	EIF3J-68	0			c.2_3insGGCGGCGGC						.																																			SO:0001582	initiator_codon_variant	8669	exon1			TCGAGATGGCGGC	U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.12_20dupGGCGGCGGC	15.37:g.44829395_44829403dupGGCGGCGGC		103	1		212	27	NM_003758	0	0	0	0	0		In_Frame_Ins	INS	ENST00000535391.1	37																																																																																				.		0.723	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000396804.1	NM_003758	
C21orf58	54058	broad.mit.edu	37	21	47721985	47721986	+	In_Frame_Ins	INS	-	-	TGG	rs144178764|rs112899928|rs35902237|rs71318063	byFrequency	TCGA-OR-A5JO-01A-11D-A29I-10	TCGA-OR-A5JO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f124772a-7861-4fc1-a7cd-da437fbccf02	80f11d6b-2e96-4c29-bd49-ea8f1a398129	g.chr21:47721985_47721986insTGG	ENST00000291691.7	-	8	2032_2033	c.896_897insCCA	c.(895-897)cat>caCCAt	p.299_299H>HH	C21orf58_ENST00000397682.3_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397679.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397683.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397680.1_In_Frame_Ins_p.193_193H>HH	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	299	Poly-His.							p.H299_A300insH(3)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		GCCACACAGCAtggtggtggtg	0.708														1382	0.275958	0.1384	0.4063	5008	,	,		16708	0.3046		0.3091	False		,,,				2504	0.3057				p.H299delinsHH		.											.	C21orf58-91	3	Insertion - In frame(3)	breast(2)|central_nervous_system(1)	c.897_898insCCA						.																																			SO:0001652	inframe_insertion	54058	exon8			CACAGCATGGTGG		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.894_896dupCCA	21.37:g.47721992_47721994dupTGG	ENSP00000291691:p.His299dup	18	0		69	14	NM_058180	0	0	0	0	0	B3KPI1	In_Frame_Ins	INS	ENST00000291691.7	37	CCDS13735.1																																																																																			-|0.500;TGG|0.500		0.708	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
