#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	1	0		11	11	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		1	0		9	9	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
NOL9	79707	hgsc.bcm.edu	37	1	6614415	6614415	+	Missense_Mutation	SNP	A	A	G	rs6693400	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:6614415A>G	ENST00000377705.5	-	1	180	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000333172.6_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	50			W -> R (in dbSNP:rs6693400). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AGTAACCGCCACCGTAGGCGC	0.781													G|||	4907	0.979832	0.9281	0.9914	5008	,	,		8643	1.0		1.0	False		,,,				2504	1.0				p.W50R		.											.	NOL9-515	0			c.T148C						.	G	ARG/TRP	1625,149		742,141,4	2.0	3.0	3.0		148	4.0	0.8	1	dbSNP_116	3	3888,4		1942,4,0	no	missense	NOL9	NM_024654.4	101	2684,145,4	GG,GA,AA		0.1028,8.3991,2.7003	benign	50/703	6614415	5513,153	887	1946	2833	SO:0001583	missense	79707	exon1			ACCGCCACCGTAG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.148T>C	1.37:g.6614415A>G	ENSP00000366934:p.Trp50Arg	0	0		10	10	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2140	0.9798534798534798	452	0.9186991869918699	358	0.988950276243094	572	1.0	758	1.0	G	0.460	-0.889729	0.02511	0.916009	0.998972	ENSG00000162408	ENST00000377705	T	0.14516	2.5	4.0	4.0	0.46444	.	0.198450	0.25411	N	0.030874	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38972	-0.9636	9	0.02654	T	1	-21.655	7.9426	0.29967	0.1142:0.0:0.8858:0.0	rs6693400;rs57411617	50	Q5SY16	NOL9_HUMAN	R	50	ENSP00000366934:W50R	ENSP00000366934:W50R	W	-	1	0	NOL9	6537002	0.793000	0.28825	0.806000	0.32338	0.033000	0.12548	0.756000	0.26419	1.042000	0.40150	-0.282000	0.10007	TGG	A|0.020;G|0.980		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
RPS6KA1	6195	hgsc.bcm.edu	37	1	26856462	26856462	+	Silent	SNP	T	T	G	rs11800553	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:26856462T>G	ENST00000374168.2	+	1	205	c.51T>G	c.(49-51)ccT>ccG	p.P17P	RPS6KA1_ENST00000374166.4_Silent_p.P17P|RPS6KA1_ENST00000526792.1_5'Flank|RPS6KA1_ENST00000374162.2_5'Flank	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	17					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCTAGTGCCTCTGGACCCGG	0.786													G|||	4691	0.936701	0.9259	0.9179	5008	,	,		6031	0.9583		0.9553	False		,,,				2504	0.9233				p.P17P		.											.	RPS6KA1-510	0			c.T51G						.						2.0	2.0	2.0					1																	26856462		1084	2070	3154	SO:0001819	synonymous_variant	6195	exon1			AGTGCCTCTGGAC	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.51T>G	1.37:g.26856462T>G		0	0		6	6	NM_002953	0	0	0	0	0	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			T|0.065;G|0.935		0.786	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
RIMKLA	284716	bcgsc.ca	37	1	42880516	42880516	+	Silent	SNP	T	T	C	rs1055055	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:42880516T>C	ENST00000431473.3	+	5	1176	c.1047T>C	c.(1045-1047)agT>agC	p.S349S		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	349					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)	p.S308S(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						CTACCTCTAGTGAAAGTGAGC	0.552													C|||	2451	0.489417	0.5197	0.5173	5008	,	,		20089	0.3433		0.6441	False		,,,				2504	0.4202				p.S349S		.											.	RIMKLA-90	1	Substitution - coding silent(1)	stomach(1)	c.T1047C						.	C		2364,2042	566.4+/-381.9	644,1076,483	73.0	72.0	73.0		1047	-3.2	0.9	1	dbSNP_86	73	5474,3126	476.6+/-369.4	1759,1956,585	yes	coding-synonymous	RIMKLA	NM_173642.3		2403,3032,1068	CC,CT,TT		36.3488,46.3459,39.7355		349/392	42880516	7838,5168	2203	4300	6503	SO:0001819	synonymous_variant	284716	exon5			CTCTAGTGAAAGT	BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.1047T>C	1.37:g.42880516T>C		184	1		134	6	NM_173642	0	0	4	4	0	Q5VUS5	Silent	SNP	ENST00000431473.3	37	CCDS466.2																																																																																			T|0.444;C|0.556		0.552	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642	
C1orf228	339541	broad.mit.edu	37	1	45166683	45166683	+	Silent	SNP	C	C	T	rs76132381	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:45166683C>T	ENST00000458657.2	+	6	838	c.531C>T	c.(529-531)caC>caT	p.H177H	C1orf228_ENST00000444751.1_3'UTR|C1orf228_ENST00000535358.1_Silent_p.H177H			Q6PIY5	CA228_HUMAN	chromosome 1 open reading frame 228	177										central_nervous_system(1)	1						CTTTGGTCCACGGCAATCCCA	0.483													C|||	19	0.00379393	0.0	0.0029	5008	,	,		18889	0.004		0.0109	False		,,,				2504	0.002				p.H177H		.											.	.	0			c.C531T						.	C		5,1379		0,5,687	76.0	72.0	73.0		531	-4.5	1.0	1	dbSNP_132	73	54,3128		0,54,1537	no	coding-synonymous	C1orf228	NM_001145636.1		0,59,2224	TT,TC,CC		1.697,0.3613,1.2922		177/441	45166683	59,4507	692	1591	2283	SO:0001819	synonymous_variant	339541	exon5			GGTCCACGGCAAT	AL122004, AY254217, BC026115	CCDS53311.1	1p34.1	2011-02-22	2009-03-17	2009-03-17	ENSG00000198520	ENSG00000198520			34345	protein-coding gene	gene with protein product			"""non-protein coding RNA 82"""	NCRNA00082		12477932	Standard	NM_001145636		Approved	MGC33556, p40	uc001cmf.2	Q6PIY5	OTTHUMG00000007834	ENST00000458657.2:c.531C>T	1.37:g.45166683C>T		226	2		150	5	NM_001145636	0	0	0	0	0	A1KXE5	Silent	SNP	ENST00000458657.2	37	CCDS53311.1	10	0.004578754578754579	0	0.0	1	0.0027624309392265192	1	0.0017482517482517483	8	0.010554089709762533	C	9.324	1.058756	0.19987	0.003613	0.01697	ENSG00000198520	ENST00000434068	.	.	.	6.11	-4.51	0.03483	.	.	.	.	.	T	0.48021	0.1477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63427	-0.6640	4	.	.	.	-23.5998	15.2914	0.73868	0.0:0.5255:0.0:0.4745	.	.	.	.	W	44	.	.	R	+	1	2	C1orf228	44939270	0.005000	0.15991	0.980000	0.43619	0.990000	0.78478	-1.651000	0.01989	-0.468000	0.06922	-0.290000	0.09829	CGG	C|0.993;T|0.007		0.483	C1orf228-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023125.2	NM_001145636	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271912	45271912	+	Silent	SNP	G	G	A	rs17886118	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:45271912G>A	ENST00000339355.2	-	1	435	c.429C>T	c.(427-429)gaC>gaT	p.D143D	BTBD19_ENST00000450269.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.D143D|BTBD19_ENST00000453418.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	143						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					GCGCGGCCTCGTCGCTGGAGT	0.731													G|||	882	0.176118	0.0855	0.2421	5008	,	,		10287	0.2847		0.1412	False		,,,				2504	0.1759				p.D143D		.											.	TCTEX1D4-91	0			c.C429T						.	G		233,2847		5,223,1312	2.0	3.0	3.0		429	-11.1	0.0	1	dbSNP_124	3	925,5617		49,827,2395	no	coding-synonymous	TCTEX1D4	NM_001013632.2		54,1050,3707	AA,AG,GG		14.1394,7.5649,12.0349		143/222	45271912	1158,8464	1540	3271	4811	SO:0001819	synonymous_variant	343521	exon2			GGCCTCGTCGCTG	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.429C>T	1.37:g.45271912G>A		0	0		4	4	NM_001013632	0	0	0	1	1		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			G|0.822;A|0.178		0.731	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
JAK1	3716	bcgsc.ca	37	1	65311262	65311262	+	Silent	SNP	G	G	A	rs2230587	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:65311262G>A	ENST00000342505.4	-	15	2297	c.2049C>T	c.(2047-2049)agC>agT	p.S683S	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	683	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TAAGGACATCGCTTTTCCGGT	0.493			Mis		ALL								G|||	993	0.198283	0.2035	0.2046	5008	,	,		20097	0.3165		0.1153	False		,,,				2504	0.1503				p.S683S		.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1-3900	0			c.C2049T						.	G		741,3175		60,621,1277	148.0	154.0	152.0		2049	-6.4	0.5	1	dbSNP_98	152	916,7392		41,834,3279	no	coding-synonymous	JAK1	NM_002227.2		101,1455,4556	AA,AG,GG		11.0255,18.9224,13.5553		683/1155	65311262	1657,10567	1958	4154	6112	SO:0001819	synonymous_variant	3716	exon15			GACATCGCTTTTC	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2049C>T	1.37:g.65311262G>A		133	2		98	6	NM_002227	0	0	2	2	0	Q59GQ2|Q9UD26	Silent	SNP	ENST00000342505.4	37	CCDS41346.1																																																																																			G|0.823;A|0.177		0.493	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
LRRC40	55631	bcgsc.ca	37	1	70625071	70625071	+	Missense_Mutation	SNP	G	G	A	rs145682711	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:70625071G>A	ENST00000370952.3	-	10	1241	c.1162C>T	c.(1162-1164)Cca>Tca	p.P388S		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	388						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						GATTCACTTGGTAGTGTCATG	0.313													G|||	4	0.000798722	0.0008	0.0014	5008	,	,		14705	0.0		0.001	False		,,,				2504	0.001				p.P388S		.											.	LRRC40-91	0			c.C1162T						.	G	SER/PRO	3,4403	6.2+/-15.9	0,3,2200	99.0	94.0	96.0		1162	5.6	1.0	1	dbSNP_134	96	36,8564	24.6+/-71.5	0,36,4264	yes	missense	LRRC40	NM_017768.4	74	0,39,6464	AA,AG,GG		0.4186,0.0681,0.2999	benign	388/603	70625071	39,12967	2203	4300	6503	SO:0001583	missense	55631	exon10			CACTTGGTAGTGT		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1162C>T	1.37:g.70625071G>A	ENSP00000359990:p.Pro388Ser	276	0		157	6	NM_017768	0	0	2	2	0	Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	CCDS646.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	21.6	4.172565	0.78452	6.81E-4	0.004186	ENSG00000066557	ENST00000370952	T	0.33438	1.41	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	M	0.69823	2.125	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.35968	-0.9767	10	0.06494	T	0.89	.	17.4495	0.87588	0.0:0.0:1.0:0.0	.	388	Q9H9A6	LRC40_HUMAN	S	388	ENSP00000359990:P388S	ENSP00000359990:P388S	P	-	1	0	LRRC40	70397659	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	7.096000	0.76960	2.644000	0.89710	0.655000	0.94253	CCA	G|0.998;A|0.002		0.313	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768	
GLMN	11146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	92712112	92712112	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:92712112G>C	ENST00000370360.3	-	19	1841	c.1760C>G	c.(1759-1761)tCt>tGt	p.S587C	GLMN_ENST00000534881.1_Missense_Mutation_p.S573C	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	587					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		ATTTTCTTCAGAGGTAGACTT	0.299									Multiple Glomus Tumors (of the Skin), Familial																												p.S587C		.											.	GLMN-227	0			c.C1760G						.						76.0	74.0	75.0					1																	92712112		2203	4298	6501	SO:0001583	missense	11146	exon19	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	TCTTCAGAGGTAG	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.1760C>G	1.37:g.92712112G>C	ENSP00000359385:p.Ser587Cys	102	0		66	64	NM_053274	0	0	0	7	7	Q5VVC3|Q9BVE8	Missense_Mutation	SNP	ENST00000370360.3	37	CCDS738.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541753	0.45280	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.49432	0.79;0.78	5.83	2.85	0.33270	.	0.622883	0.17711	N	0.164599	T	0.17023	0.0409	L	0.27053	0.805	0.32658	N	0.518462	B;B	0.33739	0.422;0.422	B;B	0.32980	0.156;0.156	T	0.04767	-1.0928	10	0.62326	D	0.03	-1.843	8.2724	0.31853	0.1404:0.2397:0.6199:0.0	.	573;587	B4DJ85;Q92990	.;GLMN_HUMAN	C	587;573	ENSP00000359385:S587C;ENSP00000440156:S573C	ENSP00000359385:S587C	S	-	2	0	GLMN	92484700	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.338000	0.43957	0.805000	0.34159	0.655000	0.94253	TCT	.		0.299	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	NM_007070	
ANKRD34A	284615	broad.mit.edu	37	1	145474799	145474799	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:145474799C>A	ENST00000323397.4	+	4	2764	c.1471C>A	c.(1471-1473)Cct>Act	p.P491T	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	491						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCTAGGTGGGCCTGGGGAGCC	0.622																																					p.P491T		.											.	ANKRD34A-68	0			c.C1471A						.						12.0	15.0	14.0					1																	145474799		2202	4298	6500	SO:0001583	missense	284615	exon4			GGTGGGCCTGGGG	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1471C>A	1.37:g.145474799C>A	ENSP00000314103:p.Pro491Thr	76	2		83	4	NM_001039888	0	0	2	2	0	B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861382	0.51482	.	.	ENSG00000181039	ENST00000323397	T	0.72942	-0.7	4.99	3.09	0.35607	.	0.000000	0.45361	D	0.000363	T	0.35128	0.0921	N	0.08118	0	0.31437	N	0.672379	P	0.48350	0.909	P	0.50440	0.641	T	0.25606	-1.0127	10	0.22109	T	0.4	-5.6579	5.8866	0.18884	0.1897:0.7139:0.0:0.0964	.	491	Q69YU3	AN34A_HUMAN	T	491	ENSP00000314103:P491T	ENSP00000314103:P491T	P	+	1	0	ANKRD34A	144186156	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.688000	0.25422	0.663000	0.31027	0.655000	0.94253	CCT	.		0.622	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
SLC27A3	11000	hgsc.bcm.edu	37	1	153748355	153748355	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:153748355G>T	ENST00000368661.3	+	1	588	c.523G>T	c.(523-525)Gga>Tga	p.G175*	SLC27A3_ENST00000271857.2_Nonsense_Mutation_p.G256*|SLC27A3_ENST00000484014.1_Intron	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	175					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGGGAGCGCTGGAGAAGGCGA	0.741																																					p.G175X		.											.	SLC27A3-91	0			c.G523T						.						9.0	13.0	12.0					1																	153748355		1940	3879	5819	SO:0001587	stop_gained	11000	exon1			AGCGCTGGAGAAG	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.523G>T	1.37:g.153748355G>T	ENSP00000357650:p.Gly175*	9	0		60	4	NM_024330	0	0	1	1	0	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Nonsense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	39	7.908987	0.98557	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	.	.	.	3.51	-2.4	0.06583	.	2.132630	0.02807	N	0.123840	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-1.992	0.6462	0.00819	0.3226:0.1685:0.3373:0.1717	.	.	.	.	X	256;175	.	ENSP00000271857:G256X	G	+	1	0	SLC27A3	152014979	0.000000	0.05858	0.000000	0.03702	0.185000	0.23345	-1.684000	0.01932	-0.877000	0.04012	0.462000	0.41574	GGA	.		0.741	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
DNAH14	127602	broad.mit.edu	37	1	225533684	225533684	+	Missense_Mutation	SNP	A	A	G	rs6667999	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:225533684A>G	ENST00000445597.2	+	48	8011	c.8011A>G	c.(8011-8013)Aaa>Gaa	p.K2671E	DNAH14_ENST00000430092.1_Missense_Mutation_p.K3474E|DNAH14_ENST00000439375.2_Missense_Mutation_p.K3474E			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2671			K -> E (in dbSNP:rs6667999).		microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGATGATGACAAAATTGTAGA	0.328													G|||	2649	0.528954	0.6399	0.4697	5008	,	,		18280	0.5089		0.4046	False		,,,				2504	0.5695				p.K3474E		.											.	DNAH14-23	0			c.A10420G						.	G	GLU/LYS	842,542		268,306,118	62.0	46.0	51.0		10420	3.4	0.0	1	dbSNP_116	51	1406,1776		323,760,508	yes	missense	DNAH14	NM_001373.1	56	591,1066,626	GG,GA,AA		44.186,39.1618,49.2335	benign	3474/4516	225533684	2248,2318	692	1591	2283	SO:0001583	missense	127602	exon68			GATGACAAAATTG	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8011A>G	1.37:g.225533684A>G	ENSP00000409472:p.Lys2671Glu	162	0		109	5	NM_001373	0	0	0	0	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		1054	0.4826007326007326	302	0.6138211382113821	165	0.4558011049723757	281	0.49125874125874125	306	0.40369393139841686	G	0.005	-2.137791	0.00335	0.608382	0.44186	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.54071	0.59;0.59;0.59	5.34	3.37	0.38596	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45862	-0.9232	7	0.02654	T	1	.	7.3982	0.26948	0.1499:0.0:0.7149:0.1352	rs6667999;rs52791604;rs60868380;rs6667999	3474	Q0VDD8-4	.	E	2671;3474;3474	ENSP00000409472:K2671E;ENSP00000414402:K3474E;ENSP00000392061:K3474E	ENSP00000414402:K3474E	K	+	1	0	DNAH14	223600307	0.836000	0.29430	0.026000	0.17262	0.022000	0.10575	1.958000	0.40402	0.621000	0.30232	-0.294000	0.09567	AAA	A|0.507;G|0.493		0.328	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
H3F3A	3020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226252155	226252155	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:226252155G>C	ENST00000366813.1	+	1	478	c.103G>C	c.(103-105)Ggg>Cgg	p.G35R	RP11-396C23.4_ENST00000609423.1_RNA|H3F3A_ENST00000366815.3_Missense_Mutation_p.G35R|H3F3A_ENST00000366814.3_Missense_Mutation_p.G35R|H3F3A_ENST00000366816.1_Missense_Mutation_p.G35R			P84243	H33_HUMAN	H3 histone, family 3A	35					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)	p.G35R(11)		central_nervous_system(116)|endometrium(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	123	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		CTCTACTGGAGGGGTGAAGAA	0.458			Mis		glioma						OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G35R		.		Dom	yes		1	1q42.12	3020	"""H3 histone, family 3A"""		O	.	H3F3A-522	11	Substitution - Missense(11)	central_nervous_system(11)	c.G103C						.						30.0	32.0	32.0					1																	226252155		2199	4299	6498	SO:0001583	missense	3020	exon2			ACTGGAGGGGTGA	BC029405	CCDS1550.1	1q42.12	2011-01-27			ENSG00000163041	ENSG00000163041		"""Histones / Replication-independent"""	4764	protein-coding gene	gene with protein product		601128		H3F3		3031613	Standard	NM_002107		Approved	H3.3A	uc001hpw.3	P84243	OTTHUMG00000037507	ENST00000366813.1:c.103G>C	1.37:g.226252155G>C	ENSP00000355778:p.Gly35Arg	282	0	2311	269	246	NM_002107	0	2	14	434	418	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Missense_Mutation	SNP	ENST00000366813.1	37	CCDS1550.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152658	0.57259	.	.	ENSG00000163041	ENST00000366816;ENST00000366815;ENST00000366814;ENST00000366813	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	4.32	4.32	0.51571	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.53932	0.1827	.	.	.	0.58432	D	0.999999	P;P	0.52577	0.954;0.954	P;P	0.47470	0.532;0.548	T	0.63523	-0.6618	9	0.87932	D	0	.	16.7598	0.85509	0.0:0.0:1.0:0.0	.	35;35	B4DEB1;P84243	.;H33_HUMAN	R	35	ENSP00000355781:G35R;ENSP00000355780:G35R;ENSP00000355779:G35R;ENSP00000355778:G35R	ENSP00000355778:G35R	G	+	1	0	H3F3A	224318778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.606000	0.98325	2.106000	0.64143	0.655000	0.94253	GGG	.		0.458	H3F3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091324.1	NM_002107	
IBA57	200205	hgsc.bcm.edu	37	1	228353651	228353651	+	Missense_Mutation	SNP	G	G	C	rs55873785	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:228353651G>C	ENST00000366711.3	+	1	136	c.134G>C	c.(133-135)gGa>gCa	p.G45A	IBA57-AS1_ENST00000496552.1_5'Flank|IBA57-AS1_ENST00000366713.1_5'Flank	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	45					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						CCAACGGCCGGAGCGGCCTGG	0.771													.|||	1783	0.35603	0.1536	0.3357	5008	,	,		7378	0.373		0.4165	False		,,,				2504	0.5644				p.G45A		.											.	IBA57-90	0			c.G134C						.						1.0	2.0	2.0					1																	228353651		1162	2542	3704	SO:0001583	missense	200205	exon1			CGGCCGGAGCGGC	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.134G>C	1.37:g.228353651G>C	ENSP00000355672:p.Gly45Ala	0	0		5	5	NM_001010867	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366711.3	37	CCDS31046.1	751	0.34386446886446886	97	0.19715447154471544	130	0.35911602209944754	225	0.39335664335664333	299	0.3944591029023747	G	9.757	1.169067	0.21621	.	.	ENSG00000181873	ENST00000366711	T	0.46451	0.87	3.98	1.02	0.19986	.	1.527780	0.03906	N	0.281094	T	0.00012	0.0000	N	0.19112	0.55	0.58432	P	9.000000000036756E-6	B	0.22003	0.063	B	0.19666	0.026	T	0.41070	-0.9529	9	0.28530	T	0.3	-0.4767	8.6843	0.34227	0.1631:0.1287:0.7082:0.0	rs55873785;rs61827463	45	Q5T440	CAF17_HUMAN	A	45	ENSP00000355672:G45A	ENSP00000355672:G45A	G	+	2	0	IBA57	226420274	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.694000	0.25512	-0.226000	0.09899	-1.943000	0.00494	GGA	G|0.656;C|0.344		0.771	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
FMN2	56776	hgsc.bcm.edu	37	1	240371484	240371484	+	Silent	SNP	A	A	T	rs202006855	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr1:240371484A>T	ENST00000319653.9	+	5	3602	c.3372A>T	c.(3370-3372)ctA>ctT	p.L1124L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1124	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCCCCCTCTACCCGGAGCGG	0.711																																					p.L1124L		.											.	FMN2-145	0			c.A3372T						.						8.0	10.0	9.0					1																	240371484		2106	4139	6245	SO:0001819	synonymous_variant	56776	exon5			CCCTCTACCCGGA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3372A>T	1.37:g.240371484A>T		7	0		19	9	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			A|0.975;T|0.026		0.711	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
PROSER2	254427	hgsc.bcm.edu	37	10	11912228	11912228	+	Silent	SNP	G	G	A	rs74657303	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr10:11912228G>A	ENST00000277570.5	+	4	1285	c.1131G>A	c.(1129-1131)acG>acA	p.T377T	PROSER2_ENST00000379200.1_Silent_p.T181T|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	377																	TGCCCAGCACGCGGGCCCGTC	0.751													G|||	272	0.0543131	0.0061	0.0821	5008	,	,		6998	0.0		0.1233	False		,,,				2504	0.0849				p.T377T		.											.	.	0			c.G1131A						.	G		50,2532		0,50,1241	2.0	2.0	2.0		1131	-8.1	0.0	10	dbSNP_131	2	530,4672		10,510,2081	no	coding-synonymous	C10orf47	NM_153256.3		10,560,3322	AA,AG,GG		10.1884,1.9365,7.4512		377/436	11912228	580,7204	1291	2601	3892	SO:0001819	synonymous_variant	254427	exon4			CAGCACGCGGGCC	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1131G>A	10.37:g.11912228G>A		0	0		10	8	NM_153256	0	0	0	0	0	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Silent	SNP	ENST00000277570.5	37	CCDS7085.1																																																																																			G|0.923;A|0.077		0.751	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	91518639	91518642	+	Splice_Site	DEL	AGTC	AGTC	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AGTC	AGTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr10:91518639_91518642delAGTC	ENST00000371728.3	+	27	4745	c.4680delAGTC	c.(4678-4680)ata>at	p.I1560fs	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Splice_Site_p.I1590fs|KIF20B_ENST00000394289.2_Splice_Site_p.I1560fs|KIF20B_ENST00000260753.4_Splice_Site_p.I1520fs	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1560	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CTTCTAAAATAGTCAGTAGTCTTT	0.284																																					p.1520_1520del		.											.	KIF20B-93	0			c.4560_4560del						.			0,4258		0,0,2129						-6.4	0.0			44	1,8251		0,1,4125	no	frameshift-near-splice	KIF20B	NM_016195.2		0,1,6254	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12509				SO:0001630	splice_region_variant	9585	exon27			TAAAATAGTCAGT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4680+1AGTC>-	10.37:g.91518639_91518642delAGTC		126	0		110	47	NM_016195	0	0	0	0	0	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Frame_Shift_Del	DEL	ENST00000371728.3	37																																																																																				.		0.284	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	Frame_Shift_Del
FBXW4	6468	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	103371096	103371097	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr10:103371096_103371097delAT	ENST00000331272.7	-	9	1808_1809	c.1190_1191delAT	c.(1189-1191)tatfs	p.Y397fs	FBXW4_ENST00000470093.1_5'UTR	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	397					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		ACAGGGCAGCATAGAGATGCTT	0.594																																					p.397_397del		.											.	FBXW4-226	0			c.1190_1191del						.																																			SO:0001589	frameshift_variant	6468	exon9			GGCAGCATAGAGA	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.1190_1191delAT	10.37:g.103371096_103371097delAT	ENSP00000359149:p.Tyr397fs	199	0		280	133	NM_022039	0	0	0	0	0	Q5SVS1|Q96IM6	Frame_Shift_Del	DEL	ENST00000331272.7	37	CCDS31271.1																																																																																			.		0.594	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000189444.6_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		13	13	NM_001077494	0	0	0	2	2	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
WDR11	55717	broad.mit.edu	37	10	122664295	122664295	+	Silent	SNP	G	G	A	rs376429849		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr10:122664295G>A	ENST00000263461.6	+	25	3411	c.3165G>A	c.(3163-3165)acG>acA	p.T1055T	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						TGGTGGCAACGAATATGATTG	0.433																																					p.T1055T		.											.	WDR11-226	0			c.G3165A						.	G		0,4406		0,0,2203	122.0	112.0	115.0		3165	-9.7	0.4	10		115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR11	NM_018117.11		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1055/1225	122664295	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55717	exon25			GGCAACGAATATG	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.3165G>A	10.37:g.122664295G>A		173	0		218	6	NM_018117	0	0	30	30	0	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000263461.6	37	CCDS7619.1																																																																																			.		0.433	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000459866.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		0	0		8	8	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
NUDT22	84304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63994397	63994397	+	Silent	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:63994397G>A	ENST00000279206.3	+	2	429	c.273G>A	c.(271-273)ctG>ctA	p.L91L	TRPT1_ENST00000546089.1_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|NUDT22_ENST00000441250.2_Silent_p.L91L|TRPT1_ENST00000317459.6_5'Flank|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000394547.3_5'Flank|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000546133.1_5'Flank	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	91							hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						GAGACTTCCTGGGCACCAACT	0.682																																					p.L91L		.											.	NUDT22-90	0			c.G273A						.						36.0	40.0	38.0					11																	63994397		2201	4296	6497	SO:0001819	synonymous_variant	84304	exon2			CTTCCTGGGCACC	BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.273G>A	11.37:g.63994397G>A		62	0		79	46	NM_001128613	0	0	17	40	23	C9JY06|Q71RD5	Silent	SNP	ENST00000279206.3	37	CCDS8061.1																																																																																			.		0.682	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396304.2	NM_032344	
LTBP3	4054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65314984	65314984	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:65314984T>A	ENST00000301873.5	-	14	2301	c.2033A>T	c.(2032-2034)aAc>aTc	p.N678I	LTBP3_ENST00000322147.4_Missense_Mutation_p.N678I|LTBP3_ENST00000536982.1_Missense_Mutation_p.N304I|LTBP3_ENST00000530785.1_5'Flank|LTBP3_ENST00000529189.1_5'Flank|LTBP3_ENST00000532932.1_Missense_Mutation_p.N108I	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	678	Cys-rich.|EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ACCGGGAAAGTTGATGCAGAA	0.647																																					p.N678I		.											.	LTBP3-91	0			c.A2033T						.						75.0	83.0	80.0					11																	65314984		2201	4297	6498	SO:0001583	missense	4054	exon14			GGAAAGTTGATGC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2033A>T	11.37:g.65314984T>A	ENSP00000301873:p.Asn678Ile	95	0		107	47	NM_001130144	0	0	25	33	8	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.57|16.57	3.159659|3.159659	0.57368|0.57368	.|.	.|.	ENSG00000168056|ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866;ENST00000527339|ENST00000526927	D;D;D;D;D;D|.	0.98822|.	-5.16;-5.16;-5.16;-5.16;-5.16;-5.16|.	4.67|4.67	3.52|3.52	0.40303|0.40303	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	0.326171|.	0.30419|.	N|.	0.009678|.	D|D	0.82742|0.82742	0.5103|0.5103	H|H	0.97240|0.97240	3.965|3.965	0.58432|0.58432	D|D	0.999999|0.999999	B;B;B;B;B;B|.	0.22003|.	0.009;0.063;0.021;0.023;0.042;0.045|.	B;B;B;B;B;B|.	0.31614|.	0.031;0.082;0.015;0.051;0.065;0.133|.	T|T	0.83156|0.83156	-0.0101|-0.0101	10|5	0.72032|.	D|.	0.01|.	.|.	7.4612|7.4612	0.27296|0.27296	0.1928:0.0:0.0:0.8072|0.1928:0.0:0.0:0.8072	.|.	589;304;561;678;678;108|.	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2|.	.;.;.;LTBP3_HUMAN;.;.|.	I|H	678;678;108;304;589;18|328	ENSP00000326647:N678I;ENSP00000301873:N678I;ENSP00000435530:N108I;ENSP00000441912:N304I;ENSP00000435276:N589I;ENSP00000432121:N18I|.	ENSP00000301873:N678I|.	N|Q	-|-	2|3	0|2	LTBP3|LTBP3	65071560|65071560	1.000000|1.000000	0.71417|0.71417	0.954000|0.954000	0.39281|0.39281	0.461000|0.461000	0.32589|0.32589	5.318000|5.318000	0.65829|0.65829	0.613000|0.613000	0.30089|0.30089	0.260000|0.260000	0.18958|0.18958	AAC|CAA	.		0.647	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		0	0		6	6	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
CD248	57124	hgsc.bcm.edu	37	11	66084284	66084284	+	Missense_Mutation	SNP	C	C	T	rs111751859	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:66084284C>T	ENST00000311330.3	-	1	231	c.215G>A	c.(214-216)aGc>aAc	p.S72N	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	72	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						ACCCACCAGGCTGTCCACACG	0.761													C|||	24	0.00479233	0.0045	0.0086	5008	,	,		11719	0.0		0.0099	False		,,,				2504	0.002				p.S72N		.											.	CD248-154	0			c.G215A						.	C	ASN/SER	24,3856		0,24,1916	6.0	8.0	7.0		215	0.4	1.0	11	dbSNP_132	7	94,7418		1,92,3663	no	missense	CD248	NM_020404.2	46	1,116,5579	TT,TC,CC		1.2513,0.6186,1.0358	benign	72/758	66084284	118,11274	1940	3756	5696	SO:0001583	missense	57124	exon1			ACCAGGCTGTCCA	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.215G>A	11.37:g.66084284C>T	ENSP00000308117:p.Ser72Asn	0	0		14	6	NM_020404	0	0	0	0	0	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	CCDS8134.1	14	0.00641025641025641	3	0.006097560975609756	4	0.011049723756906077	0	0.0	7	0.009234828496042216	C	6.754	0.508005	0.12883	0.006186	0.012513	ENSG00000174807	ENST00000311330	T	0.55413	0.52	3.75	0.451	0.16629	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.728103	0.13146	N	0.410255	T	0.23688	0.0573	N	0.25890	0.77	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12604	-1.0541	10	0.24483	T	0.36	-10.3457	2.8	0.05412	0.1438:0.5274:0.141:0.1879	.	72	Q9HCU0	CD248_HUMAN	N	72	ENSP00000308117:S72N	ENSP00000308117:S72N	S	-	2	0	CD248	65840860	0.000000	0.05858	0.995000	0.50966	0.430000	0.31655	-0.812000	0.04496	-0.017000	0.14103	-1.134000	0.01955	AGC	C|0.994;T|0.006		0.761	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404	
SHANK2	22941	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70544812	70544812	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:70544812C>T	ENST00000423696.2	-	5	733	c.697G>A	c.(697-699)Gac>Aac	p.D233N	SHANK2_ENST00000338508.4_Missense_Mutation_p.D613N|SHANK2_ENST00000468619.1_5'UTR			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	233					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TCGAAGCTGTCATAGGAGCCC	0.517																																					.		.											.	SHANK2-94	0			.						.						186.0	189.0	188.0					11																	70544812		692	1591	2283	SO:0001583	missense	22941	.			AGCTGTCATAGGA	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.697G>A	11.37:g.70544812C>T	ENSP00000394536:p.Asp233Asn	160	0		188	80	.	0	0	0	0	0	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.09|18.09	3.546756|3.546756	0.65198|0.65198	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018|ENST00000426687	T;T;T|.	0.50277|.	0.75;2.1;2.12|.	4.74|4.74	4.74|4.74	0.60224|0.60224	.|.	0.537449|.	0.16305|.	U|.	0.220246|.	T|T	0.70535|0.70535	0.3235|0.3235	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.69824|.	0.966|.	T|T	0.70502|0.70502	-0.4854|-0.4854	10|5	0.56958|.	D|.	0.05|.	.|.	13.2073|13.2073	0.59805|0.59805	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	612|.	Q9UPX8-3|.	.|.	N|I	613;233;247;243|21	ENSP00000345193:D613N;ENSP00000394536:D233N;ENSP00000294018:D243N|.	ENSP00000294018:D243N|.	D|M	-|-	1|3	0|0	SHANK2|SHANK2	70222460|70222460	0.999000|0.999000	0.42202|0.42202	0.949000|0.949000	0.38748|0.38748	0.519000|0.519000	0.34347|0.34347	5.038000|5.038000	0.64177|0.64177	2.181000|2.181000	0.69327|0.69327	0.491000|0.491000	0.48974|0.48974	GAC|ATG	.		0.517	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SYTL2	54843	bcgsc.ca	37	11	85445593	85445593	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:85445593C>T	ENST00000528231.1	-	6	1053	c.776G>A	c.(775-777)aGg>aAg	p.R259K	SYTL2_ENST00000316356.4_Missense_Mutation_p.R260K|SYTL2_ENST00000389960.4_Missense_Mutation_p.R259K|SYTL2_ENST00000524452.1_Missense_Mutation_p.R259K|SYTL2_ENST00000527523.1_Missense_Mutation_p.R211K	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	259					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGAGTCTGTCCTTTGTCTAGG	0.463																																					p.R260K		.											.	SYTL2-137	0			c.G779A						.						126.0	127.0	127.0					11																	85445593		2203	4299	6502	SO:0001583	missense	54843	exon6			TCTGTCCTTTGTC	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.776G>A	11.37:g.85445593C>T	ENSP00000431701:p.Arg259Lys	122	0		68	10	NM_001162953	0	0	4	4	0	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163364	0.38217	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.28895	1.6;1.7;1.7;1.59;1.6	5.87	5.87	0.94306	.	.	.	.	.	T	0.32823	0.0842	M	0.64997	1.995	0.80722	D	1	B;B;B;B;B	0.26547	0.04;0.152;0.01;0.152;0.008	B;B;B;B;B	0.25987	0.065;0.053;0.015;0.033;0.039	T	0.04281	-1.0963	8	.	.	.	.	14.3682	0.66820	0.0:0.9276:0.0:0.0724	.	211;259;259;260;117	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	K	259;260;259;211;259	ENSP00000374610:R259K;ENSP00000318803:R260K;ENSP00000431701:R259K;ENSP00000434010:R211K;ENSP00000435238:R259K	.	R	-	2	0	SYTL2	85123241	0.997000	0.39634	0.998000	0.56505	0.255000	0.26057	1.349000	0.33998	2.775000	0.95449	0.650000	0.86243	AGG	.		0.463	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	117335893	117335893	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:117335893G>T	ENST00000321322.6	-	17	3211	c.3210C>A	c.(3208-3210)ccC>ccA	p.P1070P	DSCAML1_ENST00000527706.1_Silent_p.P800P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1010	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCTCCTTCTTGGGTGCCTGTG	0.562																																					p.P1070P		.											.	DSCAML1-159	0			c.C3210A						.						67.0	61.0	63.0					11																	117335893		2201	4296	6497	SO:0001819	synonymous_variant	57453	exon17			CTTCTTGGGTGCC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3210C>A	11.37:g.117335893G>T		77	0		65	4	NM_020693	0	0	0	0	0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																			.		0.562	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121028854	121028854	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr11:121028854C>T	ENST00000392793.1	+	14	4881	c.4610C>T	c.(4609-4611)cCc>cTc	p.P1537L	TECTA_ENST00000264037.2_Missense_Mutation_p.P1537L			O75443	TECTA_HUMAN	tectorin alpha	1537	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGGTCGGCCCCCAACCTCACC	0.547																																					p.P1537L		.											.	TECTA-225	0			c.C4610T						.						101.0	87.0	92.0					11																	121028854		2203	4299	6502	SO:0001583	missense	7007	exon13			CGGCCCCCAACCT	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4610C>T	11.37:g.121028854C>T	ENSP00000376543:p.Pro1537Leu	112	0		75	65	NM_005422	0	0	0	0	0		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673459	0.67928	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.58797	0.31;0.31	5.91	4.95	0.65309	von Willebrand factor, type D domain (3);	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63892	-0.6534	10	0.40728	T	0.16	.	15.8979	0.79350	0.1359:0.8641:0.0:0.0	.	1537	O75443	TECTA_HUMAN	L	1537	ENSP00000376543:P1537L;ENSP00000264037:P1537L	ENSP00000264037:P1537L	P	+	2	0	TECTA	120534064	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.636000	0.67848	2.813000	0.96785	0.655000	0.94253	CCC	.		0.547	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
IQSEC3	440073	hgsc.bcm.edu	37	12	248155	248155	+	Silent	SNP	C	C	T	rs55923022	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:248155C>T	ENST00000538872.1	+	4	1744	c.1626C>T	c.(1624-1626)gcC>gcT	p.A542A	RP11-598F7.4_ENST00000505893.2_RNA|IQSEC3_ENST00000326261.4_Silent_p.A542A|IQSEC3_ENST00000382841.2_Silent_p.A239A|RP11-598F7.4_ENST00000508953.2_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	542					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A542A(1)|p.A239A(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AAGCCCCCGCCGTGGGCCGGG	0.746													T|||	657	0.13119	0.2882	0.0908	5008	,	,		10438	0.0258		0.0974	False		,,,				2504	0.091				p.A542A		.											.	IQSEC3-560	2	Substitution - coding silent(2)	prostate(2)	c.C1626T						.						4.0	5.0	4.0					12																	248155		1929	3805	5734	SO:0001819	synonymous_variant	440073	exon4			CCCCGCCGTGGGC	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.1626C>T	12.37:g.248155C>T		0	0		16	9	NM_001170738	0	0	0	0	0	A6NIF2|A6NKV9|Q8TB43	Silent	SNP	ENST00000538872.1	37	CCDS53728.1																																																																																			C|0.880;T|0.120		0.746	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
MANSC1	54682	broad.mit.edu	37	12	12483162	12483162	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:12483162G>T	ENST00000535902.1	-	4	1658	c.1095C>A	c.(1093-1095)ggC>ggA	p.G365G	MANSC1_ENST00000396349.3_Silent_p.G331G|MANSC1_ENST00000545735.1_Silent_p.G284G			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	365						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		GGGAGGAACTGCCTGGACTGG	0.488																																					p.G365G		.											.	MANSC1-90	0			c.C1095A						.						85.0	87.0	86.0					12																	12483162		2203	4300	6503	SO:0001819	synonymous_variant	54682	exon4			GGAACTGCCTGGA	AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.1095C>A	12.37:g.12483162G>T		121	0		104	3	NM_018050	0	0	8	8	0	Q8NEC1|Q9NW60	Silent	SNP	ENST00000535902.1	37	CCDS8648.1																																																																																			.		0.488	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
BIN2	51411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51685869	51685869	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:51685869T>A	ENST00000267012.4	-	10	1082	c.1021A>T	c.(1021-1023)Aat>Tat	p.N341Y	BIN2_ENST00000452142.2_Missense_Mutation_p.N309Y|BIN2_ENST00000604560.1_Missense_Mutation_p.N314Y|BIN2_ENST00000544402.1_Missense_Mutation_p.N315Y	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	341					cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						GCGGGGCCATTGCAGGCTGGT	0.562																																					p.N341Y		.											.	BIN2-91	0			c.A1021T						.						48.0	47.0	47.0					12																	51685869		2203	4300	6503	SO:0001583	missense	51411	exon10			GGCCATTGCAGGC	AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.1021A>T	12.37:g.51685869T>A	ENSP00000267012:p.Asn341Tyr	69	0		76	38	NM_016293	0	0	0	0	0	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	ENST00000267012.4	37	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.192882	0.58017	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	D;T;T	0.96830	-4.14;-0.23;-0.24	4.95	4.95	0.65309	.	0.967641	0.08460	N	0.942501	D	0.96852	0.8972	L	0.36672	1.1	0.36479	D	0.8677	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.996	D	0.94179	0.7430	10	0.66056	D	0.02	-6.9583	11.2012	0.48743	0.0:0.0:0.0:1.0	.	315;309;341	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	Y	309;341;315	ENSP00000410217:N309Y;ENSP00000267012:N341Y;ENSP00000445874:N315Y	ENSP00000267012:N341Y	N	-	1	0	BIN2	49972136	0.999000	0.42202	0.473000	0.27253	0.688000	0.40055	2.156000	0.42310	2.224000	0.72417	0.533000	0.62120	AAT	.		0.562	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000469800.1		
KRT4	3851	bcgsc.ca	37	12	53207603	53207603	+	Silent	SNP	A	A	G	rs7135148		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:53207603A>G	ENST00000551956.1	-	1	732	c.240T>C	c.(238-240)ttT>ttC	p.F80F	KRT4_ENST00000293774.4_Silent_p.F154F|KRT4_ENST00000458244.2_Silent_p.F60F			P19013	K2C4_HUMAN	keratin 4	80	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CACCAGTGCCAAAGCCTCCAG	0.602																																					p.F80F	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.T240C						.						82.0	99.0	94.0					12																	53207603		2119	4253	6372	SO:0001819	synonymous_variant	3851	exon1			AGTGCCAAAGCCT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240T>C	12.37:g.53207603A>G		50	0		50	10	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			A|1.000;|0.000		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
KRT4	3851	bcgsc.ca	37	12	53207606	53207606	+	Silent	SNP	G	G	A	rs79164931		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:53207606G>A	ENST00000551956.1	-	1	729	c.237C>T	c.(235-237)ggC>ggT	p.G79G	KRT4_ENST00000293774.4_Silent_p.G153G|KRT4_ENST00000458244.2_Silent_p.G59G			P19013	K2C4_HUMAN	keratin 4	79	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CAGTGCCAAAGCCTCCAGCAC	0.597																																					p.G79G	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.C237T						.						85.0	102.0	96.0					12																	53207606		2113	4248	6361	SO:0001819	synonymous_variant	3851	exon1			GCCAAAGCCTCCA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.237C>T	12.37:g.53207606G>A		52	0		51	9	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			.		0.597	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
METTL7B	196410	bcgsc.ca	37	12	56077740	56077740	+	Silent	SNP	C	C	T	rs11615467	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:56077740C>T	ENST00000394252.3	+	2	851	c.642C>T	c.(640-642)aaC>aaT	p.N214N		NM_152637.2	NP_689850.2	Q6UX53	MET7B_HUMAN	methyltransferase like 7B	214							methyltransferase activity (GO:0008168)			kidney(1)|large_intestine(1)|lung(4)	6						ATCTTGAGAACGCCCAGTTCT	0.542													C|||	165	0.0329473	0.0265	0.0317	5008	,	,		19829	0.001		0.0646	False		,,,				2504	0.0429				p.N214N		.											.	METTL7B-514	0			c.C642T						.	C		124,4282	92.0+/-130.7	2,120,2081	132.0	110.0	118.0		642	-8.0	0.0	12	dbSNP_120	118	401,8199	127.3+/-185.7	7,387,3906	no	coding-synonymous	METTL7B	NM_152637.2		9,507,5987	TT,TC,CC		4.6628,2.8143,4.0366		214/245	56077740	525,12481	2203	4300	6503	SO:0001819	synonymous_variant	196410	exon2			TGAGAACGCCCAG		CCDS8887.2	12q13.2	2012-06-12			ENSG00000170439	ENSG00000170439			28276	protein-coding gene	gene with protein product	"""associated with lipid droplets 1"""					17004324	Standard	NM_152637		Approved	MGC17301, ALDI	uc010spr.2	Q6UX53	OTTHUMG00000152665	ENST00000394252.3:c.642C>T	12.37:g.56077740C>T		148	1		187	6	NM_152637	0	0	1	1	0	A8K247|Q8WUI1	Silent	SNP	ENST00000394252.3	37	CCDS8887.2																																																																																			C|0.959;T|0.041		0.542	METTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327271.1	NM_152637	
SUOX	6821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56398081	56398081	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:56398081C>A	ENST00000394109.3	+	3	1632	c.908C>A	c.(907-909)gCc>gAc	p.A303D	SUOX_ENST00000551841.2_3'UTR|SUOX_ENST00000548274.1_Missense_Mutation_p.A303D|SUOX_ENST00000356124.4_Missense_Mutation_p.A303D|SUOX_ENST00000266971.3_Missense_Mutation_p.A303D|SUOX_ENST00000394115.2_Missense_Mutation_p.A303D			P51687	SUOX_HUMAN	sulfite oxidase	303	Moco domain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			GATGTGTTAGCCCAGGCTGGC	0.567																																					p.A303D		.											.	SUOX-90	0			c.C908A						.						50.0	47.0	48.0					12																	56398081		2203	4300	6503	SO:0001583	missense	6821	exon6			TGTTAGCCCAGGC	BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.908C>A	12.37:g.56398081C>A	ENSP00000377668:p.Ala303Asp	86	0		106	45	NM_000456	0	0	8	14	6		Missense_Mutation	SNP	ENST00000394109.3	37	CCDS8901.2	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371508	0.24771	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000394109	D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32	5.11	3.21	0.36854	Oxidoreductase, molybdopterin-binding domain (3);	0.225081	0.39759	N	0.001276	D	0.84991	0.5595	N	0.17345	0.48	0.43673	D	0.996102	B	0.26041	0.14	B	0.35073	0.195	T	0.75150	-0.3419	10	0.12766	T	0.61	-30.5828	5.1959	0.15236	0.0:0.6189:0.0:0.381	.	303	P51687	SUOX_HUMAN	D	303	ENSP00000348440:A303D;ENSP00000266971:A303D;ENSP00000377674:A303D;ENSP00000450245:A303D;ENSP00000377668:A303D	ENSP00000266971:A303D	A	+	2	0	SUOX	54684348	0.434000	0.25570	1.000000	0.80357	0.992000	0.81027	0.717000	0.25851	1.450000	0.47717	0.585000	0.79938	GCC	.		0.567	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250309.1	NM_000456	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		19	11	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		1	0		27	18	NM_152435	0	0	1	1	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	112690349	112690349	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:112690349delG	ENST00000430131.2	-	22	3310	c.2165delC	c.(2164-2166)cctfs	p.P722fs	HECTD4_ENST00000377560.5_Frame_Shift_Del_p.P972fs|HECTD4_ENST00000550722.1_Intron			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	722					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ATTTAAGGAAGGGGGGGAAAT	0.393																																					p.P1010fs		.											.	.	0			c.3029delC						.						65.0	68.0	67.0					12																	112690349		2203	4300	6503	SO:0001589	frameshift_variant	283450	exon23			AAGGAAGGGGGGG	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2165delC	12.37:g.112690349delG	ENSP00000404379:p.Pro722fs	24	0		33	14	NM_001109662	0	0	0	0	0	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Frame_Shift_Del	DEL	ENST00000430131.2	37																																																																																				.		0.393	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
PDS5B	23047	bcgsc.ca	37	13	33232435	33232435	+	Silent	SNP	A	A	G	rs2301393	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr13:33232435A>G	ENST00000315596.10	+	4	558	c.372A>G	c.(370-372)caA>caG	p.Q124Q		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	124					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AGAGCCCACAATTCAATAGGT	0.269													A|||	1359	0.271366	0.2337	0.3559	5008	,	,		14898	0.1389		0.4702	False		,,,				2504	0.1943				p.Q124Q		.											.	PDS5B-94	0			c.A372G						.	A		973,2617		134,705,956	54.0	51.0	52.0		372	-1.5	1.0	13	dbSNP_100	52	3475,4649		756,1963,1343	no	coding-synonymous	PDS5B	NM_015032.3		890,2668,2299	GG,GA,AA		42.7745,27.1031,37.9717		124/1448	33232435	4448,7266	1795	4062	5857	SO:0001819	synonymous_variant	23047	exon4			CCCACAATTCAAT	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.372A>G	13.37:g.33232435A>G		139	0		73	4	NM_015032	0	0	0	0	0	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Silent	SNP	ENST00000315596.10	37	CCDS41878.1																																																																																			A|0.686;G|0.314		0.269	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
MYCBP2	23077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	77745686	77745689	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	ACAG	ACAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr13:77745686_77745689delACAG	ENST00000544440.2	-	38	5635_5638	c.5618_5621delCTGT	c.(5617-5622)tctgttfs	p.SV1873fs	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Frame_Shift_Del_p.SV1873fs|MYCBP2_ENST00000407578.2_Frame_Shift_Del_p.SV1911fs					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGTGCTTACAACAGACAATGCTCT	0.397																																					p.1911_1912del		.											.	MYCBP2-236	0			c.5732_5735del						.																																			SO:0001589	frameshift_variant	23077	exon38			CTTACAACAGACA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5618_5621delCTGT	13.37:g.77745686_77745689delACAG	ENSP00000444596:p.Ser1873fs	109	0		102	43	NM_015057	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000544440.2	37																																																																																				.		0.397	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	98658494	98658494	+	Silent	SNP	A	A	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr13:98658494A>G	ENST00000490680.1	+	14	1673	c.1608A>G	c.(1606-1608)ccA>ccG	p.P536P	IPO5_ENST00000539640.1_Silent_p.P411P|IPO5_ENST00000261574.5_Silent_p.P554P|IPO5_ENST00000493492.2_3'UTR			O00410	IPO5_HUMAN	importin 5	536					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TATTTATGCCATCACTGAAGC	0.408																																					p.P554P		.											.	IPO5-228	0			c.A1662G						.						121.0	116.0	118.0					13																	98658494		2203	4300	6503	SO:0001819	synonymous_variant	3843	exon17			TATGCCATCACTG	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1608A>G	13.37:g.98658494A>G		77	0		87	41	NM_002271	0	0	13	25	12	B4DZA0|O15257|Q5T578|Q86XC7	Silent	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	A	10.31	1.315649	0.23908	.	.	ENSG00000065150	ENST00000469360	.	.	.	4.83	-2.71	0.05986	.	.	.	.	.	T	0.37293	0.0998	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31943	-0.9925	4	.	.	.	-0.788	0.0689	0.00020	0.2519:0.2297:0.2179:0.3005	.	.	.	.	R	538	.	.	H	+	2	0	IPO5	97456495	0.000000	0.05858	0.982000	0.44146	0.991000	0.79684	-1.644000	0.02002	-0.644000	0.05465	0.377000	0.23210	CAT	.		0.408	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
OR4Q3	441669	hgsc.bcm.edu	37	14	20215780	20215780	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:20215780G>T	ENST00000331723.1	+	1	194	c.194G>T	c.(193-195)gGt>gTt	p.G65V		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATTTTTTAGGTCATCTCTCT	0.428																																					p.G65V		.											.	OR4Q3-71	0			c.G194T						.						163.0	165.0	164.0					14																	20215780		2203	4300	6503	SO:0001583	missense	441669	exon1			TTTTAGGTCATCT	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.194G>T	14.37:g.20215780G>T	ENSP00000330049:p.Gly65Val	54	0		65	4	NM_172194	0	0	0	0	0	Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	5.120	0.207815	0.09704	.	.	ENSG00000182652	ENST00000331723	T	0.04406	3.63	4.32	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	0.924236	0.08868	U	0.882031	T	0.08447	0.0210	M	0.79011	2.435	0.09310	N	1	B	0.22604	0.072	B	0.22601	0.04	T	0.30238	-0.9985	10	0.59425	D	0.04	.	6.4392	0.21841	0.1692:0.1535:0.6773:0.0	.	65	Q8NH05	OR4Q3_HUMAN	V	65	ENSP00000330049:G65V	ENSP00000330049:G65V	G	+	2	0	OR4Q3	19285620	0.000000	0.05858	0.147000	0.22382	0.463000	0.32649	-0.061000	0.11693	0.437000	0.26423	0.509000	0.49947	GGT	.		0.428	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
CTAGE5	4253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	39771394	39771394	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:39771394C>G	ENST00000280083.3	+	10	1171	c.857C>G	c.(856-858)aCg>aGg	p.T286R	CTAGE5_ENST00000396165.4_Missense_Mutation_p.T257R|CTAGE5_ENST00000348007.3_Missense_Mutation_p.T286R|CTAGE5_ENST00000396158.2_Missense_Mutation_p.T291R|CTAGE5_ENST00000556148.1_Missense_Mutation_p.T211R|CTAGE5_ENST00000341749.3_Missense_Mutation_p.T274R|CTAGE5_ENST00000553352.1_Missense_Mutation_p.T257R|CTAGE5_ENST00000341502.5_Missense_Mutation_p.T286R|CTAGE5_ENST00000557038.1_Missense_Mutation_p.T206R|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.T257R|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.T821R			O15320	CTGE5_HUMAN	CTAGE family, member 5	286					positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		GAAGACATAACGGATGATGAT	0.383																																					p.T291R		.											.	CTAGE5-90	0			c.C872G						.						189.0	174.0	179.0					14																	39771394		2203	4300	6503	SO:0001583	missense	4253	exon10			ACATAACGGATGA	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.857C>G	14.37:g.39771394C>G	ENSP00000280083:p.Thr286Arg	207	0		273	123	NM_001247989	0	0	15	23	8	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	37	CCDS9674.1	.	.	.	.	.	.	.	.	.	.	C	3.360	-0.130783	0.06753	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T;T	0.70986	3.17;3.03;3.03;3.03;3.31;2.32;3.32;-0.53;-0.49;3.03	5.78	1.01	0.19927	.	1.400750	0.05395	N	0.539640	T	0.79563	0.4467	M	0.76574	2.34	0.09310	N	1	D;B;B;B;B;P	0.52996	0.957;0.013;0.003;0.013;0.001;0.708	P;B;B;B;B;P	0.55161	0.77;0.022;0.015;0.022;0.013;0.67	T	0.63134	-0.6705	9	.	.	.	.	9.0207	0.36198	0.0:0.5452:0.0:0.4548	.	248;291;286;286;257;274	F8W9E1;O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;.;CTGE5_HUMAN;.;.	R	821;274;206;248;257;286;291;286;211;286;257	ENSP00000452252:T821R;ENSP00000343897:T274R;ENSP00000450869:T206R;ENSP00000379468:T257R;ENSP00000339286:T286R;ENSP00000379462:T291R;ENSP00000280083:T286R;ENSP00000452562:T211R;ENSP00000343912:T286R;ENSP00000450449:T257R	.	T	+	2	0	CTAGE5;RP11-407N17.3	38841145	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	0.087000	0.14958	0.266000	0.21894	-1.127000	0.01993	ACG	.		0.383	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930	
ARID4A	5926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	58833675	58833676	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	TA	TA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:58833675_58833676delTA	ENST00000355431.3	+	23	3971_3972	c.3598_3599delTA	c.(3598-3600)tatfs	p.Y1200fs	ARID4A_ENST00000395168.3_Frame_Shift_Del_p.Y1146fs|ARID4A_ENST00000348476.3_Frame_Shift_Del_p.Y1131fs|ARID4A_ENST00000431317.2_Frame_Shift_Del_p.Y1131fs	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1200				IRKYYM -> SENIICL (in Ref. 4; no nucleotide entry). {ECO:0000305}.	erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CAGAAAATATTATATGTCTTTG	0.312																																					p.1200_1200del		.											.	ARID4A-231	0			c.3598_3599del						.																																			SO:0001589	frameshift_variant	5926	exon23			AAATATTATATGT	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3598_3599delTA	14.37:g.58833677_58833678delTA	ENSP00000347602:p.Tyr1200fs	135	0		113	65	NM_002892	0	0	0	0	0	Q15991|Q15992|Q15993	Frame_Shift_Del	DEL	ENST00000355431.3	37	CCDS9732.1																																																																																			.		0.312	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
SAMD15	161394	broad.mit.edu	37	14	77844127	77844127	+	Silent	SNP	G	G	A	rs61990322	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:77844127G>A	ENST00000216471.4	+	1	652	c.366G>A	c.(364-366)ttG>ttA	p.L122L	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	122										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCAAAGATTTGGAGGCCCCTA	0.473													G|||	6	0.00119808	0.0	0.0014	5008	,	,		19325	0.0		0.003	False		,,,				2504	0.002				p.L122L		.											.	SAMD15-90	0			c.G366A						.	G		0,4406		0,0,2203	131.0	144.0	140.0		366	3.6	0.3	14	dbSNP_129	140	23,8577	16.6+/-54.9	0,23,4277	no	coding-synonymous	SAMD15	NM_001010860.1		0,23,6480	AA,AG,GG		0.2674,0.0,0.1768		122/675	77844127	23,12983	2203	4300	6503	SO:0001819	synonymous_variant	161394	exon1			AGATTTGGAGGCC	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.366G>A	14.37:g.77844127G>A		67	0		71	4	NM_001010860	0	0	0	0	0	Q2M3P3	Silent	SNP	ENST00000216471.4	37	CCDS32126.1																																																																																			G|0.998;A|0.002		0.473	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
FLRT2	23768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	86089505	86089505	+	Silent	SNP	C	C	A	rs35699071		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:86089505C>A	ENST00000330753.4	+	2	2414	c.1647C>A	c.(1645-1647)ggC>ggA	p.G549G	FLRT2_ENST00000554746.1_Silent_p.G549G	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	549					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TGATCGGGGGCGCGGTGATAT	0.587																																					p.G549G		.											.	FLRT2-94	0			c.C1647A						.						77.0	82.0	81.0					14																	86089505		2203	4300	6503	SO:0001819	synonymous_variant	23768	exon2			CGGGGGCGCGGTG	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1647C>A	14.37:g.86089505C>A		98	0		123	56	NM_013231	0	0	0	0	0	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1																																																																																			C|0.983;T|0.017		0.587	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
IFI27L2	83982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	94594238	94594240	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:94594238_94594240delAGA	ENST00000238609.3	-	4	388_390	c.289_291delTCT	c.(289-291)tctdel	p.S97del	IFI27L2_ENST00000556727.1_In_Frame_Del_p.S72del	NM_032036.2	NP_114425.1	Q9H2X8	I27L2_HUMAN	interferon, alpha-inducible protein 27-like 2	97						integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	8						CAGCTGGGAGAGAAGAAGAAGGT	0.532																																					p.97_97del		.											.	IFI27L2-90	0			c.289_291del						.																																			SO:0001651	inframe_deletion	83982	exon4			TGGGAGAGAAGAA	AF208232	CCDS9920.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000119632			19753	protein-coding gene	gene with protein product		611319	"""family with sequence similarity 14, member A"""	FAM14A			Standard	NM_032036		Approved	TLH29	uc001ycq.3	Q9H2X8		ENST00000238609.3:c.289_291delTCT	14.37:g.94594244_94594246delAGA	ENSP00000238609:p.Ser97del	114	0		133	44	NM_032036	0	0	0	0	0	Q8TBD7|Q9NYL0	In_Frame_Del	DEL	ENST00000238609.3	37	CCDS9920.1																																																																																			.		0.532	IFI27L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412935.1	NM_032036	
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		4	0		11	6	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
SNRPN	6638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	25222108	25222108	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:25222108G>T	ENST00000400100.1	+	10	1242	c.352G>T	c.(352-354)Gtg>Ttg	p.V118L	SNRPN_ENST00000554227.2_Missense_Mutation_p.V122L|SNURF_ENST00000551312.2_Intron|SNURF_ENST00000338094.6_3'UTR|SNHG14_ENST00000551631.2_RNA|SNRPN_ENST00000444203.2_Missense_Mutation_p.V122L|SNRPN_ENST00000400098.1_Missense_Mutation_p.V118L|SNRPN_ENST00000346403.6_Missense_Mutation_p.V118L|SNRPN_ENST00000400097.1_Missense_Mutation_p.V118L|SNRPN_ENST00000390687.4_Missense_Mutation_p.V118L|SNRPN_ENST00000577565.1_Missense_Mutation_p.V118L	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	118					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ACCAGCTGGTGTGCCAATTCC	0.572									Prader-Willi syndrome																												p.V118L		.											.	SNRPN-469	0			c.G352T						.						59.0	61.0	61.0					15																	25222108		1890	4117	6007	SO:0001583	missense	6638	exon10	Familial Cancer Database	Prader-Labhart-Willi syndrome	GCTGGTGTGCCAA	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.352G>T	15.37:g.25222108G>T	ENSP00000382972:p.Val118Leu	41	0		43	18	NM_022807	0	0	212	212	0	B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	37	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019434	0.54576	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12	3.79	3.79	0.43588	.	0.064020	0.64402	D	0.000011	T	0.32585	0.0834	L	0.51422	1.61	0.80722	D	1	P;P	0.35844	0.524;0.524	B;B	0.28849	0.095;0.095	T	0.12218	-1.0556	10	0.18276	T	0.48	-17.1593	13.963	0.64193	0.0:0.0:1.0:0.0	.	122;118	B3KVR1;P63162	.;RSMN_HUMAN	L	118;118;118;122;118;122	ENSP00000382972:V118L;ENSP00000382970:V118L;ENSP00000382969:V118L;ENSP00000452342:V122L;ENSP00000375105:V118L;ENSP00000408767:V122L	ENSP00000375105:V118L	V	+	1	0	SNRPN	22773201	1.000000	0.71417	0.950000	0.38849	0.992000	0.81027	6.099000	0.71466	2.409000	0.81822	0.561000	0.74099	GTG	.		0.572	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
ELL3	80237	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	44069077	44069078	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:44069077_44069078delAG	ENST00000319359.3	-	1	663_664	c.22_23delCT	c.(22-24)ctgfs	p.L8fs	RP11-296A16.1_ENST00000417761.2_Intron|SERF2_ENST00000381359.1_5'Flank|ELL3_ENST00000497465.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	8					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		CTGTCCTCTCAGAGGCTCCTGG	0.649											OREG0003946	type=REGULATORY REGION|Gene=NM_005770|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.8_8del		.											.	ELL3-91	0			c.22_23del						.																																			SO:0001589	frameshift_variant	80237	exon1			CCTCTCAGAGGCT	AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.22_23delCT	15.37:g.44069079_44069080delAG	ENSP00000320346:p.Leu8fs	43	0	921	59	31	NM_025165	0	0	0	0	0	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Frame_Shift_Del	DEL	ENST00000319359.3	37	CCDS10102.1																																																																																			.		0.649	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133236.2	NM_025165	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051846	79051846	+	Missense_Mutation	SNP	T	T	C	rs199524707		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:79051846T>C	ENST00000388820.4	-	24	5188	c.4978A>G	c.(4978-4980)Atc>Gtc	p.I1660V		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1660	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGGTGCGGATGGTGGGCAGC	0.721																																					p.I1660V		.											.	ADAMTS7-226	0			c.A4978G						.						9.0	11.0	10.0					15																	79051846		2122	4204	6326	SO:0001583	missense	11173	exon24			TGCGGATGGTGGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4978A>G	15.37:g.79051846T>C	ENSP00000373472:p.Ile1660Val	21	0		107	14	NM_014272	0	0	10	10	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.471801	0.00167	.	.	ENSG00000136378	ENST00000388820	T	0.56941	0.43	2.92	-0.818	0.10833	PLAC (1);	0.176997	0.36002	N	0.002857	T	0.17066	0.0410	N	0.01874	-0.695	0.24807	N	0.992664	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	7.4446	0.27203	0.0:0.6997:0.0:0.3003	.	1660	Q9UKP4	ATS7_HUMAN	V	1660	ENSP00000373472:I1660V	ENSP00000373472:I1660V	I	-	1	0	ADAMTS7	76838901	0.463000	0.25799	0.157000	0.22605	0.002000	0.02628	0.822000	0.27352	-0.289000	0.09038	-0.830000	0.03078	ATC	.		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ZNF592	9640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	85326912	85326912	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:85326912C>G	ENST00000560079.2	+	4	1294	c.1006C>G	c.(1006-1008)Ctg>Gtg	p.L336V	ZNF592_ENST00000299927.3_Missense_Mutation_p.L336V	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	336					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCGGAGCCCTCTGGAGGCCAC	0.567																																					p.L336V		.											.	ZNF592-96	0			c.C1006G						.						71.0	83.0	79.0					15																	85326912		2203	4299	6502	SO:0001583	missense	9640	exon4			AGCCCTCTGGAGG	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1006C>G	15.37:g.85326912C>G	ENSP00000452877:p.Leu336Val	70	0		107	56	NM_014630	0	0	0	1	1	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.587745	0.28268	.	.	ENSG00000166716	ENST00000299927	T	0.00620	6.17	5.59	2.43	0.29744	.	0.286641	0.33875	N	0.004478	T	0.00384	0.0012	N	0.08118	0	0.31516	N	0.662959	B	0.33171	0.4	B	0.36464	0.225	T	0.28808	-1.0032	10	0.05351	T	0.99	-16.8867	4.2122	0.10517	0.2691:0.5443:0.0:0.1866	.	336	Q92610	ZN592_HUMAN	V	336	ENSP00000299927:L336V	ENSP00000299927:L336V	L	+	1	2	ZNF592	83127916	0.099000	0.21834	1.000000	0.80357	0.998000	0.95712	0.608000	0.24223	1.359000	0.45940	0.655000	0.94253	CTG	.		0.567	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
MAN2A2	4122	bcgsc.ca	37	15	91452595	91452595	+	Missense_Mutation	SNP	A	A	G	rs2106673	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:91452595A>G	ENST00000559717.1	+	9	1694	c.1235A>G	c.(1234-1236)cAg>cGg	p.Q412R	MAN2A2_ENST00000431652.2_5'UTR|MAN2A2_ENST00000360468.3_Missense_Mutation_p.Q412R|MAN2A2_ENST00000430376.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	412			Q -> R (in dbSNP:rs2106673).		cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			AAGAAGTCCCAGCTGTTCCGA	0.552													G|||	2562	0.511581	0.3275	0.6066	5008	,	,		17237	0.9673		0.2833	False		,,,				2504	0.4581				p.Q412R		.											.	MAN2A2-136	0			c.A1235G						.	G	ARG/GLN	1401,2995	685.4+/-404.6	218,965,1015	72.0	67.0	69.0		1235	2.4	1.0	15	dbSNP_96	69	2592,6004	689.0+/-404.3	380,1832,2086	yes	missense	MAN2A2	NM_006122.2	43	598,2797,3101	GG,GA,AA		30.1536,31.8699,30.7343	benign	412/1151	91452595	3993,8999	2198	4298	6496	SO:0001583	missense	4122	exon8			AGTCCCAGCTGTT	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1235A>G	15.37:g.91452595A>G	ENSP00000452948:p.Gln412Arg	140	0		135	5	NM_006122	0	0	9	9	0	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	1119	0.5123626373626373	155	0.3150406504065041	200	0.5524861878453039	556	0.972027972027972	208	0.27440633245382584	G	11.69	1.713975	0.30413	0.318699	0.301536	ENSG00000196547	ENST00000360468	T	0.74002	-0.8	5.74	2.42	0.29668	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.273076	0.38959	N	0.001506	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999949408	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.33445	-0.9868	9	0.15499	T	0.54	-25.785	8.1177	0.30953	0.5043:0.0:0.4957:0.0	rs2106673;rs52827682;rs56746832;rs2106673	82;412;412	B4DIK4;P49641-1;P49641	.;.;MA2A2_HUMAN	R	412	ENSP00000353655:Q412R	ENSP00000353655:Q412R	Q	+	2	0	MAN2A2	89253599	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	3.686000	0.54685	0.394000	0.25230	-0.222000	0.12452	CAG	A|0.596;G|0.404		0.552	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
ARRDC4	91947	hgsc.bcm.edu	37	15	98504326	98504326	+	Missense_Mutation	SNP	A	A	G	rs12101554	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr15:98504326A>G	ENST00000268042.6	+	1	399	c.235A>G	c.(235-237)Acc>Gcc	p.T79A	ARRDC4_ENST00000538249.1_Intron	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	79			T -> A (in dbSNP:rs12101554). {ECO:0000269|PubMed:15489334}.		positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTCGGCCAGCACCGCGGCCCT	0.786													g|||	3817	0.762181	0.5976	0.7118	5008	,	,		7745	0.88		0.7485	False		,,,				2504	0.9131				p.T79A		.											.	ARRDC4-90	0			c.A235G						.		ALA/THR	934,448		327,280,84	1.0	1.0	1.0		235	0.8	0.0	15	dbSNP_120	1	2287,687		920,447,120	no	missense	ARRDC4	NM_183376.2	58	1247,727,204	GG,GA,AA		23.1002,32.4168,26.056	benign	79/419	98504326	3221,1135	691	1487	2178	SO:0001583	missense	91947	exon1			GCCAGCACCGCGG	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.235A>G	15.37:g.98504326A>G	ENSP00000268042:p.Thr79Ala	0	0		7	7	NM_183376	0	0	0	0	0	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	1613	0.7385531135531136	289	0.5873983739837398	255	0.7044198895027625	512	0.8951048951048951	557	0.7348284960422163	g	3.442	-0.113882	0.06881	0.675832	0.768998	ENSG00000140450	ENST00000268042	T	0.07567	3.18	4.08	0.777	0.18538	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.46222	P	0.0010670000000000401	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.02654	T	1	-4.3851	2.5111	0.04657	0.2812:0.0:0.3307:0.3881	rs12101554;rs17845860;rs17858835;rs57152335	79	Q8NCT1	ARRD4_HUMAN	A	79	ENSP00000268042:T79A	ENSP00000268042:T79A	T	+	1	0	ARRDC4	96305330	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	-0.193000	0.09573	0.288000	0.22398	-0.370000	0.07254	ACC	A|0.263;G|0.737		0.786	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
CCDC154	645811	broad.mit.edu	37	16	1486505	1486505	+	Silent	SNP	G	G	A	rs184119365	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:1486505G>A	ENST00000389176.3	-	13	1621	c.1455C>T	c.(1453-1455)gaC>gaT	p.D485D	CCDC154_ENST00000409671.1_Silent_p.D331D	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	485						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						GCAGGCACTTGTCGGAGACAC	0.642													G|||	8	0.00159744	0.0	0.0	5008	,	,		17295	0.0		0.008	False		,,,				2504	0.0				p.D476D		.											.	.	0			c.C1428T						.	G		0,1384		0,0,692	76.0	67.0	70.0		1428	2.6	0.7	16		70	16,3166		0,16,1575	yes	coding-synonymous	CCDC154	NM_001143980.1		0,16,2267	AA,AG,GG		0.5028,0.0,0.3504		476/668	1486505	16,4550	692	1591	2283	SO:0001819	synonymous_variant	645811	exon13			GCACTTGTCGGAG			16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1455C>T	16.37:g.1486505G>A		70	0		86	3	NM_001143980	0	0	1	1	0	G9JV18	Silent	SNP	ENST00000389176.3	37																																																																																				G|0.996;A|0.004		0.642	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001143980	
AMDHD2	51005	hgsc.bcm.edu;bcgsc.ca	37	16	2571079	2571081	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:2571079_2571081delCTT	ENST00000293971.6	+	3	409_411	c.315_317delCTT	c.(313-318)tccttc>tcc	p.F106del	ATP6C_ENST00000569317.1_In_Frame_Del_p.F59del|AMDHD2_ENST00000302956.4_In_Frame_Del_p.F106del|AMDHD2_ENST00000413459.3_In_Frame_Del_p.F106del	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	106					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						GCGTCACCTCCTTCTGCCCCACC	0.65																																					p.105_106del		.											.	AMDHD2-155	0			c.315_317del						.																																			SO:0001651	inframe_deletion	51005	exon3			CACCTCCTTCTGC	AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.315_317delCTT	16.37:g.2571079_2571081delCTT	ENSP00000293971:p.Phe106del	202	1		188	81	NM_001145815	0	0	0	0	0	B4DL77|Q8WV54	In_Frame_Del	DEL	ENST00000293971.6	37																																																																																				.		0.650	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435652.1	NM_015944	
ERN2	10595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23706392	23706392	+	Silent	SNP	G	G	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:23706392G>C	ENST00000457008.2	-	15	1730	c.1692C>G	c.(1690-1692)gtC>gtG	p.V564V	ERN2_ENST00000256797.4_Silent_p.V664V					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		GCTGCAGCACGACCTCGGGCT	0.632																																					p.V664V		.											.	ERN2-322	0			c.C1992G						.						70.0	74.0	73.0					16																	23706392		2197	4300	6497	SO:0001819	synonymous_variant	10595	exon16			CAGCACGACCTCG	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1692C>G	16.37:g.23706392G>C		117	0		169	75	NM_033266	0	0	0	0	0		Silent	SNP	ENST00000457008.2	37																																																																																				.		0.632	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
ZNF688	146542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30582444	30582444	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:30582444C>T	ENST00000223459.6	-	2	1301	c.197G>A	c.(196-198)gGa>gAa	p.G66E	ZNF688_ENST00000395219.1_Splice_Site_p.G52E|AC002310.7_ENST00000486926.1_RNA|ZNF688_ENST00000567855.1_Splice_Site_p.G66E|AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000563707.1_Intron	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						GCCTGGGAATCCTGGGAGAGA	0.617																																					p.G66E		.											.	ZNF688-68	0			c.G197A						.						27.0	29.0	28.0					16																	30582444		2197	4300	6497	SO:0001630	splice_region_variant	146542	exon2			GGGAATCCTGGGA	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.197-1G>A	16.37:g.30582444C>T		22	0		21	7	NM_145271	0	0	9	11	2	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	37	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366702	0.82463	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.04809	3.55;4.25	5.2	4.25	0.50352	Krueppel-associated box (4);	.	.	.	.	T	0.08935	0.0221	L	0.55213	1.73	0.38795	D	0.955074	P;B	0.51240	0.943;0.192	P;B	0.48334	0.574;0.02	T	0.06303	-1.0834	9	0.72032	D	0.01	.	9.9428	0.41591	0.0:0.9081:0.0:0.0919	.	66;52	P0C7X2;A8MV39	ZN688_HUMAN;.	E	52;66	ENSP00000378645:G52E;ENSP00000223459:G66E	ENSP00000223459:G66E	G	-	2	0	ZNF688	30489945	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.521000	0.45563	1.561000	0.49584	0.655000	0.94253	GGA	.		0.617	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271	Missense_Mutation
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		4	4	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CTCF	10664	broad.mit.edu;bcgsc.ca	37	16	67654677	67654677	+	Silent	SNP	C	C	T	rs143837268	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:67654677C>T	ENST00000264010.4	+	6	1608	c.1164C>T	c.(1162-1164)agC>agT	p.S388S	CTCF_ENST00000401394.1_Silent_p.S60S	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	388					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GTTATGCCAGCAGGGACACAT	0.448													C|||	37	0.00738818	0.0	0.0014	5008	,	,		20736	0.0		0.0258	False		,,,				2504	0.0102				p.S388S	Colon(175;1200 1966 6945 23069 27405)	.											.	CTCF-91	0			c.C1164T						.	C	,	15,4381	22.3+/-47.3	0,15,2183	151.0	111.0	125.0		180,1164	6.1	1.0	16	dbSNP_134	125	173,8427	79.5+/-142.1	2,169,4129	no	coding-synonymous,coding-synonymous	CTCF	NM_001191022.1,NM_006565.3	,	2,184,6312	TT,TC,CC		2.0116,0.3412,1.4466	,	60/400,388/728	67654677	188,12808	2198	4300	6498	SO:0001819	synonymous_variant	10664	exon6			TGCCAGCAGGGAC	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1164C>T	16.37:g.67654677C>T		217	1		149	6	NM_006565	0	0	7	7	0	B5MC38|Q53XI7|Q59EL8	Silent	SNP	ENST00000264010.4	37	CCDS10841.1																																																																																			C|0.988;T|0.012		0.448	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
MBTPS1	8720	bcgsc.ca	37	16	84115393	84115393	+	Silent	SNP	G	G	A	rs12933523	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:84115393G>A	ENST00000343411.3	-	11	1902	c.1407C>T	c.(1405-1407)ctC>ctT	p.L469L	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	469	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GATAGGCTCTGAGCAGATCGA	0.592													G|||	471	0.0940495	0.0287	0.1153	5008	,	,		14673	0.1131		0.1779	False		,,,				2504	0.0613				p.L469L		.											.	MBTPS1-92	0			c.C1407T						.	G		245,4155	143.1+/-178.2	4,237,1959	100.0	94.0	96.0		1407	-3.9	0.0	16	dbSNP_121	96	1554,7046	291.7+/-300.5	130,1294,2876	no	coding-synonymous	MBTPS1	NM_003791.2		134,1531,4835	AA,AG,GG		18.0698,5.5682,13.8385		469/1053	84115393	1799,11201	2200	4300	6500	SO:0001819	synonymous_variant	8720	exon11			GGCTCTGAGCAGA	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1407C>T	16.37:g.84115393G>A		81	0		7	4	NM_003791	0	0	0	0	0	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1																																																																																			G|0.869;A|0.131		0.592	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
CRISPLD2	83716	broad.mit.edu	37	16	84883096	84883096	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:84883096G>T	ENST00000262424.5	+	4	689	c.465G>T	c.(463-465)tcG>tcT	p.S155S	CRISPLD2_ENST00000566431.1_3'UTR|CRISPLD2_ENST00000567845.1_Silent_p.S155S|CRISPLD2_ENST00000564567.1_Silent_p.S155S	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	155	SCP.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						AGAGGTGCTCGGGGCCCATGT	0.632																																					p.S155S		.											.	CRISPLD2-90	0			c.G465T						.						119.0	98.0	105.0					16																	84883096		2199	4300	6499	SO:0001819	synonymous_variant	83716	exon4			GTGCTCGGGGCCC	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.465G>T	16.37:g.84883096G>T		123	0		100	4	NM_031476	0	0	0	0	0	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Silent	SNP	ENST00000262424.5	37	CCDS10949.1																																																																																			.		0.632	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2	NM_031476	
ACSF3	197322	ucsc.edu;bcgsc.ca	37	16	89167094	89167094	+	Missense_Mutation	SNP	T	T	C	rs7188200	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr16:89167094T>C	ENST00000317447.4	+	3	382	c.5T>C	c.(4-6)cTg>cCg	p.L2P	ACSF3_ENST00000406948.3_Missense_Mutation_p.L2P|ACSF3_ENST00000378345.4_Intron	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	2			L -> P (in dbSNP:rs7188200). {ECO:0000269|PubMed:15489334}.		fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		AGTGCAATGCTGCCCCATGTG	0.622													C|||	3127	0.624401	0.6029	0.7853	5008	,	,		14671	0.4841		0.7803	False		,,,				2504	0.5235				p.L2P		.											.	ACSF3-68	0			c.T5C						.						13.0	13.0	13.0					16																	89167094		2132	4171	6303	SO:0001583	missense	197322	exon3			CAATGCTGCCCCA	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.5T>C	16.37:g.89167094T>C	ENSP00000320646:p.Leu2Pro	21	0		23	20	NM_174917	0	0	0	6	6	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	37	CCDS10974.1	1411	0.6460622710622711	285	0.5792682926829268	282	0.7790055248618785	269	0.47027972027972026	575	0.758575197889182	C	8.627	0.892749	0.17613	.	.	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.57595	0.82;0.39;0.82	4.81	-8.23	0.01033	.	3.072820	0.01137	N	0.006101	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.30268	-0.9984	9	0.30078	T	0.28	4.6826	6.063	0.19848	0.0912:0.4503:0.0926:0.3659	rs7188200;rs52794281;rs59665105;rs7188200	2	Q4G176	ACSF3_HUMAN	P	2	ENSP00000320646:L2P;ENSP00000440734:L2P;ENSP00000384627:L2P	ENSP00000320646:L2P	L	+	2	0	ACSF3	87694595	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.587000	0.02108	-2.224000	0.00725	-2.069000	0.00389	CTG	T|0.381;C|0.619		0.622	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
HIC1	3090	hgsc.bcm.edu	37	17	1960974	1960974	+	Silent	SNP	C	C	T	rs77393586	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:1960974C>T	ENST00000322941.3	+	2	1047	c.1047C>T	c.(1045-1047)cgC>cgT	p.R349R	HIC1_ENST00000399849.3_Silent_p.R330R|SMG6_ENST00000573166.1_5'Flank	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	349					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		GCCGGGAGCGCGGCTCCCCCA	0.776													c|||	720	0.14377	0.2057	0.2824	5008	,	,		6818	0.0496		0.1272	False		,,,				2504	0.0757				p.R349R		.											.	HIC1-135	0			c.C1047T						.		,	305,2047		12,281,883	2.0	3.0	3.0		1047,990	-0.8	0.9	17	dbSNP_131	3	660,5334		34,592,2371	no	coding-synonymous,coding-synonymous	HIC1	NM_001098202.1,NM_006497.3	,	46,873,3254	TT,TC,CC		11.011,12.9677,11.5624	,	349/734,330/715	1960974	965,7381	1176	2997	4173	SO:0001819	synonymous_variant	3090	exon2			GGAGCGCGGCTCC		CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1047C>T	17.37:g.1960974C>T		0	0		14	7	NM_001098202	0	0	0	0	0	D3DTI4	Silent	SNP	ENST00000322941.3	37	CCDS42229.1																																																																																			C|0.839;T|0.161		0.776	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438878.1	NM_006497	
OR3A1	4994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3195043	3195043	+	Silent	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:3195043T>A	ENST00000323404.1	-	1	833	c.834A>T	c.(832-834)ggA>ggT	p.G278G	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	278					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						TGTTGAAAATTCCAACAGCTT	0.468																																					p.G278G	GBM(20;287 516 18743 28660 36594)	.											.	OR3A1-70	0			c.A834T						.						127.0	123.0	124.0					17																	3195043		2203	4300	6503	SO:0001819	synonymous_variant	4994	exon1			GAAAATTCCAACA	X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.834A>T	17.37:g.3195043T>A		138	0		156	59	NM_002550	0	0	0	0	0	Q4VB06|Q6IFM4	Silent	SNP	ENST00000323404.1	37	CCDS11023.1																																																																																			.		0.468	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		17	17	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693384	4693384	+	Silent	SNP	T	T	C	rs150754782	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:4693384T>C	ENST00000331264.7	+	4	722	c.669T>C	c.(667-669)ggT>ggC	p.G223G		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	223						cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)	p.G223G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						CGGCCCTGGGTCCGCATCACC	0.766													T|||	90	0.0179712	0.0015	0.0288	5008	,	,		10010	0.003		0.0596	False		,,,				2504	0.0051				p.G223G		.											.	GLTPD2-68	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.T669C						.	T		9,3409		0,9,1700	2.0	3.0	3.0		669	-0.3	0.9	17	dbSNP_134	3	203,7141		2,199,3471	no	coding-synonymous	GLTPD2	NM_001014985.2		2,208,5171	CC,CT,TT		2.7642,0.2633,1.9699		223/292	4693384	212,10550	1709	3672	5381	SO:0001819	synonymous_variant	388323	exon4			CCTGGGTCCGCAT	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.669T>C	17.37:g.4693384T>C		1	0		28	10	NM_001014985	0	0	0	0	0	A7E2T2	Silent	SNP	ENST00000331264.7	37	CCDS32534.1																																																																																			T|0.978;C|0.022		0.766	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
CNTROB	116840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7842968	7842970	+	In_Frame_Del	DEL	AGA	AGA	-	rs150485845		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:7842968_7842970delAGA	ENST00000563694.1	+	8	1990_1992	c.1065_1067delAGA	c.(1063-1068)ctagaa>cta	p.E358del	CNTROB_ENST00000565740.1_In_Frame_Del_p.E358del|CNTROB_ENST00000380262.3_In_Frame_Del_p.E358del|CNTROB_ENST00000380255.3_In_Frame_Del_p.E358del	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	358					centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				GGGCTGCCCTAGAAGAAGAACGG	0.601																																					p.355_356del		.											.	CNTROB-153	0			c.1065_1067del						.																																			SO:0001651	inframe_deletion	116840	exon8			TGCCCTAGAAGAA	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.1065_1067delAGA	17.37:g.7842974_7842976delAGA	ENSP00000456335:p.Glu358del	157	0		204	104	NM_001037144	0	0	0	0	0	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	In_Frame_Del	DEL	ENST00000563694.1	37	CCDS11126.1																																																																																			.		0.601	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	1	0		20	6	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		11	7	NM_001199417	0	0	2	2	0		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830562	36830562	+	Missense_Mutation	SNP	G	G	C	rs79676758	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:36830562G>C	ENST00000325814.5	-	1	625	c.187C>G	c.(187-189)Ctg>Gtg	p.L63V		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	63	Pro-rich.				neuron fate commitment (GO:0048663)												CGCGCCGCCAGCTCCCCAGGC	0.766													G|||	965	0.192692	0.2693	0.1239	5008	,	,		11134	0.2004		0.1779	False		,,,				2504	0.1452				p.L63V		.											.	.	0			c.C187G						.						1.0	2.0	2.0					17																	36830562		328	928	1256	SO:0001583	missense	100170841	exon1			CCGCCAGCTCCCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.187C>G	17.37:g.36830562G>C	ENSP00000317905:p.Leu63Val	1	0		14	9	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	383	0.17536630036630035	117	0.23780487804878048	48	0.13259668508287292	93	0.16258741258741258	125	0.16490765171503957	G	13.17	2.158099	0.38119	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.39035	P	0.03997899999999999	P	0.50443	0.935	P	0.46479	0.518	T	0.10847	-1.0612	7	0.87932	D	0	.	10.799	0.46476	0.0:0.0:1.0:0.0	.	63	A6NHQ4	CQ096_HUMAN	V	63	.	ENSP00000317905:L63V	L	-	1	2	C17orf96	34084088	0.995000	0.38212	0.991000	0.47740	0.004000	0.04260	0.513000	0.22770	1.657000	0.50732	0.462000	0.41574	CTG	G|0.824;C|0.176		0.766	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
GHDC	84514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40342700	40342700	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:40342700C>T	ENST00000301671.8	-	7	1671	c.1230G>A	c.(1228-1230)gtG>gtA	p.V410V	GHDC_ENST00000593209.1_Silent_p.V410V|GHDC_ENST00000436923.2_Silent_p.V410V|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000428494.2_Silent_p.V371V|GHDC_ENST00000587427.1_Silent_p.V410V|GHDC_ENST00000414034.3_Silent_p.V410V			Q8N2G8	GHDC_HUMAN	GH3 domain containing	410						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCCACTGCCCCACTGCCCGGC	0.637																																					p.V410V		.											.	GHDC-90	0			c.G1230A						.						36.0	37.0	37.0					17																	40342700		2203	4300	6503	SO:0001819	synonymous_variant	84514	exon8			CTGCCCCACTGCC	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.1230G>A	17.37:g.40342700C>T		79	0		99	47	NM_001142623	0	0	16	38	22	B4DQS4|E9PDB5|Q9BXM6	Silent	SNP	ENST00000301671.8	37	CCDS11422.1																																																																																			.		0.637	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
ASB16	92591	hgsc.bcm.edu	37	17	42254281	42254281	+	Missense_Mutation	SNP	A	A	G	rs7212573	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:42254281A>G	ENST00000293414.1	+	3	829	c.745A>G	c.(745-747)Acg>Gcg	p.T249A	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000585457.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	249				T -> A (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCGCTGAACACGGCGTGCGC	0.756													G|||	2594	0.517971	0.702	0.4424	5008	,	,		11135	0.752		0.2932	False		,,,				2504	0.3129				p.T249A		.											.	ASB16-227	0			c.A745G						.	G	ALA/THR,ARG/CYS	2530,1736		801,928,404	7.0	8.0	7.0		745,340	3.1	0.7	17	dbSNP_116	7	2387,5811		422,1543,2134	no	missense,missense	ASB16,C17orf65	NM_080863.4,NM_178542.3	58,180	1223,2471,2538	GG,GA,AA		29.1169,40.6939,39.4496	benign,benign	249/454,114/194	42254281	4917,7547	2133	4099	6232	SO:0001583	missense	92591	exon3			CTGAACACGGCGT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.745A>G	17.37:g.42254281A>G	ENSP00000293414:p.Thr249Ala	0	0		23	9	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1144|1144	0.5238095238095238|0.5238095238095238	349|349	0.709349593495935|0.709349593495935	142|142	0.39226519337016574|0.39226519337016574	420|420	0.7342657342657343|0.7342657342657343	233|233	0.3073878627968338|0.3073878627968338	G|G	5.919|5.919	0.353578|0.353578	0.11182|0.11182	0.593061|0.593061	0.291169|0.291169	ENSG00000168597|ENSG00000161664	ENST00000303061|ENST00000293414	.|T	.|0.51817	.|0.69	5.22|5.22	3.08|3.08	0.35506|0.35506	.|Ankyrin repeat-containing domain (4);	.|0.157781	.|0.56097	.|N	.|0.000038	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.04148|0.04148	-0.265|-0.265	0.58432|0.58432	P|P	8.000000000008E-6|8.000000000008E-6	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.41502|0.41502	-0.9505|-0.9505	7|9	0.87932|0.05833	D|T	0|0.94	-9.3151|-9.3151	9.5645|9.5645	0.39389|0.39389	0.0761:0.0:0.6662:0.2577|0.0761:0.0:0.6662:0.2577	rs7212573|rs7212573	114|249	Q495Z4|Q96NS5	CQ065_HUMAN|ASB16_HUMAN	R|A	114|249	.|ENSP00000293414:T249A	ENSP00000366342:C114R|ENSP00000293414:T249A	C|T	-|+	1|1	0|0	C17orf65|ASB16	39609807|39609807	0.002000|0.002000	0.14202|0.14202	0.723000|0.723000	0.30687|0.30687	0.056000|0.056000	0.15407|0.15407	1.059000|1.059000	0.30517|0.30517	0.777000|0.777000	0.33496|0.33496	-0.227000|-0.227000	0.12334|0.12334	TGT|ACG	A|0.476;G|0.524		0.756	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
CACNA1G	8913	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	48638951	48638951	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:48638951C>T	ENST00000359106.5	+	1	131	c.131C>T	c.(130-132)gCg>gTg	p.A44V	CACNA1G_ENST00000358244.5_Missense_Mutation_p.A44V|CACNA1G_ENST00000510366.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000515165.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000429973.2_Missense_Mutation_p.A44V|CACNA1G_ENST00000507336.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000514181.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000514079.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000515765.1_Missense_Mutation_p.A44V|CACNA1G-AS1_ENST00000505793.1_RNA|CACNA1G_ENST00000507896.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000354983.4_Missense_Mutation_p.A44V|CACNA1G_ENST00000442258.2_Missense_Mutation_p.A44V|CACNA1G_ENST00000416767.4_Missense_Mutation_p.A44V|CACNA1G_ENST00000507510.2_Missense_Mutation_p.A44V|CACNA1G_ENST00000515411.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000512389.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000507609.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000514717.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000513964.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000503485.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000513689.2_Missense_Mutation_p.A44V|CACNA1G_ENST00000505165.1_Missense_Mutation_p.A44V|CACNA1G-AS1_ENST00000505495.1_RNA|CACNA1G_ENST00000510115.1_Missense_Mutation_p.A44V|RP11-94C24.11_ENST00000513378.1_RNA|CACNA1G_ENST00000502264.1_Missense_Mutation_p.A44V|CACNA1G_ENST00000352832.5_Missense_Mutation_p.A44V|CACNA1G-AS1_ENST00000508920.1_RNA|CACNA1G_ENST00000360761.4_Missense_Mutation_p.A44V	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	44					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CCGGGCAGCGCGGACTCCGAG	0.731																																					p.A44V		.											.	CACNA1G-67	0			c.C131T						.						4.0	5.0	5.0					17																	48638951		1666	3781	5447	SO:0001583	missense	8913	exon1			GCAGCGCGGACTC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.131C>T	17.37:g.48638951C>T	ENSP00000352011:p.Ala44Val	20	0		37	18	NM_001256360	0	0	0	0	0	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	c	12.95	2.092203	0.36952	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96940	-4.03;-4.03;-4.18;-3.97;-4.03;-4.03;-4.05;-4.12;-4.09;-4.11;-4.12;-3.99;-3.99;-4.06;-4.01;-3.97;-4.05;-4.01;-3.99;-4.05;-4.02;-3.99;-4.05;-3.99;-4.05;-4.05	2.76	0.749	0.18381	.	.	.	.	.	D	0.89873	0.6841	N	0.14661	0.345	0.26397	N	0.976484	B;P;P;D;B;P;D;P;P;P;P;P;B;B;P	0.57257	0.154;0.785;0.778;0.969;0.261;0.888;0.979;0.576;0.749;0.918;0.708;0.87;0.327;0.001;0.932	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.43082	0.039;0.121;0.085;0.266;0.029;0.224;0.407;0.109;0.081;0.144;0.109;0.089;0.048;0.0;0.398	D	0.83480	0.0064	9	0.21540	T	0.41	.	8.351	0.32303	0.0:0.8385:0.0:0.1615	.	44;44;44;44;44;44;44;44;44;44;44;44;44;44;44	O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	V	44	ENSP00000353990:A44V;ENSP00000339302:A44V;ENSP00000392390:A44V;ENSP00000347078:A44V;ENSP00000409759:A44V;ENSP00000425522:A44V;ENSP00000426261:A44V;ENSP00000425451:A44V;ENSP00000422407:A44V;ENSP00000426814:A44V;ENSP00000427238:A44V;ENSP00000423112:A44V;ENSP00000420918:A44V;ENSP00000426172:A44V;ENSP00000423045:A44V;ENSP00000427173:A44V;ENSP00000426098:A44V;ENSP00000425698:A44V;ENSP00000426232:A44V;ENSP00000423317:A44V;ENSP00000350979:A44V;ENSP00000352011:A44V;ENSP00000414388:A44V;ENSP00000423155:A44V;ENSP00000422268:A44V;ENSP00000421518:A44V	ENSP00000339302:A44V	A	+	2	0	CACNA1G	45993950	.	.	0.992000	0.48379	0.932000	0.56968	.	.	0.241000	0.21283	0.462000	0.41574	GCG	.		0.731	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
AKAP1	8165	broad.mit.edu	37	17	55183402	55183402	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:55183402G>A	ENST00000337714.3	+	2	810	c.577G>A	c.(577-579)Ggg>Agg	p.G193R	AKAP1_ENST00000314126.3_Missense_Mutation_p.G193R|AKAP1_ENST00000571629.1_Missense_Mutation_p.G193R|AKAP1_ENST00000539273.1_Missense_Mutation_p.G193R|AKAP1_ENST00000572557.1_Missense_Mutation_p.G193R	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	193					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					GCGTAGCTCTGGGGAGAGGGC	0.582																																					p.G193R		.											.	AKAP1-227	0			c.G577A						.						72.0	69.0	70.0					17																	55183402		2203	4300	6503	SO:0001583	missense	8165	exon3			AGCTCTGGGGAGA	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.577G>A	17.37:g.55183402G>A	ENSP00000337736:p.Gly193Arg	27	0		26	3	NM_001242902	0	0	4	4	0	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	37	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068859	0.36470	.	.	ENSG00000121057	ENST00000337714;ENST00000314126;ENST00000427138;ENST00000539273	T;T;T	0.16073	2.37;2.37;2.37	6.17	4.02	0.46733	.	0.451193	0.23058	N	0.052409	T	0.23210	0.0561	L	0.50333	1.59	0.09310	N	1	D	0.55605	0.972	P	0.51415	0.669	T	0.07693	-1.0759	10	0.22109	T	0.4	-16.6008	12.34	0.55089	0.0:0.1265:0.7387:0.1347	.	193	Q92667	AKAP1_HUMAN	R	193;193;235;193	ENSP00000337736:G193R;ENSP00000314075:G193R;ENSP00000443139:G193R	ENSP00000314075:G193R	G	+	1	0	AKAP1	52538401	0.283000	0.24277	0.326000	0.25389	0.081000	0.17604	0.697000	0.25556	1.610000	0.50200	0.655000	0.94253	GGG	.		0.582	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
FAM20A	54757	hgsc.bcm.edu	37	17	66596769	66596769	+	Silent	SNP	C	C	T	rs2907388	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr17:66596769C>T	ENST00000592554.1	-	1	761	c.39G>A	c.(37-39)ctG>ctA	p.L13L		NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	13					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					CGCCCAGCAGCAGCAGAGTCA	0.756													c|||	410	0.081869	0.0552	0.0159	5008	,	,		10427	0.1071		0.0278	False		,,,				2504	0.1943				p.L13L		.											.	FAM20A-90	0			c.G39A						.			121,3665		1,119,1773	4.0	4.0	4.0		39	3.1	1.0	17	dbSNP_101	4	143,7217		0,143,3537	no	coding-synonymous	FAM20A	NM_017565.3		1,262,5310	TT,TC,CC		1.9429,3.196,2.3686		13/542	66596769	264,10882	1893	3680	5573	SO:0001819	synonymous_variant	54757	exon1			CAGCAGCAGCAGA	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.39G>A	17.37:g.66596769C>T		4	0		26	12	NM_017565	0	0	0	0	0	B2RN47|B2RN49|Q9UF95	Silent	SNP	ENST00000592554.1	37	CCDS11679.1																																																																																			C|0.943;T|0.057		0.756	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
GAREM	64762	hgsc.bcm.edu	37	18	29868135	29868161	+	In_Frame_Del	DEL	TCAGTGTCTTCATTGCATTCACCTGAA	TCAGTGTCTTCATTGCATTCACCTGAA	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	TCAGTGTCTTCATTGCATTCACCTGAA	TCAGTGTCTTCATTGCATTCACCTGAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr18:29868135_29868161delTCAGTGTCTTCATTGCATTCACCTGAA	ENST00000269209.6	-	4	402_428	c.399_425delTTCAGGTGAATGCAATGAAGACACTGA	c.(397-426)gcttcaggtgaatgcaatgaagacactgaa>gca	p.SGECNEDTE134del	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000399218.4_In_Frame_Del_p.SGECNEDTE134del|GAREM_ENST00000578619.1_5'UTR			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	134	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										GTTGTAAACTTCAGTGTCTTCATTGCATTCACCTGAAGCAACCTACA	0.392																																					p.133_142del		.											.	.	0			c.399_425del						.																																			SO:0001651	inframe_deletion	64762	exon4			TAAACTTCAGTGT	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.399_425delTTCAGGTGAATGCAATGAAGACACTGA	18.37:g.29868135_29868161delTCAGTGTCTTCATTGCATTCACCTGAA	ENSP00000269209:p.Ser134_Glu142del	63	0		52	15	NM_022751	0	0	0	0	0	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	In_Frame_Del	DEL	ENST00000269209.6	37	CCDS56057.1																																																																																			.		0.392	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
MEX3C	51320	hgsc.bcm.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	GCCGCCGCG	GCCGCCGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																					p.179_182del		.											.	MEX3C-659	0			c.537_545del						.			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				SO:0001627	intron_variant	51320	exon1			GCCGCCGCCGCCG	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		0	0		34	13	NM_016626	0	0	0	0	0	A1L022|Q9NZE3	In_Frame_Del	DEL	ENST00000591040.1	37																																																																																				.		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
ATP8B1	5205	broad.mit.edu	37	18	55342160	55342160	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr18:55342160G>T	ENST00000283684.4	-	15	1724	c.1725C>A	c.(1723-1725)aaC>aaA	p.N575K	ATP8B1_ENST00000536015.1_Missense_Mutation_p.N575K|RP11-35G9.5_ENST00000588925.1_RNA|RP11-35G9.3_ENST00000599199.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	575					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TGGTGATGGTGTTCTGGGTCC	0.507																																					p.N575K		.											.	ATP8B1-587	0			c.C1725A						.						157.0	134.0	142.0					18																	55342160		2203	4300	6503	SO:0001583	missense	5205	exon16			GATGGTGTTCTGG	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.1725C>A	18.37:g.55342160G>T	ENSP00000283684:p.Asn575Lys	94	0		113	5	NM_005603	0	0	19	19	0	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	.	.	.	.	.	.	.	.	.	.	G	6.532	0.466445	0.12402	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	T;T	0.64438	-0.1;-0.1	5.63	2.93	0.34026	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.135180	0.64402	N	0.000002	T	0.44456	0.1294	L	0.35644	1.08	0.47584	D	0.999467	P	0.44521	0.837	B	0.40864	0.342	T	0.24333	-1.0163	10	0.16420	T	0.52	.	4.8043	0.13312	0.3302:0.1471:0.5228:0.0	.	575	O43520	AT8B1_HUMAN	K	575	ENSP00000283684:N575K;ENSP00000445359:N575K	ENSP00000283684:N575K	N	-	3	2	ATP8B1	53493158	1.000000	0.71417	0.987000	0.45799	0.044000	0.14063	1.024000	0.30077	0.353000	0.24079	-0.716000	0.03619	AAC	.		0.507	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	0	0		6	6	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
PLPPR3	79948	hgsc.bcm.edu	37	19	813220	813220	+	Missense_Mutation	SNP	T	T	C	rs351994	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:813220T>C	ENST00000520876.3	-	8	1585	c.1507A>G	c.(1507-1509)Acg>Gcg	p.T503A	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.T531A	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		503						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										CCGGCCCCCGTCTGCGCGCCC	0.781													t|||	1480	0.295527	0.6687	0.2378	5008	,	,		6132	0.0456		0.1809	False		,,,				2504	0.2076				p.T531A		.											.	.	0			c.A1591G						.		ALA/THR	929,1563		175,579,492	3.0	4.0	3.0		1591	3.2	0.0	19	dbSNP_79	3	716,5684		57,602,2541	no	missense	LPPR3	NM_024888.1	58	232,1181,3033	CC,CT,TT		11.1875,37.2793,18.4998	benign	531/747	813220	1645,7247	1246	3200	4446	SO:0001583	missense	0	exon7			CCCCCGTCTGCGC																												ENST00000520876.3:c.1507A>G	19.37:g.813220T>C	ENSP00000430297:p.Thr503Ala	1	0		8	7	NM_024888	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	37	CCDS58636.1	544	0.2490842490842491	314	0.6382113821138211	79	0.21823204419889503	23	0.04020979020979021	128	0.16886543535620052	t	0.011	-1.724891	0.00694	0.372793	0.111875	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876	T;T	0.21191	2.02;2.02	3.16	3.16	0.36331	.	0.447280	0.20568	N	0.089784	T	0.00012	0.0000	N	0.04959	-0.14	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.42649	-0.9439	9	0.02654	T	1	0.0067	10.0419	0.42164	0.0:0.8946:0.0:0.1054	rs351994	504;503;531	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	A	504;531;503	ENSP00000352962:T531A;ENSP00000430297:T503A	ENSP00000300947:T504A	T	-	1	0	AC006273.1	764220	0.346000	0.24844	0.022000	0.16811	0.404000	0.30871	1.300000	0.33436	0.640000	0.30582	-0.764000	0.03450	ACG	T|0.751;C|0.249		0.781	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		0	0		5	5	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		14	14	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	964309	964309	+	Nonsense_Mutation	SNP	C	C	A	rs143790786		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:964309C>A	ENST00000263620.3	+	5	1155	c.828C>A	c.(826-828)taC>taA	p.Y276*		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	276	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATGCTGTACGTGCTGGTGA	0.617																																					p.Y276X	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C828A						.						153.0	117.0	129.0					19																	964309		2203	4300	6503	SO:0001587	stop_gained	1820	exon5			GCTGTACGTGCTG	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.828C>A	19.37:g.964309C>A	ENSP00000263620:p.Tyr276*	178	0		339	108	NM_005224	0	0	3	4	1	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Nonsense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	C	38	6.785300	0.97837	.	.	ENSG00000116017	ENST00000263620	.	.	.	4.5	-1.97	0.07503	.	0.183135	0.49305	D	0.000144	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7431	9.1031	0.36681	0.0:0.46:0.0:0.54	.	.	.	.	X	276	.	ENSP00000263620:Y276X	Y	+	3	2	ARID3A	915309	0.942000	0.31987	0.996000	0.52242	0.979000	0.70002	0.392000	0.20801	-0.216000	0.10048	-0.258000	0.10820	TAC	C|0.999;T|0.001		0.617	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
GRIN3B	116444	hgsc.bcm.edu	37	19	1003441	1003441	+	Missense_Mutation	SNP	C	C	T	rs143106549	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:1003441C>T	ENST00000234389.3	+	2	758	c.739C>T	c.(739-741)Cgg>Tgg	p.R247W	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	247					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCGTGCCCGTCGGGTGCTGGA	0.756													N|||	2	0.000399361	0.0	0.0	5008	,	,		11449	0.0		0.002	False		,,,				2504	0.0				p.R247W		.											.	GRIN3B-90	0			c.C739T						.		TRP/ARG	0,3714		0,0,1857	3.0	4.0	4.0		739	1.8	0.0	19	dbSNP_134	4	1,7453		0,1,3726	no	missense	GRIN3B	NM_138690.1	101	0,1,5583	TT,TC,CC		0.0134,0.0,0.0090	probably-damaging	247/1044	1003441	1,11167	1857	3727	5584	SO:0001583	missense	116444	exon2			GCCCGTCGGGTGC		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.739C>T	19.37:g.1003441C>T	ENSP00000234389:p.Arg247Trp	4	0		80	57	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	14.20	2.464896	0.43839	0.0	1.34E-4	ENSG00000116032	ENST00000234389	T	0.11712	2.75	4.05	1.81	0.25067	.	1.331270	0.04884	U	0.448283	T	0.10294	0.0252	L	0.43923	1.385	0.09310	N	1	P	0.50617	0.937	B	0.40534	0.332	T	0.27739	-1.0065	10	0.42905	T	0.14	.	4.5576	0.12143	0.0:0.5889:0.2021:0.209	.	247	O60391	NMD3B_HUMAN	W	247	ENSP00000234389:R247W	ENSP00000234389:R247W	R	+	1	2	GRIN3B	954441	0.006000	0.16342	0.002000	0.10522	0.033000	0.12548	2.180000	0.42537	0.651000	0.30788	0.473000	0.43528	CGG	C|0.999;T|0.000		0.756	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
GRIN3B	116444	hgsc.bcm.edu	37	19	1009485	1009485	+	Missense_Mutation	SNP	C	C	G	rs10401245	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:1009485C>G	ENST00000234389.3	+	9	3035	c.3016C>G	c.(3016-3018)Cag>Gag	p.Q1006E		NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	1006					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCGGCGCGGCCAGCTCCTGGC	0.766													-|||	2765	0.552117	0.6989	0.4539	5008	,	,		7826	0.3571		0.6044	False		,,,				2504	0.5706				p.Q1006E		.											.	GRIN3B-90	0			c.C3016G						.		GLU/GLN	1366,510		516,334,88	1.0	2.0	2.0		3016	2.3	0.0	19	dbSNP_119	2	2951,1521		1041,869,326	no	missense	GRIN3B	NM_138690.1	29	1557,1203,414	GG,GC,CC		34.0116,27.1855,31.9943	benign	1006/1044	1009485	4317,2031	938	2236	3174	SO:0001583	missense	116444	exon9			CGCGGCCAGCTCC		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.3016C>G	19.37:g.1009485C>G	ENSP00000234389:p.Gln1006Glu	0	0		9	9	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	1149	0.5260989010989011	340	0.6910569105691057	183	0.505524861878453	180	0.3146853146853147	446	0.5883905013192612	G	0.015	-1.555403	0.00918	0.728145	0.659884	ENSG00000116032	ENST00000234389	T	0.05382	3.45	4.53	2.3	0.28687	.	1.124140	0.06884	U	0.803130	T	0.00012	0.0000	N	0.02916	-0.46	0.20821	P	0.999849587	B	0.02656	0.0	B	0.01281	0.0	T	0.40869	-0.9540	9	0.02654	T	1	.	15.4334	0.75121	0.0:0.5531:0.4469:0.0	rs10401245;rs59900162	1006	O60391	NMD3B_HUMAN	E	1006	ENSP00000234389:Q1006E	ENSP00000234389:Q1006E	Q	+	1	0	GRIN3B	960485	0.026000	0.19158	0.004000	0.12327	0.116000	0.19942	0.670000	0.25157	0.107000	0.17824	-0.504000	0.04507	CAG	C|0.474;G|0.526		0.766	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		25	10	NM_003200	0	0	3	11	8	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	KLF16_ENST00000592313.1_5'UTR|CTB-31O20.6_ENST00000592884.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		0	0		20	19	NM_031918	0	0	0	6	6		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
DOHH	83475	hgsc.bcm.edu	37	19	3492318	3492318	+	Silent	SNP	G	G	C	rs78287632	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:3492318G>C	ENST00000427575.1	-	4	982	c.531C>G	c.(529-531)cgC>cgG	p.R177R	DOHH_ENST00000250937.3_Silent_p.R177R	NM_001145165.1	NP_001138637.1			deoxyhypusine hydroxylase/monooxygenase											central_nervous_system(1)|large_intestine(1)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CGAACATGGCGCGGTATCGCT	0.741													G|||	93	0.0185703	0.0227	0.013	5008	,	,		12700	0.0		0.0298	False		,,,				2504	0.0245				p.R177R		.											.	DOHH-90	0			c.C531G						.	G	,	68,4070		0,68,2001	5.0	7.0	6.0		531,531	-7.8	0.8	19	dbSNP_132	6	159,7969		1,157,3906	no	coding-synonymous,coding-synonymous	DOHH	NM_001145165.1,NM_031304.4	,	1,225,5907	CC,CG,GG		1.9562,1.6433,1.8506	,	177/303,177/303	3492318	227,12039	2069	4064	6133	SO:0001819	synonymous_variant	83475	exon4			CATGGCGCGGTAT	BC002817	CCDS12108.1	19p13.3	2008-02-05	2006-05-22	2006-05-22		ENSG00000129932			28662	protein-coding gene	gene with protein product		611262	"""HEAT-like (PBS lyase) repeat containing 1"""	HLRC1		16371467, 16533814	Standard	NM_031304		Approved	MGC4293	uc002lxs.3	Q9BU89		ENST00000427575.1:c.531C>G	19.37:g.3492318G>C		0	0		64	42	NM_001145165	0	0	5	9	4		Silent	SNP	ENST00000427575.1	37	CCDS12108.1																																																																																			G|0.979;C|0.021		0.741	DOHH-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452932.1	NM_031304	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000262970.5_Silent_p.A1023A|ANKRD24_ENST00000318934.4_Silent_p.A933A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		.											.	ANKRD24-68	0			c.A2799G						.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		0	0		14	14	NM_133475	0	0	0	0	0	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.541;G|0.459		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
EMR1	2015	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	6906459	6906459	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:6906459G>T	ENST00000312053.4	+	9	1002	c.965G>T	c.(964-966)tGt>tTt	p.C322F	EMR1_ENST00000450315.3_Missense_Mutation_p.C145F|EMR1_ENST00000381404.4_Missense_Mutation_p.C270F|EMR1_ENST00000381407.5_Missense_Mutation_p.C181F|EMR1_ENST00000250572.8_Missense_Mutation_p.C322F	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	322	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CTCTTCAAATGTAAGGAAGAT	0.403																																					p.C322F		.											.	EMR1-526	0			c.G965T						.						136.0	129.0	131.0					19																	6906459		2203	4300	6503	SO:0001583	missense	2015	exon9			TCAAATGTAAGGA	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.965G>T	19.37:g.6906459G>T	ENSP00000311545:p.Cys322Phe	152	0		281	19	NM_001256253	0	0	0	0	0	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	8.331	0.826513	0.16749	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.79554	-1.22;-1.28;-1.26;-0.24;0.22	2.98	1.94	0.25998	.	.	.	.	.	D	0.86472	0.5941	M	0.76002	2.32	0.33943	D	0.643442	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.997;0.99;0.997	D	0.86800	0.1991	9	0.87932	D	0	.	6.0336	0.19694	0.1434:0.0:0.8566:0.0	.	145;181;322;270;322	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	F	322;322;270;322;181;145	ENSP00000311545:C322F;ENSP00000370811:C270F;ENSP00000250572:C322F;ENSP00000370814:C181F;ENSP00000405974:C145F	ENSP00000250572:C322F	C	+	2	0	EMR1	6857459	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	3.012000	0.49575	0.836000	0.34901	-0.140000	0.14226	TGT	.		0.403	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		0	0		6	6	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
OR10H2	26538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15839027	15839027	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:15839027C>T	ENST00000305899.3	+	1	194	c.174C>T	c.(172-174)ccC>ccT	p.P58P		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TCCACACGCCCATGTACCTCT	0.617																																					p.P58P		.											.	OR10H2-70	0			c.C174T						.						209.0	170.0	183.0					19																	15839027		2203	4300	6503	SO:0001819	synonymous_variant	26538	exon1			CACGCCCATGTAC	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.174C>T	19.37:g.15839027C>T		329	1		775	250	NM_013939	0	0	0	0	0	Q6IFQ1|Q96R58	Silent	SNP	ENST00000305899.3	37	CCDS12333.1																																																																																			.		0.617	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		4	4	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
NUDT19	390916	hgsc.bcm.edu	37	19	33183352	33183352	+	Silent	SNP	G	G	C	rs61732600	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:33183352G>C	ENST00000397061.3	+	1	486	c.486G>C	c.(484-486)ccG>ccC	p.P162P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	162	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					AGCCACCGCCGGGCCTGGCCT	0.751													G|||	1109	0.221446	0.1498	0.245	5008	,	,		11161	0.249		0.3062	False		,,,				2504	0.1861				p.P162P		.											.	NUDT19-22	0			c.G486C						.	G		469,2861		40,389,1236	4.0	5.0	5.0		486	-9.6	0.0	19	dbSNP_129	5	1887,5465		292,1303,2081	no	coding-synonymous	NUDT19	NM_001105570.1		332,1692,3317	CC,CG,GG		25.6665,14.0841,22.0558		162/376	33183352	2356,8326	1665	3676	5341	SO:0001819	synonymous_variant	390916	exon1			ACCGCCGGGCCTG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.486G>C	19.37:g.33183352G>C		0	0		21	20	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			G|0.743;C|0.257		0.751	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
SLC7A9	11136	bcgsc.ca	37	19	33355553	33355553	+	Missense_Mutation	SNP	C	C	T	rs138156402		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:33355553C>T	ENST00000023064.4	-	3	408	c.217G>A	c.(217-219)Ggg>Agg	p.G73R	SLC7A9_ENST00000590341.1_Missense_Mutation_p.G73R|SLC7A9_ENST00000587772.1_Missense_Mutation_p.G73R|RN7SKP22_ENST00000365097.1_RNA	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	73					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GCGAGGACCCCGCAAGCCGCC	0.637																																					p.G73R	GBM(181;1335 2108 9644 44178 46689)	.											.	SLC7A9-91	0			c.G217A	GRCh37	HM060045	SLC7A9	M	rs138156402	.	C	ARG/GLY,ARG/GLY	0,4406		0,0,2203	81.0	79.0	79.0		217,217	5.1	0.6	19	dbSNP_134	79	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	SLC7A9	NM_001126335.1,NM_014270.4	125,125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	73/488,73/488	33355553	2,13004	2203	4300	6503	SO:0001583	missense	11136	exon3			GGACCCCGCAAGC	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.217G>A	19.37:g.33355553C>T	ENSP00000023064:p.Gly73Arg	97	2		121	51	NM_001243036	0	0	0	0	0	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574123	0.65765	0.0	2.33E-4	ENSG00000021488	ENST00000023064	D	0.90676	-2.71	5.13	5.13	0.70059	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97601	0.9214	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99285	1.0897	10	0.87932	D	0	.	18.9574	0.92664	0.0:1.0:0.0:0.0	.	73	P82251	BAT1_HUMAN	R	73	ENSP00000023064:G73R	ENSP00000023064:G73R	G	-	1	0	SLC7A9	38047393	1.000000	0.71417	0.626000	0.29213	0.086000	0.17979	7.818000	0.86416	2.565000	0.86533	0.462000	0.41574	GGG	C|1.000;T|0.000		0.637	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
GGN	199720	hgsc.bcm.edu	37	19	38876474	38876474	+	Silent	SNP	C	C	T	rs183192050	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:38876474C>T	ENST00000334928.6	-	3	1560	c.1428G>A	c.(1426-1428)ctG>ctA	p.L476L	GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	476	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)		p.L476L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			cggtgggagccagggctgACT	0.761													C|||	103	0.0205671	0.0174	0.0144	5008	,	,		9849	0.0		0.0338	False		,,,				2504	0.0368				p.L476L		.											.	GGN-90	1	Substitution - coding silent(1)	kidney(1)	c.G1428A						.	C		23,3623		0,23,1800	3.0	4.0	4.0		1428	1.5	0.2	19		4	134,7106		0,134,3486	no	coding-synonymous	GGN	NM_152657.3		0,157,5286	TT,TC,CC		1.8508,0.6308,1.4422		476/653	38876474	157,10729	1823	3620	5443	SO:0001819	synonymous_variant	199720	exon3			GGGAGCCAGGGCT	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1428G>A	19.37:g.38876474C>T		0	0		12	6	NM_152657	0	0	0	0	0	Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	ENST00000334928.6	37	CCDS12516.1																																																																																			C|0.980;T|0.020		0.761	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
CCDC8	83987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46914646	46914646	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:46914646C>T	ENST00000307522.3	-	1	2195	c.1422G>A	c.(1420-1422)caG>caA	p.Q474Q		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	474					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CTGTCTTGACCTGTTTCCGGG	0.607																																					p.Q474Q		.											.	CCDC8-93	0			c.G1422A						.						57.0	61.0	59.0					19																	46914646		2203	4300	6503	SO:0001819	synonymous_variant	83987	exon1			CTTGACCTGTTTC	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1422G>A	19.37:g.46914646C>T		96	0		95	48	NM_032040	0	0	0	0	0	Q8TB26	Silent	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	C	9.715	1.158105	0.21454	.	.	ENSG00000169515	ENST00000540252	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	T	0.30541	0.0768	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.14309	-1.0477	5	0.02654	T	1	-2.5489	9.9661	0.41725	0.0:0.7935:0.2065:0.0	.	.	.	.	K	321	.	ENSP00000441180:R321K	R	-	2	0	CCDC8	51606486	0.991000	0.36638	1.000000	0.80357	0.994000	0.84299	0.262000	0.18460	2.509000	0.84616	0.555000	0.69702	AGG	.		0.607	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	2	0		12	9	NM_017805	0	0	2	5	3	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		20	19	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF582	147948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56901430	56901430	+	Silent	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:56901430G>A	ENST00000301310.4	-	4	330	c.172C>T	c.(172-174)Cta>Tta	p.L58L	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Silent_p.L58L	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CCTTGCTCTAGGAAGGAGATC	0.552																																					p.L58L	Ovarian(183;1887 2032 4349 30507 51343)	.											.	ZNF582-138	0			c.C172T						.						98.0	90.0	93.0					19																	56901430		2203	4300	6503	SO:0001819	synonymous_variant	147948	exon4			GCTCTAGGAAGGA	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.172C>T	19.37:g.56901430G>A		114	0		130	54	NM_144690	0	0	4	4	0	B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	ENST00000301310.4	37	CCDS33121.1																																																																																			.		0.552	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	1	0		15	6	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
HADHB	3032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26502030	26502030	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:26502030A>T	ENST00000317799.5	+	9	762	c.658A>T	c.(658-660)Agt>Tgt	p.S220C	HADHB_ENST00000537713.1_Missense_Mutation_p.S205C|HADHB_ENST00000405867.3_Intron|HADHB_ENST00000545822.1_Missense_Mutation_p.S198C|HADHB_ENST00000494615.1_3'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	220					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTCTCCACCAGTGAGACCAT	0.532																																					p.S220C		.											.	HADHB-154	0			c.A658T						.						97.0	94.0	95.0					2																	26502030		2203	4300	6503	SO:0001583	missense	3032	exon9			TCCACCAGTGAGA		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.658A>T	2.37:g.26502030A>T	ENSP00000325136:p.Ser220Cys	96	0		151	76	NM_000183	0	0	114	241	127	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	37	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114793	0.77210	.	.	ENSG00000138029	ENST00000317799;ENST00000537713;ENST00000545822	D;D;D	0.87412	-2.25;-2.25;-2.25	5.69	4.53	0.55603	Thiolase, N-terminal (1);Thiolase-like (1);	0.320106	0.42294	D	0.000729	D	0.85492	0.5709	L	0.29908	0.895	0.34004	D	0.650687	P;P;P	0.44734	0.541;0.842;0.596	B;P;P	0.51918	0.428;0.684;0.563	D	0.89508	0.3769	10	0.87932	D	0	-2.5187	11.0763	0.48034	0.9263:0.0:0.0736:0.0	.	205;198;220	F5GZQ3;B4E2W0;P55084	.;.;ECHB_HUMAN	C	220;205;198	ENSP00000325136:S220C;ENSP00000444295:S205C;ENSP00000442665:S198C	ENSP00000325136:S220C	S	+	1	0	HADHB	26355534	1.000000	0.71417	0.951000	0.38953	0.841000	0.47740	4.733000	0.62036	1.076000	0.40961	0.533000	0.62120	AGT	.		0.532	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
EHD3	30845	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	31489342	31489342	+	Silent	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:31489342C>A	ENST00000322054.5	+	6	1665	c.1380C>A	c.(1378-1380)ggC>ggA	p.G460G	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	460	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CGGTGGATGGCAAGATCACAG	0.577																																					p.G460G		.											.	EHD3-92	0			c.C1380A						.						102.0	86.0	91.0					2																	31489342		2203	4300	6503	SO:0001819	synonymous_variant	30845	exon6			GGATGGCAAGATC	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1380C>A	2.37:g.31489342C>A		194	1		264	111	NM_014600	0	0	0	0	0	B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	ENST00000322054.5	37	CCDS1774.1																																																																																			.		0.577	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600	
PKDCC	91461	hgsc.bcm.edu	37	2	42275726	42275726	+	Silent	SNP	C	C	G	rs11891679	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:42275726C>G	ENST00000294964.5	+	1	567	c.387C>G	c.(385-387)cgC>cgG	p.R129R		NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						cgggcccgcgcctggGCTGCG	0.816													C|||	1218	0.243211	0.3359	0.1671	5008	,	,		5594	0.0873		0.2773	False		,,,				2504	0.2975				p.R129R		.											.	PKDCC-67	0			c.C387G						.						1.0	2.0	2.0					2																	42275726		396	1081	1477	SO:0001819	synonymous_variant	91461	exon1			CCCGCGCCTGGGC		CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.387C>G	2.37:g.42275726C>G		0	0		5	4	NM_138370	0	0	0	0	0		Silent	SNP	ENST00000294964.5	37	CCDS33186.2																																																																																			C|0.762;G|0.238		0.816	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325745.3		
VWA3B	200403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98920228	98920228	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:98920228C>A	ENST00000477737.1	+	26	3688	c.3484C>A	c.(3484-3486)Cat>Aat	p.H1162N	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1162										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTCTTGCTCTCATATAAAGTC	0.368																																					p.H1162N		.											.	VWA3B-139	0			c.C3484A						.						140.0	120.0	126.0					2																	98920228		1862	4115	5977	SO:0001583	missense	200403	exon26			TGCTCTCATATAA	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3484C>A	2.37:g.98920228C>A	ENSP00000417955:p.His1162Asn	107	0		162	69	NM_144992	0	0	0	0	0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.92|12.92	2.081383|2.081383	0.36758|0.36758	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737;ENST00000358269|ENST00000473149	T|.	0.21191|.	2.02|.	4.48|4.48	2.59|2.59	0.31030|0.31030	.|.	.|.	.|.	.|.	.|.	T|.	0.28134|.	0.0694|.	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	0.999994|0.999994	P;P|.	0.43352|.	0.804;0.454|.	B;B|.	0.40134|.	0.32;0.105|.	T|.	0.17899|.	-1.0354|.	9|.	0.62326|.	D|.	0.03|.	.|.	4.6013|4.6013	0.12354|0.12354	0.2302:0.6573:0.0:0.1125|0.2302:0.6573:0.0:0.1125	.|.	554;1162|.	Q502W6-5;Q502W6|.	.;VWA3B_HUMAN|.	N|X	1162;284|572	ENSP00000417955:H1162N|.	ENSP00000351009:H284N|.	H|S	+|+	1|2	0|0	VWA3B|VWA3B	98286660|98286660	0.695000|0.695000	0.27747|0.27747	0.612000|0.612000	0.29024|0.29024	0.350000|0.350000	0.29205|0.29205	1.329000|1.329000	0.33770|0.33770	1.179000|1.179000	0.42884|0.42884	0.655000|0.655000	0.94253|0.94253	CAT|TCA	.		0.368	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	0	0		6	6	NM_173647	0	0	0	0	0	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125521704	125521704	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:125521704T>A	ENST00000431078.1	+	16	2874	c.2510T>A	c.(2509-2511)tTc>tAc	p.F837Y		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	837	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATTAAAGACTTCATTCGACTC	0.368																																					p.F837Y		.											.	CNTNAP5-524	0			c.T2510A						.						113.0	108.0	109.0					2																	125521704		1833	4078	5911	SO:0001583	missense	129684	exon16			AAGACTTCATTCG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2510T>A	2.37:g.125521704T>A	ENSP00000399013:p.Phe837Tyr	47	0		51	21	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.980789	0.92982	.	.	ENSG00000155052	ENST00000431078	T	0.80304	-1.36	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	D	0.000076	D	0.83257	0.5215	L	0.58810	1.83	0.80722	D	1	P	0.51537	0.946	P	0.51487	0.671	T	0.83249	-0.0054	10	0.41790	T	0.15	.	15.2395	0.73458	0.0:0.0:0.0:1.0	.	837	Q8WYK1	CNTP5_HUMAN	Y	837	ENSP00000399013:F837Y	ENSP00000399013:F837Y	F	+	2	0	CNTNAP5	125238174	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.080000	0.71299	2.199000	0.70637	0.533000	0.62120	TTC	.		0.368	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
SSB	6741	hgsc.bcm.edu;bcgsc.ca	37	2	170667792	170667794	+	In_Frame_Del	DEL	GTG	GTG	-	rs568710324	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	GTG	GTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:170667792_170667794delGTG	ENST00000409333.1	+	11	1344_1346	c.1097_1099delGTG	c.(1096-1101)agtgat>aat	p.366_367SD>N	METTL5_ENST00000409837.1_Intron|SSB_ENST00000260956.4_In_Frame_Del_p.366_367SD>N			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	366					histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						AAATTTGCTAGTGatgatgaaca	0.36																																					p.366_367del		.											.	SSB-94	0			c.1097_1099del						.																																			SO:0001651	inframe_deletion	6741	exon11			TTGCTAGTGATGA		CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.1097_1099delGTG	2.37:g.170667792_170667794delGTG	ENSP00000386636:p.Ser366_Asp367delinsAsn	159	0		111	45	NM_003142	0	0	0	0	0	Q15367|Q53XJ4	In_Frame_Del	DEL	ENST00000409333.1	37	CCDS2237.1																																																																																			.		0.360	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333316.1	NM_003142	
FZD5	7855	hgsc.bcm.edu	37	2	208632989	208632989	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:208632989G>T	ENST00000295417.3	-	2	1028	c.475C>A	c.(475-477)Ccc>Acc	p.P159T		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	159					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		GGCCTGGGGGGCGCCGTGGTG	0.746																																					p.P159T		.											.	FZD5-660	0			c.C475A						.						3.0	4.0	4.0					2																	208632989		1862	3820	5682	SO:0001583	missense	7855	exon2			TGGGGGGCGCCGT	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.475C>A	2.37:g.208632989G>T	ENSP00000354607:p.Pro159Thr	4	0		19	8	NM_003468	0	0	0	0	0	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	37	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	G	7.079	0.569895	0.13560	.	.	ENSG00000163251	ENST00000295417	T	0.80304	-1.36	4.36	3.47	0.39725	.	0.499785	0.19694	N	0.108187	T	0.71108	0.3301	L	0.46157	1.445	0.34409	D	0.696127	B	0.23316	0.083	B	0.15052	0.012	T	0.68957	-0.5272	10	0.15952	T	0.53	.	11.0692	0.47993	0.0936:0.0:0.9064:0.0	.	159	Q13467	FZD5_HUMAN	T	159	ENSP00000354607:P159T	ENSP00000354607:P159T	P	-	1	0	FZD5	208341234	0.986000	0.35501	0.994000	0.49952	0.747000	0.42532	1.991000	0.40727	1.029000	0.39812	0.561000	0.74099	CCC	.		0.746	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
SPATA3	130560	broad.mit.edu	37	2	231865144	231865144	+	Missense_Mutation	SNP	G	G	C	rs12105962	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:231865144G>C	ENST00000452881.1	+	2	473	c.365G>C	c.(364-366)tGc>tCc	p.C122S	SPATA3_ENST00000409956.1_Intron|SPATA3_ENST00000424440.1_Missense_Mutation_p.C122S|SPATA3_ENST00000433428.2_Missense_Mutation_p.C122S|SPATA3_ENST00000455816.1_Missense_Mutation_p.C122S			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	122										endometrium(2)|lung(1)	3						AGCTCCGCTTGCTGGCGTCGT	0.652													G|||	1085	0.216653	0.1876	0.3256	5008	,	,		17115	0.1736		0.2565	False		,,,				2504	0.182				p.C122S		.											.	.	0			c.G365C						.	G	SER/CYS	251,1133		19,213,460	37.0	35.0	36.0		365	4.2	1.0	2	dbSNP_120	36	817,2365		99,619,873	yes	missense	SPATA3	NM_139073.3	112	118,832,1333	CC,CG,GG		25.6757,18.1358,23.3903	probably-damaging	122/193	231865144	1068,3498	692	1591	2283	SO:0001583	missense	130560	exon2			CCGCTTGCTGGCG	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.365G>C	2.37:g.231865144G>C	ENSP00000388895:p.Cys122Ser	202	1		140	4	NM_139073	0	0	0	0	0	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	ENST00000452881.1	37	CCDS2481.1	513	0.2348901098901099	94	0.1910569105691057	119	0.3287292817679558	106	0.1853146853146853	194	0.2559366754617414	G	10.64	1.405615	0.25378	0.181358	0.256757	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662	.	.	.	4.25	4.25	0.50352	.	0.000000	0.49916	D	0.000135	T	0.00012	0.0000	L	0.34521	1.04	0.26558	P	0.9737856	D	0.89917	1.0	D	0.87578	0.998	T	0.16335	-1.0406	8	0.66056	D	0.02	-27.4861	12.4701	0.55781	0.0:0.0:1.0:0.0	rs12105962;rs59056322	113	Q8NHX4	SPTA3_HUMAN	S	122;122;122;122;113	.	ENSP00000347884:C113S	C	+	2	0	SPATA3	231573388	1.000000	0.71417	1.000000	0.80357	0.527000	0.34593	3.817000	0.55668	2.657000	0.90304	0.655000	0.94253	TGC	G|0.771;C|0.229		0.652	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
ALPPL2	251	hgsc.bcm.edu	37	2	233274475	233274475	+	Missense_Mutation	SNP	C	C	A	rs56080708	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:233274475C>A	ENST00000295453.3	+	11	1544	c.1492C>A	c.(1492-1494)Cgc>Agc	p.R498S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CCTGGCGCCCCGCGCCGGCAC	0.731													c|||	477	0.0952476	0.0514	0.062	5008	,	,		10169	0.2133		0.0785	False		,,,				2504	0.0736				p.R498S		.											.	ALPPL2-91	0			c.C1492A						.	C	SER/ARG	328,4022		17,294,1864	12.0	16.0	15.0		1492	1.2	0.0	2	dbSNP_129	15	716,7764		55,606,3579	no	missense	ALPPL2	NM_031313.2	110	72,900,5443	AA,AC,CC		8.4434,7.5402,8.1372	benign	498/533	233274475	1044,11786	2175	4240	6415	SO:0001583	missense	251	exon11			GCGCCCCGCGCCG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1492C>A	2.37:g.233274475C>A	ENSP00000295453:p.Arg498Ser	0	0		32	32	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	231	0.10576923076923077	28	0.056910569105691054	21	0.058011049723756904	120	0.2097902097902098	62	0.08179419525065963	c	0.762	-0.768825	0.02974	0.075402	0.084434	ENSG00000163286	ENST00000295453	D	0.95412	-3.7	2.17	1.24	0.21308	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.00271	0.0008	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.42327	-0.9458	9	0.06236	T	0.91	.	4.2075	0.10495	0.3616:0.5075:0.0:0.1308	rs56080708;rs61730276	498	P10696	PPBN_HUMAN	S	498	ENSP00000295453:R498S	ENSP00000295453:R498S	R	+	1	0	ALPPL2	232982719	0.000000	0.05858	0.020000	0.16555	0.076000	0.17211	-0.511000	0.06321	0.233000	0.21120	0.205000	0.17691	CGC	C|0.901;A|0.099		0.731	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
NDUFA10	4705	broad.mit.edu	37	2	240944641	240944641	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:240944641G>T	ENST00000252711.2	-	8	976	c.876C>A	c.(874-876)taC>taA	p.Y292*	NDUFA10_ENST00000404554.1_Nonsense_Mutation_p.Y292*|NDUFA10_ENST00000307300.4_Nonsense_Mutation_p.Y322*	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	292					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		ATCGCAGGTGGTATAAAGTGC	0.438																																					p.Y292X		.											.	NDUFA10-514	0			c.C876A						.						158.0	148.0	151.0					2																	240944641		2203	4300	6503	SO:0001587	stop_gained	4705	exon8			CAGGTGGTATAAA	AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.876C>A	2.37:g.240944641G>T	ENSP00000252711:p.Tyr292*	115	0		91	4	NM_004544	0	0	85	85	0	Q8WXC9	Nonsense_Mutation	SNP	ENST00000252711.2	37	CCDS2531.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.90|15.90	2.969214|2.969214	0.53614|0.53614	.|.	.|.	ENSG00000130414|ENSG00000130414	ENST00000444548|ENST00000419408;ENST00000252711;ENST00000404554;ENST00000422018;ENST00000448880;ENST00000307300	.|.	.|.	.|.	4.71|4.71	2.85|2.85	0.33270|0.33270	.|.	.|0.334273	.|0.34777	.|N	.|0.003700	T|.	0.26810|.	0.0656|.	.|.	.|.	.|.	0.46222|0.46222	D|D	0.998939|0.998939	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.14980|.	-1.0453|.	4|.	.|0.02654	.|T	.|1	-15.0542|-15.0542	6.883|6.883	0.24183|0.24183	0.2122:0.0:0.7878:0.0|0.2122:0.0:0.7878:0.0	.|.	.|.	.|.	.|.	T|X	63|57;292;292;292;55;322	.|.	.|ENSP00000252711:Y292X	P|Y	-|-	1|3	0|2	NDUFA10|NDUFA10	240593314|240593314	0.979000|0.979000	0.34478|0.34478	0.010000|0.010000	0.14722|0.14722	0.011000|0.011000	0.07611|0.07611	1.222000|1.222000	0.32515|0.32515	1.104000|1.104000	0.41587|0.41587	0.655000|0.655000	0.94253|0.94253	CCA|TAC	.		0.438	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544	
ANKMY1	51281	bcgsc.ca	37	2	241463595	241463595	+	Missense_Mutation	SNP	T	T	C	rs35996697	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr2:241463595T>C	ENST00000272972.3	-	7	1486	c.1272A>G	c.(1270-1272)atA>atG	p.I424M	ANKMY1_ENST00000536462.1_Missense_Mutation_p.I236M|ANKMY1_ENST00000405523.3_Missense_Mutation_p.I283M|ANKMY1_ENST00000403283.1_Missense_Mutation_p.I362M|ANKMY1_ENST00000405002.1_Missense_Mutation_p.I194M|ANKMY1_ENST00000361678.4_Missense_Mutation_p.I283M|ANKMY1_ENST00000373318.2_Missense_Mutation_p.I283M|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000401804.1_Missense_Mutation_p.I513M|ANKMY1_ENST00000391987.1_Missense_Mutation_p.I424M|ANKMY1_ENST00000373320.4_Missense_Mutation_p.I194M	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	424			I -> M (in dbSNP:rs35996697). {ECO:0000269|Ref.1}.				metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		TCCTGTGGTCTATGGACCCCC	0.647													C|||	598	0.119409	0.1891	0.134	5008	,	,		17123	0.0089		0.1779	False		,,,				2504	0.0685				p.I424M		.											.	ANKMY1-90	0			c.A1272G						.	C	MET/ILE,MET/ILE	872,3534	742.8+/-411.4	81,710,1412	60.0	60.0	60.0		1272,849	-2.5	0.0	2	dbSNP_126	60	1485,7115	748.5+/-407.3	132,1221,2947	yes	missense,missense	ANKMY1	NM_016552.2,NM_017844.2	10,10	213,1931,4359	CC,CT,TT		17.2674,19.7912,18.1224	benign,benign	424/942,283/718	241463595	2357,10649	2203	4300	6503	SO:0001583	missense	51281	exon7			GTGGTCTATGGAC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1272A>G	2.37:g.241463595T>C	ENSP00000272972:p.Ile424Met	120	1		83	7	NM_016552	0	0	3	3	0	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	37	CCDS2536.1	266	0.12179487179487179	87	0.17682926829268292	52	0.143646408839779	5	0.008741258741258742	122	0.16094986807387862	C	4.697	0.129512	0.08981	0.197912	0.172674	ENSG00000144504	ENST00000373318;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T	0.55760	2.92;0.52;2.25;0.52;4.39;2.48;0.5;2.23;2.23;2.5	2.39	-2.55	0.06288	Ankyrin repeat-containing domain (1);	12.913800	0.00166	N	0.000017	T	0.00039	0.0001	N	0.08118	0	0.80722	P	0.0	B;B;B;B;B;B	0.15473	0.013;0.0;0.01;0.0;0.001;0.013	B;B;B;B;B;B	0.13407	0.004;0.0;0.009;0.0;0.003;0.004	T	0.06058	-1.0848	9	0.34782	T	0.22	-35.69	6.204	0.20591	0.0:0.4656:0.2359:0.2984	rs35996697	424;236;194;283;283;424	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;Q9P2S6-2;Q9P2S6	.;.;.;.;.;ANKY1_HUMAN	M	283;424;283;424;194;362;513;236;283;194	ENSP00000362415:I283M;ENSP00000272972:I424M;ENSP00000355097:I283M;ENSP00000375847:I424M;ENSP00000362417:I194M;ENSP00000383968:I362M;ENSP00000385887:I513M;ENSP00000444707:I236M;ENSP00000385635:I283M;ENSP00000385145:I194M	ENSP00000272972:I424M	I	-	3	3	ANKMY1	241112268	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.660000	0.00400	-1.112000	0.02984	-1.140000	0.01884	ATA	T|0.828;C|0.172		0.647	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		0	0		4	4	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	PANK2_ENST00000497424.1_Intron|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|RP11-119B16.2_ENST00000451507.1_RNA	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		6	6	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
KIZ-AS1	101929591	broad.mit.edu	37	20	21196288	21196288	+	RNA	SNP	T	T	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:21196288T>C	ENST00000591761.1	-	0	119				PLK1S1_ENST00000457464.1_RNA|RP4-777D9.2_ENST00000433213.2_RNA|RP4-777D9.2_ENST00000443753.1_RNA																							CAATCACAGGTAAAGCTATGG	0.373																																					.		.											.	.	0			c.1278+2T>C						.						59.0	59.0	59.0					20																	21196288		1859	4096	5955			55857	exon7			CACAGGTAAAGCT																													20.37:g.21196288T>C		246	2		127	5	NM_001163023	0	0	0	0	0		Splice_Site	SNP	ENST00000591761.1	37																																																																																				.		0.373	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2		
FRG1B	284802	broad.mit.edu;bcgsc.ca	37	20	29628289	29628289	+	Silent	SNP	A	A	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:29628289A>T	ENST00000278882.3	+	6	671	c.291A>T	c.(289-291)atA>atT	p.I97I	FRG1B_ENST00000358464.4_Silent_p.I97I|FRG1B_ENST00000439954.2_Silent_p.I102I			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	97										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CAGGGGACATAGAAGCAAAAA	0.378																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			GGACATAGAAGCA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.291A>T	20.37:g.29628289A>T		733	0		866	32	.	0	0	179	179	0	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																				.		0.378	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		2	0		34	18	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
COL9A3	1299	ucsc.edu;bcgsc.ca	37	20	61472012	61472012	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr20:61472012C>T	ENST00000343916.3	+	32	1986	c.1983C>T	c.(1981-1983)atC>atT	p.I661I	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	661	Triple-helical region 1 (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CACCGGGGATCTGCGACACCT	0.632																																					p.I661I		.											.	COL9A3-514	0			c.C1983T						.						22.0	24.0	23.0					20																	61472012		2200	4299	6499	SO:0001819	synonymous_variant	1299	exon32			GGGGATCTGCGAC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1983C>T	20.37:g.61472012C>T		167	3		262	114	NM_001853	0	0	1	3	2	Q13681|Q9H4G9|Q9UPE2	Silent	SNP	ENST00000343916.3	37	CCDS13505.1																																																																																			.		0.632	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
KRTAP13-4	284827	bcgsc.ca	37	21	31802768	31802768	+	Missense_Mutation	SNP	G	G	A	rs2226548	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr21:31802768G>A	ENST00000334068.2	+	1	197	c.175G>A	c.(175-177)Gcc>Acc	p.A59T		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	59	4 X 10 AA approximate repeats.		A -> T (in dbSNP:rs2226548). {ECO:0000269|PubMed:15489334}.			intermediate filament (GO:0005882)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						CTGGGAGCCCGCCAGCTGCCA	0.622													-|||	2760	0.551118	0.6452	0.6427	5008	,	,		17651	0.2758		0.5736	False		,,,				2504	0.6196				p.A59T	NSCLC(196;2401 3038 18004 35753)	.											.	KRTAP13-4-90	0			c.G175A						.	A	THR/ALA	2801,1605		880,1041,282	59.0	59.0	59.0		175	-2.5	0.0	21	dbSNP_96	59	5047,3553		1483,2081,736	yes	missense	KRTAP13-4	NM_181600.1	58	2363,3122,1018	AA,AG,GG		41.314,36.4276,39.6586	benign	59/161	31802768	7848,5158	2203	4300	6503	SO:0001583	missense	284827	exon1			GAGCCCGCCAGCT	AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.175G>A	21.37:g.31802768G>A	ENSP00000334834:p.Ala59Thr	110	0		116	6	NM_181600	0	0	0	0	0	A2RRL3	Missense_Mutation	SNP	ENST00000334068.2	37	CCDS13592.1	1146	0.5247252747252747	325	0.6605691056910569	234	0.6464088397790055	167	0.291958041958042	420	0.554089709762533	-	0.010	-1.772617	0.00640	0.635724	0.58686	ENSG00000186971	ENST00000334068	T	0.02498	4.27	4.95	-2.5	0.06384	.	1.375280	0.05046	N	0.477219	T	0.00012	0.0000	N	0.00056	-2.365	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.47736	-0.9094	9	0.02654	T	1	.	0.6398	0.00809	0.4482:0.1285:0.1727:0.2506	rs2226548	59	Q3LI77	KR134_HUMAN	T	59	ENSP00000334834:A59T	ENSP00000334834:A59T	A	+	1	0	KRTAP13-4	30724639	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.656000	0.05342	-0.445000	0.07159	-0.988000	0.02552	GCC	G|0.411;A|0.589		0.622	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128222.1		
SLC37A1	54020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43954845	43954845	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr21:43954845C>G	ENST00000352133.2	+	4	1158	c.176C>G	c.(175-177)gCt>gGt	p.A59G	SLC37A1_ENST00000398341.3_Missense_Mutation_p.A59G			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	59					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TGGGATGAAGCTGACGTCAGG	0.607																																					p.A59G		.											.	SLC37A1-90	0			c.C176G						.						104.0	94.0	97.0					21																	43954845		2203	4300	6503	SO:0001583	missense	54020	exon5			ATGAAGCTGACGT	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.176C>G	21.37:g.43954845C>G	ENSP00000344648:p.Ala59Gly	232	0		237	109	NM_018964	0	0	5	6	1	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	C	7.640	0.680637	0.14907	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.60424	0.19;0.19	4.88	-3.53	0.04667	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.282690	0.05136	N	0.493452	T	0.29061	0.0722	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09037	-1.0693	10	0.15499	T	0.54	-12.7395	2.849	0.05552	0.4028:0.3364:0.1675:0.0933	.	59	P57057	GLPT_HUMAN	G	59	ENSP00000381383:A59G;ENSP00000344648:A59G	ENSP00000344648:A59G	A	+	2	0	SLC37A1	42827914	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.551000	0.06027	-0.580000	0.05944	0.655000	0.94253	GCT	.		0.607	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
C22orf34	348645	bcgsc.ca;mdanderson.org	37	22	50017837	50017837	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr22:50017837G>T	ENST00000444628.1	-	4	1695	c.624C>A	c.(622-624)ccC>ccA	p.P208P	C22orf34_ENST00000400023.1_Intron|C22orf34_ENST00000405854.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	131										pancreas(1)	1						TTTGTGGGGAGGGCACAGTGA	0.627																																					.		.											.	.	0			.						.																																			SO:0001819	synonymous_variant	348645	.			TGGGGAGGGCACA	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.624C>A	22.37:g.50017837G>T		99	0		135	74	.	0	0	0	0	0	Q147Y0|Q5R3D1|Q6ZTN8	RNA	SNP	ENST00000444628.1	37																																																																																				.		0.627	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_026997	
PLXNB2	23654	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50720456	50720456	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr22:50720456G>A	ENST00000449103.1	-	20	3312	c.3172C>T	c.(3172-3174)Ccg>Tcg	p.P1058S	PLXNB2_ENST00000359337.4_Missense_Mutation_p.P1058S|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1058	IPT/TIG 3.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGCACAGCCGGGGACAGGAAG	0.647																																					p.P1058S		.											.	PLXNB2-211	0			c.C3172T						.						49.0	56.0	54.0					22																	50720456		2121	4234	6355	SO:0001583	missense	23654	exon20			CAGCCGGGGACAG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3172C>T	22.37:g.50720456G>A	ENSP00000409171:p.Pro1058Ser	82	1		115	48	NM_012401	0	0	76	99	23	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.618001	0.46736	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	D;D	0.86030	-2.06;-2.06	4.63	3.62	0.41486	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.163742	0.29348	N	0.012410	D	0.89255	0.6663	L	0.55481	1.735	0.39199	D	0.963113	D	0.71674	0.998	D	0.70227	0.968	D	0.90129	0.4205	10	0.59425	D	0.04	.	12.7183	0.57127	0.0805:0.0:0.9195:0.0	.	1058	O15031	PLXB2_HUMAN	S	1058	ENSP00000409171:P1058S;ENSP00000352288:P1058S	ENSP00000352288:P1058S	P	-	1	0	PLXNB2	49062583	0.998000	0.40836	0.986000	0.45419	0.213000	0.24496	2.798000	0.47884	1.180000	0.42898	0.313000	0.20887	CCG	.		0.647	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
CAND2	23066	hgsc.bcm.edu	37	3	12851676	12851676	+	Missense_Mutation	SNP	G	G	A	rs183581869	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:12851676G>A	ENST00000456430.2	+	5	651	c.610G>A	c.(610-612)Gcc>Acc	p.A204T	CAND2_ENST00000295989.5_Missense_Mutation_p.A111T	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	204				A -> T (in Ref. 6; BAA31642). {ECO:0000305}.	positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCACCTGGCGGCCGCCTGCAG	0.736													G|||	37	0.00738818	0.0008	0.0115	5008	,	,		10825	0.002		0.0149	False		,,,				2504	0.0112				p.A204T	GBM(43;676 868 1633 6395 37496)	.											.	CAND2-72	0			c.G610A						.	G	THR/ALA,THR/ALA	9,3243		0,9,1617	3.0	3.0	3.0		610,331	3.1	1.0	3		3	92,6998		1,90,3454	yes	missense,missense	CAND2	NM_001162499.1,NM_012298.2	58,58	1,99,5071	AA,AG,GG		1.2976,0.2768,0.9766	benign,benign	204/1237,111/1120	12851676	101,10241	1626	3545	5171	SO:0001583	missense	23066	exon5			CTGGCGGCCGCCT		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.610G>A	3.37:g.12851676G>A	ENSP00000387641:p.Ala204Thr	0	0		35	19	NM_001162499	0	0	0	0	0	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	22	0.010073260073260074	4	0.008130081300813009	7	0.019337016574585635	0	0.0	11	0.014511873350923483	G	15.81	2.943118	0.53079	0.002768	0.012976	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.07444	3.19;3.19	4.98	3.1	0.35709	Armadillo-like helical (1);Armadillo-type fold (1);	0.536241	0.18169	N	0.149540	T	0.03390	0.0098	N	0.03224	-0.385	0.80722	D	1	B;D	0.67145	0.049;0.996	B;D	0.76071	0.017;0.987	T	0.46119	-0.9214	10	0.15499	T	0.54	-30.4726	6.6136	0.22765	0.0963:0.316:0.5877:0.0	.	204;111	O75155;O75155-2	CAND2_HUMAN;.	T	111;204	ENSP00000295989:A111T;ENSP00000387641:A204T	ENSP00000295989:A111T	A	+	1	0	CAND2	12826676	0.815000	0.29118	1.000000	0.80357	0.979000	0.70002	1.026000	0.30103	2.586000	0.87340	0.491000	0.48974	GCC	G|0.990;A|0.010		0.736	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
CCR4	1233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	32995848	32995848	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:32995848C>T	ENST00000330953.5	+	2	1102	c.934C>T	c.(934-936)Cgc>Tgc	p.R312C		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	312					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.R312C(1)		NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						GGAGAAATTTCGCAAGTACAT	0.478																																					p.R312C		.											.	CCR4-658	1	Substitution - Missense(1)	skin(1)	c.C934T						.						64.0	68.0	67.0					3																	32995848		2203	4300	6503	SO:0001583	missense	1233	exon2			AAATTTCGCAAGT	X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.934C>T	3.37:g.32995848C>T	ENSP00000332659:p.Arg312Cys	45	0		26	10	NM_005508	0	0	0	0	0	Q9ULY6|Q9ULY7	Missense_Mutation	SNP	ENST00000330953.5	37	CCDS2656.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046571	0.75846	.	.	ENSG00000183813	ENST00000330953	T	0.58358	0.34	5.73	4.8	0.61643	.	0.107611	0.39210	N	0.001435	T	0.72669	0.3489	M	0.84948	2.725	0.58432	D	0.999999	D	0.89917	1.0	D	0.64506	0.926	T	0.77286	-0.2644	10	0.87932	D	0	.	13.8604	0.63557	0.2219:0.7781:0.0:0.0	.	312	P51679	CCR4_HUMAN	C	312	ENSP00000332659:R312C	ENSP00000332659:R312C	R	+	1	0	CCR4	32970852	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.730000	0.74780	2.706000	0.92434	0.563000	0.77884	CGC	.		0.478	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253252.2		
KIAA1143	57456	ucsc.edu;bcgsc.ca	37	3	44794960	44794960	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:44794960G>A	ENST00000296121.4	-	3	397	c.338C>T	c.(337-339)aCa>aTa	p.T113I	KIAA1143_ENST00000484437.1_5'UTR	NM_020696.3	NP_065747.1	Q96AT1	K1143_HUMAN	KIAA1143	113										NS(1)|breast(1)|central_nervous_system(1)|large_intestine(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.00847)|KIRC - Kidney renal clear cell carcinoma(197;0.0465)|Kidney(197;0.0582)		TGAGCTTGCTGTTAAACCTGA	0.363																																					p.T113I		.											.	KIAA1143-90	0			c.C338T						.						82.0	86.0	85.0					3																	44794960		2203	4297	6500	SO:0001583	missense	57456	exon3			CTTGCTGTTAAAC	AB032969	CCDS2721.1	3p21.31	2005-08-15			ENSG00000163807	ENSG00000163807			29198	protein-coding gene	gene with protein product						10574461	Standard	NM_020696		Approved		uc011bac.2	Q96AT1	OTTHUMG00000133088	ENST00000296121.4:c.338C>T	3.37:g.44794960G>A	ENSP00000296121:p.Thr113Ile	41	0		40	4	NM_020696	0	0	27	27	0	A8K0I4|Q96HJ8|Q9ULS7	Missense_Mutation	SNP	ENST00000296121.4	37	CCDS2721.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331499	0.60853	.	.	ENSG00000163807	ENST00000296121	T	0.47177	0.85	5.3	4.42	0.53409	.	0.278041	0.39475	N	0.001342	T	0.47210	0.1433	L	0.47716	1.5	0.39966	D	0.974722	B	0.31859	0.343	B	0.41332	0.354	T	0.53165	-0.8477	10	0.72032	D	0.01	-13.3519	10.102	0.42511	0.0:0.1293:0.6145:0.2562	.	113	Q96AT1	K1143_HUMAN	I	113	ENSP00000296121:T113I	ENSP00000296121:T113I	T	-	2	0	KIAA1143	44769964	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.910000	0.48766	1.351000	0.45789	0.557000	0.71058	ACA	.		0.363	KIAA1143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256746.1	NM_020696	
MAGI1	9223	bcgsc.ca	37	3	65428493	65428493	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:65428493G>T	ENST00000497477.2	-	8	1109	c.1110C>A	c.(1108-1110)gaC>gaA	p.D370E	MAGI1_ENST00000330909.8_Missense_Mutation_p.D370E|MAGI1_ENST00000402939.2_Missense_Mutation_p.D370E|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Missense_Mutation_p.D370E			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	370	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CATAGACAGGGTCTTCAATCT	0.378																																					p.D370E		.											.	MAGI1-661	0			c.C1110A						.						118.0	127.0	124.0					3																	65428493		2203	4300	6503	SO:0001583	missense	9223	exon8			GACAGGGTCTTCA	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1110C>A	3.37:g.65428493G>T	ENSP00000424369:p.Asp370Glu	99	0		74	4	NM_001033057	0	0	0	0	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.108290|4.108290	0.77096|0.77096	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287|ENST00000460329	T;D;D;D;D;D;D|.	0.83837|.	0.05;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77|.	6.04|6.04	5.17|5.17	0.71159|0.71159	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78342|0.78342	0.4268|0.4268	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	D|D	1|1	D;B;D;D;D|.	0.89917|.	1.0;0.42;1.0;1.0;1.0|.	D;B;D;D;D|.	0.91635|.	0.998;0.198;0.998;0.998;0.999|.	T|T	0.81333|0.81333	-0.0980|-0.0980	10|5	0.87932|.	D|.	0|.	-18.8178|-18.8178	9.8332|9.8332	0.40954|0.40954	0.1924:0.0:0.8076:0.0|0.1924:0.0:0.8076:0.0	.|.	370;370;370;370;370|.	Q96QZ7-6;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5|.	.;.;.;.;.|.	E|N	370;370;266;245;370;370;156;120|251	ENSP00000385450:D370E;ENSP00000331157:D370E;ENSP00000418177:D245E;ENSP00000420323:D370E;ENSP00000424369:D370E;ENSP00000420796:D156E;ENSP00000418044:D120E|.	ENSP00000331157:D370E|.	D|T	-|-	3|2	2|0	MAGI1|MAGI1	65403533|65403533	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	1.767000|1.767000	0.38501|0.38501	1.576000|1.576000	0.49790|0.49790	0.563000|0.563000	0.77884|0.77884	GAC|ACC	.		0.378	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		10	10	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		10	10	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
KIAA2018	205717	ucsc.edu	37	3	113376119	113376119	+	Silent	SNP	C	C	T	rs62265538|rs112313093|rs59601191		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:113376119C>T	ENST00000478658.1	-	5	4427	c.4410G>A	c.(4408-4410)caG>caA	p.Q1470Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1470Q			Q68DE3	K2018_HUMAN	KIAA2018	1470	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gttgctgctgctgctgctgct	0.493																																					p.Q1470Q		.											.	KIAA2018-93	0			c.G4410A						.						58.0	65.0	63.0					3																	113376119		2185	4279	6464	SO:0001819	synonymous_variant	205717	exon7			CTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4410G>A	3.37:g.113376119C>T		83	0		137	14	NM_001009899	0	0	10	87	77	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			C|0.500;T|0.500		0.493	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
GRAMD1C	54762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113655144	113655144	+	Silent	SNP	A	A	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:113655144A>G	ENST00000358160.4	+	14	1980	c.1488A>G	c.(1486-1488)ttA>ttG	p.L496L	GRAMD1C_ENST00000472026.1_Silent_p.L329L|GRAMD1C_ENST00000440446.2_Silent_p.L291L|GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_Silent_p.L225L	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	496						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						AATCTGTATTAAATCAGGCCA	0.373																																					p.L496L		.											.	GRAMD1C-93	0			c.A1488G						.						62.0	63.0	63.0					3																	113655144		2203	4300	6503	SO:0001819	synonymous_variant	54762	exon14			TGTATTAAATCAG		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.1488A>G	3.37:g.113655144A>G		28	0		57	26	NM_017577	0	0	0	0	0	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Silent	SNP	ENST00000358160.4	37	CCDS33826.1																																																																																			.		0.373	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
LRRC58	116064	broad.mit.edu	37	3	120050053	120050055	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:120050053_120050055delAAG	ENST00000295628.3	-	4	1203_1205	c.1108_1110delCTT	c.(1108-1110)cttdel	p.L370del		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	370										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		CTGTTCAACCAAGAAGAACTTTC	0.419																																					p.370_370del		.											.	.	0			c.1108_1110del						.																																			SO:0001651	inframe_deletion	116064	exon4			TCAACCAAGAAGA	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.1108_1110delCTT	3.37:g.120050056_120050058delAAG	ENSP00000295628:p.Leu370del	340	0		214	7	NM_001099678	0	0	0	0	0		In_Frame_Del	DEL	ENST00000295628.3	37	CCDS46892.1																																																																																			.		0.419	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
ILDR1	286676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121712436	121712436	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:121712436G>C	ENST00000344209.5	-	7	1286	c.1160C>G	c.(1159-1161)tCt>tGt	p.S387C	ILDR1_ENST00000273691.3_Missense_Mutation_p.S343C|ILDR1_ENST00000393631.1_Missense_Mutation_p.S298C|ILDR1_ENST00000462014.1_Missense_Mutation_p.S355C|ILDR1_ENST00000460554.1_5'UTR	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	387					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)	p.S343Y(1)|p.S387Y(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		CAATGCCCAAGACTTTGGCCC	0.592																																					p.S387C		.											.	ILDR1-91	2	Substitution - Missense(2)	large_intestine(2)	c.C1160G						.						74.0	71.0	72.0					3																	121712436		2203	4300	6503	SO:0001583	missense	286676	exon7			GCCCAAGACTTTG	BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.1160C>G	3.37:g.121712436G>C	ENSP00000345667:p.Ser387Cys	121	0		78	76	NM_001199799	0	0	0	0	0	Q6ZP61|Q7Z578	Missense_Mutation	SNP	ENST00000344209.5	37	CCDS56271.1	.	.	.	.	.	.	.	.	.	.	G	3.822	-0.037634	0.07497	.	.	ENSG00000145103	ENST00000273691;ENST00000344209;ENST00000393631;ENST00000462014	T;T;T;T	0.78595	-0.6;-0.6;-1.19;-0.19	5.59	-0.407	0.12385	.	1.276770	0.04962	N	0.462174	T	0.59542	0.2201	N	0.16478	0.41	0.09310	N	0.999999	B;B;B;B	0.15473	0.013;0.0;0.003;0.006	B;B;B;B	0.10450	0.004;0.001;0.005;0.005	T	0.41520	-0.9504	10	0.38643	T	0.18	-1.9774	2.0364	0.03541	0.4213:0.1579:0.3081:0.1127	.	298;387;343;355	Q86SU0-5;Q86SU0;Q86SU0-2;Q86SU0-6	.;ILDR1_HUMAN;.;.	C	343;387;298;355	ENSP00000273691:S343C;ENSP00000345667:S387C;ENSP00000377251:S298C;ENSP00000419414:S355C	ENSP00000273691:S343C	S	-	2	0	ILDR1	123195126	0.000000	0.05858	0.313000	0.25210	0.150000	0.21749	0.131000	0.15870	-0.135000	0.11495	0.650000	0.86243	TCT	.		0.592	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	NM_175924	
PARP15	165631	broad.mit.edu;bcgsc.ca	37	3	122296638	122296638	+	Missense_Mutation	SNP	G	G	A	rs1875272	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:122296638G>A	ENST00000464300.2	+	1	190	c.124G>A	c.(124-126)Gtg>Atg	p.V42M	PARP15_ENST00000483793.1_Missense_Mutation_p.V42M	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	42				V -> M (in Ref. 4; AAY64451). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		GGCGGGGAGCGTGCTGCCGGC	0.697													G|||	1182	0.236022	0.2564	0.33	5008	,	,		14132	0.247		0.2197	False		,,,				2504	0.1472				p.V42M		.											.	PARP15-524	0			c.G124A						.						27.0	30.0	29.0					3																	122296638		692	1591	2283	SO:0001583	missense	165631	exon1			GGGAGCGTGCTGC	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.124G>A	3.37:g.122296638G>A	ENSP00000417214:p.Val42Met	81	0		83	6	NM_001113523	0	0	0	0	0	J3KR47|Q8N1K3	Missense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	554	0.25366300366300365	125	0.2540650406504065	105	0.2900552486187845	155	0.270979020979021	169	0.22295514511873352	G	10.71	1.427298	0.25726	.	.	ENSG00000173200	ENST00000464300;ENST00000483793	T;T	0.15139	2.62;2.45	2.55	0.535	0.17133	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	5.999999999950489E-6	P	0.39551	0.678	B	0.20577	0.03	T	0.47799	-0.9089	7	0.52906	T	0.07	.	4.5242	0.11973	0.1537:0.229:0.6174:0.0	rs1875272;rs1875272	42	C9J7L3	.	M	42	ENSP00000417214:V42M;ENSP00000417785:V42M	ENSP00000417214:V42M	V	+	1	0	PARP15	123779328	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.711000	0.05019	0.116000	0.18110	0.561000	0.74099	GTG	G|0.744;A|0.256		0.697	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	0	0		11	11	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
CEP70	80321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	138219606	138219606	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:138219606T>C	ENST00000264982.3	-	14	1605	c.1339A>G	c.(1339-1341)Atg>Gtg	p.M447V	CEP70_ENST00000481834.1_Missense_Mutation_p.M447V|CEP70_ENST00000542237.1_Missense_Mutation_p.M427V|CEP70_ENST00000484888.1_Missense_Mutation_p.M447V|CEP70_ENST00000489254.1_Missense_Mutation_p.M295V	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	447					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						TCTTCCAGCATAGTATCTACT	0.328																																					p.M447V		.											.	CEP70-69	0			c.A1339G						.						110.0	119.0	116.0					3																	138219606		2203	4296	6499	SO:0001583	missense	80321	exon14			CCAGCATAGTATC	AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1339A>G	3.37:g.138219606T>C	ENSP00000264982:p.Met447Val	94	0		51	46	NM_024491	0	0	0	13	13	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	37	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.324307	0.24080	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94	4.74	4.74	0.60224	.	0.191192	0.49305	D	0.000142	T	0.16471	0.0396	L	0.39397	1.21	0.33992	D	0.649273	B;B;B;B	0.29432	0.244;0.021;0.003;0.021	B;B;B;B	0.24848	0.056;0.015;0.006;0.015	T	0.19353	-1.0308	10	0.31617	T	0.26	-11.8858	10.5321	0.44983	0.0:0.0:0.0:1.0	.	295;427;447;447	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	V	447;427;295;447;429;447	ENSP00000264982:M447V;ENSP00000444128:M427V;ENSP00000417821:M295V;ENSP00000419231:M447V;ENSP00000419833:M429V;ENSP00000417465:M447V	ENSP00000264982:M447V	M	-	1	0	CEP70	139702296	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.589000	0.36644	1.985000	0.57927	0.533000	0.62120	ATG	.		0.328	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
MED12L	116931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	150804785	150804785	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:150804785delC	ENST00000474524.1	+	1	110	c.72delC	c.(70-72)gtcfs	p.V24fs	MED12L_ENST00000422248.2_Frame_Shift_Del_p.V24fs|MED12L_ENST00000273432.4_Frame_Shift_Del_p.V24fs|MED12L_ENST00000309237.4_Frame_Shift_Del_p.V24fs	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	24						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CGCCCGACGTCTACCCACAGG	0.672																																					p.V24fs		.											.	MED12L-576	0			c.72delC						.						7.0	11.0	10.0					3																	150804785		2165	4276	6441	SO:0001589	frameshift_variant	116931	exon1			CGACGTCTACCCA	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.72delC	3.37:g.150804785delC	ENSP00000417235:p.Val24fs	77	0		59	54	NM_053002	0	0	0	0	0	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Frame_Shift_Del	DEL	ENST00000474524.1	37	CCDS33876.1																																																																																			.		0.672	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
ADIPOQ	9370	bcgsc.ca	37	3	186570892	186570892	+	Silent	SNP	T	T	G	rs2241766	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr3:186570892T>G	ENST00000412955.2	+	2	186	c.45T>G	c.(43-45)ggT>ggG	p.G15G	ADIPOQ-AS1_ENST00000422718.1_RNA|ADIPOQ_ENST00000444204.2_Silent_p.G15G|ADIPOQ_ENST00000320741.2_Silent_p.G15G			Q15848	ADIPO_HUMAN	adiponectin, C1Q and collagen domain containing	15					adiponectin-activated signaling pathway (GO:0033211)|brown fat cell differentiation (GO:0050873)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to insulin stimulus (GO:0032869)|circadian rhythm (GO:0007623)|detection of oxidative stress (GO:0070994)|fatty acid beta-oxidation (GO:0006635)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|low-density lipoprotein particle clearance (GO:0034383)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of hormone secretion (GO:0046888)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular protein transport (GO:0090317)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metanephric mesenchymal cell migration (GO:2000590)|negative regulation of phagocytosis (GO:0050765)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of receptor binding (GO:1900121)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of synaptic transmission (GO:0050805)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|positive regulation of blood pressure (GO:0045777)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of metanephric glomerular visceral epithelial cell development (GO:2000478)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myeloid cell apoptotic process (GO:0033034)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal albumin absorption (GO:2000534)|positive regulation of signal transduction (GO:0009967)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|regulation of glucose metabolic process (GO:0010906)|response to activity (GO:0014823)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to linoleic acid (GO:0070543)|response to nutrient (GO:0007584)|response to sucrose (GO:0009744)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|sialic acid binding (GO:0033691)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(2)	16	all_cancers(143;1.2e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.47e-19)	GBM - Glioblastoma multiforme(93;0.0776)		CTCTGCCCGGTCATGACCAGG	0.622													T|||	758	0.151358	0.0356	0.1859	5008	,	,		17033	0.2986		0.1322	False		,,,				2504	0.1513				p.G15G		.											.	ADIPOQ-91	0			c.T45G	GRCh37	CM032392	ADIPOQ	M	rs2241766	.	T	,	212,4194	128.6+/-165.4	5,202,1996	88.0	81.0	84.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	45,45	-1.2	0.0	3	dbSNP_98	84	991,7609	214.5+/-254.1	64,863,3373	no	coding-synonymous,coding-synonymous	ADIPOQ	NM_001177800.1,NM_004797.3	,	69,1065,5369	GG,GT,TT		11.5233,4.8116,9.2496	,	15/245,15/245	186570892	1203,11803	2203	4300	6503	SO:0001819	synonymous_variant	9370	exon3			GCCCGGTCATGAC	D45371	CCDS3284.1	3q27	2013-02-26	2005-01-24	2005-01-27	ENSG00000181092	ENSG00000181092		"""Endogenous ligands"""	13633	protein-coding gene	gene with protein product	"""adipose most abundant gene transcript 1"", ""adiponectin precursor"""	605441	"""adipocyte, C1Q and collagen domain containing"""	ACDC		7592907, 8631877	Standard	NM_001177800		Approved	ACRP30, AdipoQ, apM1, GBP28, adiponectin	uc003fra.3	Q15848	OTTHUMG00000156521	ENST00000412955.2:c.45T>G	3.37:g.186570892T>G		267	2		135	6	NM_001177800	0	0	0	0	0	Q58EX9	Silent	SNP	ENST00000412955.2	37	CCDS3284.1																																																																																			T|0.885;G|0.115		0.622	ADIPOQ-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344490.2	NM_004797	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	7	0		190	13	NM_175918	0	0	9	9	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		13	0		148	20	NM_175918	0	0	7	34	27	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388790	1388790	+	Missense_Mutation	SNP	T	T	C	rs79415192		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:1388790T>C	ENST00000324803.4	+	1	3451	c.491T>C	c.(490-492)gTg>gCg	p.V164A		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	164					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V164A(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CGTGCCGACGTGGAGTGCCCG	0.692																																					p.V164A		.											.	CRIPAK-90	1	Substitution - Missense(1)	lung(1)	c.T491C						.						180.0	124.0	143.0					4																	1388790		2201	4281	6482	SO:0001583	missense	285464	exon1			CCGACGTGGAGTG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.491T>C	4.37:g.1388790T>C	ENSP00000323978:p.Val164Ala	33	0		126	23	NM_175918	0	0	13	19	6	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	t	1.148	-0.647432	0.03506	.	.	ENSG00000179979	ENST00000324803	T	0.24350	1.86	1.25	-2.49	0.06403	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20174	-1.0283	9	0.14252	T	0.57	.	0.8761	0.01224	0.1598:0.3215:0.2492:0.2695	.	164	Q8N1N5	CRPAK_HUMAN	A	164	ENSP00000323978:V164A	ENSP00000323978:V164A	V	+	2	0	CRIPAK	1378790	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.847000	0.04331	-2.974000	0.00285	-1.550000	0.00899	GTG	C|1.000;|0.000		0.692	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		35	0		163	14	NM_175918	0	0	26	32	6	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	5	0		100	12	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		8	8	NM_001098634	0	0	0	2	2	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
CWH43	80157	broad.mit.edu	37	4	49032891	49032891	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:49032891G>T	ENST00000226432.4	+	11	1605	c.1422G>T	c.(1420-1422)atG>atT	p.M474I	CWH43_ENST00000513409.1_Missense_Mutation_p.M447I	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	474					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						AGCCCTATATGGGGAACAATG	0.413																																					p.M474I		.											.	CWH43-93	0			c.G1422T						.						138.0	140.0	139.0					4																	49032891		2203	4300	6503	SO:0001583	missense	80157	exon11			CTATATGGGGAAC		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1422G>T	4.37:g.49032891G>T	ENSP00000226432:p.Met474Ile	110	0		150	4	NM_025087	0	0	0	0	0	B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	G	7.741	0.701356	0.15172	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.28895	1.59;1.59	5.44	-7.9	0.01169	Endonuclease/exonuclease/phosphatase (1);	0.526478	0.18464	N	0.140428	T	0.11580	0.0282	N	0.25647	0.755	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	.	.	.	.	1.9042	0.03274	0.4571:0.144:0.2103:0.1886	.	474	Q9H720	PG2IP_HUMAN	I	474;447	ENSP00000226432:M474I;ENSP00000422802:M447I	.	M	+	3	0	CWH43	48727648	0.370000	0.25047	0.346000	0.25655	0.991000	0.79684	-0.944000	0.03913	-1.595000	0.01613	-0.266000	0.10368	ATG	.		0.413	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		0	0		5	4	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
DSPP	1834	ucsc.edu	37	4	88537435	88537435	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:88537435C>T	ENST00000282478.7	+	4	3654	c.3621C>T	c.(3619-3621)agC>agT	p.S1207S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1207S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1207	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtagtgatagcagtgacagca	0.557																																					p.S1207S		.											.	DSPP-90	0			c.C3621T						.																																			SO:0001819	synonymous_variant	1834	exon5			TGATAGCAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3621C>T	4.37:g.88537435C>T		725	2		931	109	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537441	88537441	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:88537441C>T	ENST00000282478.7	+	4	3660	c.3627C>T	c.(3625-3627)gaC>gaT	p.D1209D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1209D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1209	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.552																																					p.D1209D		.											.	DSPP-90	0			c.C3627T						.						45.0	65.0	58.0					4																	88537441		1601	2919	4520	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3627C>T	4.37:g.88537441C>T		740	3		937	154	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.552	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537456	88537456	+	Silent	SNP	C	C	T	rs111240022		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:88537456C>T	ENST00000282478.7	+	4	3675	c.3642C>T	c.(3640-3642)agC>agT	p.S1214S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1214S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1214	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcgacagcagtg	0.562																																					p.S1214S		.											.	DSPP-90	0			c.C3642T						.	C		91,3101		0,91,1505	39.0	60.0	53.0		3642	-6.5	0.0	4	dbSNP_132	53	128,5684		0,128,2778	no	coding-synonymous	DSPP	NM_014208.3		0,219,4283	TT,TC,CC		2.2023,2.8509,2.4323		1214/1302	88537456	219,8785	1596	2906	4502	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3642C>T	4.37:g.88537456C>T		694	2		932	337	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	0	0		5	5	NM_152400	0	0	0	0	0	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
ANKRD50	57182	broad.mit.edu	37	4	125600062	125600062	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:125600062T>A	ENST00000504087.1	-	3	1550		c.e3-2		ANKRD50_ENST00000515641.1_Splice_Site	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50											NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						AGAACACACCTGTAAAACACA	0.348																																					.		.											.	ANKRD50-90	0			c.513-2A>T						.						79.0	82.0	81.0					4																	125600062		2203	4299	6502	SO:0001630	splice_region_variant	57182	exon4			CACACCTGTAAAA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.513-2A>T	4.37:g.125600062T>A		117	0		129	3	NM_020337	0	0	0	0	0	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Splice_Site	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	12.79	2.043430	0.36085	.	.	ENSG00000151458	ENST00000504087	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1564	0.81670	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD50	125819512	1.000000	0.71417	0.997000	0.53966	0.056000	0.15407	7.198000	0.77823	2.228000	0.72767	0.477000	0.44152	.	.		0.348	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	Intron
FRG1	2483	broad.mit.edu	37	4	190878615	190878615	+	Silent	SNP	A	A	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:190878615A>T	ENST00000226798.4	+	6	717	c.495A>T	c.(493-495)atA>atT	p.I165I	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	165					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CAGGGGACATAGAAGCAAAAA	0.378																																					p.I165I		.											.	FRG1-90	0			c.A495T						.						48.0	46.0	47.0					4																	190878615		2176	4282	6458	SO:0001819	synonymous_variant	2483	exon6			GGACATAGAAGCA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.495A>T	4.37:g.190878615A>T		647	0		981	23	NM_004477	0	0	179	179	0	A8K775	Silent	SNP	ENST00000226798.4	37	CCDS34121.1																																																																																			.		0.378	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
SLC6A18	348932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1244384	1244384	+	Silent	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:1244384G>A	ENST00000324642.3	+	10	1515	c.1392G>A	c.(1390-1392)ggG>ggA	p.G464G	SLC6A18_ENST00000296821.4_Silent_p.G362G	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	464					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TGCAGTCTGGGAACTACTGGC	0.567																																					p.G464G		.											.	SLC6A18-91	0			c.G1392A						.						128.0	127.0	127.0					5																	1244384		2203	4300	6503	SO:0001819	synonymous_variant	348932	exon10			GTCTGGGAACTAC	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1392G>A	5.37:g.1244384G>A		98	0		113	49	NM_182632	0	0	0	0	0		Silent	SNP	ENST00000324642.3	37	CCDS3860.1																																																																																			.		0.567	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	NM_182632	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	79030793	79030793	+	Missense_Mutation	SNP	G	G	T	rs547347301		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:79030793G>T	ENST00000446378.2	+	2	6236	c.6205G>T	c.(6205-6207)Gtc>Ttc	p.V2069F		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2069					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CTCCTCTTCTGTCAAAACAGC	0.458													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19561	0.0		0.0	False		,,,				2504	0.0				p.V2069F		.											.	CMYA5-77	0			c.G6205T						.						71.0	70.0	70.0					5																	79030793		1868	4108	5976	SO:0001583	missense	202333	exon2			TCTTCTGTCAAAA	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6205G>T	5.37:g.79030793G>T	ENSP00000394770:p.Val2069Phe	56	0		82	8	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	8.608	0.888492	0.17540	.	.	ENSG00000164309	ENST00000446378	T	0.45276	0.9	5.81	-3.23	0.05109	.	1.697930	0.03755	N	0.257190	T	0.26195	0.0639	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26538	-1.0100	10	0.52906	T	0.07	.	3.6032	0.08032	0.3554:0.0:0.2611:0.3835	.	2069	Q8N3K9	CMYA5_HUMAN	F	2069	ENSP00000394770:V2069F	ENSP00000394770:V2069F	V	+	1	0	CMYA5	79066549	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.503000	0.06383	-0.208000	0.10171	0.650000	0.86243	GTC	.		0.458	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
MEF2C	4208	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	88100446	88100446	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:88100446T>A	ENST00000437473.2	-	3	644	c.227A>T	c.(226-228)cAt>cTt	p.H76L	MEF2C_ENST00000340208.5_Missense_Mutation_p.H76L|MEF2C_ENST00000504921.2_Missense_Mutation_p.H76L|MEF2C_ENST00000514015.1_Missense_Mutation_p.H76L|MEF2C_ENST00000424173.2_Missense_Mutation_p.H76L|MEF2C_ENST00000506554.1_Missense_Mutation_p.H76L|MEF2C_ENST00000539796.1_Missense_Mutation_p.H76L|MEF2C_ENST00000510942.1_Missense_Mutation_p.H76L|MEF2C_ENST00000508569.1_Missense_Mutation_p.H76L|MEF2C_ENST00000514028.1_Missense_Mutation_p.H76L	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	76					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CCGGCTCTCATGCGGCTCGTT	0.562										HNSCC(66;0.2)																											p.H76L		.											.	MEF2C-704	0			c.A227T						.						135.0	124.0	128.0					5																	88100446		2203	4300	6503	SO:0001583	missense	4208	exon3			CTCTCATGCGGCT	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.227A>T	5.37:g.88100446T>A	ENSP00000396219:p.His76Leu	243	0		316	23	NM_001193350	0	0	6	7	1	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	37	CCDS47245.1	.	.	.	.	.	.	.	.	.	.	T	34	5.390487	0.95988	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796;ENST00000513252;ENST00000506716;ENST00000507984;ENST00000502983;ENST00000508610;ENST00000502831;ENST00000503075	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61	5.5	5.5	0.81552	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.90363	0.6984	M	0.70275	2.135	0.80722	D	1	P;D;D;D	0.89917	0.875;1.0;0.982;1.0	B;D;D;D	0.97110	0.441;1.0;0.962;1.0	D	0.91494	0.5214	10	0.87932	D	0	-7.612	15.6133	0.76744	0.0:0.0:0.0:1.0	.	76;76;76;76	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	L	76	ENSP00000340874:H76L;ENSP00000389610:H76L;ENSP00000421925:H76L;ENSP00000426665:H76L;ENSP00000396219:H76L;ENSP00000422390:H76L;ENSP00000425636:H76L;ENSP00000423597:H76L;ENSP00000424606:H76L;ENSP00000441153:H76L;ENSP00000423826:H76L;ENSP00000423656:H76L;ENSP00000424331:H76L;ENSP00000427163:H76L;ENSP00000426442:H76L;ENSP00000427286:H76L;ENSP00000426465:H76L	ENSP00000340874:H76L	H	-	2	0	MEF2C	88136202	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.040000	0.89188	2.085000	0.62840	0.533000	0.62120	CAT	.		0.562	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
RGMB	285704	hgsc.bcm.edu	37	5	98109828	98109828	+	Silent	SNP	G	G	A	rs2547973	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:98109828G>A	ENST00000513185.1	+	1	490	c.54G>A	c.(52-54)gaG>gaA	p.E18E	RGMB-AS1_ENST00000505362.1_RNA|RGMB_ENST00000308234.7_Silent_p.E59E|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000498871.2_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000505677.1_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	18					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ccgaggttgagcagcgccgca	0.756													G|||	1477	0.294928	0.1672	0.2824	5008	,	,		8223	0.2956		0.3012	False		,,,				2504	0.4693				p.E59E		.											.	.	0			c.G177A						.						1.0	1.0	1.0					5																	98109828		405	1009	1414	SO:0001819	synonymous_variant	285704	exon3			GGTTGAGCAGCGC	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.54G>A	5.37:g.98109828G>A		0	0		6	6	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Silent	SNP	ENST00000513185.1	37																																																																																				G|0.735;A|0.265		0.756	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000505362.1_RNA|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000498871.2_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000505677.1_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		4	4	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
APC	324	hgsc.bcm.edu;bcgsc.ca	37	5	112175676	112175677	+	Frame_Shift_Del	DEL	AG	AG	-	rs387906235|rs387906234|rs121913334		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:112175676_112175677delAG	ENST00000457016.1	+	16	4765_4766	c.4385_4386delAG	c.(4384-4386)aagfs	p.K1462fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.K1462fs|APC_ENST00000257430.4_Frame_Shift_Del_p.K1462fs			P25054	APC_HUMAN	adenomatous polyposis coli	1462	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1465fs*3(24)|p.E1464fs*8(8)|p.K1462fs*6(2)|p.R1463fs*10(1)|p.?(1)|p.K1454fs*3(1)|p.K1192fs*3(1)|p.K1462fs*5(1)|p.K1462fs*10(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACTGCTGAAAAGAGAGAGAGTG	0.45		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.1462_1462del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC-12026	40	Deletion - Frameshift(38)|Unknown(1)|Complex - frameshift(1)	large_intestine(36)|thyroid(1)|lung(1)|soft_tissue(1)|skin(1)	c.4385_4386del	GRCh37	CD011102|CI045946	APC	D|I		.																																			SO:0001589	frameshift_variant	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	CTGAAAAGAGAGA	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4385_4386delAG	5.37:g.112175684_112175685delAG	ENSP00000413133:p.Lys1462fs	100	1		50	43	NM_001127510	0	0	0	0	0	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																			.		0.450	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CHSY3	337876	hgsc.bcm.edu	37	5	129240972	129240972	+	Silent	SNP	G	G	C	rs33917	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:129240972G>C	ENST00000305031.4	+	1	808	c.450G>C	c.(448-450)ccG>ccC	p.P150P	CTC-575N7.1_ENST00000515569.1_RNA|CTC-575N7.1_ENST00000503616.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ACGGCCGGCCGGGGAGTAGCC	0.766													G|||	2286	0.45647	0.2254	0.513	5008	,	,		7622	0.5833		0.5368	False		,,,				2504	0.5153				p.P150P		.											.	CHSY3-25	0			c.G450C						.						1.0	2.0	2.0					5																	129240972		822	2140	2962	SO:0001819	synonymous_variant	337876	exon1			CCGGCCGGGGAGT	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.450G>C	5.37:g.129240972G>C		0	0		6	6	NM_175856	0	0	0	0	0	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																			G|0.479;C|0.521		0.766	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
PCDHAC1	56135	broad.mit.edu	37	5	140307491	140307491	+	Silent	SNP	C	C	T	rs116016831	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:140307491C>T	ENST00000253807.2	+	1	1014	c.1014C>T	c.(1012-1014)ccC>ccT	p.P338P	PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.P338P|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	338	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P338P(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCATGCCCCCGAACTGGACT	0.522													c|||	36	0.0071885	0.0242	0.0	5008	,	,		21363	0.0		0.004	False		,,,				2504	0.0				p.P338P		.											.	PCDHAC1-28	1	Substitution - coding silent(1)	endometrium(1)	c.C1014T						.	C	,,,,,,,,,,,,,,,,,	92,4314	75.7+/-113.9	1,90,2112	165.0	153.0	157.0		1014,,,,,,,,,,,,,,,,,1014	-11.8	0.0	5	dbSNP_132	157	14,8586	10.5+/-38.8	0,14,4286	no	coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHA9,PCDHAC1,PCDHA13,PCDHA12,PCDHA11,PCDHA10,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018898.3,NM_018900.2,NM_018901.2,NM_018902.3,NM_018903.2,NM_018904.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1,NM_031860.1,NM_031882.2	,,,,,,,,,,,,,,,,,	1,104,6398	TT,TC,CC		0.1628,2.0881,0.815	,,,,,,,,,,,,,,,,,	338/964,,,,,,,,,,,,,,,,,338/819	140307491	106,12900	2203	4300	6503	SO:0001819	synonymous_variant	56135	exon1			TGCCCCCGAACTG	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1014C>T	5.37:g.140307491C>T		289	0		377	7	NM_031882	0	0	0	0	0	Q9Y5F5|Q9Y5I5	Silent	SNP	ENST00000253807.2	37	CCDS4241.1																																																																																			C|0.992;T|0.008		0.522	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHB7	56129	broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		.											.	PCDHB7-95	1	Substitution - coding silent(1)	lung(1)	c.G1578T						.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		173	1		616	20	NM_018940	0	0	1	1	0	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHGA6	56109	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140755561	140755561	+	Silent	SNP	G	G	A	rs553803944		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:140755561G>A	ENST00000517434.1	+	1	1911	c.1911G>A	c.(1909-1911)gcG>gcA	p.A637A	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAGACGCGCTCAAGCAGA	0.692																																					p.A637A		.											.	PCDHGA6-67	0			c.G1911A						.						40.0	50.0	47.0					5																	140755561		2203	4297	6500	SO:0001819	synonymous_variant	56109	exon1			AGACGCGCTCAAG	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1911G>A	5.37:g.140755561G>A		50	1		290	130	NM_018919	0	0	0	0	0	A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	CCDS54926.1																																																																																			.		0.692	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167645355	167645355	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:167645355G>T	ENST00000518659.1	+	23	4498	c.4459G>T	c.(4459-4461)Gtc>Ttc	p.V1487F	TENM2_ENST00000403607.2_Missense_Mutation_p.V1311F|TENM2_ENST00000520394.1_Missense_Mutation_p.V1248F|TENM2_ENST00000545108.1_Missense_Mutation_p.V1486F|TENM2_ENST00000519204.1_Missense_Mutation_p.V1366F	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1487					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TCACACTGGGGTCCTCTACAT	0.527																																					p.V1478F		.											.	.	0			c.G4432T						.						158.0	162.0	161.0					5																	167645355		2191	4286	6477	SO:0001583	missense	57451	exon23			ACTGGGGTCCTCT	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4459G>T	5.37:g.167645355G>T	ENSP00000429430:p.Val1487Phe	199	0		298	149	NM_001122679	0	0	0	0	0	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	G	12.64	1.998505	0.35226	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;D;T;T;T	0.90133	1.59;-2.62;1.59;1.59;1.59	5.71	3.69	0.42338	Six-bladed beta-propeller, TolB-like (1);	0.335919	0.33327	N	0.005034	D	0.86151	0.5864	L	0.49126	1.545	0.42372	D	0.992457	B;B;P	0.36909	0.208;0.132;0.573	B;B;B	0.37508	0.252;0.07;0.106	D	0.84790	0.0778	10	0.52906	T	0.07	.	7.3628	0.26756	0.3426:0.0:0.6574:0.0	.	1486;1487;1248	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	F	1487;1486;1366;1248;1311	ENSP00000429430:V1487F;ENSP00000438635:V1486F;ENSP00000428964:V1366F;ENSP00000427874:V1248F;ENSP00000384905:V1311F	ENSP00000384905:V1311F	V	+	1	0	ODZ2	167577933	0.993000	0.37304	0.986000	0.45419	0.967000	0.64934	1.872000	0.39549	1.422000	0.47177	0.655000	0.94253	GTC	.		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
WWC1	23286	bcgsc.ca	37	5	167868779	167868779	+	Silent	SNP	A	A	G	rs3733981	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:167868779A>G	ENST00000265293.4	+	16	2875	c.2373A>G	c.(2371-2373)aaA>aaG	p.K791K	WWC1_ENST00000521089.1_Silent_p.K791K|WWC1_ENST00000522140.1_3'UTR	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	791					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ACTTGAAGAAACAGAGCAGGG	0.632													A|||	2743	0.547724	0.7595	0.4006	5008	,	,		15530	0.6151		0.335	False		,,,				2504	0.5153				p.K791K		.											.	WWC1-157	0			c.A2373G						.	A	,,	3061,1345	689.4+/-405.1	1081,899,223	40.0	40.0	40.0		2373,2373,2373	-3.5	1.0	5	dbSNP_107	40	2963,5637	458.1+/-364.5	518,1927,1855	no	coding-synonymous,coding-synonymous,coding-synonymous	WWC1	NM_001161661.1,NM_001161662.1,NM_015238.2	,,	1599,2826,2078	GG,GA,AA		34.4535,30.5266,46.3171	,,	791/1120,791/1119,791/1114	167868779	6024,6982	2203	4300	6503	SO:0001819	synonymous_variant	23286	exon16			GAAGAAACAGAGC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2373A>G	5.37:g.167868779A>G		336	4		492	12	NM_015238	0	0	0	0	0	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	37	CCDS4366.1	1120	0.5128205128205128	385	0.782520325203252	161	0.4447513812154696	347	0.6066433566433567	227	0.2994722955145119	A	10.85	1.466417	0.26335	0.694734	0.344535	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	5.31	-3.53	0.04667	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.99999999148424	.	.	.	.	.	.	T	0.27872	-1.0061	3	.	.	.	.	11.9069	0.52717	0.4652:0.0:0.5348:0.0	rs3733981;rs56965563;rs3733981	.	.	.	A	753;568	.	.	T	+	1	0	WWC1	167801357	0.920000	0.31207	0.970000	0.41538	0.985000	0.73830	0.139000	0.16036	-0.512000	0.06505	0.374000	0.22700	ACA	A|0.525;G|0.475		0.632	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
CREBRF	153222	hgsc.bcm.edu	37	5	172513606	172513606	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:172513606G>T	ENST00000296953.2	+	3	431	c.112G>T	c.(112-114)Gat>Tat	p.D38Y	CREBRF_ENST00000522692.1_Missense_Mutation_p.D38Y|CREBRF_ENST00000520420.1_Missense_Mutation_p.D38Y|CREBRF_ENST00000540014.1_Missense_Mutation_p.D38Y	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	38					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAACAGTTCGGATCCAGATTT	0.413																																					p.D38Y		.											.	.	0			c.G112T						.						158.0	145.0	149.0					5																	172513606		2203	4300	6503	SO:0001583	missense	153222	exon3			AGTTCGGATCCAG	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.112G>T	5.37:g.172513606G>T	ENSP00000296953:p.Asp38Tyr	56	0		58	4	NM_153607	0	0	3	3	0	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	37	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968684	0.92855	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T	0.61859	0.07;0.07	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70335	-0.4900	10	0.87932	D	0	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	38;38	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	Y	38	ENSP00000296953:D38Y;ENSP00000440075:D38Y	ENSP00000296953:D38Y	D	+	1	0	C5orf41	172446212	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.173000	0.94815	2.885000	0.99019	0.655000	0.94253	GAT	.		0.413	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
NKX2-5	1482	broad.mit.edu	37	5	172659730	172659730	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:172659730C>A	ENST00000329198.4	-	2	1090	c.817G>T	c.(817-819)Gct>Tct	p.A273S		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	273	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCGGGGTAAGCGGCAGTGCAG	0.672																																					p.A273S	Esophageal Squamous(72;810 1219 2387 13420 44943)	.											.	NKX2-5-90	0			c.G817T						.						11.0	13.0	12.0					5																	172659730		2196	4286	6482	SO:0001583	missense	1482	exon2			GGTAAGCGGCAGT	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.817G>T	5.37:g.172659730C>A	ENSP00000327758:p.Ala273Ser	63	1		123	8	NM_004387	0	0	4	4	0	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	C	6.919	0.539183	0.13250	.	.	ENSG00000183072	ENST00000329198	D	0.89810	-2.57	4.07	4.07	0.47477	.	.	.	.	.	T	0.70535	0.3235	N	0.02960	-0.455	0.80722	D	1	B	0.25743	0.133	B	0.19391	0.025	T	0.68062	-0.5508	9	0.06625	T	0.88	.	11.6143	0.51080	0.0:1.0:0.0:0.0	.	273	P52952	NKX25_HUMAN	S	273	ENSP00000327758:A273S	ENSP00000327758:A273S	A	-	1	0	NKX2-5	172592336	0.895000	0.30542	0.787000	0.31911	0.085000	0.17905	1.416000	0.34759	2.083000	0.62718	0.542000	0.68232	GCT	.		0.672	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
KIAA1191	57179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	175774669	175774672	+	Frame_Shift_Del	DEL	TTTC	TTTC	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	TTTC	TTTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:175774669_175774672delTTTC	ENST00000298569.4	-	9	1382_1385	c.849_852delGAAA	c.(847-852)aagaaafs	p.KK283fs	RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393728.2_5'UTR|KIAA1191_ENST00000510164.1_Frame_Shift_Del_p.KK283fs|KIAA1191_ENST00000393725.2_Frame_Shift_Del_p.KK264fs	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	283						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GTGGTGGCTGTTTCTTTCCTTCCA	0.549																																					p.283_284del		.											.	KIAA1191-91	0			c.849_852del						.																																			SO:0001589	frameshift_variant	57179	exon9			TGGCTGTTTCTTT	BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.849_852delGAAA	5.37:g.175774673_175774676delTTTC	ENSP00000298569:p.Lys283fs	48	0		61	31	NM_020444	0	0	0	0	0	B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Frame_Shift_Del	DEL	ENST00000298569.4	37	CCDS4399.1																																																																																			.		0.549	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253146.2	NM_020444	
GPRIN1	114787	broad.mit.edu;bcgsc.ca	37	5	176024723	176024723	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:176024723G>T	ENST00000303991.4	-	2	2290	c.2113C>A	c.(2113-2115)Cca>Aca	p.P705T		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	705					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAAGGATGGGGACTCCGTT	0.617																																					p.P705T		.											.	GPRIN1-92	0			c.C2113A						.						65.0	66.0	66.0					5																	176024723		2203	4300	6503	SO:0001583	missense	114787	exon2			AGGATGGGGACTC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.2113C>A	5.37:g.176024723G>T	ENSP00000305839:p.Pro705Thr	49	1		68	35	NM_052899	0	0	0	0	0	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	G	6.230	0.410639	0.11812	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.08634	3.07	4.58	-0.925	0.10458	.	0.763799	0.10754	N	0.638004	T	0.06600	0.0169	L	0.54323	1.7	0.09310	N	1	P	0.42518	0.782	B	0.41036	0.346	T	0.26087	-1.0113	10	0.09590	T	0.72	-0.9749	1.9701	0.03404	0.2472:0.2266:0.4069:0.1193	.	705	Q7Z2K8	GRIN1_HUMAN	T	705	ENSP00000305839:P705T	ENSP00000305839:P705T	P	-	1	0	GPRIN1	175957329	0.000000	0.05858	0.015000	0.15790	0.033000	0.12548	-0.066000	0.11598	0.325000	0.23359	0.455000	0.32223	CCA	.		0.617	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
SLC34A1	6569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	176825193	176825193	+	Missense_Mutation	SNP	C	C	T	rs147711480		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr5:176825193C>T	ENST00000324417.5	+	13	1917	c.1826C>T	c.(1825-1827)cCg>cTg	p.P609L	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	609					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCTCACCCCCGCTGCCCCCC	0.682													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15685	0.0		0.0	False		,,,				2504	0.0				p.P609L		.											.	SLC34A1-91	0			c.C1826T						.	C	LEU/PRO	4,4402	8.1+/-20.4	0,4,2199	27.0	30.0	29.0		1826	-2.9	0.0	5	dbSNP_134	29	2,8598	2.2+/-6.3	0,2,4298	no	missense	SLC34A1	NM_003052.4	98	0,6,6497	TT,TC,CC		0.0233,0.0908,0.0461	benign	609/640	176825193	6,13000	2203	4300	6503	SO:0001583	missense	6569	exon13			CACCCCCGCTGCC	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1826C>T	5.37:g.176825193C>T	ENSP00000321424:p.Pro609Leu	32	0		22	13	NM_003052	0	0	0	0	0	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	C	5.851	0.341243	0.11069	9.08E-4	2.33E-4	ENSG00000131183	ENST00000324417	T	0.29397	1.57	5.01	-2.88	0.05682	.	0.836101	0.10597	N	0.656094	T	0.15696	0.0378	N	0.25647	0.755	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22034	-1.0228	10	0.32370	T	0.25	-18.4411	3.0273	0.06095	0.5466:0.2005:0.0985:0.1544	.	609	Q06495	NPT2A_HUMAN	L	609	ENSP00000321424:P609L	ENSP00000321424:P609L	P	+	2	0	SLC34A1	176757799	0.000000	0.05858	0.002000	0.10522	0.286000	0.27126	-0.304000	0.08199	-0.567000	0.06046	0.305000	0.20034	CCG	C|0.999;T|0.001		0.682	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
MAK	4117	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	10784764	10784764	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:10784764C>T	ENST00000313243.2	-	11	1740	c.1358G>A	c.(1357-1359)gGg>gAg	p.G453E	MAK_ENST00000538030.1_3'UTR|MAK_ENST00000354489.2_Missense_Mutation_p.G453E|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000474039.1_Missense_Mutation_p.G453E|SYCP2L_ENST00000543878.1_Intron			P20794	MAK_HUMAN	male germ cell-associated kinase	453					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				CTTGTTTTCCCCTGTCGAGTG	0.468																																					p.G453E		.											.	MAK-335	0			c.G1358A						.						135.0	124.0	127.0					6																	10784764		2203	4300	6503	SO:0001583	missense	4117	exon11			TTTTCCCCTGTCG		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.1358G>A	6.37:g.10784764C>T	ENSP00000313021:p.Gly453Glu	219	0		134	7	NM_005906	0	0	0	0	0	F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	ENST00000313243.2	37	CCDS4516.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803871	0.31869	.	.	ENSG00000111837	ENST00000313243;ENST00000354489	T;T	0.71817	-0.6;-0.6	5.27	-2.02	0.07388	.	1.115670	0.06528	N	0.740933	T	0.42765	0.1217	M	0.61703	1.905	0.22639	N	0.998903	B	0.12630	0.006	B	0.12837	0.008	T	0.38243	-0.9670	10	0.51188	T	0.08	.	4.6355	0.12523	0.228:0.3607:0.0:0.4113	.	453	P20794	MAK_HUMAN	E	453	ENSP00000313021:G453E;ENSP00000346484:G453E	ENSP00000313021:G453E	G	-	2	0	MAK	10892750	0.000000	0.05858	0.004000	0.12327	0.117000	0.20001	-0.816000	0.04477	-0.883000	0.03982	0.563000	0.77884	GGG	.		0.468	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	
VARS2	57176	broad.mit.edu	37	6	30888510	30888510	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:30888510G>A	ENST00000321897.5	+	14	2095	c.1463G>A	c.(1462-1464)gGg>gAg	p.G488E	VARS2_ENST00000416670.2_Missense_Mutation_p.G488E|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Missense_Mutation_p.G518E|VARS2_ENST00000542001.1_Missense_Mutation_p.G348E			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	488					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CAGGAAATGGGGGCCCGAGCT	0.567																																					p.G518E		.											.	VARS2-26	0			c.G1553A						.						24.0	22.0	22.0					6																	30888510		1511	2707	4218	SO:0001583	missense	57176	exon15			AAATGGGGGCCCG	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1463G>A	6.37:g.30888510G>A	ENSP00000316092:p.Gly488Glu	77	0		89	3	NM_001167734	0	0	18	18	0	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502994	0.44558	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	4.91	3.07	0.35406	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.229661	0.42548	N	0.000693	T	0.19765	0.0475	L	0.54323	1.7	0.32394	N	0.55283	P;P;P	0.47253	0.785;0.745;0.892	P;P;P	0.53360	0.724;0.667;0.694	T	0.03175	-1.1064	10	0.87932	D	0	-17.6219	13.2865	0.60245	0.0:0.4639:0.5361:0.0	.	486;518;488	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	E	488;488;348;518	ENSP00000316092:G488E;ENSP00000394802:G488E;ENSP00000438200:G348E;ENSP00000441000:G518E	ENSP00000316092:G488E	G	+	2	0	VARS2	30996489	1.000000	0.71417	0.575000	0.28536	0.452000	0.32318	3.338000	0.52128	0.546000	0.28920	0.555000	0.69702	GGG	.		0.567	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		23	13	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
TFEB	7942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	41652375	41652375	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:41652375G>T	ENST00000230323.4	-	10	1694	c.1393C>A	c.(1393-1395)Cgg>Agg	p.R465R	TFEB_ENST00000358871.2_Silent_p.R479R|TFEB_ENST00000373033.1_Silent_p.R465R|AL035588.1_ENST00000597468.1_5'Flank|TFEB_ENST00000420312.1_Silent_p.R380R|TFEB_ENST00000403298.4_Silent_p.R465R	NM_001271945.1|NM_007162.2	NP_001258874.1|NP_009093.1	P19484	TFEB_HUMAN	transcription factor EB	465					autophagy (GO:0006914)|embryonic placenta development (GO:0001892)|humoral immune response (GO:0006959)|lysosome organization (GO:0007040)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	11	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			AAGCTGCTCCGGCGGCTGCTG	0.682			T	ALPHA	renal (childhood epithelioid)																																p.R479R		.		Dom	yes		6	6p21	7942	transcription factor EB		"""E,M"""	.	TFEB-659	0			c.C1435A						.						43.0	46.0	45.0					6																	41652375		2203	4297	6500	SO:0001819	synonymous_variant	7942	exon9			TGCTCCGGCGGCT	M33782	CCDS4858.1, CCDS64424.1, CCDS64425.1	6p21	2013-05-21			ENSG00000112561	ENSG00000112561		"""Basic helix-loop-helix proteins"""	11753	protein-coding gene	gene with protein product		600744				2115126	Standard	NM_007162		Approved	TCFEB, bHLHe35	uc003oqu.2	P19484	OTTHUMG00000014684	ENST00000230323.4:c.1393C>A	6.37:g.41652375G>T		155	0		158	79	NM_001167827	0	0	7	11	4	Q709B3|Q7Z6P9|Q9BRJ5|Q9UJD8	Silent	SNP	ENST00000230323.4	37	CCDS4858.1																																																																																			.		0.682	TFEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040522.3		
TDRD6	221400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46657547	46657547	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:46657547A>G	ENST00000316081.6	+	1	1682	c.1682A>G	c.(1681-1683)gAt>gGt	p.D561G	RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.D561G|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	561	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			ACCAAATTGGATGACAAGAGT	0.433																																					p.D561G		.											.	TDRD6-138	0			c.A1682G						.						166.0	166.0	166.0					6																	46657547		2203	4300	6503	SO:0001583	missense	221400	exon1			AATTGGATGACAA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1682A>G	6.37:g.46657547A>G	ENSP00000346065:p.Asp561Gly	309	1		366	168	NM_001168359	0	0	0	0	0	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.343472	0.01277	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.10860	2.83;2.83	6.02	-0.696	0.11287	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.841713	0.11023	N	0.608125	T	0.01592	0.0051	N	0.22421	0.69	0.09310	N	1	B;B	0.13145	0.005;0.007	B;B	0.14023	0.004;0.01	T	0.47799	-0.9089	10	0.22706	T	0.39	-8.3327	2.9223	0.05773	0.5019:0.11:0.281:0.1072	.	561;561	F5H5M3;O60522	.;TDRD6_HUMAN	G	561	ENSP00000443299:D561G;ENSP00000346065:D561G	ENSP00000346065:D561G	D	+	2	0	TDRD6	46765506	0.057000	0.20700	0.002000	0.10522	0.138000	0.21146	0.723000	0.25939	0.177000	0.19895	-0.290000	0.09829	GAT	.		0.433	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
CEP162	22832	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	84904675	84904675	+	Silent	SNP	A	A	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:84904675A>G	ENST00000403245.3	-	10	1068	c.954T>C	c.(952-954)gaT>gaC	p.D318D	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Silent_p.D242D	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		AGCTCTTGATATCTTCCACTG	0.358																																					p.D318D		.											.	KIAA1009-91	0			c.T954C						.						215.0	190.0	198.0					6																	84904675		2203	4299	6502	SO:0001819	synonymous_variant	22832	exon10			CTTGATATCTTCC																												ENST00000403245.3:c.954T>C	6.37:g.84904675A>G		107	1		147	68	NM_014895	0	0	0	0	0		Silent	SNP	ENST00000403245.3	37	CCDS34494.2																																																																																			.		0.358	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
UBE2J1	51465	bcgsc.ca	37	6	90042814	90042814	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:90042814G>T	ENST00000435041.2	-	7	947	c.669C>A	c.(667-669)gcC>gcA	p.A223A		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	223					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		CCGATGTACTGGCCGTAGCAC	0.363																																					p.A223A		.											.	UBE2J1-226	0			c.C669A						.						172.0	177.0	175.0					6																	90042814		2203	4300	6503	SO:0001819	synonymous_variant	51465	exon7			TGTACTGGCCGTA	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.669C>A	6.37:g.90042814G>T		58	0		72	4	NM_016021	0	0	0	0	0	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	37	CCDS5021.1																																																																																			.		0.363	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
LIN28B	389421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	105526424	105526424	+	Silent	SNP	C	C	A	rs140802515	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:105526424C>A	ENST00000345080.4	+	4	722	c.519C>A	c.(517-519)ccC>ccA	p.P173P		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	173					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CACAGCCACCCGCGAGTTCTC	0.527																																					p.P173P		.											.	LIN28B-90	0			c.C519A						.						93.0	84.0	87.0					6																	105526424		2203	4300	6503	SO:0001819	synonymous_variant	389421	exon4			GCCACCCGCGAGT	AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.519C>A	6.37:g.105526424C>A		75	0		122	60	NM_001004317	0	0	0	0	0	A1L165|B2RPN6|Q5TCM4	Silent	SNP	ENST00000345080.4	37	CCDS34504.1																																																																																			C|0.999;T|0.001		0.527	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041646.2	NM_001004317	
METTL24	728464	hgsc.bcm.edu	37	6	110679413	110679413	+	Silent	SNP	A	A	G	rs62435951	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:110679413A>G	ENST00000338882.4	-	1	62	c.63T>C	c.(61-63)gcT>gcC	p.A21A	METTL24_ENST00000490043.1_5'Flank	NM_001123364.1	NP_001116836.1	Q5JXM2	MET24_HUMAN	methyltransferase like 24	21						extracellular region (GO:0005576)	methyltransferase activity (GO:0008168)										ACAACAGCACAGCCCCGAGTA	0.811													G|||	2627	0.524561	0.4667	0.5187	5008	,	,		6564	0.4712		0.6252	False		,,,				2504	0.5583				p.A21A		.											.	.	0			c.T63C						.	G		520,1076		103,314,381	2.0	2.0	2.0		63	-1.9	0.0	6	dbSNP_129	2	1666,2220		392,882,669	no	coding-synonymous	C6orf186	NM_001123364.1		495,1196,1050	GG,GA,AA		42.8718,32.5815,39.876		21/367	110679413	2186,3296	798	1943	2741	SO:0001819	synonymous_variant	728464	exon1			CAGCACAGCCCCG		CCDS43489.1	6q21	2012-03-08	2012-02-21	2012-02-21	ENSG00000053328	ENSG00000053328			21566	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 186"""	C6orf186			Standard	NM_001123364		Approved	dJ71D21.2	uc010kdu.1	Q5JXM2	OTTHUMG00000015359	ENST00000338882.4:c.63T>C	6.37:g.110679413A>G		0	0		4	4	NM_001123364	0	0	0	0	0	Q6ZSU5	Silent	SNP	ENST00000338882.4	37	CCDS43489.1																																																																																			A|0.470;G|0.530		0.811	METTL24-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041794.1	NM_001123364	
WDR27	253769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	170033154	170033154	+	Silent	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:170033154G>A	ENST00000448612.1	-	21	2221	c.2112C>T	c.(2110-2112)ctC>ctT	p.L704L	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000333572.6_Silent_p.L704L|WDR27_ENST00000423258.1_Silent_p.L577L	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	674						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GGCCAGCTGCGAGTACGATGT	0.522																																					p.L704L		.											.	WDR27-69	0			c.C2112T						.						52.0	53.0	52.0					6																	170033154		1987	4159	6146	SO:0001819	synonymous_variant	253769	exon21			AGCTGCGAGTACG	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.2112C>T	6.37:g.170033154G>A		98	0		91	10	NM_182552	0	0	0	0	0	A5PLM8|C9JGV0|Q5T066	Silent	SNP	ENST00000448612.1	37	CCDS47520.2																																																																																			.		0.522	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	3	0		22	10	NM_002047	0	0	5	14	9	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
AEBP1	165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44151812	44151812	+	Silent	SNP	G	G	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:44151812G>C	ENST00000223357.3	+	17	2414	c.2109G>C	c.(2107-2109)ccG>ccC	p.P703P	AEBP1_ENST00000450684.2_Silent_p.P278P|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	703	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AAGATTTCCCGGATCTCAACT	0.582																																					p.P703P		.											.	AEBP1-90	0			c.G2109C						.						78.0	79.0	78.0					7																	44151812		2203	4300	6503	SO:0001819	synonymous_variant	165	exon17			TTTCCCGGATCTC	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2109G>C	7.37:g.44151812G>C		80	0		60	35	NM_001129	0	0	1	1	0	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	37	CCDS5476.1																																																																																			.		0.582	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
EGFR	1956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	55224349	55224349	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:55224349G>A	ENST00000275493.2	+	9	1307	c.1130G>A	c.(1129-1131)aGg>aAg	p.R377K	EGFR_ENST00000420316.2_Missense_Mutation_p.R377K|EGFR_ENST00000455089.1_Missense_Mutation_p.R332K|EGFR_ENST00000442591.1_Missense_Mutation_p.R377K|EGFR_ENST00000344576.2_Missense_Mutation_p.R377K|EGFR_ENST00000342916.3_Missense_Mutation_p.R377K|EGFR_ENST00000454757.2_Missense_Mutation_p.R324K	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	377					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GTGGCATTTAGGGGGTGAGTC	0.403		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.R377K		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR-44910	0			c.G1130A						.						81.0	83.0	82.0					7																	55224349		2203	4300	6503	SO:0001583	missense	1956	exon9	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CATTTAGGGGGTG		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1130G>A	7.37:g.55224349G>A	ENSP00000275493:p.Arg377Lys	110	0		119	66	NM_005228	0	0	0	0	0	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	3.418	-0.118847	0.06838	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;1.03;-1.18;-1.18;-1.18	5.95	-7.48	0.01360	EGF receptor, L domain (1);	0.908160	0.09792	N	0.755210	T	0.37489	0.1005	N	0.00468	-1.46	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.001;0.001;0.0	T	0.53158	-0.8478	10	0.02654	T	1	.	15.0944	0.72223	0.8179:0.0:0.0953:0.0868	.	332;377;377;377;377	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	K	332;377;247;377;377;377;377;324;171	ENSP00000415559:R332K;ENSP00000342376:R377K;ENSP00000345973:R377K;ENSP00000413843:R377K;ENSP00000275493:R377K;ENSP00000410031:R377K;ENSP00000395243:R324K	ENSP00000275493:R377K	R	+	2	0	EGFR	55191843	0.742000	0.28228	0.087000	0.20705	0.733000	0.41908	0.615000	0.24329	-1.466000	0.01897	-0.136000	0.14681	AGG	.		0.403	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
ELN	2006	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73462021	73462021	+	Silent	SNP	C	C	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:73462021C>G	ENST00000252034.7	+	13	1059	c.660C>G	c.(658-660)ccC>ccG	p.P220P	ELN_ENST00000320492.7_Intron|ELN_ENST00000458204.1_Silent_p.P210P|ELN_ENST00000357036.5_Silent_p.P225P|ELN_ENST00000380584.4_Intron|ELN_ENST00000358929.4_Silent_p.P220P|ELN_ENST00000429192.1_Silent_p.P225P|ELN_ENST00000414324.1_Silent_p.P215P|ELN_ENST00000445912.1_Silent_p.P220P|ELN_ENST00000380553.4_Intron|ELN_ENST00000320399.6_Silent_p.P220P|ELN_ENST00000380575.4_Silent_p.P210P|ELN_ENST00000380562.4_Silent_p.P220P|ELN_ENST00000380576.5_Silent_p.P220P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	220					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				ATGGACTGCCCTACACCACAG	0.597			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P225P		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN-95	0			c.C675G						.						178.0	157.0	164.0					7																	73462021		2203	4300	6503	SO:0001819	synonymous_variant	2006	exon13			ACTGCCCTACACC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.660C>G	7.37:g.73462021C>G		179	2		264	118	NM_001081753	0	0	0	0	0	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	37	CCDS5562.2																																																																																			.		0.597	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
C7orf60	154743	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	112579732	112579732	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:112579732C>A	ENST00000297145.4	-	1	239	c.74G>T	c.(73-75)cGg>cTg	p.R25L	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	25							rRNA (adenine) methyltransferase activity (GO:0016433)			breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						CTCCTGCTCCCGGGGCGGCGG	0.701																																					p.R25L		.											.	C7orf60-93	0			c.G74T						.						29.0	31.0	30.0					7																	112579732		1883	4110	5993	SO:0001583	missense	154743	exon1			TGCTCCCGGGGCG		CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.74G>T	7.37:g.112579732C>A	ENSP00000297145:p.Arg25Leu	66	0		78	42	NM_152556	0	0	0	0	0	Q8N3D0|Q96MV7	Missense_Mutation	SNP	ENST00000297145.4	37	CCDS43634.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087539	0.55968	.	.	ENSG00000164603	ENST00000297145	.	.	.	4.93	1.58	0.23477	.	0.672960	0.13413	U	0.389751	T	0.17831	0.0428	N	0.08118	0	0.23969	N	0.996316	B	0.23128	0.08	B	0.15052	0.012	T	0.17837	-1.0356	9	0.54805	T	0.06	-0.5413	8.1145	0.30935	0.0:0.6103:0.2965:0.0932	.	25	Q1RMZ1	CG060_HUMAN	L	25	.	ENSP00000297145:R25L	R	-	2	0	C7orf60	112366968	0.710000	0.27896	1.000000	0.80357	0.964000	0.63967	-0.363000	0.07593	0.530000	0.28619	0.456000	0.33151	CGG	.		0.701	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338923.1	NM_152556	
SLC4A2	6522	bcgsc.ca	37	7	150772800	150772800	+	Nonsense_Mutation	SNP	G	G	T	rs373320216		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr7:150772800G>T	ENST00000485713.1	+	21	4449	c.3409G>T	c.(3409-3411)Gag>Tag	p.E1137*	SLC4A2_ENST00000392826.2_Nonsense_Mutation_p.E1128*|SLC4A2_ENST00000310317.5_Nonsense_Mutation_p.E1055*|SLC4A2_ENST00000461735.1_Nonsense_Mutation_p.E1123*|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000413384.2_Nonsense_Mutation_p.E1137*|RP11-148K1.12_ENST00000485974.1_RNA	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1137	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCAGTTCTATGAGCGGCTGCA	0.582																																					p.E1137X		.											.	SLC4A2-90	0			c.G3409T						.						73.0	76.0	75.0					7																	150772800		2203	4300	6503	SO:0001587	stop_gained	6522	exon21			TTCTATGAGCGGC		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3409G>T	7.37:g.150772800G>T	ENSP00000419412:p.Glu1137*	41	2		47	24	NM_003040	0	0	40	47	7	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Nonsense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	44	11.137759	0.99521	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	.	.	.	5.54	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.8032	0.63214	0.073:0.0:0.927:0.0	.	.	.	.	X	1137;1137;1055;1128;1123	.	ENSP00000311402:E1055X	E	+	1	0	SLC4A2	150403733	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.800000	0.85949	1.577000	0.49804	0.655000	0.94253	GAG	.		0.582	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	6296613	6296613	+	Silent	SNP	C	C	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:6296613C>T	ENST00000344683.5	+	6	652	c.576C>T	c.(574-576)ccC>ccT	p.P192P	MCPH1_ENST00000519480.1_Silent_p.P192P|MCPH1_ENST00000522905.1_Intron	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	192					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		ATCTTTCCCCCACCTGTAAGT	0.333																																					p.P192P	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.C576T						.						61.0	57.0	58.0					8																	6296613		1842	4094	5936	SO:0001819	synonymous_variant	79648	exon6			TTCCCCCACCTGT	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.576C>T	8.37:g.6296613C>T		22	0		38	25	NM_001172574	0	0	0	0	0	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	37	CCDS43689.1																																																																																			.		0.333	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
MTMR9	66036	broad.mit.edu	37	8	11172527	11172527	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:11172527G>A	ENST00000221086.3	+	7	1540	c.1067G>A	c.(1066-1068)aGg>aAg	p.R356K	AF131216.6_ENST00000498997.2_RNA|MTMR9_ENST00000526292.1_Missense_Mutation_p.R271K	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	356	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CCAAGAAGCAGGACCATTCGT	0.483																																					p.R356K		.											.	MTMR9-226	0			c.G1067A						.						181.0	156.0	165.0					8																	11172527		2203	4300	6503	SO:0001583	missense	66036	exon7			GAAGCAGGACCAT	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1067G>A	8.37:g.11172527G>A	ENSP00000221086:p.Arg356Lys	285	0		384	8	NM_015458	0	0	1	1	0	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	ENST00000221086.3	37	CCDS5979.1	.	.	.	.	.	.	.	.	.	.	G	32	5.117106	0.94385	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.98044	-4.68;-4.68	5.05	4.17	0.49024	Myotubularin phosphatase domain (1);	0.039933	0.85682	N	0.000000	D	0.99171	0.9713	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98821	1.0747	10	0.87932	D	0	.	12.776	0.57448	0.0788:0.0:0.9212:0.0	.	356	Q96QG7	MTMR9_HUMAN	K	356;271	ENSP00000221086:R356K;ENSP00000433239:R271K	ENSP00000221086:R356K	R	+	2	0	MTMR9	11209937	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.519000	0.98025	1.347000	0.45714	0.563000	0.77884	AGG	.		0.483	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
INTS9	55756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28654146	28654146	+	Silent	SNP	G	G	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:28654146G>A	ENST00000521022.1	-	9	852	c.771C>T	c.(769-771)aaC>aaT	p.N257N	RP11-662B19.2_ENST00000520055.1_RNA|INTS9_ENST00000416984.2_Silent_p.N236N|INTS9_ENST00000521777.1_Silent_p.N233N|INTS9_ENST00000397363.4_Silent_p.N151N	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	257					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		GAACATCGCTGTTTTTGAGAG	0.438																																					p.N257N		.											.	INTS9-24	0			c.C771T						.						135.0	120.0	125.0					8																	28654146		2203	4300	6503	SO:0001819	synonymous_variant	55756	exon9			ATCGCTGTTTTTG	BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.771C>T	8.37:g.28654146G>A		160	0		167	59	NM_018250	0	0	4	9	5	B7Z560|B7Z6M5|O00224|Q8TB16	Silent	SNP	ENST00000521022.1	37	CCDS34873.1	.	.	.	.	.	.	.	.	.	.	G	7.813	0.716146	0.15306	.	.	ENSG00000104299	ENST00000524081	.	.	.	5.39	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-30.6166	12.3094	0.54920	0.0783:0.0:0.9217:0.0	.	.	.	.	X	220	.	.	Q	-	1	0	INTS9	28710065	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.804000	0.47931	1.272000	0.44329	-0.218000	0.12543	CAG	.		0.438	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1	NM_018250	
ANK1	286	broad.mit.edu	37	8	41575158	41575158	+	Silent	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:41575158G>T	ENST00000347528.4	-	12	1352	c.1269C>A	c.(1267-1269)ctC>ctA	p.L423L	ANK1_ENST00000396945.1_Silent_p.L423L|ANK1_ENST00000396942.1_Silent_p.L423L|ANK1_ENST00000352337.4_Silent_p.L423L|ANK1_ENST00000289734.7_Silent_p.L423L|ANK1_ENST00000379758.2_Silent_p.L423L|ANK1_ENST00000265709.8_Silent_p.L456L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	423	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCCGCTGCAGGAGGTTCTTCA	0.612																																					p.L456L		.											.	ANK1-716	0			c.C1368A						.						24.0	18.0	20.0					8																	41575158		2002	3816	5818	SO:0001819	synonymous_variant	286	exon12			CTGCAGGAGGTTC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1269C>A	8.37:g.41575158G>T		122	0		137	3	NM_001142446	0	0	1	1	0	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	37	CCDS6119.1																																																																																			.		0.612	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
VPS13B	157680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	100821724	100821724	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:100821724T>C	ENST00000358544.2	+	44	8249	c.8138T>C	c.(8137-8139)aTc>aCc	p.I2713T	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.I2688T	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2713					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCTCTCATCATCAAGGTTCAG	0.433																																					p.I2713T	Colon(161;2205 2542 7338 31318)	.											.	VPS13B-301	0			c.T8138C						.						101.0	98.0	99.0					8																	100821724		2203	4300	6503	SO:0001583	missense	157680	exon44			TCATCATCAAGGT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8138T>C	8.37:g.100821724T>C	ENSP00000351346:p.Ile2713Thr	76	0		87	34	NM_017890	0	0	0	0	0	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767032	0.69878	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.76448	-1.02;-1.02	5.33	5.33	0.75918	Vacuolar protein sorting-associated protein (1);	0.059912	0.64402	D	0.000003	D	0.83649	0.5300	L	0.44542	1.39	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71870	0.957;0.975	D	0.85425	0.1145	10	0.72032	D	0.01	.	15.5919	0.76537	0.0:0.0:0.0:1.0	.	2688;2713	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	T	2688;2713	ENSP00000349685:I2688T;ENSP00000351346:I2713T	ENSP00000349685:I2688T	I	+	2	0	VPS13B	100890900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.710000	0.84655	2.148000	0.66965	0.523000	0.50628	ATC	.		0.433	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
GPR20	2843	ucsc.edu	37	8	142367335	142367335	+	Missense_Mutation	SNP	T	T	C	rs10875472	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:142367335T>C	ENST00000377741.3	-	2	779	c.689A>G	c.(688-690)cAc>cGc	p.H230R	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	230			H -> R (in dbSNP:rs10875472). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			GCGACCCTGGTGGAGCAGACC	0.652													C|||	3790	0.756789	0.8578	0.8573	5008	,	,		18953	0.5099		0.8171	False		,,,				2504	0.7413				p.H230R		.											.	GPR20-91	0			c.A689G						.	C	ARG/HIS	3683,565		1604,475,45	11.0	10.0	10.0		689	-0.0	1.0	8	dbSNP_120	10	6733,1623		2718,1297,163	yes	missense	GPR20	NM_005293.2	29	4322,1772,208	CC,CT,TT		19.4232,13.3004,17.3596	benign	230/359	142367335	10416,2188	2124	4178	6302	SO:0001583	missense	2843	exon2			CCCTGGTGGAGCA	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.689A>G	8.37:g.142367335T>C	ENSP00000366970:p.His230Arg	20	0		101	54	NM_005293	0	0	0	0	0	Q17R96	Missense_Mutation	SNP	ENST00000377741.3	37	CCDS34949.1	1661	0.7605311355311355	424	0.8617886178861789	301	0.8314917127071824	308	0.5384615384615384	628	0.8284960422163589	C	0.012	-1.687029	0.00738	0.866996	0.805768	ENSG00000204882	ENST00000377741	T	0.70749	-0.51	4.77	-0.0371	0.13885	GPCR, rhodopsin-like superfamily (1);	0.393637	0.25780	N	0.028347	T	0.00012	0.0000	N	0.10782	0.045	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.35549	-0.9784	9	0.10636	T	0.68	-14.4951	1.3483	0.02168	0.1434:0.3264:0.1427:0.3875	rs10875472	230	Q99678	GPR20_HUMAN	R	230	ENSP00000366970:H230R	ENSP00000366970:H230R	H	-	2	0	GPR20	142436517	0.998000	0.40836	0.989000	0.46669	0.056000	0.15407	0.938000	0.28965	-0.170000	0.10816	-0.355000	0.07637	CAC	T|0.236;C|0.764		0.652	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		14	13	NM_030895	0	0	0	2	2	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
EPPK1	83481	hgsc.bcm.edu	37	8	144940706	144940706	+	Missense_Mutation	SNP	C	C	T	rs112377501	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:144940706C>T	ENST00000525985.1	-	2	6787	c.6716G>A	c.(6715-6717)cGc>cAc	p.R2239H				P58107	EPIPL_HUMAN	epiplakin 1	2239						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R2239H(2)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCTCCTGGCGGCCGGGCTG	0.701																																					p.R2239H		.											.	EPPK1-25	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.G6716A						.						61.0	61.0	61.0					8																	144940706		2173	4243	6416	SO:0001583	missense	83481	exon1			TCCTGGCGGCCGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6716G>A	8.37:g.144940706C>T	ENSP00000436337:p.Arg2239His	21	0		64	4	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	16.79	3.221029	0.58560	.	.	ENSG00000227184	ENST00000525985	T	0.73047	-0.71	4.67	3.7	0.42460	.	.	.	.	.	T	0.50854	0.1640	L	0.38175	1.15	0.25587	N	0.986731	P	0.43938	0.822	B	0.30179	0.112	T	0.49093	-0.8975	9	0.45353	T	0.12	.	5.4805	0.16721	0.0:0.7826:0.0:0.2174	.	2239	E9PPU0	.	H	2239	ENSP00000436337:R2239H	ENSP00000436337:R2239H	R	-	2	0	EPPK1	145012694	.	.	0.959000	0.39883	0.982000	0.71751	.	.	2.420000	0.82092	0.591000	0.81541	CGC	C|0.993;T|0.007		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu	37	8	144998948	144998948	+	Missense_Mutation	SNP	G	G	A	rs192022872	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:144998948G>A	ENST00000322810.4	-	31	5729	c.5560C>T	c.(5560-5562)Cgg>Tgg	p.R1854W	PLEC_ENST00000398774.2_Missense_Mutation_p.R1685W|PLEC_ENST00000436759.2_Missense_Mutation_p.R1744W|PLEC_ENST00000354958.2_Missense_Mutation_p.R1695W|PLEC_ENST00000357649.2_Missense_Mutation_p.R1721W|PLEC_ENST00000527096.1_Missense_Mutation_p.R1740W|PLEC_ENST00000345136.3_Missense_Mutation_p.R1717W|PLEC_ENST00000356346.3_Missense_Mutation_p.R1703W|PLEC_ENST00000354589.3_Missense_Mutation_p.R1717W	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1854	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCCCGCAGCCGGATCAACTCC	0.721													G|||	3	0.000599042	0.0008	0.0	5008	,	,		10096	0.0		0.001	False		,,,				2504	0.001				p.R1854W		.											.	PLEC-141	0			c.C5560T						.																																			SO:0001583	missense	5339	exon31			GCAGCCGGATCAA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5560C>T	8.37:g.144998948G>A	ENSP00000323856:p.Arg1854Trp	0	0		9	7	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	15.04	2.713747	0.48622	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.80214	-1.25;-1.25;-1.35;-1.24;-1.35;-1.21;-1.27;-1.27;-1.32	4.71	3.81	0.43845	.	0.000000	0.56097	U	0.000025	D	0.86569	0.5964	L	0.54323	1.7	0.51012	D	0.999909	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.999;0.999;0.998;0.998;0.998;1.0;0.999	D	0.87255	0.2275	10	0.87932	D	0	.	13.467	0.61260	0.0:0.0:0.8327:0.1673	.	1744;1703;1695;1854;1685;1717;1721;1717	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	W	1717;1721;1717;1685;1854;1695;1703;1744;1740	ENSP00000344848:R1717W;ENSP00000350277:R1721W;ENSP00000346602:R1717W;ENSP00000381756:R1685W;ENSP00000323856:R1854W;ENSP00000347044:R1695W;ENSP00000348702:R1703W;ENSP00000388180:R1744W;ENSP00000434583:R1740W	ENSP00000323856:R1854W	R	-	1	2	PLEC	145070936	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.630000	0.37081	0.928000	0.37168	0.542000	0.68232	CGG	G|0.999;A|0.001		0.721	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000356346.3_Silent_p.A1546A|PLEC_ENST00000354589.3_Silent_p.A1560A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		0	0		15	7	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	3	0		32	16	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		15	15	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
RASEF	158158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	85605354	85605354	+	Missense_Mutation	SNP	C	C	T	rs377721011		TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr9:85605354C>T	ENST00000376447.3	-	16	2329	c.2069G>A	c.(2068-2070)aGt>aAt	p.S690N		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	690					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						ATCTTTGGCACTTGTTTCACA	0.368																																					p.S690N		.											.	RASEF-280	0			c.G2069A						.	C	ASN/SER	0,4406		0,0,2203	136.0	122.0	127.0		2069	3.7	1.0	9		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	RASEF	NM_152573.2	46	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	690/741	85605354	1,13005	2203	4300	6503	SO:0001583	missense	158158	exon16			TTGGCACTTGTTT	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.2069G>A	9.37:g.85605354C>T	ENSP00000365630:p.Ser690Asn	120	0		160	38	NM_152573	0	0	0	0	0	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409363	0.83340	0.0	1.16E-4	ENSG00000165105	ENST00000376447	D	0.88975	-2.45	5.52	3.7	0.42460	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96632	0.8901	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97317	0.9941	10	0.87932	D	0	.	14.2592	0.66073	0.0:0.9156:0.0:0.0844	.	690	Q8IZ41	RASEF_HUMAN	N	690	ENSP00000365630:S690N	ENSP00000365630:S690N	S	-	2	0	RASEF	84795174	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.627000	0.61276	0.722000	0.32252	0.655000	0.94253	AGT	.		0.368	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	88933891	88933894	+	Frame_Shift_Del	DEL	ATTA	ATTA	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	ATTA	ATTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr9:88933891_88933894delATTA	ENST00000375963.3	-	16	3367_3370	c.3195_3198delTAAT	c.(3193-3198)attaatfs	p.IN1065fs	ZCCHC6_ENST00000375957.1_Frame_Shift_Del_p.IN3fs|ZCCHC6_ENST00000375960.2_Intron|ZCCHC6_ENST00000277141.6_Frame_Shift_Del_p.IN354fs|ZCCHC6_ENST00000375961.2_Frame_Shift_Del_p.IN1065fs	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1065					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTTCAAGTCCATTAATTGTCATAC	0.402																																					p.1065_1066del		.											.	ZCCHC6-92	0			c.3195_3198del						.																																			SO:0001589	frameshift_variant	79670	exon16			AAGTCCATTAATT	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3195_3198delTAAT	9.37:g.88933891_88933894delATTA	ENSP00000365130:p.Ile1065fs	138	0		258	76	NM_024617	0	0	0	0	0	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Frame_Shift_Del	DEL	ENST00000375963.3	37	CCDS35057.1																																																																																			.		0.402	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
PRDM12	59335	hgsc.bcm.edu	37	9	133556930	133556930	+	Silent	SNP	C	C	T	rs12004652	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr9:133556930C>T	ENST00000253008.2	+	5	1038	c.978C>T	c.(976-978)ccC>ccT	p.P326P		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	326					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		ACCGGCCGCCCAGCACCGCGC	0.821													C|||	1718	0.343051	0.3442	0.3487	5008	,	,		3938	0.5367		0.159	False		,,,				2504	0.3272				p.P326P		.											.	PRDM12-90	0			c.C978T						.	C		767,2301		98,571,865	2.0	2.0	2.0		978	3.3	1.0	9	dbSNP_120	2	765,5515		67,631,2442	no	coding-synonymous	PRDM12	NM_021619.2		165,1202,3307	TT,TC,CC		12.1815,25.0,16.3885		326/368	133556930	1532,7816	1534	3140	4674	SO:0001819	synonymous_variant	59335	exon5			GCCGCCCAGCACC	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.978C>T	9.37:g.133556930C>T		0	0		11	7	NM_021619	0	0	0	0	0	A3KFK9	Silent	SNP	ENST00000253008.2	37	CCDS6934.1																																																																																			C|0.686;T|0.314		0.821	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
NUP214	8021	bcgsc.ca	37	9	134019849	134019849	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr9:134019849G>T	ENST00000359428.5	+	12	1621	c.1477G>T	c.(1477-1479)Gct>Tct	p.A493S	RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.A493S|NUP214_ENST00000411637.2_Missense_Mutation_p.A493S			P35658	NU214_HUMAN	nucleoporin 214kDa	493	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GAAGTCATCTGCTACGGTCAC	0.547			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.A493S	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.G1477T						.						182.0	184.0	183.0					9																	134019849		2203	4300	6503	SO:0001583	missense	8021	exon12			TCATCTGCTACGG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1477G>T	9.37:g.134019849G>T	ENSP00000352400:p.Ala493Ser	63	0		64	4	NM_005085	0	0	0	0	0	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.270144	0.01421	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899	T;T;T	0.78924	-1.22;-1.22;-1.22	5.69	2.45	0.29901	.	0.574660	0.14527	N	0.314095	T	0.49745	0.1575	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.12156	0.005;0.007	T	0.40887	-0.9539	10	0.02654	T	1	-0.5395	5.0835	0.14668	0.2604:0.1709:0.5687:0.0	.	493;493	P35658-4;P35658	.;NU214_HUMAN	S	493;493;493;493;86	ENSP00000352400:A493S;ENSP00000396576:A493S;ENSP00000405014:A493S	ENSP00000352400:A493S	A	+	1	0	NUP214	133009670	0.308000	0.24509	0.002000	0.10522	0.004000	0.04260	1.815000	0.38981	0.743000	0.32719	-0.136000	0.14681	GCT	.		0.547	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
MAGEB2	4113	broad.mit.edu;bcgsc.ca	37	X	30236700	30236700	+	Start_Codon_SNP	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:30236700G>T	ENST00000378988.4	+	2	104	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	1										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						CAGCCATCATGCCTCGTGGTC	0.532																																					p.M1I		.											.	MAGEB2-131	0			c.G3T						.						39.0	38.0	39.0					X																	30236700		2202	4300	6502	SO:0001582	initiator_codon_variant	4113	exon2			CATCATGCCTCGT	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.3G>T	X.37:g.30236700G>T	ENSP00000368273:p.Met1Ile	342	0		460	16	NM_002364	0	0	0	0	0	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809333	0.70797	.	.	ENSG00000099399	ENST00000378988	T	0.03689	3.84	3.43	3.43	0.39272	.	0.156920	0.52532	D	0.000080	T	0.14787	0.0357	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00194	-1.1933	9	0.87932	D	0	.	9.5037	0.39033	0.0:0.0:1.0:0.0	.	1	O15479	MAGB2_HUMAN	I	1	ENSP00000368273:M1I	ENSP00000368273:M1I	M	+	3	0	MAGEB2	30146621	1.000000	0.71417	0.984000	0.44739	0.318000	0.28184	3.516000	0.53436	1.985000	0.57927	0.513000	0.50165	ATG	.		0.532	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364	Missense_Mutation
FAM47C	442444	broad.mit.edu	37	X	37028069	37028069	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:37028069T>C	ENST00000358047.3	+	1	1638	c.1586T>C	c.(1585-1587)aTt>aCt	p.I529T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	529										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCTCCCAAGATTCTGGTGTCC	0.612																																					p.I529T		.											.	FAM47C-111	0			c.T1586C						.						84.0	83.0	84.0					X																	37028069		2202	4300	6502	SO:0001583	missense	442444	exon1			CCAAGATTCTGGT	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1586T>C	X.37:g.37028069T>C	ENSP00000367913:p.Ile529Thr	94	0		114	4	NM_001013736	0	0	0	0	0	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.715619	0.00005	.	.	ENSG00000198173	ENST00000358047	T	0.09445	2.98	0.957	-1.91	0.07641	.	.	.	.	.	T	0.01627	0.0052	N	0.00159	-1.955	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24083	-1.0170	9	0.08599	T	0.76	.	3.0862	0.06278	0.1957:0.3646:0.0:0.4397	.	529	Q5HY64	FA47C_HUMAN	T	529	ENSP00000367913:I529T	ENSP00000367913:I529T	I	+	2	0	FAM47C	36937990	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.039000	0.13884	-2.664000	0.00417	-2.457000	0.00206	ATT	.		0.612	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
MAGED1	9500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	51640148	51640148	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:51640148G>T	ENST00000375722.1	+	4	1649	c.1397G>T	c.(1396-1398)cGa>cTa	p.R466L	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Missense_Mutation_p.R466L|MAGED1_ENST00000375695.2_Missense_Mutation_p.R522L|MAGED1_ENST00000375772.3_Missense_Mutation_p.R466L			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	466					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GCACAGCCCCGAGATGTGGCC	0.547										Multiple Myeloma(10;0.10)																											p.R522L		.											.	MAGED1-133	0			c.G1565T						.						31.0	23.0	26.0					X																	51640148		2203	4300	6503	SO:0001583	missense	9500	exon5			AGCCCCGAGATGT	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1397G>T	X.37:g.51640148G>T	ENSP00000364874:p.Arg466Leu	124	0		163	74	NM_001005333	0	0	165	165	0	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	37	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.916116	0.33815	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	4.0	3.03	0.35002	.	0.000000	0.28504	N	0.015110	T	0.45637	0.1352	N	0.04805	-0.155	0.32798	N	0.500192	D;D	0.67145	0.996;0.985	P;P	0.62885	0.908;0.691	T	0.54443	-0.8293	10	0.46703	T	0.11	.	3.6236	0.08105	0.1334:0.0:0.6188:0.2477	.	522;466	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	L	466;466;466;522	ENSP00000364927:R466L;ENSP00000364874:R466L;ENSP00000325333:R466L;ENSP00000364847:R522L	ENSP00000325333:R466L	R	+	2	0	MAGED1	51656888	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.818000	0.39012	1.943000	0.56356	0.429000	0.28392	CGA	.		0.547	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
IQSEC2	23096	broad.mit.edu	37	X	53264131	53264133	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:53264131_53264133delTGG	ENST00000375368.5	-	14	3905_3907	c.3705_3707delCCA	c.(3703-3708)caccat>cat	p.1235_1236HH>H	IQSEC2_ENST00000396435.3_In_Frame_Del_p.1245_1246HH>H|IQSEC2_ENST00000375365.2_3'UTR			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1235	His-rich.|Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ATGGCCAtgatggtggtggtggt	0.665																																					p.1245_1246del		.											.	IQSEC2-178	0			c.3735_3737del						.		,	106,2327		14,58,20,1011,247					,	1.7	1.0			37	227,3988		17,90,103,1472,954	no	utr-3,coding	IQSEC2	NM_015075.1,NM_001111125.2	,	31,148,123,2483,1201	A1A1,A1R,A1,RR,R		5.3855,4.3568,5.009	,	,		333,6315				SO:0001651	inframe_deletion	23096	exon15			CCATGATGGTGGT	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3705_3707delCCA	X.37:g.53264140_53264142delTGG	ENSP00000364517:p.His1237del	99	0		127	7	NM_001111125	0	0	0	0	0	B3KT97|C7SDG1|O60275|Q5JUX1	In_Frame_Del	DEL	ENST00000375368.5	37																																																																																				.		0.665	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53576374	53576374	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:53576374A>G	ENST00000342160.3	-	66	10038	c.9581T>C	c.(9580-9582)tTt>tCt	p.F3194S	HUWE1_ENST00000474288.1_5'Flank|HUWE1_ENST00000262854.6_Missense_Mutation_p.F3194S			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3194					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTCATCCACAAAAAGTAGGAC	0.542																																					p.F3194S		.											.	HUWE1-280	0			c.T9581C						.						58.0	59.0	59.0					X																	53576374		2203	4300	6503	SO:0001583	missense	10075	exon67			TCCACAAAAAGTA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9581T>C	X.37:g.53576374A>G	ENSP00000340648:p.Phe3194Ser	178	0		215	113	NM_031407	0	0	0	14	14	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	14.91	2.676129	0.47886	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.47528	0.84;0.84	5.62	5.62	0.85841	.	0.060477	0.64402	D	0.000003	T	0.66886	0.2835	M	0.72353	2.195	0.80722	D	1	D;D	0.57899	0.967;0.981	D;D	0.71184	0.939;0.972	T	0.70498	-0.4855	10	0.72032	D	0.01	.	13.7472	0.62883	1.0:0.0:0.0:0.0	.	3194;3178	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	S	3194	ENSP00000340648:F3194S;ENSP00000262854:F3194S	ENSP00000262854:F3194S	F	-	2	0	HUWE1	53593099	1.000000	0.71417	0.950000	0.38849	0.994000	0.84299	8.249000	0.89833	1.890000	0.54733	0.486000	0.48141	TTT	.		0.542	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
ATRX	546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	76939349	76939349	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:76939349T>A	ENST00000373344.5	-	9	1613	c.1399A>T	c.(1399-1401)Aaa>Taa	p.K467*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.K429*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	467					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCTACCTGTTTTCTTGAAAGT	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.K467X		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX-248	1	Unknown(1)	bone(1)	c.A1399T						.						190.0	189.0	189.0					X																	76939349		2203	4294	6497	SO:0001587	stop_gained	546	exon9			CCTGTTTTCTTGA	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1399A>T	X.37:g.76939349T>A	ENSP00000362441:p.Lys467*	42	0		58	18	NM_000489	0	0	0	0	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	t	37	6.309906	0.97462	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.89	4.89	0.63831	.	0.342561	0.29212	N	0.012806	.	.	.	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7472	5.3664	0.16115	0.0:0.1004:0.1767:0.723	.	.	.	.	X	467;429;423	.	ENSP00000362441:K467X	K	-	1	0	ATRX	76826005	0.976000	0.34144	0.901000	0.35422	0.954000	0.61252	5.467000	0.66737	1.615000	0.50252	0.414000	0.27820	AAA	.		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
ABCD1	215	hgsc.bcm.edu;bcgsc.ca	37	X	153001693	153001695	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	GTC	GTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chrX:153001693_153001695delGTC	ENST00000218104.3	+	3	1608_1610	c.1209_1211delGTC	c.(1207-1212)atgtcg>atg	p.S405del	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	405					alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCGGATCATGTCGTCGTACAAG	0.611																																					p.403_404del		.											.	ABCD1-130	0			c.1209_1211del	GRCh37	CM044848	ABCD1	M		.																																			SO:0001651	inframe_deletion	215	exon3			GATCATGTCGTCG	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1209_1211delGTC	X.37:g.153001696_153001698delGTC	ENSP00000218104:p.Ser405del	259	1		165	144	NM_000033	0	0	0	0	0	Q6GTZ2	In_Frame_Del	DEL	ENST00000218104.3	37	CCDS14728.1																																																																																			.		0.611	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547094	+	In_Frame_Ins	INS	-	-	CAGCAGCAG	rs10902490|rs113304321|rs528214697	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr12:132547093_132547094insCAGCAGCAG	ENST00000333577.4	+	48	8398_8399	c.8289_8290insCAGCAGCAG	c.(8290-8292)cag>CAGCAGCAGcag	p.2764_2764Q>QQQQ	EP400_ENST00000389562.2_In_Frame_Ins_p.2727_2727Q>QQQQ|EP400_ENST00000332482.4_In_Frame_Ins_p.2691_2691Q>QQQQ|EP400_ENST00000389561.2_In_Frame_Ins_p.2728_2728Q>QQQQ|EP400_ENST00000330386.6_In_Frame_Ins_p.2647_2647Q>QQQQ			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagca	0.564																																					p.Q2727delinsQQQQ		.											.	EP400-520	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.8181_8182insCAGCAGCAG						.																																			SO:0001652	inframe_insertion	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8317_8325dupCAGCAGCAG	12.37:g.132547094_132547102dupCAGCAGCAG	ENSP00000333602:p.GlnGlnGln2782dup	161	0		246	0	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Ins	INS	ENST00000333577.4	37																																																																																				.		0.564	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
GDF15	9518	broad.mit.edu	37	19	18499102	18499103	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr19:18499102_18499103insG	ENST00000252809.3	+	2	316_317	c.284_285insG	c.(283-288)ctgggafs	p.LG95fs	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	95					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						ACAGTGCGGCTGGGATCCGGCG	0.663											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L95fs		.											.	GDF15-650	0			c.284_285insG						.																																			SO:0001589	frameshift_variant	9518	exon2			TGCGGCTGGGATC	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.287dupG	19.37:g.18499105_18499105dupG	ENSP00000252809:p.Leu95fs	135	0	726	345	7	NM_004864	0	0	0	0	0	O14629|P78360|Q9BWA0|Q9NRT0	Frame_Shift_Ins	INS	ENST00000252809.3	37	CCDS12376.1																																																																																			.		0.663	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
ABLIM2	84448	hgsc.bcm.edu;bcgsc.ca	37	4	8108224	8108225	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr4:8108224_8108225insA	ENST00000341937.5	-	2	214_215	c.150_151insT	c.(148-153)tgtaaafs	p.K51fs	ABLIM2_ENST00000428004.2_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000361737.5_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000407564.3_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000361581.5_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000447017.2_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000505872.1_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000545242.1_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000296372.8_Frame_Shift_Ins_p.K51fs|ABLIM2_ENST00000546334.1_Frame_Shift_Ins_p.K51fs	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	51	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						CACTCACCTTTACAGACGAAGC	0.644																																					p.K51_A52delinsX		.											.	ABLIM2-47	0			c.151_152insT						.																																			SO:0001589	frameshift_variant	84448	exon2			CACCTTTACAGAC	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.151dupT	4.37:g.8108225_8108225dupA	ENSP00000342813:p.Lys51fs	142	0		112	21	NM_001130083	0	0	0	0	0	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Nonsense_Mutation	INS	ENST00000341937.5	37	CCDS47013.1																																																																																			.		0.644	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ|TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		.											.	TBP-91	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						.																																			SO:0001652	inframe_insertion	6908	exon3			ACAACAACAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	77	0		93	56	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762844	+	Missense_Mutation	DNP	GG	GG	CT	rs2607015|rs2753960|rs67600122	byFrequency	TCGA-OR-A5K0-01A-11D-A29I-10	TCGA-OR-A5K0-10B-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d7593b2a-0d86-44aa-a404-7fd1b10f65d4	6934dbbc-19e6-42c3-9e9f-1db3e7b7981d	g.chr6:31762843_31762844GG>CT	ENST00000375663.3	-	2	591_592	c.151_152CC>AG	c.(151-153)CCc>AGc	p.P51S	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCTA	0.733																																					p.P51S		.											.	VARS-93	0			c.C151A						.																																			SO:0001583	missense	7407	exon2			GAAAGGGAGTCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.151_152delinsCT	6.37:g.31762843_31762844delinsCT	ENSP00000364815:p.Pro51Ser	0	0		10	0	NM_006295	0	0	0	0	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	DNP	ENST00000375663.3	37	CCDS34412.1																																																																																			G|0.721;T|0.279		0.733	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
