#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		11	10	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
CYP4A22	284541	bcgsc.ca	37	1	47609489	47609489	+	Missense_Mutation	SNP	T	T	C	rs10789501	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:47609489T>C	ENST00000371891.3	+	6	722	c.691T>C	c.(691-693)Tgt>Cgt	p.C231R	CYP4A22_ENST00000371890.3_Intron|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000294337.3_Missense_Mutation_p.C231R	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	231			C -> R (allele CYP4A22*2, allele CYP4A22*3, allele CYP4A22*4, allele CYP4A22*5, allele CYP4A22*6, allele CYP4A22*7, allele CYP4A22*8, allele CYP4A22*9, allele CYP4A22*10, allele CYP4A22*11, allele CYP4A22*12, allele CYP4A22*13, allele CYP4A22*14 and allele CYP4A22*15; dbSNP:rs10789501). {ECO:0000269|PubMed:15611369, ECO:0000269|PubMed:16806293}.			endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGTTTTTTGCTGTATGAGGAA	0.552													C|||	2908	0.580671	0.5015	0.464	5008	,	,		20346	0.9335		0.3489	False		,,,				2504	0.6452				p.C231R	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22-139	0			c.T691C						.	C	ARG/CYS	2187,2219		554,1079,570	137.0	125.0	129.0		691	1.9	0.0	1	dbSNP_120	129	2907,5693		483,1941,1876	yes	missense	CYP4A22	NM_001010969.2	180	1037,3020,2446	CC,CT,TT		33.8023,49.6369,39.1665	benign	231/520	47609489	5094,7912	2203	4300	6503	SO:0001583	missense	284541	exon6			TTTTGCTGTATGA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.691T>C	1.37:g.47609489T>C	ENSP00000360958:p.Cys231Arg	194	2		192	7	NM_001010969	0	0	0	0	0	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	1188	0.5439560439560439	243	0.49390243902439024	151	0.4171270718232044	539	0.9423076923076923	255	0.33641160949868076	N	0.003	-2.442517	0.00180	0.496369	0.338023	ENSG00000162365	ENST00000371891;ENST00000294337	T;T	0.65732	-0.17;-0.17	1.94	1.94	0.25998	.	0.000000	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00000	-3.89	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44922	-0.9296	9	0.02654	T	1	.	3.8065	0.08779	0.4389:0.412:0.0:0.1491	rs10789501;rs56846047;rs10789501	231	Q5TCH4	CP4AM_HUMAN	R	231	ENSP00000360958:C231R;ENSP00000294337:C231R	ENSP00000294337:C231R	C	+	1	0	CYP4A22	47382076	0.014000	0.17966	0.002000	0.10522	0.001000	0.01503	0.053000	0.14184	0.188000	0.20168	-1.033000	0.02402	TGT	T|0.527;C|0.473		0.552	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
CLCA4	22802	ucsc.edu	37	1	87045902	87045902	+	Silent	SNP	A	A	T	rs1932809|rs4001061|rs77067122|rs56040873|rs574759485|rs368263974	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:87045902A>T	ENST00000370563.3	+	14	2676	c.2634A>T	c.(2632-2634)acA>acT	p.T878T	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	878			Missing. {ECO:0000269|PubMed:10437792, ECO:0000269|PubMed:15489334}.		chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTGAtcctacacctactccta	0.348														35	0.00698882	0.0234	0.0014	5008	,	,		16699	0.002		0.001	False		,,,				2504	0.0				p.T878T		.											.	CLCA4-92	0			c.A2634T						.	A		815,2361		278,259,1051	73.0	63.0	66.0		2634	-1.3	0.0	1	dbSNP_92	66	2425,4057		1007,411,1823	no	coding-synonymous	CLCA4	NM_012128.3		1285,670,2874	TT,TA,AA		37.4113,25.6612,33.5473		878/920	87045902	3240,6418	1588	3241	4829	SO:0001819	synonymous_variant	22802	exon14			TCCTACACCTACT	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2634A>T	1.37:g.87045902A>T		118	0		64	37	NM_012128	0	0	0	0	0	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																			A|0.332;T|0.668		0.348	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
IGSF3	3321	broad.mit.edu	37	1	117142736	117142736	+	Missense_Mutation	SNP	A	A	G	rs138851517	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:117142736A>G	ENST00000369486.3	-	7	2621	c.1856T>C	c.(1855-1857)aTc>aCc	p.I619T	IGSF3_ENST00000369483.1_Missense_Mutation_p.I639T|IGSF3_ENST00000318837.6_Missense_Mutation_p.I639T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	619	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGCCTTCTCGATGGCAGTTCG	0.627													A|||	10	0.00199681	0.0023	0.0029	5008	,	,		16651	0.001		0.001	False		,,,				2504	0.0031				p.I639T		.											.	IGSF3-92	0			c.T1916C						.																																			SO:0001583	missense	3321	exon8			TTCTCGATGGCAG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1856T>C	1.37:g.117142736A>G	ENSP00000358498:p.Ile619Thr	96	2		85	11	NM_001542	0	0	1	1	0	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096884	0.56075	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.15256	2.44;2.44;2.44	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.132915	0.52532	D	0.000079	T	0.06096	0.0158	N	0.19112	0.55	0.48571	D	0.999675	B;B;B	0.30914	0.162;0.3;0.195	B;B;B	0.33454	0.069;0.164;0.114	T	0.16837	-1.0389	10	0.51188	T	0.08	-37.2914	12.3358	0.55067	1.0:0.0:0.0:0.0	.	639;619;639	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	T	619;639;639	ENSP00000358498:I619T;ENSP00000358495:I639T;ENSP00000321184:I639T	ENSP00000321184:I639T	I	-	2	0	IGSF3	116944259	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.960000	0.76036	2.001000	0.58596	0.374000	0.22700	ATC	A|0.500;G|0.500		0.627	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
LCE1F	353137	hgsc.bcm.edu	37	1	152749003	152749008	+	In_Frame_Del	DEL	TGGCTC	TGGCTC	-	rs544759833|rs200931119	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	TGGCTC	TGGCTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:152749003_152749008delTGGCTC	ENST00000334371.2	+	1	156_161	c.156_161delTGGCTC	c.(154-162)tgtggctcc>tgc	p.GS53del		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	53					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGGCTGCTGTGGCTCCAGCTCTGGG	0.68														25	0.00499201	0.0008	0.0058	5008	,	,		15823	0.002		0.001	False		,,,				2504	0.0174				p.52_54del		.											.	LCE1F-68	0			c.156_161del						.			13,4251		0,13,2119						2.4	0.8			40	164,8090		0,164,3963	no	coding	LCE1F	NM_178354.2		0,177,6082	A1A1,A1R,RR		1.9869,0.3049,1.414				177,12341				SO:0001651	inframe_deletion	353137	exon1			CTGCTGTGGCTCC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.156_161delTGGCTC	1.37:g.152749003_152749008delTGGCTC	ENSP00000334187:p.Gly53_Ser54del	58	0		66	12	NM_178354	0	0	0	0	0		In_Frame_Del	DEL	ENST00000334371.2	37	CCDS1023.1																																																																																			.		0.680	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
HHIPL2	79802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	222721210	222721210	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:222721210C>A	ENST00000343410.6	-	1	235	c.177G>T	c.(175-177)gaG>gaT	p.E59D		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	59					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CAGAGCAAAACTCAAGGTGCA	0.572																																					p.E59D		.											.	HHIPL2-69	0			c.G177T						.						34.0	37.0	36.0					1																	222721210		1913	4125	6038	SO:0001583	missense	79802	exon1			GCAAAACTCAAGG	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.177G>T	1.37:g.222721210C>A	ENSP00000342118:p.Glu59Asp	72	0		53	43	NM_024746	0	0	0	0	0	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	6.873	0.530371	0.13127	.	.	ENSG00000143512	ENST00000343410	T	0.58358	0.34	4.93	-0.324	0.12706	Folate receptor-like (1);	0.240762	0.39407	N	0.001363	T	0.37404	0.1002	L	0.46614	1.455	0.30307	N	0.788878	B	0.06786	0.001	B	0.10450	0.005	T	0.23226	-1.0194	10	0.22109	T	0.4	-21.5326	6.3882	0.21572	0.0:0.5404:0.116:0.3436	.	59	Q6UWX4	HIPL2_HUMAN	D	59	ENSP00000342118:E59D	ENSP00000342118:E59D	E	-	3	2	HHIPL2	220787833	0.101000	0.21875	0.258000	0.24420	0.282000	0.26991	-0.413000	0.07123	-0.384000	0.07845	-0.136000	0.14681	GAG	.		0.572	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
OR14I1	401994	bcgsc.ca	37	1	248845356	248845356	+	Missense_Mutation	SNP	G	G	T	rs41311583	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr1:248845356G>T	ENST00000342623.3	-	1	273	c.250C>A	c.(250-252)Ctg>Atg	p.L84M		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	84			L -> M (in dbSNP:rs41311583).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L84M(1)		NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						CTGCGAGTCAGGGAGTTACGG	0.478													T|||	659	0.131589	0.1649	0.0951	5008	,	,		22143	0.128		0.1113	False		,,,				2504	0.137				p.L84M		.											.	OR14I1-46	1	Substitution - Missense(1)	stomach(1)	c.C250A						.	T	MET/LEU	673,3733		44,585,1574	123.0	105.0	112.0		250	-2.5	0.0	1	dbSNP_127	112	962,7638		55,852,3393	yes	missense	OR14I1	NM_001004734.1	15	99,1437,4967	TT,TG,GG		11.186,15.2746,12.5711	possibly-damaging	84/312	248845356	1635,11371	2203	4300	6503	SO:0001583	missense	401994	exon1			GAGTCAGGGAGTT		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.250C>A	1.37:g.248845356G>T	ENSP00000339726:p.Leu84Met	382	3		349	12	NM_001004734	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342623.3	37	CCDS31125.1	285	0.1304945054945055	86	0.17479674796747968	38	0.10497237569060773	73	0.12762237762237763	88	0.11609498680738786	.	12.84	2.059125	0.36373	0.152746	0.11186	ENSG00000189181	ENST00000342623	T	0.01422	4.91	3.48	-2.55	0.06288	GPCR, rhodopsin-like superfamily (1);	0.205916	0.23414	N	0.048434	T	0.00012	0.0000	M	0.78049	2.395	0.80722	P	0.0	P	0.47545	0.897	P	0.51324	0.666	T	0.25187	-1.0139	9	0.66056	D	0.02	.	6.1146	0.20120	0.1323:0.0:0.3002:0.5675	rs41311583;rs61834347	84	A6ND48	O14I1_HUMAN	M	84	ENSP00000339726:L84M	ENSP00000339726:L84M	L	-	1	2	OR14I1	246911979	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-6.278000	0.00072	-0.723000	0.04915	-1.751000	0.00678	CTG	G|0.876;T|0.124		0.478	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734	
ADARB2	105	hgsc.bcm.edu	37	10	1405402	1405402	+	Missense_Mutation	SNP	C	C	T	rs191180422	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr10:1405402C>T	ENST00000381312.1	-	3	1223	c.898G>A	c.(898-900)Gag>Aag	p.E300K	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	300	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCGCGCCGCTCGGCCGGTTCT	0.761													C|||	8	0.00159744	0.0	0.0043	5008	,	,		6987	0.0		0.001	False		,,,				2504	0.0041				p.E300K		.											.	ADARB2-153	0			c.G898A						.	C	LYS/GLU	2,3830		0,2,1914	4.0	4.0	4.0		898	3.3	0.0	10		4	29,7701		0,29,3836	no	missense	ADARB2	NM_018702.3	56	0,31,5750	TT,TC,CC		0.3752,0.0522,0.2681	benign	300/740	1405402	31,11531	1916	3865	5781	SO:0001583	missense	105	exon3			GCCGCTCGGCCGG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.898G>A	10.37:g.1405402C>T	ENSP00000370713:p.Glu300Lys	0	0		17	10	NM_018702	0	0	0	0	0	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	37	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990794	0.35131	5.22E-4	0.003752	ENSG00000185736	ENST00000381312	T	0.75821	-0.97	5.24	3.34	0.38264	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.204711	0.50627	N	0.000111	T	0.72700	0.3493	L	0.43646	1.37	0.80722	D	1	P	0.38711	0.643	P	0.45119	0.47	T	0.69450	-0.5142	10	0.36615	T	0.2	-25.1429	15.4893	0.75593	0.0:0.7376:0.2624:0.0	.	300	Q9NS39	RED2_HUMAN	K	300	ENSP00000370713:E300K	ENSP00000370713:E300K	E	-	1	0	ADARB2	1395402	1.000000	0.71417	0.005000	0.12908	0.002000	0.02628	2.572000	0.45999	0.561000	0.29186	-0.304000	0.09214	GAG	.		0.761	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	1	0		16	7	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	0	0		20	8	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
CDHR5	53841	broad.mit.edu	37	11	617527	617527	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr11:617527A>C	ENST00000358353.3	-	16	2684	c.2362T>G	c.(2362-2364)Tac>Gac	p.Y788D	IRF7_ENST00000397566.1_5'Flank|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397574.2_5'Flank|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000525445.1_5'Flank|IRF7_ENST00000397562.3_5'Flank|IRF7_ENST00000348655.6_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.Y788D|CDHR5_ENST00000349570.7_Missense_Mutation_p.Y594D			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	788					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						ACAGCCTTGTACCCGCCCTCC	0.716																																					p.Y788D		.											.	CDHR5-90	0			c.T2362G						.						34.0	33.0	33.0					11																	617527		2202	4297	6499	SO:0001583	missense	53841	exon15			CCTTGTACCCGCC	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.2362T>G	11.37:g.617527A>C	ENSP00000351118:p.Tyr788Asp	35	4		128	29	NM_021924	0	0	0	0	0	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782955	0.31502	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000349570	T;T;T	0.80653	-1.32;-1.32;-1.4	3.95	3.95	0.45737	.	.	.	.	.	D	0.85691	0.5755	L	0.53249	1.67	0.32994	D	0.52529	D;P;P	0.89917	1.0;0.573;0.573	D;B;B	0.87578	0.998;0.258;0.258	D	0.87789	0.2617	9	0.87932	D	0	-25.1372	9.4901	0.38953	1.0:0.0:0.0:0.0	.	782;594;788	Q9HBB8-4;Q9HBB8-2;Q9HBB8	.;.;CDHR5_HUMAN	D	788;788;594	ENSP00000380676:Y788D;ENSP00000351118:Y788D;ENSP00000345726:Y594D	ENSP00000345726:Y594D	Y	-	1	0	CDHR5	607527	1.000000	0.71417	0.987000	0.45799	0.174000	0.22865	2.384000	0.44362	1.568000	0.49683	0.418000	0.28097	TAC	.		0.716	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
MUC2	4583	broad.mit.edu	37	11	1092947	1092947	+	Missense_Mutation	SNP	C	C	T	rs111219026		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr11:1092947C>T	ENST00000441003.2	+	30	4793	c.4766C>T	c.(4765-4767)aCc>aTc	p.T1589I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1590I|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1589N(2)|p.T1590N(2)|p.T1590I(2)|p.T1589I(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.627																																					p.T1589I		.											.	MUC2-90	8	Substitution - Missense(8)	endometrium(8)	c.C4766T						.						58.0	93.0	81.0					11																	1092947		1850	3386	5236	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4766C>T	11.37:g.1092947C>T	ENSP00000415183:p.Thr1589Ile	86	1		100	4	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	5.954	0.360009	0.11296	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14266	2.52;2.82	1.75	1.75	0.24633	.	1.843980	0.03632	U	0.238018	T	0.09024	0.0223	.	.	.	0.09310	N	1	P	0.41978	0.767	B	0.31101	0.124	T	0.33085	-0.9882	9	0.39692	T	0.17	.	8.7142	0.34401	0.0:1.0:0.0:0.0	.	1589	E7EUV1	.	I	1589;1590	ENSP00000415183:T1589I;ENSP00000351956:T1590I	ENSP00000351956:T1590I	T	+	2	0	MUC2	1082947	0.034000	0.19679	0.006000	0.13384	0.170000	0.22686	1.835000	0.39181	1.016000	0.39470	0.121000	0.15741	ACC	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093344	1093344	+	Silent	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr11:1093344G>T	ENST00000441003.2	+	30	5190	c.5163G>T	c.(5161-5163)ccG>ccT	p.P1721P	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.P1688P|MUC2_ENST00000333592.6_Silent_p.P9P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1688P(1)|p.P1721P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccatct	0.642																																					p.P1721P		.											.	MUC2-90	2	Substitution - coding silent(2)	lung(2)	c.G5163T						.						231.0	269.0	256.0					11																	1093344		1975	3757	5732	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5163G>T	11.37:g.1093344G>T		99	1		73	5	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	189	3		101	49	NM_002458	0	0	0	1	1	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TPCN2	219931	bcgsc.ca	37	11	68851466	68851466	+	Silent	SNP	G	G	T	rs896973	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr11:68851466G>T	ENST00000294309.3	+	19	1844	c.1743G>T	c.(1741-1743)gcG>gcT	p.A581A	TPCN2_ENST00000542467.1_Intron|TPCN2_ENST00000442692.2_3'UTR|MIR3164_ENST00000581178.1_RNA	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	581					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ACATGCGTGCGTTTGGCGGGA	0.667													G|||	1670	0.333466	0.357	0.3285	5008	,	,		17038	0.2867		0.4831	False		,,,				2504	0.1994				p.A581A		.											.	TPCN2-90	0			c.G1743T						.	G		1688,2712	510.6+/-367.6	325,1038,837	194.0	146.0	162.0		1743	-7.5	0.2	11	dbSNP_86	162	4281,4307	574.0+/-390.0	1034,2213,1047	no	coding-synonymous	TPCN2	NM_139075.3		1359,3251,1884	TT,TG,GG		49.8486,38.3636,45.9578		581/753	68851466	5969,7019	2200	4294	6494	SO:0001819	synonymous_variant	219931	exon19			GCGTGCGTTTGGC	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.1743G>T	11.37:g.68851466G>T		239	1		178	8	NM_139075	0	0	1	1	0	Q9NT82	Silent	SNP	ENST00000294309.3	37	CCDS8189.1																																																																																			G|0.583;T|0.417		0.667	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14610191	14610191	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr12:14610191A>C	ENST00000540793.1	+	7	2275	c.2120A>C	c.(2119-2121)gAg>gCg	p.E707A	ATF7IP_ENST00000544627.1_Missense_Mutation_p.E715A|ATF7IP_ENST00000541654.1_Intron|ATF7IP_ENST00000543189.1_Missense_Mutation_p.E706A|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E707A|ATF7IP_ENST00000536444.1_Missense_Mutation_p.E706A			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	707	Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AATGTAAGCGAGAGTGCACCA	0.368																																					p.E707A		.											.	ATF7IP-252	0			c.A2120C						.						123.0	119.0	121.0					12																	14610191		2203	4300	6503	SO:0001583	missense	55729	exon8			TAAGCGAGAGTGC	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2120A>C	12.37:g.14610191A>C	ENSP00000444589:p.Glu707Ala	83	0		115	62	NM_018179	0	0	1	1	0	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547513	0.86022	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.20598	2.06;2.08;2.06;2.06;2.06	5.75	5.75	0.90469	.	0.074605	0.56097	D	0.000023	T	0.40423	0.1116	L	0.59436	1.845	0.48632	D	0.999682	D;D;D;D	0.63046	0.971;0.971;0.992;0.992	P;P;P;P	0.61592	0.783;0.783;0.802;0.891	T	0.06661	-1.0814	10	0.40728	T	0.16	-11.843	16.3534	0.83225	1.0:0.0:0.0:0.0	.	706;707;706;318	G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;MCAF1_HUMAN;.;.	A	707;706;706;715;707	ENSP00000261168:E707A;ENSP00000443179:E706A;ENSP00000445955:E706A;ENSP00000440440:E715A;ENSP00000444589:E707A	ENSP00000261168:E707A	E	+	2	0	ATF7IP	14501458	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	4.413000	0.59795	2.311000	0.77944	0.528000	0.53228	GAG	.		0.368	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
ALDH1L2	160428	hgsc.bcm.edu	37	12	105478202	105478202	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr12:105478202C>T	ENST00000258494.9	-	1	153	c.13G>A	c.(13-15)Ggc>Agc	p.G5S	ALDH1L2_ENST00000424857.2_Missense_Mutation_p.G5S	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	5					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						GCCTGGCTGCCCCGCCGCAGC	0.776																																					p.G5S		.											.	ALDH1L2-91	0			c.G13A						.						1.0	1.0	1.0					12																	105478202		791	1829	2620	SO:0001583	missense	160428	exon1			GGCTGCCCCGCCG	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.13G>A	12.37:g.105478202C>T	ENSP00000258494:p.Gly5Ser	0	0		14	9	NM_001034173	0	0	0	0	0	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	37	CCDS31891.1	.	.	.	.	.	.	.	.	.	.	C	9.771	1.172809	0.21704	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.73681	-0.77;3.36	4.54	1.67	0.24075	.	0.337688	0.27052	N	0.021162	T	0.41811	0.1175	N	0.02011	-0.69	0.09310	N	1	B	0.17038	0.02	B	0.15052	0.012	T	0.30707	-0.9969	10	0.46703	T	0.11	.	3.4786	0.07594	0.2018:0.5882:0.0:0.21	.	5	Q3SY69	AL1L2_HUMAN	S	5	ENSP00000258494:G5S;ENSP00000389608:G5S	ENSP00000258494:G5S	G	-	1	0	ALDH1L2	104002332	0.015000	0.18098	0.045000	0.18777	0.011000	0.07611	0.651000	0.24873	0.626000	0.30322	-0.516000	0.04426	GGC	.		0.776	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
MICU2	221154	hgsc.bcm.edu	37	13	22178258	22178258	+	Silent	SNP	C	C	T	rs9509812	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr13:22178258C>T	ENST00000382374.4	-	1	95	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	10	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGGCCGCCACCCGCGCGCAGC	0.751													C|||	455	0.0908546	0.0113	0.1441	5008	,	,		12694	0.002		0.2545	False		,,,				2504	0.0838				p.R10R		.											.	EFHA1-90	0			c.G30A						.	C		108,3144		5,98,1523	3.0	3.0	3.0		30	-1.6	0.0	13	dbSNP_119	3	1216,5514		95,1026,2244	no	coding-synonymous	EFHA1	NM_152726.2		100,1124,3767	TT,TC,CC		18.0684,3.321,13.2639		10/435	22178258	1324,8658	1626	3365	4991	SO:0001819	synonymous_variant	221154	exon1			CGCCACCCGCGCG	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.30G>A	13.37:g.22178258C>T		0	0		28	27	NM_152726	0	0	0	2	2	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			C|0.873;T|0.127		0.751	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000592950.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	0	0		6	6	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
DLEU7	220107	hgsc.bcm.edu	37	13	51417535	51417535	+	Missense_Mutation	SNP	G	G	A	rs898861	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr13:51417535G>A	ENST00000504404.1	-	1	297	c.248C>T	c.(247-249)gCg>gTg	p.A83V	DLEU7_ENST00000400393.3_Missense_Mutation_p.A83V|DLEU7-AS1_ENST00000413510.2_RNA			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	83			A -> V (in dbSNP:rs898861). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.										Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		TGGGGAGTTCGCCCGCGCCGC	0.811													G|||	885	0.176717	0.0968	0.1888	5008	,	,		8444	0.2917		0.1988	False		,,,				2504	0.135				p.A83V		.											.	.	0			c.C248T						.	G	VAL/ALA	212,2568		7,198,1185	2.0	3.0	3.0		248	1.8	0.0	13	dbSNP_86	3	970,5336		43,884,2226	yes	missense	DLEU7	NM_198989.2	64	50,1082,3411	AA,AG,GG		15.3822,7.6259,13.009	possibly-damaging	83/161	51417535	1182,7904	1390	3153	4543	SO:0001583	missense	220107	exon1			GAGTTCGCCCGCG	AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.248C>T	13.37:g.51417535G>A	ENSP00000427177:p.Ala83Val	0	0		10	9	NM_198989	0	0	0	0	0	Q2M2E4|Q6ZT82	Missense_Mutation	SNP	ENST00000504404.1	37		458	0.2097069597069597	57	0.11585365853658537	67	0.1850828729281768	188	0.32867132867132864	146	0.19261213720316622	G	11.22	1.574237	0.28092	0.076259	0.153822	ENSG00000186047	ENST00000400393;ENST00000504404;ENST00000335465	T;T	0.49139	0.79;0.82	2.72	1.81	0.25067	.	0.342483	0.19746	U	0.107012	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B;B	0.28026	0.198;0.198	B;B	0.25506	0.061;0.061	T	0.32587	-0.9901	9	0.07175	T	0.84	.	5.0335	0.14423	0.0:0.2383:0.5179:0.2437	rs898861;rs12869977	83;83	Q6UYE1;Q6UYE1-2	LEU7_HUMAN;.	V	83;83;36	ENSP00000420976:A83V;ENSP00000427177:A83V	ENSP00000439677:A36V	A	-	2	0	DLEU7	50315536	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.065000	0.14466	0.650000	0.30769	0.491000	0.48974	GCG	G|0.789;A|0.211		0.811	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989	
GALC	2581	bcgsc.ca	37	14	88450770	88450770	+	Missense_Mutation	SNP	G	G	A	rs1805078	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr14:88450770G>A	ENST00000261304.2	-	5	656	c.550C>T	c.(550-552)Cgt>Tgt	p.R184C	GALC_ENST00000393568.4_Missense_Mutation_p.R161C|GALC_ENST00000544807.2_Missense_Mutation_p.R128C|GALC_ENST00000554916.1_5'UTR|GALC_ENST00000393569.2_Missense_Mutation_p.R158C	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	184			R -> C (in dbSNP:rs1805078). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:20886637, ECO:0000269|PubMed:7581365}.		carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCATGGTAACGCTTGGCGCCC	0.368													G|||	136	0.0271565	0.0015	0.0346	5008	,	,		16908	0.004		0.0616	False		,,,				2504	0.045				p.R184C		.											.	GALC-90	0			c.C550T	GRCh37	CM950518	GALC	M	rs1805078	.	G	CYS/ARG,CYS/ARG,CYS/ARG	44,3824		1,42,1891	73.0	70.0	71.0		550,481,472	1.9	1.0	14	dbSNP_89	71	463,7797		10,443,3677	yes	missense,missense,missense	GALC	NM_000153.3,NM_001201401.1,NM_001201402.1	180,180,180	11,485,5568	AA,AG,GG		5.6053,1.1375,4.1804	benign,benign,benign	184/686,161/663,158/660	88450770	507,11621	1934	4130	6064	SO:0001583	missense	2581	exon5			GGTAACGCTTGGC	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.550C>T	14.37:g.88450770G>A	ENSP00000261304:p.Arg184Cys	205	2		183	10	NM_000153	0	0	0	0	0	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Missense_Mutation	SNP	ENST00000261304.2	37	CCDS9878.2	59	0.027014652014652016	2	0.0040650406504065045	10	0.027624309392265192	3	0.005244755244755245	44	0.05804749340369393	G	16.59	3.164428	0.57476	0.011375	0.056053	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000393568;ENST00000445021	D;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56	4.85	1.9	0.25705	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.461649	0.24722	N	0.036130	D	0.88518	0.6458	L	0.42245	1.32	0.35315	D	0.784242	P;D;D;D;D	0.61080	0.94;0.966;0.958;0.98;0.989	P;P;P;P;P	0.53185	0.526;0.657;0.646;0.599;0.72	D	0.87372	0.2351	10	0.62326	D	0.03	-1.7267	5.6673	0.17702	0.1486:0.0:0.5922:0.2593	rs1805078;rs52831396;rs1805078	128;161;158;184;184	P54803-5;E7EPA4;P54803-4;G3XAI6;P54803	.;.;.;.;GALC_HUMAN	C	184;128;158;161;184	ENSP00000261304:R184C;ENSP00000437513:R128C;ENSP00000377199:R158C;ENSP00000377198:R161C	ENSP00000261304:R184C	R	-	1	0	GALC	87520523	1.000000	0.71417	0.993000	0.49108	0.732000	0.41865	2.224000	0.42945	0.467000	0.27218	0.313000	0.20887	CGT	G|0.966;A|0.034		0.368	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2		
ITPK1	3705	hgsc.bcm.edu	37	14	93408017	93408017	+	Silent	SNP	C	C	T	rs563090061	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr14:93408017C>T	ENST00000267615.6	-	11	1307	c.1134G>A	c.(1132-1134)gcG>gcA	p.A378A	ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000556603.2_Silent_p.A378A|ITPK1_ENST00000555495.1_Silent_p.A259A			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	378					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CGGTGCCGCCCGCGTCGGCCT	0.736													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		13386	0.001		0.0	False		,,,				2504	0.001				p.A378A		.											.	ITPK1-115	0			c.G1134A						.						3.0	3.0	3.0					14																	93408017		1665	3314	4979	SO:0001819	synonymous_variant	3705	exon11			GCCGCCCGCGTCG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.1134G>A	14.37:g.93408017C>T		0	0		12	12	NM_001142593	0	0	0	0	0	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	37	CCDS9907.1																																																																																			.		0.736	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
SNRPN	6638	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	25207273	25207273	+	De_novo_Start_OutOfFrame	SNP	C	C	A	rs426541	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr15:25207273C>A	ENST00000400100.1	+	0	513				SNURF_ENST00000551312.2_Missense_Mutation_p.H9Q|SNURF_ENST00000577949.1_Missense_Mutation_p.H9Q|SNRPN_ENST00000346403.6_De_novo_Start_OutOfFrame|SNRPN_ENST00000554227.2_De_novo_Start_OutOfFrame|SNRPN_ENST00000400098.1_De_novo_Start_OutOfFrame|SNURF_ENST00000338327.4_Missense_Mutation_p.H9Q|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_De_novo_Start_OutOfFrame|SNURF_ENST00000338094.6_Missense_Mutation_p.H9Q|SNRPN_ENST00000390687.4_De_novo_Start_OutOfFrame|SNRPN_ENST00000577565.1_De_novo_Start_OutOfFrame	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ATCGCTTACACCTGAGACGAA	0.423									Prader-Willi syndrome																												p.H9Q		.											.	SNURF-90	0			c.C27A						.						141.0	120.0	127.0					15																	25207273		2203	4300	6503			8926	exon2	Familial Cancer Database	Prader-Labhart-Willi syndrome	CTTACACCTGAGA	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.-378C>A	15.37:g.25207273C>A		109	0		112	17	NM_005678	0	0	0	0	0	B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	37	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	c	12.54	1.968783	0.34754	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.76	1.87	0.25490	.	.	.	.	.	T	0.30696	0.0773	.	.	.	0.26574	N	0.973501	B	0.21688	0.059	B	0.19391	0.025	T	0.28808	-1.0032	7	0.72032	D	0.01	-13.9473	5.8899	0.18904	0.0:0.7606:0.0:0.2394	.	9	Q9Y675	SNURF_HUMAN	Q	9	.	ENSP00000336543:H9Q	H	+	3	2	SNURF	22758366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.492000	0.22435	0.578000	0.29487	0.655000	0.94253	CAC	C|0.990;T|0.010		0.423	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
CDAN1	146059	bcgsc.ca	37	15	43017426	43017426	+	Silent	SNP	T	T	G	rs16957091	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr15:43017426T>G	ENST00000356231.3	-	27	3497	c.3474A>C	c.(3472-3474)ctA>ctC	p.L1158L		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	1158					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CCAGCTCCCGTAGCAAGAATA	0.577													G|||	2311	0.461462	0.9554	0.1916	5008	,	,		19027	0.254		0.2346	False		,,,				2504	0.4325				p.L1158L		.											.	CDAN1-92	0			c.A3474C						.	G		3640,766	312.5+/-292.6	1518,604,81	69.0	64.0	66.0		3474	3.0	1.0	15	dbSNP_123	66	1955,6643	724.7+/-406.5	240,1475,2584	no	coding-synonymous	CDAN1	NM_138477.2		1758,2079,2665	GG,GT,TT		22.7378,17.3854,43.0252		1158/1228	43017426	5595,7409	2203	4299	6502	SO:0001819	synonymous_variant	146059	exon27			CTCCCGTAGCAAG	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.3474A>C	15.37:g.43017426T>G		165	2		115	7	NM_138477	0	0	9	9	0	Q6NYD0|Q7Z7L5|Q969N3	Silent	SNP	ENST00000356231.3	37	CCDS32209.1																																																																																			T|0.565;G|0.435		0.577	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
UBR1	197131	bcgsc.ca	37	15	43256191	43256191	+	Missense_Mutation	SNP	T	T	C	rs3917223	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr15:43256191T>C	ENST00000290650.4	-	42	4720	c.4642A>G	c.(4642-4644)Aca>Gca	p.T1548A	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1548			T -> A (in dbSNP:rs3917223).		cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AACAAATTTGTAGGTAAAGAT	0.373													T|||	166	0.033147	0.0023	0.0259	5008	,	,		18240	0.001		0.0736	False		,,,				2504	0.0716				p.T1548A		.											.	UBR1-91	0			c.A4642G						.	T	ALA/THR	73,4333	65.3+/-102.7	1,71,2131	76.0	73.0	74.0		4642	4.7	1.0	15	dbSNP_108	74	632,7966	162.2+/-214.9	26,580,3693	yes	missense	UBR1	NM_174916.2	58	27,651,5824	CC,CT,TT		7.3505,1.6568,5.4214	benign	1548/1750	43256191	705,12299	2203	4299	6502	SO:0001583	missense	197131	exon42			AATTTGTAGGTAA		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4642A>G	15.37:g.43256191T>C	ENSP00000290650:p.Thr1548Ala	82	0		74	4	NM_174916	0	0	0	0	0	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	71	0.03250915750915751	0	0.0	11	0.03038674033149171	1	0.0017482517482517483	59	0.07783641160949868	T	14.23	2.472063	0.43942	0.016568	0.073505	ENSG00000159459	ENST00000290650	T	0.48836	0.8	4.65	4.65	0.58169	.	0.113840	0.64402	D	0.000011	T	0.02012	0.0063	L	0.33245	0.995	0.80722	D	1	P	0.40083	0.702	B	0.36092	0.217	T	0.00878	-1.1530	10	0.28530	T	0.3	-28.0639	12.4581	0.55716	0.0:0.0:0.0:1.0	rs3917223;rs17719808;rs52813857;rs61722037;rs17719808	1548	Q8IWV7	UBR1_HUMAN	A	1548	ENSP00000290650:T1548A	ENSP00000290650:T1548A	T	-	1	0	UBR1	41043483	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.860000	0.55995	1.969000	0.57287	0.528000	0.53228	ACA	T|0.630;G|0.013;C|0.038;A|0.319		0.373	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
PKD1	5310	hgsc.bcm.edu	37	16	2156447	2156447	+	Silent	SNP	G	G	A	rs2003782	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:2156447G>A	ENST00000262304.4	-	18	7649	c.7441C>T	c.(7441-7443)Ctg>Ttg	p.L2481L	PKD1_ENST00000423118.1_Silent_p.L2481L|PKD1_ENST00000561991.1_5'Flank	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2481	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACAGCGCCCAGTGGGAAGAGG	0.716													a|||	1082	0.216054	0.5439	0.1715	5008	,	,		15215	0.0		0.159	False		,,,				2504	0.0859				p.L2481L		.											.	PKD1-91	0			c.C7441T						.		,	1033,1813		192,649,582	3.0	4.0	4.0		7441,7441	0.4	0.0	16	dbSNP_92	4	861,5451		64,733,2359	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	256,1382,2941	AA,AG,GG		13.6407,36.2966,20.6814	,	2481/4303,2481/4304	2156447	1894,7264	1423	3156	4579	SO:0001819	synonymous_variant	5310	exon18			CGCCCAGTGGGAA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7441C>T	16.37:g.2156447G>A		0	0		41	23	NM_000296	0	0	7	7	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.793;A|0.207		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
SETD1A	9739	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	30976945	30976945	+	Silent	SNP	C	C	T	rs146323096	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:30976945C>T	ENST00000262519.8	+	8	2429	c.1743C>T	c.(1741-1743)gaC>gaT	p.D581D		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	581	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D581D(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CTTCTGGAGACGACATGGAGA	0.667													C|||	2	0.000399361	0.0	0.0	5008	,	,		11093	0.002		0.0	False		,,,				2504	0.0				p.D581D		.											.	SETD1A-93	1	Substitution - coding silent(1)	ovary(1)	c.C1743T						.	C		2,4386		0,2,2192	23.0	27.0	26.0		1743	2.4	1.0	16	dbSNP_134	26	0,8586		0,0,4293	no	coding-synonymous	SETD1A	NM_014712.1		0,2,6485	TT,TC,CC		0.0,0.0456,0.0154		581/1708	30976945	2,12972	2194	4293	6487	SO:0001819	synonymous_variant	9739	exon8			TGGAGACGACATG	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1743C>T	16.37:g.30976945C>T		71	0		75	38	NM_014712	0	0	0	0	0	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	CCDS32435.1																																																																																			C|1.000;T|0.000		0.667	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
BCAR1	9564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	75269596	75269596	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:75269596C>G	ENST00000162330.5	-	5	1327	c.1201G>C	c.(1201-1203)Gat>Cat	p.D401H	BCAR1_ENST00000542031.2_Missense_Mutation_p.D399H|BCAR1_ENST00000535626.2_Missense_Mutation_p.D253H|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000420641.3_Missense_Mutation_p.D419H|BCAR1_ENST00000393422.2_Missense_Mutation_p.D419H|BCAR1_ENST00000393420.6_Missense_Mutation_p.D419H|BCAR1_ENST00000538440.2_Missense_Mutation_p.D401H|BCAR1_ENST00000418647.3_Missense_Mutation_p.D447H|BCAR1_ENST00000546196.1_Missense_Mutation_p.D372H	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	401	Substrate for kinases. {ECO:0000250}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		ACGCCACCATCAGCCACCTCA	0.692																																					p.D447H		.											.	BCAR1-1145	0			c.G1339C						.						30.0	36.0	34.0					16																	75269596		2197	4300	6497	SO:0001583	missense	9564	exon6			CACCATCAGCCAC	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.1201G>C	16.37:g.75269596C>G	ENSP00000162330:p.Asp401His	81	0		207	96	NM_001170714	0	0	8	11	3	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.691029	0.30052	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.38887	1.22;1.74;1.51;1.33;1.51;1.11;1.32;1.22;3.01	4.44	3.47	0.39725	.	0.690744	0.13504	N	0.383004	T	0.42630	0.1211	N	0.19112	0.55	0.09310	N	1	D;D;D;D;D;P;D;D;D	0.69078	0.99;0.997;0.994;0.994;0.995;0.874;0.994;0.99;0.975	P;P;P;P;P;P;P;P;P	0.62740	0.751;0.874;0.751;0.808;0.906;0.461;0.808;0.647;0.647	T	0.14868	-1.0457	10	0.44086	T	0.13	-7.6946	7.5644	0.27870	0.0:0.7998:0.0:0.2002	.	419;253;447;399;419;419;401;401;191	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	H	401;419;419;401;447;253;419;399;372	ENSP00000162330:D401H;ENSP00000377074:D419H;ENSP00000392708:D419H;ENSP00000443841:D401H;ENSP00000391669:D447H;ENSP00000440370:D253H;ENSP00000377072:D419H;ENSP00000440415:D399H;ENSP00000442161:D372H	ENSP00000162330:D401H	D	-	1	0	BCAR1	73827097	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	1.081000	0.30791	0.992000	0.38840	0.558000	0.71614	GAT	.		0.692	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		12	10	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		14	12	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		14	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
CHRNE	1145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4798460	4798460	+	IGR	SNP	G	G	A	rs370042103		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr17:4798460G>A	ENST00000293780.4	-	0	2455				MINK1_ENST00000355280.6_Missense_Mutation_p.R1003Q|MINK1_ENST00000453408.3_Missense_Mutation_p.R983Q|MINK1_ENST00000347992.7_Missense_Mutation_p.R974Q	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	ACCAACACCCGGGCCCACAGT	0.602																																					p.R1003Q		.											.	MINK1-943	0			c.G3008A						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4004		0,0,2002	564.0	522.0	535.0		2948,2897,3008,2921	5.3	1.0	17		535	1,8363		0,1,4181	no	missense,missense,missense,missense	MINK1	NM_001024937.3,NM_015716.4,NM_153827.4,NM_170663.4	43,43,43,43	0,1,6183	AA,AG,GG		0.012,0.0,0.0081	benign,benign,benign,benign	983/1313,966/1296,1003/1333,974/1304	4798460	1,12367	2002	4182	6184	SO:0001628	intergenic_variant	50488	exon25			ACACCCGGGCCCA	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778		17.37:g.4798460G>A		121	0		98	83	NM_153827	0	0	0	2	2	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085461	0.94100	0.0	1.2E-4	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.76186	-0.99;-1.0;-0.98	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.83552	0.5279	M	0.83384	2.64	0.58432	D	0.999998	B;D;D;D	0.67145	0.433;0.996;0.993;0.996	B;P;P;P	0.54140	0.088;0.743;0.558;0.743	D	0.85988	0.1487	10	0.66056	D	0.02	.	16.4886	0.84191	0.0:0.0:1.0:0.0	.	966;983;1003;974	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	Q	1003;983;974	ENSP00000347427:R1003Q;ENSP00000406487:R983Q;ENSP00000269296:R974Q	ENSP00000269296:R974Q	R	+	2	0	MINK1	4739236	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.757000	0.94681	0.655000	0.94253	CGG	.		0.602	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		9	9	NM_001199417	0	0	0	1	1		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
CRHR1	1394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43907881	43907881	+	Silent	SNP	G	G	A	rs369145044		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr17:43907881G>A	ENST00000398285.3	+	8	741	c.741G>A	c.(739-741)gtG>gtA	p.V247V	CRHR1_ENST00000293493.7_Silent_p.V43V|CRHR1_ENST00000339069.5_Silent_p.V117V|CRHR1_ENST00000314537.5_Silent_p.V218V|CRHR1_ENST00000352855.5_Silent_p.V178V|CRHR1_ENST00000577353.1_Silent_p.V218V	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	247					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CAGCCATCGTGCTCACCTACT	0.617																																					p.V247V	Ovarian(110;57 1568 10207 38216 49865)	.											.	CRHR1-522	0			c.G741A						.	G	,,,	1,4403	2.1+/-5.4	0,1,2201	94.0	97.0	96.0		741,534,654,654	3.2	1.0	17		96	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CRHR1	NM_001145146.1,NM_001145147.1,NM_001145148.1,NM_004382.4	,,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,,	247/445,178/376,218/402,218/416	43907881	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	1394	exon8			CATCGTGCTCACC	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.741G>A	17.37:g.43907881G>A		114	0		89	77	NM_001145146	0	0	0	0	0	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Silent	SNP	ENST00000398285.3	37	CCDS45712.1																																																																																			.		0.617	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
PGS1	9489	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76394346	76394346	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr17:76394346A>G	ENST00000262764.6	+	4	451	c.425A>G	c.(424-426)gAa>gGa	p.E142G	SNORA30_ENST00000363193.1_RNA|PGS1_ENST00000329897.7_Missense_Mutation_p.E7G	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	142					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GACTGCCTGGAAAGTACTCTA	0.453																																					p.E142G	Esophageal Squamous(45;182 1126 10685 43198)	.											.	PGS1-90	0			c.A425G						.						178.0	189.0	185.0					17																	76394346		1886	4107	5993	SO:0001583	missense	9489	exon4			GCCTGGAAAGTAC		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.425A>G	17.37:g.76394346A>G	ENSP00000262764:p.Glu142Gly	54	0		31	25	NM_024419	0	0	0	0	0	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	37	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.840660	0.51057	.	.	ENSG00000087157	ENST00000262764;ENST00000329897;ENST00000335081	T	0.23552	1.9	5.56	5.56	0.83823	.	0.051473	0.85682	D	0.000000	T	0.36054	0.0953	L	0.56199	1.76	0.50813	D	0.999893	P	0.49185	0.92	P	0.50860	0.652	T	0.05920	-1.0856	10	0.44086	T	0.13	-16.5523	14.2909	0.66278	1.0:0.0:0.0:0.0	.	142	Q32NB8	PGPS1_HUMAN	G	142;7;7	ENSP00000262764:E142G	ENSP00000262764:E142G	E	+	2	0	PGS1	73905941	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	6.191000	0.72063	2.103000	0.63969	0.533000	0.62120	GAA	.		0.453	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
OSBPL1A	114876	bcgsc.ca	37	18	21752366	21752366	+	Silent	SNP	A	A	G	rs2077984	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr18:21752366A>G	ENST00000319481.3	-	22	2381	c.2175T>C	c.(2173-2175)taT>taC	p.Y725Y	OSBPL1A_ENST00000399443.3_Silent_p.Y212Y|RNA5SP452_ENST00000363004.1_RNA|OSBPL1A_ENST00000357041.4_Silent_p.Y343Y	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	725					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CCACATTGCCATACTGTTCGA	0.388													G|||	605	0.120807	0.3222	0.0317	5008	,	,		19396	0.0724		0.0169	False		,,,				2504	0.0685				p.Y725Y		.											.	OSBPL1A-94	0			c.T2175C						.	G	,,	1165,3241	712.6+/-408.1	158,849,1196	204.0	178.0	187.0		1029,636,2175	-8.7	0.5	18	dbSNP_96	187	126,8474	813.9+/-407.0	0,126,4174	no	coding-synonymous,coding-synonymous,coding-synonymous	OSBPL1A	NM_001242508.1,NM_018030.4,NM_080597.3	,,	158,975,5370	GG,GA,AA		1.4651,26.4412,9.9262	,,	343/569,212/438,725/951	21752366	1291,11715	2203	4300	6503	SO:0001819	synonymous_variant	114876	exon22			ATTGCCATACTGT	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.2175T>C	18.37:g.21752366A>G		183	2		111	6	NM_080597	0	0	1	1	0	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	37	CCDS11884.1																																																																																			A|0.894;G|0.106		0.388	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
ARID3A	1820	hgsc.bcm.edu	37	19	929741	929741	+	Silent	SNP	C	C	T	rs34967265	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:929741C>T	ENST00000263620.3	+	2	540	c.213C>T	c.(211-213)ggC>ggT	p.G71G	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	71						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCTGCGGGCCTGGGACACC	0.766													c|||	805	0.160743	0.354	0.1167	5008	,	,		8522	0.0873		0.0586	False		,,,				2504	0.1115				p.G71G	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C213T						.	C		862,2694		85,692,1001	3.0	5.0	4.0		213	2.4	0.4	19	dbSNP_126	4	366,7224		12,342,3441	no	coding-synonymous	ARID3A	NM_005224.2		97,1034,4442	TT,TC,CC		4.8221,24.2407,11.0174		71/594	929741	1228,9918	1778	3795	5573	SO:0001819	synonymous_variant	1820	exon2			TGCGGGCCTGGGA	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.213C>T	19.37:g.929741C>T		0	0		11	7	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			C|0.865;T|0.135		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		13	13	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
TMEM259	91304	hgsc.bcm.edu	37	19	1010396	1010396	+	Missense_Mutation	SNP	G	G	C	rs77868901	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:1010396G>C	ENST00000356663.3	-	11	1937	c.1816C>G	c.(1816-1818)Ccg>Gcg	p.P606A	TMEM259_ENST00000333175.5_3'UTR	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	606						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P606S(1)									ATGGAGGCCGGGCTAGGCCCG	0.726													N|||	155	0.0309505	0.0136	0.0058	5008	,	,		11720	0.0169		0.0457	False		,,,				2504	0.0716				p.P606A		.											.	.	1	Substitution - Missense(1)	skin(1)	c.C1816G						.		ALA/PRO,	48,3754		0,48,1853	3.0	4.0	4.0		1816,	-0.4	0.0	19	dbSNP_131	4	183,7553		2,179,3687	yes	missense,utr-3	C19orf6	NM_001033026.1,NM_033420.3	27,	2,227,5540	CC,CG,GG		2.3656,1.2625,2.0021	benign,	606/621,	1010396	231,11307	1901	3868	5769	SO:0001583	missense	91304	exon11			AGGCCGGGCTAGG	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1816C>G	19.37:g.1010396G>C	ENSP00000349087:p.Pro606Ala	3	0		27	10	NM_001033026	0	0	83	163	80	O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	37	CCDS32862.1	64	0.029304029304029304	12	0.024390243902439025	2	0.0055248618784530384	9	0.015734265734265736	41	0.05408970976253298	G	10.39	1.338342	0.24253	0.012625	0.023656	ENSG00000182087	ENST00000356663	.	.	.	3.36	-0.399	0.12415	.	0.456049	0.19721	N	0.107600	T	0.01940	0.0061	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.14727	-1.0462	9	0.22109	T	0.4	-0.4483	4.0757	0.09902	0.4474:0.1805:0.3721:0.0	.	606	Q4ZIN3	MBRL_HUMAN	A	606	.	ENSP00000349087:P606A	P	-	1	0	C19orf6	961396	0.005000	0.15991	0.021000	0.16686	0.040000	0.13550	-0.036000	0.12185	-0.082000	0.12640	0.500000	0.49745	CCG	G|0.970;C|0.030		0.726	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
REXO1	57455	hgsc.bcm.edu	37	19	1827378	1827415	+	Frame_Shift_Del	DEL	GCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	GCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	-	rs371311794|rs377354747|rs538132404	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	GCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	GCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:1827378_1827415delGCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	ENST00000170168.4	-	2	1467_1504	c.1373_1410delCGAGCCCCACAAGCGGGGACTCCCGACCGGCGGCCGGC	c.(1372-1410)ccgagccccacaagcggggactcccgaccggcggccggcfs	p.PSPTSGDSRPAAG458fs	REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	458						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGGCCTCTGCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCGGCCGCCGCGC	0.714																																					p.458_470del		.											.	REXO1-90	0			c.1373_1410del						.																																			SO:0001589	frameshift_variant	57455	exon2			GCCTCTGCCGGCC	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1373_1410delCGAGCCCCACAAGCGGGGACTCCCGACCGGCGGCCGGC	19.37:g.1827378_1827415delGCCGGCCGCCGGTCGGGAGTCCCCGCTTGTGGGGCTCG	ENSP00000170168:p.Pro458fs	1	0		20	11	NM_020695	0	0	0	0	0	Q9ULT2	Frame_Shift_Del	DEL	ENST00000170168.4	37	CCDS32866.1																																																																																			.		0.714	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9060456	9060456	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:9060456G>T	ENST00000397910.4	-	3	27193	c.26990C>A	c.(26989-26991)aCa>aAa	p.T8997K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8999	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGGGTGGATGTTGACTCCAT	0.498																																					p.T8997K		.											.	MUC16-566	0			c.C26990A						.						157.0	150.0	152.0					19																	9060456		2087	4215	6302	SO:0001583	missense	94025	exon3			GTGGATGTTGACT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26990C>A	19.37:g.9060456G>T	ENSP00000381008:p.Thr8997Lys	135	1		213	80	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	6.968	0.548491	0.13312	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	2.62	-3.32	0.04973	.	.	.	.	.	T	0.01800	0.0057	N	0.12746	0.255	.	.	.	P	0.45827	0.867	P	0.44477	0.451	T	0.37526	-0.9702	8	0.87932	D	0	.	0.7226	0.00943	0.2471:0.182:0.3855:0.1854	.	8997	B5ME49	.	K	8997	ENSP00000381008:T8997K	ENSP00000381008:T8997K	T	-	2	0	MUC16	8921456	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-2.907000	0.00700	-0.495000	0.06659	0.306000	0.20318	ACA	.		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
SLC44A2	57153	hgsc.bcm.edu	37	19	10745635	10745674	+	Splice_Site	DEL	CTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	CTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	-	rs188956220|rs376045718|rs371389060		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	CTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	CTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:10745635_10745674delCTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	ENST00000335757.5	+	12	1331_1356	c.955_980delCTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT	c.(955-981)ctttgccctttgcagtgatcattctga>a	p.LCPLQ*SF*319fs	SLC44A2_ENST00000586078.1_Splice_Site_p.LCPLQ*SF*319fs|SLC44A2_ENST00000407327.4_Splice_Site_p.LCPLQ*SF*317fs			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	319					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)	p.L325L(1)|p.I321F(1)		NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CCGGCTCAGCCTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGTCATTATCATC	0.562																																					p.319_327del		.											.	SLC44A2-91	2	Substitution - Missense(1)|Substitution - coding silent(1)	endometrium(2)	c.956_980del						.																																			SO:0001630	splice_region_variant	57153	exon12			CTCAGCCTTTGCC	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.956-1CTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT>-	19.37:g.10745635_10745674delCTTTGCCCTTTGCAGTGATCATTCTGAGTATCCTTGAAGT		54	0		81	28	NM_020428	0	0	0	0	0	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Frame_Shift_Del	DEL	ENST00000335757.5	37	CCDS12245.1																																																																																			.		0.562	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		Frame_Shift_Del
OR10H3	26532	bcgsc.ca	37	19	15852621	15852621	+	Missense_Mutation	SNP	G	G	A	rs151318110		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:15852621G>A	ENST00000305892.1	+	1	419	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_013938.1	NP_039226.1	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H, member 3	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						ATGAGTCCCCGTGGCTGTGCC	0.517													g|||	1	0.000199681	0.0	0.0	5008	,	,		24449	0.0		0.0	False		,,,				2504	0.001				p.R140H		.											.	OR10H3-68	0			c.G419A						.						181.0	147.0	159.0					19																	15852621		2203	4300	6503	SO:0001583	missense	26532	exon1			GTCCCCGTGGCTG		CCDS12334.1	19p13.1	2012-08-09				ENSG00000171936		"""GPCR / Class A : Olfactory receptors"""	8174	protein-coding gene	gene with protein product							Standard	NM_013938		Approved		uc010xoq.2	O60404		ENST00000305892.1:c.419G>A	19.37:g.15852621G>A	ENSP00000307130:p.Arg140His	168	3		238	114	NM_013938	0	0	0	0	0	Q2HIZ3|Q6IFQ0	Missense_Mutation	SNP	ENST00000305892.1	37	CCDS12334.1	.	.	.	.	.	.	.	.	.	.	.	0.184	-1.059401	0.01950	.	.	ENSG00000171936	ENST00000305892	T	0.42513	0.97	2.35	-0.102	0.13613	GPCR, rhodopsin-like superfamily (1);	1.255120	0.05976	N	0.643223	T	0.36717	0.0977	L	0.54323	1.7	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.34675	-0.9819	10	0.52906	T	0.07	.	5.4555	0.16588	0.4112:0.0:0.5888:0.0	.	140	O60404	O10H3_HUMAN	H	140	ENSP00000307130:R140H	ENSP00000307130:R140H	R	+	2	0	OR10H3	15713621	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.454000	0.01004	-0.038000	0.13624	-3.030000	0.00073	CGT	G|0.999;T|0.001		0.517	OR10H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460918.1		
ANO8	57719	broad.mit.edu	37	19	17438052	17438052	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:17438052C>A	ENST00000159087.4	-	16	2811	c.2653G>T	c.(2653-2655)Gcc>Tcc	p.A885S		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	885					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						ACCTTAAAGGCCTCGCGGCGC	0.602																																					p.A885S		.											.	ANO8-93	0			c.G2653T						.						14.0	12.0	13.0					19																	17438052		1853	3629	5482	SO:0001583	missense	57719	exon16			TAAAGGCCTCGCG	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.2653G>T	19.37:g.17438052C>A	ENSP00000159087:p.Ala885Ser	63	1		80	6	NM_020959	0	0	0	0	0	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743129	0.49151	.	.	ENSG00000074855	ENST00000159087	T	0.66099	-0.19	4.94	3.88	0.44766	.	0.051001	0.85682	D	0.000000	T	0.57344	0.2047	L	0.55990	1.75	0.36655	D	0.877604	P	0.46395	0.877	B	0.40741	0.339	T	0.68194	-0.5473	10	0.56958	D	0.05	.	13.2423	0.60004	0.0:0.8385:0.1615:0.0	.	885	Q9HCE9	ANO8_HUMAN	S	885	ENSP00000159087:A885S	ENSP00000159087:A885S	A	-	1	0	ANO8	17299052	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	5.608000	0.67654	1.187000	0.43000	-0.479000	0.04858	GCC	.		0.602	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
MAU2	23383	hgsc.bcm.edu	37	19	19431690	19431704	+	In_Frame_Del	DEL	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	-	rs553682593|rs375425486|rs550594758	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	GCGGCCCAGGCGGCG	GCGGCCCAGGCGGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:19431690_19431704delGCGGCCCAGGCGGCG	ENST00000392313.6	+	1	201_215	c.22_36delGCGGCCCAGGCGGCG	c.(22-36)gcggcccaggcggcgdel	p.AAQAA13del	SUGP1_ENST00000334782.5_5'Flank|MAU2_ENST00000262815.8_In_Frame_Del_p.AAQAA13del|SUGP1_ENST00000247001.5_5'Flank|SUGP1_ENST00000585763.1_5'Flank	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	13	Ala-rich.|Sufficient for interaction with NIPBL.				maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						ggcggcggcagcggcccaggcggcggcggcccagg	0.735																																					p.8_12del		.											.	MAU2-91	0			c.22_36del						.			89,1901		39,11,945						-8.2	0.6			3	148,4936		53,42,2447	no	coding	MAU2	NM_015329.3		92,53,3392	A1A1,A1R,RR		2.9111,4.4724,3.3503				237,6837				SO:0001651	inframe_deletion	23383	exon1			GCGGCAGCGGCCC	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.22_36delGCGGCCCAGGCGGCG	19.37:g.19431690_19431704delGCGGCCCAGGCGGCG	ENSP00000376127:p.Ala13_Ala17del	3	0		64	48	NM_015329	0	0	0	0	0	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	In_Frame_Del	DEL	ENST00000392313.6	37	CCDS32969.2																																																																																			.		0.735	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	0	0		12	7	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
NUDT19	390916	hgsc.bcm.edu	37	19	33183352	33183352	+	Silent	SNP	G	G	C	rs61732600	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:33183352G>C	ENST00000397061.3	+	1	486	c.486G>C	c.(484-486)ccG>ccC	p.P162P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	162	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					AGCCACCGCCGGGCCTGGCCT	0.751													G|||	1109	0.221446	0.1498	0.245	5008	,	,		11161	0.249		0.3062	False		,,,				2504	0.1861				p.P162P		.											.	NUDT19-22	0			c.G486C						.	G		469,2861		40,389,1236	4.0	5.0	5.0		486	-9.6	0.0	19	dbSNP_129	5	1887,5465		292,1303,2081	no	coding-synonymous	NUDT19	NM_001105570.1		332,1692,3317	CC,CG,GG		25.6665,14.0841,22.0558		162/376	33183352	2356,8326	1665	3676	5341	SO:0001819	synonymous_variant	390916	exon1			ACCGCCGGGCCTG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.486G>C	19.37:g.33183352G>C		0	0		22	8	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			G|0.743;C|0.257		0.751	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		28	10	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
DLL3	10683	hgsc.bcm.edu	37	19	39989862	39989862	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:39989862A>T	ENST00000205143.4	+	2	107	c.100A>T	c.(100-102)Atc>Ttc	p.I34F	DLL3_ENST00000356433.5_Missense_Mutation_p.I34F|DLL3_ENST00000600579.1_3'UTR	NM_016941.3	NP_058637.1	Q9NYJ7	DLL3_HUMAN	delta-like 3 (Drosophila)	34					compartment pattern specification (GO:0007386)|negative regulation of neurogenesis (GO:0050768)|Notch signaling pathway (GO:0007219)|paraxial mesoderm development (GO:0048339)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)	integral component of membrane (GO:0016021)	Notch binding (GO:0005112)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)	19	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGAGCTGCAGATCCACTCTTT	0.731																																					p.I34F		.											.	DLL3-1083	0			c.A100T						.						5.0	6.0	6.0					19																	39989862		2091	4107	6198	SO:0001583	missense	10683	exon2			CTGCAGATCCACT	AF241373	CCDS12537.1, CCDS12538.1	19q13.2	2008-05-14	2001-12-03			ENSG00000090932			2909	protein-coding gene	gene with protein product		602768	"""delta (Drosophila)-like 3"""			10364530, 10742114	Standard	NM_203486		Approved	SCDO1	uc002olx.2	Q9NYJ7		ENST00000205143.4:c.100A>T	19.37:g.39989862A>T	ENSP00000205143:p.Ile34Phe	5	0		29	17	NM_016941	0	0	0	0	0	E9PFG2|Q8NBS4	Missense_Mutation	SNP	ENST00000205143.4	37	CCDS12538.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.290523	0.59976	.	.	ENSG00000090932	ENST00000356433;ENST00000205143	D;D	0.98150	-4.75;-4.75	4.17	2.04	0.26737	Notch ligand, N-terminal (1);	0.182059	0.26727	N	0.022807	D	0.97807	0.9280	M	0.72894	2.215	0.47009	D	0.999284	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.75020	0.985;0.977;0.967	D	0.96627	0.9464	9	.	.	.	.	7.8006	0.29172	0.8284:0.0:0.1716:0.0	.	34;34;34	Q8NBS4;Q9NYJ7;E9PFG2	.;DLL3_HUMAN;.	F	34	ENSP00000348810:I34F;ENSP00000205143:I34F	.	I	+	1	0	DLL3	44681702	1.000000	0.71417	0.996000	0.52242	0.281000	0.26958	2.434000	0.44802	1.523000	0.49018	0.459000	0.35465	ATC	.		0.731	DLL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464958.1		
CEACAM6	4680	bcgsc.ca	37	19	42260742	42260742	+	Missense_Mutation	SNP	C	C	T	rs141329594	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:42260742C>T	ENST00000199764.6	+	2	517	c.299C>T	c.(298-300)aCa>aTa	p.T100I	AC011513.4_ENST00000601409.1_RNA|CEA_ENST00000598976.1_Intron	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	100	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		GGTCGAGAGACAATATACCCC	0.453																																					p.T100I		.											.	CEACAM6-91	0			c.C299T						.	C	ILE/THR	4,4402	4.2+/-10.8	0,4,2199	314.0	297.0	303.0		299	-0.5	0.7	19	dbSNP_134	303	5,8595	2.2+/-6.3	0,5,4295	no	missense	CEACAM6	NM_002483.4	89	0,9,6494	TT,TC,CC		0.0581,0.0908,0.0692	benign	100/345	42260742	9,12997	2203	4300	6503	SO:0001583	missense	4680	exon2			GAGAGACAATATA	M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.299C>T	19.37:g.42260742C>T	ENSP00000199764:p.Thr100Ile	298	7		402	26	NM_002483	0	0	0	0	0	Q13774|Q14920|Q53XP7	Missense_Mutation	SNP	ENST00000199764.6	37	CCDS12585.1	.	.	.	.	.	.	.	.	.	.	C	7.727	0.698352	0.15106	9.08E-4	5.81E-4	ENSG00000086548	ENST00000199764	T	0.68479	-0.33	2.55	-0.464	0.12160	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48429	0.1499	L	0.31752	0.955	0.09310	N	1	B	0.14805	0.011	B	0.16722	0.016	T	0.38001	-0.9681	9	0.46703	T	0.11	.	3.8844	0.09091	0.2271:0.612:0.0:0.1609	.	100	P40199	CEAM6_HUMAN	I	100	ENSP00000199764:T100I	ENSP00000199764:T100I	T	+	2	0	CEACAM6	46952582	0.002000	0.14202	0.736000	0.30914	0.051000	0.14879	-0.871000	0.04223	0.158000	0.19367	0.305000	0.20034	ACA	C|0.996;T|0.004		0.453	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
ZNF233	353355	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44777858	44777858	+	Missense_Mutation	SNP	C	C	T	rs143381681		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:44777858C>T	ENST00000391958.2	+	5	1172	c.1045C>T	c.(1045-1047)Cgg>Tgg	p.R349W	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Missense_Mutation_p.R331W|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				GGTATATGCCCGGAGCTCCAA	0.527																																					p.R349W		.											.	ZNF233-92	0			c.C1045T						.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	100.0	95.0	96.0		1045,1045	-2.9	0.0	19	dbSNP_134	96	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	ZNF233	NM_001207005.1,NM_181756.2	101,101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	349/671,349/671	44777858	2,13004	2203	4300	6503	SO:0001583	missense	353355	exon5			TATGCCCGGAGCT	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1045C>T	19.37:g.44777858C>T	ENSP00000375820:p.Arg349Trp	91	1		138	71	NM_001207005	0	0	0	0	0	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.549595	0.45383	0.0	2.33E-4	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.16196	2.36;2.36	4.29	-2.88	0.05682	.	.	.	.	.	T	0.12561	0.0305	M	0.76002	2.32	0.09310	N	1	P	0.46578	0.88	B	0.32805	0.153	T	0.18650	-1.0330	9	0.87932	D	0	0.0227	1.5499	0.02572	0.4551:0.2456:0.1825:0.1168	.	349	A6NK53	ZN233_HUMAN	W	331;349;270	ENSP00000334957:R331W;ENSP00000375820:R349W	ENSP00000280305:R270W	R	+	1	2	ZNF233	49469698	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.004000	0.13106	-0.404000	0.07610	0.609000	0.83330	CGG	C|1.000;T|0.000		0.527	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
APOE	348	hgsc.bcm.edu	37	19	45411941	45411941	+	Missense_Mutation	SNP	T	T	C	rs429358	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:45411941T>C	ENST00000252486.4	+	4	499	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	130	8 X 22 AA approximate tandem repeats.		C -> R (in HLPP3; form E3**, form E4, form E4/3 and some forms E5-type; only form E3** is disease-linked; dbSNP:rs429358). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539, ECO:0000269|PubMed:9360638}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GGAGGACGTGTGCGGCCGCCT	0.736													c|||	754	0.150559	0.2678	0.1037	5008	,	,		8484	0.0863		0.1551	False		,,,				2504	0.0869				p.C130R		.											.	APOE-90	0			c.T388C	GRCh37	CM900020	APOE	M	rs429358	.	C	ARG/CYS	808,3460		86,636,1412	12.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	388	3.0	0.4	19	dbSNP_80	12	961,7261		66,829,3216	no	missense	APOE	NM_000041.2	180	152,1465,4628	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	11.6882,18.9316,14.1633	benign	130/318	45411941	1769,10721	2134	4111	6245	SO:0001583	missense	348	exon4			GACGTGTGCGGCC	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.388T>C	19.37:g.45411941T>C	ENSP00000252486:p.Cys130Arg	2	0		74	30	NM_000041	0	0	109	313	204	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	326	0.14926739926739926	128	0.2601626016260163	40	0.11049723756906077	50	0.08741258741258741	108	0.1424802110817942	C	0.007	-1.965077	0.00461	0.189316	0.116882	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.81078	-0.24;-1.45;-1.45	5.25	3.02	0.34903	Apolipoprotein/apolipophorin (1);	0.486559	0.18187	N	0.148941	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	0.02654	T	1	-8.1152	3.0382	0.06129	0.1694:0.5443:0.1863:0.1001	rs429358;rs630496;rs61228756	130	P02649	APOE_HUMAN	R	130;130;175;130	ENSP00000252486:C130R;ENSP00000413135:C130R;ENSP00000410423:C130R	ENSP00000252486:C130R	C	+	1	0	APOE	50103781	0.019000	0.18553	0.404000	0.26397	0.109000	0.19521	0.121000	0.15667	1.239000	0.43787	-0.215000	0.12644	TGC	T|0.861;C|0.139		0.736	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
APOE	348	hgsc.bcm.edu	37	19	45412079	45412079	+	Missense_Mutation	SNP	C	C	T	rs7412	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:45412079C>T	ENST00000252486.4	+	4	637	c.526C>T	c.(526-528)Cgc>Tgc	p.R176C		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	176	8 X 22 AA approximate tandem repeats.		R -> C (in HLPP3; forms E1 Weisgraber, form E2 and form E3**; dbSNP:rs7412). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CCTGCAGAAGCGCCTGGCAGT	0.746													c|||	376	0.0750799	0.1029	0.0476	5008	,	,		8311	0.1002		0.0626	False		,,,				2504	0.044				p.R176C		.											.	APOE-90	0			c.C526T	GRCh37	CM860003	APOE	M	rs7412	.	C	CYS/ARG	271,2853		8,255,1299	3.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	526	4.1	1.0	19	dbSNP_52	3	356,5976		6,344,2816	yes	missense	APOE	NM_000041.2	180	14,599,4115	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	5.6222,8.6748,6.6307	probably-damaging	176/318	45412079	627,8829	1562	3166	4728	SO:0001583	missense	348	exon4			CAGAAGCGCCTGG	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.526C>T	19.37:g.45412079C>T	ENSP00000252486:p.Arg176Cys	0	0		12	9	NM_000041	0	1	86	149	62	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	162	0.07417582417582418	46	0.09349593495934959	23	0.06353591160220995	43	0.07517482517482517	50	0.06596306068601583	C	15.82	2.945479	0.53079	0.086748	0.056222	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.74947	-0.89;-0.89;-0.89	5.09	4.05	0.47172	Apolipoprotein/apolipophorin (1);	0.000000	0.50627	D	0.000104	T	0.20414	0.0491	M	0.81682	2.555	0.37880	D	0.930361	D	0.89917	1.0	D	0.97110	1.0	T	0.65998	-0.6032	10	0.66056	D	0.02	-7.7588	6.5628	0.22495	0.1808:0.7277:0.0:0.0915	rs7412;rs3200542	176	P02649	APOE_HUMAN	C	176;176;221;176	ENSP00000252486:R176C;ENSP00000413135:R176C;ENSP00000410423:R176C	ENSP00000252486:R176C	R	+	1	0	APOE	50103919	0.986000	0.35501	1.000000	0.80357	0.351000	0.29236	0.344000	0.19962	1.134000	0.42165	0.555000	0.69702	CGC	C|0.933;T|0.067		0.746	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
NR1H2	7376	hgsc.bcm.edu	37	19	50881832	50881866	+	Frame_Shift_Del	DEL	GAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	GAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	-	rs75450723|rs190497316|rs373521285|rs376476625	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	GAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	GAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:50881832_50881866delGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	ENST00000253727.5	+	6	761_795	c.526_560delGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	c.(526-561)gagtcacagtcacagtcgcagtcacctgtggggccgfs	p.ESQSQSQSPVGP176fs	NR1H2_ENST00000598168.1_Frame_Shift_Del_p.ESQSQSQSPVGP176fs|NR1H2_ENST00000411902.2_Frame_Shift_Del_p.ESQSQSQSPVGP79fs|NR1H2_ENST00000593926.1_Frame_Shift_Del_p.ESQSQSQSPVGP176fs|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Frame_Shift_Del_p.ESQSQSQSPVGP176fs	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	176					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		ACAGCAGCAGGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCCGCAGGGCAGC	0.638																																					p.176_187del		.											.	NR1H2-186	0			c.526_560del						.																																			SO:0001589	frameshift_variant	7376	exon6			CAGCAGGAGTCAC	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.526_560delGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	19.37:g.50881832_50881866delGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCC	ENSP00000253727:p.Glu176fs	72	0		104	0	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Frame_Shift_Del	DEL	ENST00000253727.5	37	CCDS42593.1																																																																																			.		0.638	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
NR1H2	7376	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50881858	50881864	+	Frame_Shift_Del	DEL	TGTGGGG	TGTGGGG	-			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	TGTGGGG	TGTGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:50881858_50881864delTGTGGGG	ENST00000253727.5	+	6	787_793	c.552_558delTGTGGGG	c.(550-558)cctgtggggfs	p.PVG184fs	NR1H2_ENST00000598168.1_Frame_Shift_Del_p.PVG184fs|NR1H2_ENST00000411902.2_Frame_Shift_Del_p.PVG87fs|NR1H2_ENST00000593926.1_Frame_Shift_Del_p.PVG184fs|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Frame_Shift_Del_p.PVG184fs	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	184					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CGCAGTCACCTGTGGGGCCGCAGGGCA	0.628																																					p.184_186del		.											.	NR1H2-186	0			c.552_558del						.																																			SO:0001589	frameshift_variant	7376	exon6			GTCACCTGTGGGG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.552_558delTGTGGGG	19.37:g.50881858_50881864delTGTGGGG	ENSP00000253727:p.Pro184fs	59	0		80	0	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Frame_Shift_Del	DEL	ENST00000253727.5	37	CCDS42593.1																																																																																			.		0.628	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		6	6	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
TTC7A	57217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	47184029	47184029	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr2:47184029G>A	ENST00000319190.5	+	3	768	c.400G>A	c.(400-402)Gag>Aag	p.E134K	TTC7A_ENST00000409245.1_Missense_Mutation_p.E100K|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000394850.2_Missense_Mutation_p.E134K|TTC7A_ENST00000263737.6_5'UTR|RP11-15I20.1_ENST00000607950.1_RNA	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	134					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GCATTACGTGGAGGGCTCATA	0.547																																					p.E134K		.											.	TTC7A-136	0			c.G400A						.						176.0	149.0	158.0					2																	47184029		2203	4300	6503	SO:0001583	missense	57217	exon3			TACGTGGAGGGCT	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.400G>A	2.37:g.47184029G>A	ENSP00000316699:p.Glu134Lys	219	0		144	8	NM_020458	0	0	2	3	1	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	ENST00000319190.5	37	CCDS33193.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143415	0.77888	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850	T;T;T	0.32023	1.89;1.89;1.47	5.84	5.84	0.93424	Tetratricopeptide-like helical (1);	0.056848	0.64402	D	0.000001	T	0.32526	0.0832	M	0.65498	2.005	0.80722	D	1	P;P;B	0.48694	0.914;0.578;0.125	B;B;B	0.41510	0.359;0.254;0.096	T	0.28235	-1.0050	10	0.05351	T	0.99	-27.3006	18.8993	0.92435	0.0:0.0:1.0:0.0	.	134;134;100	Q2T9J9;Q9ULT0;G5E9G4	.;TTC7A_HUMAN;.	K	100;134;134	ENSP00000386307:E100K;ENSP00000316699:E134K;ENSP00000378320:E134K	ENSP00000316699:E134K	E	+	1	0	TTC7A	47037533	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.279000	0.72620	2.768000	0.95171	0.561000	0.74099	GAG	.		0.547	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	0	0		8	8	NM_173647	0	0	0	0	0	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
UNC80	285175	broad.mit.edu;bcgsc.ca	37	2	210705348	210705348	+	Silent	SNP	C	C	G	rs10178675	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr2:210705348C>G	ENST00000439458.1	+	20	3419	c.3339C>G	c.(3337-3339)ctC>ctG	p.L1113L	UNC80_ENST00000272845.6_Silent_p.L1108L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1113					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TGGACCGACTCTCTTTCATCA	0.458													C|||	971	0.19389	0.3714	0.1095	5008	,	,		17314	0.0079		0.1223	False		,,,				2504	0.2791				p.L1113L		.											.	UNC80-90	0			c.C3339G						.	C	,	435,949		71,293,328	137.0	116.0	123.0		3339,3324	2.0	1.0	2	dbSNP_119	123	378,2804		23,332,1236	no	coding-synonymous,coding-synonymous	UNC80	NM_032504.1,NM_182587.3	,	94,625,1564	GG,GC,CC		11.8793,31.4306,17.8055	,	1113/3259,1108/3235	210705348	813,3753	692	1591	2283	SO:0001819	synonymous_variant	285175	exon20			CCGACTCTCTTTC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3339C>G	2.37:g.210705348C>G		130	1		102	5	NM_032504	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	37	CCDS46504.1																																																																																			C|0.831;G|0.169		0.458	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
SPAG16	79582	bcgsc.ca	37	2	214794743	214794743	+	Missense_Mutation	SNP	A	A	C	rs12623569	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr2:214794743A>C	ENST00000331683.5	+	12	1369	c.1274A>C	c.(1273-1275)aAa>aCa	p.K425T	SPAG16_ENST00000374309.3_Missense_Mutation_p.K331T	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	425			K -> T (in dbSNP:rs12623569). {ECO:0000269|PubMed:11867345, ECO:0000269|PubMed:12391165}.		cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GATCTATGTAAAGGCGATTGC	0.428													A|||	1386	0.276757	0.2738	0.3112	5008	,	,		17159	0.4067		0.2843	False		,,,				2504	0.1145				p.K425T		.											.	SPAG16-188	0			c.A1274C						.	A	THR/LYS	1197,3209	419.6+/-338.7	147,903,1153	119.0	117.0	118.0		1274	4.3	0.6	2	dbSNP_120	118	2253,6347	382.3+/-340.3	295,1663,2342	yes	missense	SPAG16	NM_024532.3	78	442,2566,3495	CC,CA,AA		26.1977,27.1675,26.5262	benign	425/632	214794743	3450,9556	2203	4300	6503	SO:0001583	missense	79582	exon12			TATGTAAAGGCGA	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1274A>C	2.37:g.214794743A>C	ENSP00000332592:p.Lys425Thr	148	1		133	6	NM_024532	0	0	0	0	0	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	653	0.298992673992674	114	0.23170731707317074	110	0.30386740331491713	220	0.38461538461538464	209	0.2757255936675462	A	9.017	0.983924	0.18889	0.271675	0.261977	ENSG00000144451	ENST00000331683;ENST00000374309	T;T	0.78707	-1.2;-1.2	5.48	4.29	0.51040	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.277074	0.29466	N	0.012065	T	0.00012	0.0000	N	0.02181	-0.65	0.27912	P	0.9385632	B;B;B;B	0.17667	0.008;0.023;0.002;0.008	B;B;B;B	0.19391	0.011;0.025;0.002;0.011	T	0.12708	-1.0537	9	0.02654	T	1	.	11.4259	0.50009	0.8484:0.1516:0.0:0.0	rs12623569;rs52808897;rs59619307;rs12623569	331;276;365;425	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	T	425;331	ENSP00000332592:K425T;ENSP00000363428:K331T	ENSP00000332592:K425T	K	+	2	0	SPAG16	214502988	0.999000	0.42202	0.563000	0.28383	0.260000	0.26232	2.907000	0.48743	0.864000	0.35578	0.533000	0.62120	AAA	A|0.722;C|0.278		0.428	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		0	0		19	7	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
SULF2	55959	broad.mit.edu	37	20	46300955	46300955	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr20:46300955T>G	ENST00000359930.4	-	11	2414	c.1563A>C	c.(1561-1563)aaA>aaC	p.K521N	SULF2_ENST00000361612.4_Missense_Mutation_p.K521N|SULF2_ENST00000484875.1_Missense_Mutation_p.K521N|SULF2_ENST00000467815.1_Missense_Mutation_p.K521N	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	521					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TCTTGAAGAGTTTTTTCCGGC	0.597																																					p.K521N		.											.	SULF2-293	0			c.A1563C						.						70.0	69.0	69.0					20																	46300955		2203	4300	6503	SO:0001583	missense	55959	exon11			GAAGAGTTTTTTC	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1563A>C	20.37:g.46300955T>G	ENSP00000353007:p.Lys521Asn	66	1		103	6	NM_001161841	0	0	0	0	0	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	T	9.641	1.139008	0.21205	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.99060	-5.38;-5.38;-5.38;-5.38	4.75	3.78	0.43462	Alkaline-phosphatase-like, core domain (1);	0.380724	0.28742	N	0.014286	D	0.96806	0.8957	L	0.42245	1.32	0.32627	N	0.522548	B;B	0.21688	0.002;0.059	B;B	0.24006	0.006;0.05	D	0.96430	0.9318	10	0.19147	T	0.46	-15.8358	11.1877	0.48666	0.0:0.8323:0.0:0.1677	.	521;521	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	N	521	ENSP00000353007:K521N;ENSP00000418290:K521N;ENSP00000354662:K521N;ENSP00000418442:K521N	ENSP00000353007:K521N	K	-	3	2	SULF2	45734362	0.202000	0.23423	0.789000	0.31954	0.444000	0.32077	0.535000	0.23114	1.124000	0.41980	-0.244000	0.11960	AAA	.		0.597	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
KCNG1	3755	broad.mit.edu	37	20	49626376	49626376	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr20:49626376C>A	ENST00000371571.4	-	2	785	c.500G>T	c.(499-501)cGc>cTc	p.R167L	KCNG1_ENST00000506387.1_5'Flank|RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000396017.3_Missense_Mutation_p.R167L	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	167					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.R167H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CAGGTAGCGGCGCTTGCAGCA	0.687																																					p.R167L		.											.	KCNG1-515	1	Substitution - Missense(1)	urinary_tract(1)	c.G500T						.						39.0	40.0	40.0					20																	49626376		2203	4295	6498	SO:0001583	missense	3755	exon2			TAGCGGCGCTTGC	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.500G>T	20.37:g.49626376C>A	ENSP00000360626:p.Arg167Leu	43	1		106	12	NM_002237	0	0	0	0	0	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874904	0.91664	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.65	4.7	0.59300	BTB/POZ-like (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.87547	2.89	0.53688	D	0.999975	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.96	T	0.75844	-0.3174	9	.	.	.	.	16.5941	0.84791	0.0:0.8696:0.1304:0.0	.	167;167	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	L	167	ENSP00000360626:R167L;ENSP00000379338:R167L;ENSP00000394075:R167L;ENSP00000394093:R167L	.	R	-	2	0	KCNG1	49059783	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.960000	0.63673	1.362000	0.46000	0.561000	0.74099	CGC	.		0.687	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237	
SEPT5	5413	hgsc.bcm.edu	37	22	19702147	19702147	+	Silent	SNP	G	G	A	rs370608296	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr22:19702147G>A	ENST00000455784.2	+	1	161	c.36G>A	c.(34-36)gcG>gcA	p.A12A	SEPT5_ENST00000406395.1_Silent_p.A12A	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	12					cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GCAAGCTGGCGACCCCAGGTG	0.781													G|||	15	0.00299521	0.0008	0.0115	5008	,	,		5050	0.0		0.006	False		,,,				2504	0.0				p.A12A		.											.	SEPT5-636	0			c.G36A						.	G		7,2113		0,7,1053	3.0	5.0	4.0		36	0.9	1.0	22		4	31,3749		1,29,1860	no	coding-synonymous	SEPT5	NM_002688.5		1,36,2913	AA,AG,GG		0.8201,0.3302,0.6441		12/370	19702147	38,5862	1060	1890	2950	SO:0001819	synonymous_variant	5413	exon1			GCTGGCGACCCCA	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.36G>A	22.37:g.19702147G>A		0	0		14	14	NM_002688	0	0	0	0	0	O15251|Q96MY5	Silent	SNP	ENST00000455784.2	37	CCDS13764.1																																																																																			.		0.781	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
LRRN1	57633	broad.mit.edu;bcgsc.ca	37	3	3887575	3887575	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:3887575A>T	ENST00000319331.3	+	2	2011	c.1250A>T	c.(1249-1251)gAt>gTt	p.D417V	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	417	LRRCT.					integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TTAATCCAGGATTCGAGTGAA	0.498																																					p.D417V		.											.	LRRN1-90	0			c.A1250T						.						100.0	101.0	101.0					3																	3887575		2203	4300	6503	SO:0001583	missense	57633	exon2			TCCAGGATTCGAG	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1250A>T	3.37:g.3887575A>T	ENSP00000314901:p.Asp417Val	125	2		104	86	NM_020873	0	0	0	0	0	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863953	0.51482	.	.	ENSG00000175928	ENST00000319331	T	0.59638	0.25	5.65	5.65	0.86999	Cysteine-rich flanking region, C-terminal (1);	0.256102	0.44483	D	0.000448	T	0.45756	0.1358	L	0.40543	1.245	0.80722	D	1	P	0.36465	0.554	B	0.23716	0.048	T	0.45026	-0.9289	10	0.36615	T	0.2	.	15.8761	0.79162	1.0:0.0:0.0:0.0	.	417	Q6UXK5	LRRN1_HUMAN	V	417	ENSP00000314901:D417V	ENSP00000314901:D417V	D	+	2	0	LRRN1	3862575	1.000000	0.71417	0.974000	0.42286	0.997000	0.91878	5.287000	0.65645	2.153000	0.67306	0.528000	0.53228	GAT	.		0.498	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
UBP1	7342	bcgsc.ca	37	3	33458266	33458266	+	Missense_Mutation	SNP	T	T	C	rs3736563	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:33458266T>C	ENST00000283629.3	-	3	855	c.326A>G	c.(325-327)aAt>aGt	p.N109S	UBP1_ENST00000283628.5_Missense_Mutation_p.N109S|UBP1_ENST00000447368.2_Missense_Mutation_p.N109S|RNU7-110P_ENST00000516891.1_RNA	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	109			N -> S (in dbSNP:rs3736563). {ECO:0000269|PubMed:8114710}.		angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TAATTTTCCATTGATCTCAGG	0.294													C|||	2399	0.479034	0.5333	0.5605	5008	,	,		18916	0.6091		0.3141	False		,,,				2504	0.3834				p.N109S		.											.	UBP1-537	0			c.A326G						.	C	SER/ASN,SER/ASN,SER/ASN	2363,2043	566.7+/-382.0	610,1143,450	104.0	107.0	106.0		326,326,326	4.0	1.0	3	dbSNP_107	106	2423,6175	697.0+/-404.9	332,1759,2208	yes	missense,missense,missense	UBP1	NM_001128160.1,NM_001128161.1,NM_014517.4	46,46,46	942,2902,2658	CC,CT,TT		28.181,46.3686,36.8041	benign,benign,benign	109/505,109/541,109/541	33458266	4786,8218	2203	4299	6502	SO:0001583	missense	7342	exon3			TTTCCATTGATCT	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.326A>G	3.37:g.33458266T>C	ENSP00000283629:p.Asn109Ser	337	5		232	7	NM_001128160	0	0	1	1	0	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	993	0.45467032967032966	253	0.5142276422764228	182	0.5027624309392266	309	0.5402097902097902	249	0.32849604221635886	C	2.681	-0.275386	0.05679	0.536314	0.28181	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628;ENST00000456378	T;T;T;T	0.16324	2.35;2.35;2.35;2.35	5.73	3.95	0.45737	CP2 transcription factor (1);	0.144057	0.64402	N	0.000005	T	0.00012	0.0000	N	0.03608	-0.345	0.44247	P	0.002905999999999964	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.44590	-0.9318	9	0.07325	T	0.83	-11.4831	2.3834	0.04360	0.113:0.4797:0.1756:0.2318	rs3736563;rs57275094;rs3736563	109;109	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	S	109	ENSP00000283629:N109S;ENSP00000395558:N109S;ENSP00000283628:N109S;ENSP00000401614:N109S	ENSP00000283628:N109S	N	-	2	0	UBP1	33433270	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	1.041000	0.30291	0.464000	0.27142	-0.119000	0.15052	AAT	T|0.585;C|0.415		0.294	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	1	0		8	7	NM_018397	0	0	0	0	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
CD200	4345	bcgsc.ca	37	3	112068596	112068596	+	Silent	SNP	T	T	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:112068596T>C	ENST00000315711.8	+	5	789	c.732T>C	c.(730-732)gtT>gtC	p.V244V	CD200_ENST00000473539.1_Silent_p.V269V|CD200_ENST00000383681.3_Silent_p.V170V	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	244					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				TAAGCATTGTTTCCCTGGTAA	0.393																																					p.V269V		.											.	CD200-90	0			c.T807C						.						132.0	118.0	123.0					3																	112068596		2203	4300	6503	SO:0001819	synonymous_variant	4345	exon6			CATTGTTTCCCTG		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.732T>C	3.37:g.112068596T>C		67	0		58	4	NM_001004196	0	0	2	2	0	B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Silent	SNP	ENST00000315711.8	37	CCDS2965.1																																																																																			.		0.393	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354078.1		
GPR156	165829	hgsc.bcm.edu;bcgsc.ca	37	3	119962580	119962580	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:119962580G>T	ENST00000464295.1	-	3	585	c.140C>A	c.(139-141)cCt>cAt	p.P47H	GPR156_ENST00000461057.1_Missense_Mutation_p.P47H|GPR156_ENST00000315843.3_Missense_Mutation_p.P47H			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		CAAGAGGACAGGAGATAATGA	0.423																																					p.P47H		.											.	GPR156-92	0			c.C140A						.						134.0	119.0	124.0					3																	119962580		2203	4300	6503	SO:0001583	missense	165829	exon2			AGGACAGGAGATA	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.140C>A	3.37:g.119962580G>T	ENSP00000417261:p.Pro47His	79	0		47	4	NM_001168271	0	0	0	0	0	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983090	0.74474	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.25749	1.78;1.78;1.79	5.2	5.2	0.72013	.	0.098068	0.42964	D	0.000633	T	0.34948	0.0915	L	0.27053	0.805	0.46631	D	0.999136	D;D	0.76494	0.999;0.999	D;D	0.66716	0.946;0.946	T	0.01935	-1.1244	9	.	.	.	-15.8483	14.1778	0.65555	0.0:0.0:1.0:0.0	.	47;47	E9PFZ4;Q8NFN8	.;GP156_HUMAN	H	47	ENSP00000417261:P47H;ENSP00000324553:P47H;ENSP00000418758:P47H	.	P	-	2	0	GPR156	121445270	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.717000	0.68446	2.719000	0.93026	0.650000	0.86243	CCT	.		0.423	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
MUC4	4585	ucsc.edu;bcgsc.ca	37	3	195517745	195517745	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr3:195517745A>C	ENST00000463781.3	-	2	1165	c.706T>G	c.(706-708)Tct>Gct	p.S236A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S236A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	241					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCTTCTGAGAAACAGTCCCT	0.468																																					p.S236A		.											.	MUC4-90	0			c.T706G						.						254.0	236.0	242.0					3																	195517745		2025	4191	6216	SO:0001583	missense	4585	exon2			TCTGAGAAACAGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.706T>G	3.37:g.195517745A>C	ENSP00000417498:p.Ser236Ala	307	4		286	246	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.448	0.267819	0.10349	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.58506	0.33;0.38	3.17	-6.34	0.01982	.	0.613061	0.12350	U	0.476655	T	0.39436	0.1078	L	0.52905	1.665	0.09310	N	1	B;P	0.38504	0.406;0.634	B;B	0.34138	0.176;0.16	T	0.15983	-1.0418	10	0.30854	T	0.27	.	5.0213	0.14363	0.2253:0.0:0.4729:0.3017	.	236;241	E7ESK3;Q99102	.;MUC4_HUMAN	A	236;236;210	ENSP00000417498:S236A;ENSP00000420243:S236A	ENSP00000376209:S210A	S	-	1	0	MUC4	197002140	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.011000	0.03652	-1.585000	0.01634	0.434000	0.28630	TCT	.		0.468	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MFSD7	84179	hgsc.bcm.edu	37	4	675949	675949	+	Missense_Mutation	SNP	G	G	A	rs183765686	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:675949G>A	ENST00000404286.2	-	10	1496	c.1481C>T	c.(1480-1482)gCg>gTg	p.A494V	MFSD7_ENST00000515118.1_Missense_Mutation_p.A397V|MFSD7_ENST00000503156.1_Nonsense_Mutation_p.R416*|MFSD7_ENST00000322224.4_Missense_Mutation_p.A493V|MFSD7_ENST00000347950.5_Missense_Mutation_p.A375V	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	494					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						GGCCCCCCTCGCCGTGCACTC	0.761													G|||	30	0.00599042	0.0023	0.0086	5008	,	,		8836	0.0		0.0169	False		,,,				2504	0.0041				p.A493V		.											.	MFSD7-90	0			c.C1478T						.	G	VAL/ALA	8,3458		0,8,1725	3.0	4.0	3.0		1478	-3.8	0.0	4		3	112,7148		0,112,3518	no	missense	MFSD7	NM_032219.2	64	0,120,5243	AA,AG,GG		1.5427,0.2308,1.1188	possibly-damaging	493/560	675949	120,10606	1733	3630	5363	SO:0001583	missense	84179	exon10			CCCCTCGCCGTGC	AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.1481C>T	4.37:g.675949G>A	ENSP00000384616:p.Ala494Val	1	0		12	7	NM_032219	0	0	0	0	0	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	ENST00000404286.2	37		20|20	0.009157509157509158|0.009157509157509158	1|1	0.0020325203252032522|0.0020325203252032522	5|5	0.013812154696132596|0.013812154696132596	0|0	0.0|0.0	14|14	0.018469656992084433|0.018469656992084433	G|G	14.57|14.57	2.575772|2.575772	0.45902|0.45902	0.002308|0.002308	0.015427|0.015427	ENSG00000169026|ENSG00000169026	ENST00000347950;ENST00000322224;ENST00000404286;ENST00000515118|ENST00000503156	D;D;D;D|.	0.96136|.	-3.61;-3.06;-3.07;-3.92|.	1.9|1.9	-3.81|-3.81	0.04294|0.04294	.|.	.|.	.|.	.|.	.|.	T|.	0.04092|.	0.0114|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.19583|.	0.037;0.037;0.008;0.013|.	B;B;B;B|.	0.15870|.	0.014;0.014;0.003;0.008|.	T|.	0.25187|.	-1.0139|.	9|.	0.48119|0.02654	T|T	0.1|1	.|.	0.6961|0.6961	0.00899|0.00899	0.1916:0.1374:0.4297:0.2413|0.1916:0.1374:0.4297:0.2413	.|.	397;375;494;493|.	D6R9R0;Q6UXD7-3;Q6UXD7;Q6UXD7-2|.	.;.;MFSD7_HUMAN;.|.	V|X	375;493;494;397|416	ENSP00000307545:A375V;ENSP00000320234:A493V;ENSP00000384616:A494V;ENSP00000423204:A397V|.	ENSP00000320234:A493V|ENSP00000425753:R416X	A|R	-|-	2|1	0|2	MFSD7|MFSD7	665949|665949	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-2.755000|-2.755000	0.00789|0.00789	-1.937000|-1.937000	0.01047|0.01047	-0.523000|-0.523000	0.04350|0.04350	GCG|CGA	G|0.991;A|0.009		0.761	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358585.1	NM_032219	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	5	0		163	10	NM_175918	0	0	5	5	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
FAM53A	152877	hgsc.bcm.edu	37	4	1656850	1656850	+	Missense_Mutation	SNP	G	G	A	rs62287701	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:1656850G>A	ENST00000308132.6	-	4	929	c.737C>T	c.(736-738)aCg>aTg	p.T246M	FAM53A_ENST00000461064.1_Missense_Mutation_p.T246M|FAM53A_ENST00000489363.1_Missense_Mutation_p.T246M|FAM53A_ENST00000472884.2_Missense_Mutation_p.T246M	NM_001174070.1	NP_001167541.1	Q6NSI3	FA53A_HUMAN	family with sequence similarity 53, member A	246						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			CAGCGCAGGCGTGGACGTGGG	0.736													G|||	21	0.00419329	0.0	0.0029	5008	,	,		11110	0.0		0.0189	False		,,,				2504	0.0				p.T246M		.											.	FAM53A-90	0			c.C737T						.	G	MET/THR,MET/THR	9,4343		0,9,2167	9.0	9.0	9.0		737,737	3.8	0.0	4	dbSNP_129	9	105,8301		0,105,4098	no	missense,missense	FAM53A	NM_001013622.3,NM_001174070.1	81,81	0,114,6265	AA,AG,GG		1.2491,0.2068,0.8936	probably-damaging,probably-damaging	246/399,246/399	1656850	114,12644	2176	4203	6379	SO:0001583	missense	152877	exon4			GCAGGCGTGGACG	BC070112	CCDS33939.1, CCDS75091.1	4p16.3	2005-08-09			ENSG00000174137	ENSG00000174137			31860	protein-coding gene	gene with protein product							Standard	NM_001013622		Approved	DNTNP	uc021xkl.1	Q6NSI3	OTTHUMG00000159855	ENST00000308132.6:c.737C>T	4.37:g.1656850G>A	ENSP00000310057:p.Thr246Met	1	0		47	18	NM_001013622	0	0	0	1	1	Q6ZUL5	Missense_Mutation	SNP	ENST00000308132.6	37	CCDS33939.1	18|18	0.008241758241758242|0.008241758241758242	0|0	0.0|0.0	2|2	0.0055248618784530384|0.0055248618784530384	0|0	0.0|0.0	16|16	0.021108179419525065|0.021108179419525065	G|G	14.41|14.41	2.527505|2.527505	0.44969|0.44969	0.002068|0.002068	0.012491|0.012491	ENSG00000174137|ENSG00000174137	ENST00000489029|ENST00000308132;ENST00000489363;ENST00000461064;ENST00000472884	.|T;T;T;T	.|0.56941	.|0.43;0.43;0.43;0.43	4.61|4.61	3.77|3.77	0.43336|0.43336	.|.	.|0.000000	.|0.64402	.|D	.|0.000015	T|T	0.56381|0.56381	0.1981|0.1981	M|M	0.76838|0.76838	2.35|2.35	0.48571|0.48571	D|D	0.999677|0.999677	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.76575	.|0.988;0.988	T|T	0.69698|0.69698	-0.5075|-0.5075	5|10	.|0.87932	.|D	.|0	-27.8013|-27.8013	12.5895|12.5895	0.56436|0.56436	0.081:0.0:0.919:0.0|0.081:0.0:0.919:0.0	rs62287701|rs62287701	.|246;246	.|Q6NSI3;C9JYQ7	.|FA53A_HUMAN;.	C|M	96|246	.|ENSP00000310057:T246M;ENSP00000419044:T246M;ENSP00000418243:T246M;ENSP00000426260:T246M	.|ENSP00000310057:T246M	R|T	-|-	1|2	0|0	FAM53A|FAM53A	1626647|1626647	1.000000|1.000000	0.71417|0.71417	0.034000|0.034000	0.17996|0.17996	0.011000|0.011000	0.07611|0.07611	6.373000|6.373000	0.73128|0.73128	0.947000|0.947000	0.37659|0.37659	-0.251000|-0.251000	0.11542|0.11542	CGC|ACG	G|0.991;A|0.009		0.736	FAM53A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359224.1	NM_001013622	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	5	0		77	7	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228456	4228456	+	Silent	SNP	G	G	T	rs73191872		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:4228456G>T	ENST00000296358.4	-	1	160	c.136C>A	c.(136-138)Cgg>Agg	p.R46R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACAccgccccgccggggggcc	0.736																																					p.R46R		.											.	OTOP1-92	0			c.C136A						.						4.0	4.0	4.0					4																	4228456		1989	3880	5869	SO:0001819	synonymous_variant	133060	exon1			CGCCCCGCCGGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.136C>A	4.37:g.4228456G>T		7	0		80	15	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OTOP1	133060	hgsc.bcm.edu	37	4	4228472	4228472	+	Silent	SNP	T	T	C	rs76810534		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:4228472T>C	ENST00000296358.4	-	1	144	c.120A>G	c.(118-120)gaA>gaG	p.E40E		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	40				E -> K (in Ref. 1; AAI30431/AAI30433). {ECO:0000305}.	biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		gggccggggATTCCGGGGACC	0.756																																					p.E40E		.											.	OTOP1-92	0			c.A120G						.						3.0	4.0	4.0					4																	4228472		1916	3754	5670	SO:0001819	synonymous_variant	133060	exon1			CGGGGATTCCGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.120A>G	4.37:g.4228472T>C		5	0		57	12	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.756	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		0	0		17	6	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
KIAA0922	23240	bcgsc.ca	37	4	154513627	154513627	+	Splice_Site	SNP	A	A	G	rs7669418	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:154513627A>G	ENST00000409663.3	+	18	1862	c.1810A>G	c.(1810-1812)Atc>Gtc	p.I604V	KIAA0922_ENST00000440693.1_Intron|KIAA0922_ENST00000409959.3_Splice_Site_p.I605V	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	604			I -> V (in dbSNP:rs7669418).			integral component of membrane (GO:0016021)		p.I457V(1)		breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCACACCTAGATCAAGTACTT	0.498													G|||	1130	0.225639	0.1483	0.2147	5008	,	,		19400	0.2361		0.3072	False		,,,				2504	0.2434				p.I605V		.											.	KIAA0922-92	1	Substitution - Missense(1)	stomach(1)	c.A1813G						.	G	VAL/ILE,VAL/ILE	794,3612	751.2+/-412.2	66,662,1475	124.0	104.0	111.0		1813,1810	3.5	1.0	4	dbSNP_116	111	2670,5930	684.2+/-403.9	426,1818,2056	yes	missense-near-splice,missense-near-splice	KIAA0922	NM_001131007.1,NM_015196.3	29,29	492,2480,3531	GG,GA,AA		31.0465,18.0209,26.6339	benign,benign	605/1611,604/1610	154513627	3464,9542	2203	4300	6503	SO:0001630	splice_region_variant	23240	exon18			ACCTAGATCAAGT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.1810-1A>G	4.37:g.154513627A>G		62	0		75	7	NM_001131007	0	0	0	0	0	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	563	0.25778388278388276	67	0.13617886178861788	94	0.2596685082872928	157	0.2744755244755245	245	0.3232189973614776	G	0.015	-1.540589	0.00934	0.180209	0.310465	ENSG00000121210	ENST00000409663;ENST00000409959	T;T	0.12039	2.72;2.73	4.41	3.55	0.40652	.	0.000000	0.85682	N	0.000000	T	0.00012	0.0000	N	0.00380	-1.58	0.09310	P	1.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43782	-0.9370	8	.	.	.	-6.4731	10.0083	0.41970	0.0758:0.138:0.7862:0.0	rs7669418;rs17370255;rs57147535;rs7669418	605;604	A2VDJ0-5;A2VDJ0	.;T131L_HUMAN	V	604;605	ENSP00000386574:I604V;ENSP00000386787:I605V	.	I	+	1	0	KIAA0922	154733077	1.000000	0.71417	0.992000	0.48379	0.002000	0.02628	6.044000	0.71012	0.596000	0.29794	-0.834000	0.03071	ATC	A|0.743;G|0.257		0.498	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	Missense_Mutation
NAF1	92345	hgsc.bcm.edu	37	4	164050186	164050186	+	Missense_Mutation	SNP	C	C	T	rs200516616	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr4:164050186C>T	ENST00000274054.2	-	8	1541	c.1348G>A	c.(1348-1350)Ggt>Agt	p.G450S	NAF1_ENST00000422287.2_Intron|NAF1_ENST00000509434.1_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	450	Pro-rich.				pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GTAGCCCAACCCATGTTTACA	0.552													C|||	4	0.000798722	0.0	0.0014	5008	,	,		4832	0.0		0.003	False		,,,				2504	0.0				p.G450S		.											.	NAF1-70	0			c.G1348A						.	C	,SER/GLY	4,4130		0,4,2063	7.0	6.0	6.0		,1348	-0.6	0.4	4		6	49,7983		0,49,3967	yes	intron,missense	NAF1	NM_001128931.1,NM_138386.2	,56	0,53,6030	TT,TC,CC		0.6101,0.0968,0.4356	,benign	,450/495	164050186	53,12113	2067	4016	6083	SO:0001583	missense	92345	exon8			CCCAACCCATGTT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1348G>A	4.37:g.164050186C>T	ENSP00000274054:p.Gly450Ser	7	0		6	4	NM_138386	0	0	0	0	0	D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	C	2.898	-0.228083	0.06022	9.68E-4	0.006101	ENSG00000145414	ENST00000274054	T	0.32272	1.46	4.26	-0.646	0.11472	.	1.456920	0.03892	N	0.278939	T	0.12603	0.0306	N	0.19112	0.55	0.21933	N	0.999467	B	0.26081	0.141	B	0.17722	0.019	T	0.13602	-1.0503	10	0.18710	T	0.47	-1.8427	5.522	0.16938	0.0:0.4943:0.1432:0.3625	.	450	Q96HR8	NAF1_HUMAN	S	450	ENSP00000274054:G450S	ENSP00000274054:G450S	G	-	1	0	NAF1	164269636	0.055000	0.20627	0.425000	0.26659	0.250000	0.25880	0.024000	0.13555	-0.312000	0.08741	-2.411000	0.00221	GGT	.		0.552	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	IRX4_ENST00000505938.1_5'Flank|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000231357.2_Silent_p.G30G|IRX4_ENST00000513692.1_Silent_p.G30G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		4	0		13	8	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
SNX18	112574	hgsc.bcm.edu	37	5	53814052	53814052	+	Silent	SNP	T	T	C	rs2548615	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:53814052T>C	ENST00000326277.3	+	1	460	c.270T>C	c.(268-270)ccT>ccC	p.P90P	SNX18_ENST00000381410.4_Silent_p.P90P|SNX18_ENST00000343017.6_Silent_p.P90P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	90					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGCCCCTGCCTGTCGCGCCCC	0.791													N|||	4953	0.989018	0.9728	0.9942	5008	,	,		9287	1.0		0.9901	False		,,,				2504	0.9949				p.P90P		.											.	SNX18-226	0			c.T270C						.	C	,,	1635,19		808,19,0	1.0	2.0	2.0		270,270,270	-2.1	0.2	5	dbSNP_100	2	4035,67		1984,67,0	no	coding-synonymous,coding-synonymous,coding-synonymous	SNX18	NM_001102575.1,NM_001145427.1,NM_052870.2	,,	2792,86,0	CC,CT,TT		1.6333,1.1487,1.4941	,,	90/625,90/592,90/629	53814052	5670,86	827	2051	2878	SO:0001819	synonymous_variant	112574	exon1			CCTGCCTGTCGCG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.270T>C	5.37:g.53814052T>C		0	0		4	4	NM_052870	0	0	0	0	0	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																			G|0.979;C|0.003		0.791	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79029401	79029401	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:79029401G>C	ENST00000446378.2	+	2	4844	c.4813G>C	c.(4813-4815)Gac>Cac	p.D1605H		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1605					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGCTCAGGGAGACTTCCCATC	0.453																																					p.D1605H		.											.	CMYA5-77	0			c.G4813C						.						118.0	117.0	117.0					5																	79029401		1875	4115	5990	SO:0001583	missense	202333	exon2			CAGGGAGACTTCC	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4813G>C	5.37:g.79029401G>C	ENSP00000394770:p.Asp1605His	51	0		135	42	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785602	0.31593	.	.	ENSG00000164309	ENST00000446378	T	0.03889	3.77	5.1	-0.201	0.13212	.	1.157780	0.06326	N	0.705393	T	0.02970	0.0088	N	0.17082	0.46	0.09310	N	1	B	0.20887	0.049	B	0.17722	0.019	T	0.47156	-0.9139	10	0.30854	T	0.27	.	1.6952	0.02860	0.2792:0.1399:0.4386:0.1423	.	1605	Q8N3K9	CMYA5_HUMAN	H	1605	ENSP00000394770:D1605H	ENSP00000394770:D1605H	D	+	1	0	CMYA5	79065157	0.000000	0.05858	0.001000	0.08648	0.094000	0.18550	-0.153000	0.10144	0.182000	0.20032	0.655000	0.94253	GAC	.		0.453	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000498871.2_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		6	6	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
ATP10B	23120	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160049541	160049541	+	Missense_Mutation	SNP	C	C	A	rs571308932		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:160049541C>A	ENST00000327245.5	-	14	2518	c.1672G>T	c.(1672-1674)Gcc>Tcc	p.A558S	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	558					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACCACAGGGCAGCATCTCGA	0.498																																					p.A558S		.											.	ATP10B-72	0			c.G1672T						.						103.0	106.0	105.0					5																	160049541		1970	4158	6128	SO:0001583	missense	23120	exon14			ACAGGGCAGCATC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1672G>T	5.37:g.160049541C>A	ENSP00000313600:p.Ala558Ser	100	1		169	54	NM_025153	0	0	0	0	0	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	8.494	0.862656	0.17178	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.42131	0.98;2.06	5.53	4.61	0.57282	HAD-like domain (1);	0.482862	0.21082	N	0.080473	T	0.35480	0.0933	L	0.33137	0.985	0.33384	D	0.575282	P;B	0.36753	0.568;0.022	B;B	0.41332	0.354;0.033	T	0.45425	-0.9262	9	.	.	.	.	12.3461	0.55122	0.2897:0.7102:0.0:0.0	.	166;558	Q2YDW8;O94823	.;AT10B_HUMAN	S	558;166	ENSP00000313600:A558S;ENSP00000431081:A166S	.	A	-	1	0	ATP10B	159982119	0.068000	0.21057	1.000000	0.80357	0.881000	0.50899	0.158000	0.16422	2.596000	0.87737	0.655000	0.94253	GCC	.		0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		9	9	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
DAXX	1616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33288624	33288624	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:33288624G>A	ENST00000374542.5	-	3	1132	c.928C>T	c.(928-930)Cag>Tag	p.Q310*	DAXX_ENST00000414083.2_Nonsense_Mutation_p.Q235*|DAXX_ENST00000266000.6_Nonsense_Mutation_p.Q310*|DAXX_ENST00000477162.1_Intron|ZBTB22_ENST00000418724.1_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	310	Interaction with histone H3.3.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						GCCATGAGCTGGAGCTGCTGT	0.587			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.Q322X		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	DAXX-731	0			c.C964T						.						93.0	87.0	89.0					6																	33288624		2203	4300	6503	SO:0001587	stop_gained	1616	exon3			TGAGCTGGAGCTG	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.928C>T	6.37:g.33288624G>A	ENSP00000363668:p.Gln310*	121	0		78	63	NM_001141970	0	0	0	0	0	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Nonsense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	G	35	5.547026	0.96488	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.67	4.67	0.58626	.	0.264789	0.39687	N	0.001289	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-20.8506	10.9009	0.47051	0.0:0.19:0.81:0.0	.	.	.	.	X	310;310;235	.	ENSP00000266000:Q310X	Q	-	1	0	DAXX	33396602	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.552000	0.36244	2.437000	0.82529	0.643000	0.83706	CAG	.		0.587	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
SYNGAP1	8831	bcgsc.ca	37	6	33408542	33408542	+	Silent	SNP	G	G	A	rs587780472|rs411136	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:33408542G>A	ENST00000418600.2	+	11	1814	c.1713G>A	c.(1711-1713)tcG>tcA	p.S571S	MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Silent_p.S512S|SYNGAP1_ENST00000293748.5_Silent_p.S571S	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	571	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.S556S(1)|p.S571S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						TGTTTGCTTCGTGGCGGCTGC	0.632													G|||	2192	0.4377	0.2716	0.4035	5008	,	,		17633	0.6319		0.3837	False		,,,				2504	0.5419				p.S571S		.											.	SYNGAP1-48	2	Substitution - coding silent(2)	stomach(2)	c.G1713A						.	G		1228,3176		187,854,1161	23.0	23.0	23.0		1713	-10.5	0.2	6	dbSNP_80	23	3424,5172		694,2036,1568	no	coding-synonymous	SYNGAP1	NM_006772.2		881,2890,2729	AA,AG,GG		39.8325,27.8837,35.7846		571/1344	33408542	4652,8348	2202	4298	6500	SO:0001819	synonymous_variant	8831	exon11			TGCTTCGTGGCGG	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1713G>A	6.37:g.33408542G>A		56	0		46	5	NM_006772	0	0	1	1	0	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	37	CCDS34434.2																																																																																			G|0.608;A|0.392		0.632	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
MMS22L	253714	ucsc.edu;bcgsc.ca	37	6	97627382	97627382	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:97627382G>T	ENST00000275053.4	-	17	2703	c.2438C>A	c.(2437-2439)aCc>aAc	p.T813N	MMS22L_ENST00000369251.2_Missense_Mutation_p.T773N	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	813					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGATCTTACGGTTAAGGCTTG	0.348																																					p.T813N		.											.	MMS22L-92	0			c.C2438A						.						69.0	67.0	67.0					6																	97627382		2203	4300	6503	SO:0001583	missense	253714	exon17			CTTACGGTTAAGG		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2438C>A	6.37:g.97627382G>T	ENSP00000275053:p.Thr813Asn	52	0		46	4	NM_198468	0	0	0	0	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702871	0.48307	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.31247	2.19;1.5	5.73	4.85	0.62838	.	0.135902	0.51477	D	0.000090	T	0.26738	0.0654	L	0.57536	1.79	0.28334	N	0.921636	D;D	0.59767	0.986;0.97	P;P	0.54759	0.76;0.716	T	0.07908	-1.0748	10	0.38643	T	0.18	.	11.0402	0.47827	0.0694:0.1306:0.8001:0.0	.	773;813	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	N	813;773	ENSP00000275053:T813N;ENSP00000358254:T773N	ENSP00000275053:T813N	T	-	2	0	MMS22L	97734103	0.997000	0.39634	0.733000	0.30861	0.532000	0.34746	2.981000	0.49329	1.411000	0.46957	0.644000	0.83932	ACC	.		0.348	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
CDK19	23097	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	110953362	110953362	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:110953362C>G	ENST00000368911.3	-	6	696	c.517G>C	c.(517-519)Gac>Cac	p.D173H	CDK19_ENST00000413605.2_Missense_Mutation_p.D49H|CDK19_ENST00000323817.3_Missense_Mutation_p.D113H	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						AAACCCATGTCAGCtaaaaaa	0.343																																					p.D173H		.											.	CDK19-548	0			c.G517C						.						42.0	42.0	42.0					6																	110953362		2203	4300	6503	SO:0001583	missense	23097	exon6			CCATGTCAGCTAA	AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.517G>C	6.37:g.110953362C>G	ENSP00000357907:p.Asp173His	28	0		14	14	NM_015076	0	0	0	0	0	Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Missense_Mutation	SNP	ENST00000368911.3	37	CCDS5085.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516479	0.85495	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000413605;ENST00000457688	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98012	0.9345	H	0.96805	3.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.99368	1.0919	10	0.87932	D	0	-15.8739	18.944	0.92615	0.0:1.0:0.0:0.0	.	49;173	B4DUB1;Q9BWU1	.;CDK19_HUMAN	H	173;113;112;49;113	ENSP00000357907:D173H;ENSP00000317665:D113H;ENSP00000410604:D49H;ENSP00000415621:D113H	ENSP00000317665:D113H	D	-	1	0	CDK19	111060055	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.474000	0.83562	0.650000	0.86243	GAC	.		0.343	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041804.1	NM_015076	
LAMA4	3910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	112455803	112455803	+	Silent	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:112455803G>T	ENST00000230538.7	-	26	3820	c.3423C>A	c.(3421-3423)atC>atA	p.I1141I	LAMA4_ENST00000424408.2_Silent_p.I1134I|LAMA4_ENST00000522006.1_Silent_p.I1134I|LAMA4_ENST00000389463.4_Silent_p.I1134I	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1141	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGTGGTAAATGATTGAGATCT	0.294																																					p.I1141I		.											.	LAMA4-140	0			c.C3423A						.						88.0	93.0	91.0					6																	112455803		2203	4300	6503	SO:0001819	synonymous_variant	3910	exon26			GTAAATGATTGAG		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3423C>A	6.37:g.112455803G>T		27	0		26	20	NM_001105206	0	0	0	0	0	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	37	CCDS43491.1																																																																																			.		0.294	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
FAM26D	221301	broad.mit.edu	37	6	116875427	116875427	+	Silent	SNP	G	G	A	rs7762318	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:116875427G>A	ENST00000368596.3	+	1	515	c.471G>A	c.(469-471)ctG>ctA	p.L157L	FAM26D_ENST00000405399.1_Silent_p.L14L|FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000368597.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	157					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		AAGAGATCCTGGCTGGGTTTC	0.438													A|||	3218	0.642572	0.4198	0.7349	5008	,	,		21800	0.8978		0.6123	False		,,,				2504	0.6462				p.L14L		.											.	FAM26D-90	0			c.G42A						.																																			SO:0001819	synonymous_variant	221301	exon3			GATCCTGGCTGGG	AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.471G>A	6.37:g.116875427G>A		72	2		63	4	NM_001256887	0	0	0	0	0	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Silent	SNP	ENST00000368596.3	37																																																																																				G|0.360;A|0.640		0.438	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000041958.1	NM_153036	
UTRN	7402	hgsc.bcm.edu;ucsc.edu	37	6	145093104	145093104	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:145093104G>T	ENST00000367545.3	+	58	8557	c.8557G>T	c.(8557-8559)Gct>Tct	p.A2853S	UTRN_ENST00000367526.4_Splice_Site_p.A408S	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2853	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCAATCCCTTGGTAAGTGTTA	0.284																																					p.A2853S		.											.	UTRN-95	0			c.G8557T						.						64.0	69.0	67.0					6																	145093104		2203	4300	6503	SO:0001630	splice_region_variant	7402	exon58			TCCCTTGGTAAGT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8557+1G>T	6.37:g.145093104G>T		13	0		37	4	NM_007124	0	0	0	0	0	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876839	0.72180	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.63417	-0.04;-0.04	5.78	5.78	0.91487	EF-hand domain, type 1 (1);	0.277859	0.25050	N	0.033530	T	0.47838	0.1467	L	0.43701	1.375	0.58432	D	0.999996	B	0.02656	0.0	B	0.20184	0.028	T	0.39078	-0.9631	10	0.45353	T	0.12	.	19.9976	0.97389	0.0:0.0:1.0:0.0	.	2853	P46939	UTRO_HUMAN	S	2853;408	ENSP00000356515:A2853S;ENSP00000356496:A408S	ENSP00000356496:A408S	A	+	1	0	UTRN	145134797	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.159000	0.94728	2.737000	0.93849	0.563000	0.77884	GCT	.		0.284	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		Missense_Mutation
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000596229.1_RNA|LRP11_ENST00000546019.1_Intron|RP11-244K5.8_ENST00000606915.1_RNA	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	0	0		9	9	NM_032832	0	0	0	1	1	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
SP8	221833	hgsc.bcm.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	9	0		51	24	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		21	8	NM_002047	0	0	0	2	2	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
OGDH	4967	broad.mit.edu	37	7	44684936	44684936	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:44684936delT	ENST00000222673.5	+	3	275	c.233delT	c.(232-234)attfs	p.I78fs	OGDH_ENST00000444676.1_Frame_Shift_Del_p.I78fs|OGDH_ENST00000443864.2_Frame_Shift_Del_p.I78fs|OGDH_ENST00000447398.1_Frame_Shift_Del_p.I78fs|OGDH_ENST00000439616.2_Intron|OGDH_ENST00000543843.1_Frame_Shift_Del_p.I18fs|OGDH_ENST00000449767.1_Frame_Shift_Del_p.I78fs	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	78					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R81fs*19(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TCATGGGACATTTTTTTTCGC	0.577																																					p.I78fs		.											.	OGDH-228	1	Deletion - Frameshift(1)	breast(1)	c.233delT						.						127.0	121.0	123.0					7																	44684936		2203	4300	6503	SO:0001589	frameshift_variant	4967	exon3			GGGACATTTTTTT	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.233delT	7.37:g.44684936delT	ENSP00000222673:p.Ile78fs	73	0		102	7	NM_001165036	0	0	0	0	0	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Frame_Shift_Del	DEL	ENST00000222673.5	37	CCDS34627.1																																																																																			.		0.577	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
GTF2I	2969	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	74119504	74119504	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:74119504G>C	ENST00000324896.4	+	7	984	c.595G>C	c.(595-597)Gtg>Ctg	p.V199L	AC083884.8_ENST00000594967.1_RNA|AC083884.8_ENST00000450426.2_RNA|AC083884.8_ENST00000434256.1_RNA|GTF2I_ENST00000346152.4_Missense_Mutation_p.V199L|GTF2I_ENST00000443166.1_Missense_Mutation_p.V199L|GTF2I_ENST00000353920.4_Missense_Mutation_p.V199L|GTF2I_ENST00000416070.1_Missense_Mutation_p.V199L	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	199					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						AGGTGGTCGTGTGATGGTAAC	0.333																																					p.V199L		.											.	GTF2I-90	0			c.G595C						.						103.0	91.0	95.0					7																	74119504		2203	4300	6503	SO:0001583	missense	2969	exon7			GGTCGTGTGATGG	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.595G>C	7.37:g.74119504G>C	ENSP00000322542:p.Val199Leu	28	0		30	6	NM_032999	0	0	0	0	0	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.113059	0.37242	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070;ENST00000443166	T;T;T;T;T	0.42513	1.55;1.55;1.55;1.56;0.97	5.11	5.11	0.69529	.	0.308515	0.27375	N	0.019641	T	0.35828	0.0945	L	0.46157	1.445	0.38138	D	0.938357	B;B;B;B;B;B	0.06786	0.0;0.001;0.001;0.0;0.0;0.0	B;B;B;B;B;B	0.08055	0.0;0.003;0.001;0.001;0.001;0.001	T	0.20940	-1.0260	10	0.11485	T	0.65	-3.7916	16.1158	0.81304	0.0:0.0:1.0:0.0	.	199;199;199;199;199;199	Q499G6;P78347-2;P78347-3;P78347-4;P78347;Q86U51	.;.;.;.;GTF2I_HUMAN;.	L	199;194;199;199;199;199	ENSP00000322542:V199L;ENSP00000322671:V199L;ENSP00000322599:V199L;ENSP00000387651:V199L;ENSP00000404240:V199L	ENSP00000322542:V199L	V	+	1	0	GTF2I	73757440	0.781000	0.28676	0.992000	0.48379	0.920000	0.55202	0.816000	0.27267	2.770000	0.95276	0.655000	0.94253	GTG	.		0.333	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1	NM_032999	
CUX1	1523	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	101821789	101821789	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:101821789T>C	ENST00000292535.7	+	11	907	c.869T>C	c.(868-870)gTt>gCt	p.V290A	CUX1_ENST00000547394.2_Missense_Mutation_p.V285A|CUX1_ENST00000550008.2_Missense_Mutation_p.V290A|CUX1_ENST00000425244.2_Missense_Mutation_p.V255A|CUX1_ENST00000292538.4_Missense_Mutation_p.V301A|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000393824.3_Missense_Mutation_p.V262A|CUX1_ENST00000556210.1_Missense_Mutation_p.V290A|CUX1_ENST00000360264.3_Missense_Mutation_p.V301A|CUX1_ENST00000437600.4_Missense_Mutation_p.V299A|CUX1_ENST00000546411.2_Missense_Mutation_p.V290A|CUX1_ENST00000549414.2_Missense_Mutation_p.V290A	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	290					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AGCCTAGAAGTTGAGTTGGCC	0.622																																					p.V301A		.											.	CUX1-160	0			c.T902C						.						38.0	37.0	37.0					7																	101821789		2203	4300	6503	SO:0001583	missense	1523	exon11			TAGAAGTTGAGTT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.869T>C	7.37:g.101821789T>C	ENSP00000292535:p.Val290Ala	238	1		297	42	NM_001202543	0	0	5	5	0	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	T	8.010	0.757339	0.15846	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;2.71;1.02;1.02;1.02;1.02;1.02;1.02	5.29	4.14	0.48551	.	0.197908	0.43110	N	0.000603	T	0.14787	0.0357	N	0.02539	-0.55	0.45502	D	0.998466	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.06405	0.0;0.0;0.001;0.001;0.002;0.0;0.002	T	0.16188	-1.0411	10	0.02654	T	1	-10.8337	9.1532	0.36976	0.0:0.1467:0.0:0.8533	.	262;290;255;285;299;301;301	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	A	301;285;301;255;299;290;290;290;290;290	ENSP00000292538:V301A;ENSP00000449371:V285A;ENSP00000353401:V301A;ENSP00000409745:V255A;ENSP00000414091:V299A;ENSP00000292535:V290A;ENSP00000446630:V290A;ENSP00000447373:V290A;ENSP00000450125:V290A;ENSP00000451558:V290A	ENSP00000292535:V290A	V	+	2	0	CUX1	101608509	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.844000	0.48246	1.024000	0.39682	0.459000	0.35465	GTT	T|1.000;C|0.000		0.622	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
TMEM168	64418	broad.mit.edu	37	7	112424402	112424402	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:112424402A>G	ENST00000312814.6	-	2	1039	c.479T>C	c.(478-480)cTg>cCg	p.L160P	TMEM168_ENST00000454074.1_Missense_Mutation_p.L160P	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	160						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						AACAAGCTCCAGAAATTCAAC	0.428																																					p.L160P		.											.	TMEM168-91	0			c.T479C						.						68.0	68.0	68.0					7																	112424402		2203	4300	6503	SO:0001583	missense	64418	exon2			AGCTCCAGAAATT		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.479T>C	7.37:g.112424402A>G	ENSP00000323068:p.Leu160Pro	109	0		162	6	NM_022484	0	0	0	0	0	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	ENST00000312814.6	37	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751668	0.69533	.	.	ENSG00000146802	ENST00000312814;ENST00000454074	.	.	.	6.06	6.06	0.98353	.	0.063428	0.64402	D	0.000005	T	0.76307	0.3969	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.77827	-0.2443	9	0.66056	D	0.02	-30.0602	16.6245	0.84952	1.0:0.0:0.0:0.0	.	160	Q9H0V1	TM168_HUMAN	P	160	.	ENSP00000323068:L160P	L	-	2	0	TMEM168	112211638	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.339000	0.96797	2.323000	0.78572	0.528000	0.53228	CTG	.		0.428	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484	
ASIC3	9311	broad.mit.edu	37	7	150746080	150746080	+	Silent	SNP	C	C	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr7:150746080C>A	ENST00000349064.5	+	1	306	c.108C>A	c.(106-108)ggC>ggA	p.G36G	ASIC3_ENST00000297512.8_Silent_p.G36G|ASIC3_ENST00000357922.4_Silent_p.G36G	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	36					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										TCGGGCCAGGCAGCCTGAGCC	0.697																																					p.G36G		.											.	.	0			c.C108A						.						39.0	41.0	40.0					7																	150746080		2202	4298	6500	SO:0001819	synonymous_variant	9311	exon1			GCCAGGCAGCCTG	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.108C>A	7.37:g.150746080C>A		42	1		157	7	NM_020322	0	0	1	1	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																			.		0.697	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	55540356	55540356	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:55540356T>C	ENST00000220676.1	+	4	4062	c.3914T>C	c.(3913-3915)cTt>cCt	p.L1305P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1305					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTCTGTTCACTTACTGATACT	0.433																																					p.L1305P	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1-102	0			c.T3914C						.						154.0	151.0	152.0					8																	55540356		2203	4300	6503	SO:0001583	missense	6101	exon4			GTTCACTTACTGA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3914T>C	8.37:g.55540356T>C	ENSP00000220676:p.Leu1305Pro	118	0		116	17	NM_006269	0	0	0	0	0		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.655493	0.29425	.	.	ENSG00000104237	ENST00000220676	T	0.35421	1.31	5.79	0.203	0.15195	.	0.414645	0.20639	N	0.088425	T	0.21590	0.0520	L	0.32530	0.975	0.19945	N	0.999947	B	0.21905	0.062	B	0.20184	0.028	T	0.16958	-1.0385	10	0.87932	D	0	.	2.9897	0.05979	0.3319:0.1779:0.0:0.4902	.	1305	P56715	RP1_HUMAN	P	1305	ENSP00000220676:L1305P	ENSP00000220676:L1305P	L	+	2	0	RP1	55702909	0.002000	0.14202	0.045000	0.18777	0.424000	0.31475	0.460000	0.21924	0.417000	0.25871	-0.333000	0.08304	CTT	.		0.433	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CYP11B2	1585	broad.mit.edu	37	8	143996654	143996654	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:143996654G>T	ENST00000323110.2	-	3	405	c.403C>A	c.(403-405)Cct>Act	p.P135T		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	135					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CGCCATTCAGGCCCATTCCTA	0.627									Familial Hyperaldosteronism type I																												p.P135T		.											.	CYP11B2-90	0			c.C403A						.						33.0	26.0	28.0					8																	143996654		2203	4300	6503	SO:0001583	missense	1585	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	ATTCAGGCCCATT	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.403C>A	8.37:g.143996654G>T	ENSP00000325822:p.Pro135Thr	113	1		78	7	NM_000498	0	0	0	0	0	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	14.79	2.640405	0.47153	.	.	ENSG00000179142	ENST00000323110	T	0.71103	-0.54	3.44	0.116	0.14647	.	0.696286	0.12629	N	0.452329	T	0.66086	0.2754	M	0.67953	2.075	0.09310	N	0.999999	B	0.28258	0.205	B	0.32022	0.139	T	0.59484	-0.7446	10	0.51188	T	0.08	.	7.7411	0.28841	0.0:0.5027:0.3265:0.1709	.	135	P19099	C11B2_HUMAN	T	135	ENSP00000325822:P135T	ENSP00000325822:P135T	P	-	1	0	CYP11B2	143993656	0.019000	0.18553	0.108000	0.21378	0.782000	0.44232	0.735000	0.26115	0.225000	0.20959	0.561000	0.74099	CCT	.		0.627	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000345136.3_Silent_p.A1976A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		0	0		13	13	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000345136.3_Silent_p.A1969A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		21	21	NM_201380	0	0	0	1	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998868	144998868	+	Silent	SNP	C	C	T	rs140406501	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:144998868C>T	ENST00000322810.4	-	31	5809	c.5640G>A	c.(5638-5640)gcG>gcA	p.A1880A	PLEC_ENST00000527096.1_Silent_p.A1766A|PLEC_ENST00000354589.3_Silent_p.A1743A|PLEC_ENST00000356346.3_Silent_p.A1729A|PLEC_ENST00000354958.2_Silent_p.A1721A|PLEC_ENST00000357649.2_Silent_p.A1747A|PLEC_ENST00000398774.2_Silent_p.A1711A|PLEC_ENST00000436759.2_Silent_p.A1770A|PLEC_ENST00000345136.3_Silent_p.A1743A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1880	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGGCTGCAGCCGCCTCACGCT	0.716													C|||	120	0.0239617	0.0	0.1081	5008	,	,		8312	0.003		0.0199	False		,,,				2504	0.0225				p.A1880A		.											.	PLEC-141	0			c.G5640A						.						1.0	2.0	2.0					8																	144998868		1178	2761	3939	SO:0001819	synonymous_variant	5339	exon31			TGCAGCCGCCTCA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5640G>A	8.37:g.144998868C>T		0	0		9	8	NM_201380	0	0	0	1	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.978;T|0.022		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		13	12	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
SMARCA2	6595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	2077741	2077741	+	Missense_Mutation	SNP	G	G	T	rs373755812		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:2077741G>T	ENST00000382203.1	+	14	2358	c.2149G>T	c.(2149-2151)Gcc>Tcc	p.A717S	SMARCA2_ENST00000357248.2_Missense_Mutation_p.A717S|SMARCA2_ENST00000382194.1_Missense_Mutation_p.A717S|SMARCA2_ENST00000349721.2_Missense_Mutation_p.A717S			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	717					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GAAACAGTCTGCCCTCCTAAT	0.468																																					p.A717S		.											.	SMARCA2-653	0			c.G2149T						.						109.0	84.0	93.0					9																	2077741		2203	4300	6503	SO:0001583	missense	6595	exon14			CAGTCTGCCCTCC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2149G>T	9.37:g.2077741G>T	ENSP00000371638:p.Ala717Ser	150	0		246	100	NM_139045	0	0	0	0	0	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	g	5.267	0.234628	0.09969	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.56	5.56	0.83823	.	0.235104	0.37219	N	0.002196	T	0.76877	0.4049	N	0.00869	-1.13	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.75608	-0.3259	10	0.02654	T	1	-19.4585	12.619	0.56594	0.0:0.0:0.7226:0.2774	.	318;717;717	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	S	717	ENSP00000265773:A717S;ENSP00000349788:A717S;ENSP00000371638:A717S;ENSP00000371629:A717S	ENSP00000265773:A717S	A	+	1	0	SMARCA2	2067741	0.861000	0.29849	0.957000	0.39632	0.376000	0.30014	1.345000	0.33953	2.614000	0.88457	0.586000	0.80456	GCC	.		0.468	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		2	0		22	11	NM_024896	0	0	1	1	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
MLLT3	4300	hgsc.bcm.edu;broad.mit.edu	37	9	20414341	20414343	+	In_Frame_Del	DEL	CTA	CTA	-	rs372894655	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	CTA	CTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:20414341_20414343delCTA	ENST00000380338.4	-	5	787_789	c.501_503delTAG	c.(499-504)agtagc>agc	p.167_168SS>S	MLLT3_ENST00000429426.2_In_Frame_Del_p.164_165SS>S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		gctgctgctgctactgctgctgc	0.532			T	MLL	ALL																																p.167_168del		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)	c.501_503del						.			369,2479		91,187,1146						4.9	1.0			13	562,5562		125,312,2625	no	coding	MLLT3	NM_004529.2		216,499,3771	A1A1,A1R,RR		9.177,12.9565,10.3767				931,8041				SO:0001651	inframe_deletion	4300	exon5			CTGCTGCTACTGC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501_503delTAG	9.37:g.20414341_20414343delCTA	ENSP00000369695:p.Ser190del	34	0		46	17	NM_004529	0	0	0	0	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	In_Frame_Del	DEL	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MLLT3	4300	hgsc.bcm.edu	37	9	20414349	20414349	+	Silent	SNP	G	G	A			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:20414349G>A	ENST00000380338.4	-	5	781	c.495C>T	c.(493-495)agC>agT	p.S165S	MLLT3_ENST00000429426.2_Silent_p.S162S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	165	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctactgctgctgctgctgc	0.532			T	MLL	ALL																																p.S165S		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	0			c.C495T						.						8.0	15.0	13.0					9																	20414349		1360	3003	4363	SO:0001819	synonymous_variant	4300	exon5			ACTGCTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.495C>T	9.37:g.20414349G>A		30	0		42	9	NM_004529	0	0	2	2	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
CHMP5	51510	hgsc.bcm.edu	37	9	33264540	33264540	+	5'Flank	SNP	C	C	G	rs1071545	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:33264540C>G	ENST00000223500.8	+	0	0				BAG1_ENST00000379704.2_5'UTR|BAG1_ENST00000472232.3_Missense_Mutation_p.G45R|CHMP5_ENST00000419016.2_5'Flank	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			GGTGGACGCCCAGAGGGAGGC	0.771													G|||	4905	0.979433	0.9251	0.9942	5008	,	,		8749	1.0		1.0	False		,,,				2504	1.0				p.G45R		.											.	BAG1-228	0			c.G133C						.		,ARG/GLY	3714,198		1759,196,1	4.0	5.0	4.0		,133	3.6	0.0	9	dbSNP_86	4	7514,4		3755,4,0	no	utr-5,missense	BAG1	NM_001172415.1,NM_004323.5	,125	5514,200,1	GG,GC,CC		0.0532,5.0613,1.7673	,benign	,45/346	33264540	11228,202	1956	3759	5715	SO:0001631	upstream_gene_variant	573	exon1			GACGCCCAGAGGG	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264540C>G	Exception_encountered	0	0		19	19	NM_004323	0	0	0	3	3	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	2143	0.9812271062271062	452	0.9186991869918699	361	0.9972375690607734	572	1.0	758	1.0	G	5.424	0.263435	0.10294	0.949387	0.999468	ENSG00000107262	ENST00000472232	.	.	.	3.62	3.62	0.41486	.	0.965269	0.08484	N	0.939035	T	0.00012	0.0000	N	0.08118	0	0.47407	P	5.870000000000042E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	8	0.06236	T	0.91	-3.4106	9.2895	0.37778	0.0:0.2201:0.7798:0.0	rs1071545;rs1702659;rs59772010	45	Q99933	BAG1_HUMAN	R	45	.	ENSP00000420514:G45R	G	-	1	0	BAG1	33254540	0.798000	0.28890	0.040000	0.18447	0.006000	0.05464	0.985000	0.29578	1.113000	0.41760	-0.674000	0.03794	GGG	C|0.976;G|0.024		0.771	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
NCBP1	4686	hgsc.bcm.edu	37	9	100396172	100396172	+	Silent	SNP	G	G	A	rs11554641	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:100396172G>A	ENST00000375147.3	+	1	265	c.9G>A	c.(7-9)cgG>cgA	p.R3R	TSTD2_ENST00000354801.2_5'Flank|RP11-244N9.4_ENST00000437864.1_RNA|TSTD2_ENST00000341170.4_5'Flank	NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	3					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				GCATGTCGCGGCGGCGGCACA	0.721													G|||	23	0.00459265	0.0008	0.0043	5008	,	,		12921	0.0		0.0189	False		,,,				2504	0.0				p.R3R	Ovarian(36;879 898 2893 44212 50307)	.											.	NCBP1-90	0			c.G9A						.	G		4,3998		0,4,1997	6.0	9.0	8.0		9	4.5	1.0	9	dbSNP_132	8	87,7863		1,85,3889	no	coding-synonymous	NCBP1	NM_002486.4		1,89,5886	AA,AG,GG		1.0943,0.1,0.7614		3/791	100396172	91,11861	2001	3975	5976	SO:0001819	synonymous_variant	4686	exon1			GTCGCGGCGGCGG	BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.9G>A	9.37:g.100396172G>A		5	0		116	66	NM_002486	0	0	0	0	0	B2R718|Q59G76|Q5T1V0|Q5T7X2	Silent	SNP	ENST00000375147.3	37	CCDS6728.1																																																																																			G|0.991;A|0.009		0.721	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486	
CCDC183	84960	hgsc.bcm.edu	37	9	139694613	139694613	+	Missense_Mutation	SNP	C	C	A	rs35342663	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:139694613C>A	ENST00000338005.6	+	4	465	c.430C>A	c.(430-432)Ctg>Atg	p.L144M	RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.L174M|KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		144										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GGAGCTGCGGCTGCTGCAGGT	0.741													C|||	462	0.0922524	0.152	0.0144	5008	,	,		7965	0.1389		0.0219	False		,,,				2504	0.091				p.L144M		.											.	KIAA1984-91	0			c.C430A						.	C	MET/LEU	345,2927		9,327,1300	4.0	4.0	4.0		430	-3.5	0.0	9	dbSNP_126	4	162,7194		2,158,3518	no	missense	KIAA1984	NM_001039374.4	15	11,485,4818	AA,AC,CC		2.2023,10.544,4.7704	benign	144/535	139694613	507,10121	1636	3678	5314	SO:0001583	missense	84960	exon4			CTGCGGCTGCTGC																												ENST00000338005.6:c.430C>A	9.37:g.139694613C>A	ENSP00000338013:p.Leu144Met	2	0		25	9	NM_001039374	0	0	0	0	0	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	155	0.07097069597069597	63	0.12804878048780488	6	0.016574585635359115	71	0.12412587412587413	15	0.01978891820580475	C	8.887	0.953003	0.18431	0.10544	0.022023	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.11604	2.76	4.69	-3.55	0.04639	.	1.415250	0.05927	U	0.634446	T	0.00073	0.0002	N	0.21448	0.665	0.80722	P	0.0	B	0.24368	0.102	B	0.23852	0.049	T	0.40098	-0.9581	9	0.45353	T	0.12	-2.6838	3.6184	0.08086	0.384:0.3008:0.0:0.3152	rs35342663;rs59016673;rs62581420	144	Q5T5S1	K1984_HUMAN	M	144	ENSP00000338013:L144M	ENSP00000338013:L144M	L	+	1	2	KIAA1984	138814434	0.000000	0.05858	0.004000	0.12327	0.449000	0.32228	-3.365000	0.00496	-1.346000	0.02211	-0.384000	0.06662	CTG	C|0.928;A|0.072		0.741	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
CDR1	1038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	139865766	139865766	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chrX:139865766T>C	ENST00000370532.2	-	1	957	c.766A>G	c.(766-768)Aca>Gca	p.T256A		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	256										breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				TCAATCAGTGTCTTCCAGAAA	0.403																																					p.T256A		.											.	CDR1-130	0			c.A766G						.						89.0	88.0	88.0					X																	139865766		2203	4300	6503	SO:0001583	missense	1038	exon1			TCAGTGTCTTCCA		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.766A>G	X.37:g.139865766T>C	ENSP00000359563:p.Thr256Ala	115	0		158	147	NM_004065	0	0	0	0	0	Q5JXH6	Missense_Mutation	SNP	ENST00000370532.2	37	CCDS14670.1	.	.	.	.	.	.	.	.	.	.	T	11.19	1.566720	0.28003	.	.	ENSG00000184258	ENST00000370532	.	.	.	3.25	2.05	0.26809	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	0.09310	N	1	P	0.46512	0.879	B	0.42030	0.373	T	0.06807	-1.0806	7	.	.	.	.	3.5366	0.07796	0.0:0.1379:0.227:0.6351	.	256	P51861	CDR1_HUMAN	A	256	.	.	T	-	1	0	CDR1	139693432	0.020000	0.18652	0.021000	0.16686	0.007000	0.05969	0.008000	0.13197	0.326000	0.23384	-0.465000	0.05216	ACA	.		0.403	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
NCOR2	9612	broad.mit.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939				p.G1840delinsSSGG		.											.	NCOR2-229	0			c.5518_5519insAGCAGCGGC						.																																			SO:0001652	inframe_insertion	9612	exon39			CACCCCCGCCGCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	4	0		32	19	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
KCNN2	3781	broad.mit.edu	37	5	113698631	113698632	+	In_Frame_Ins	INS	-	-	GCC	rs151038013|rs111266015|rs76852708|rs34641516		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr5:113698631_113698632insGCC	ENST00000512097.3	+	2	1177_1178	c.159_160insGCC	c.(160-162)gcc>GCCgcc	p.54_54A>AA	KCNN2_ENST00000264773.3_In_Frame_Ins_p.54_54A>AA			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	54	Poly-Ala.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	CTGCAGCCGCTGCCGCCGCCGC	0.703																																					p.A53delinsAA		.											.	KCNN2-92	0			c.159_160insGCC						.			1003,2377		300,403,987						-5.9	0.0		dbSNP_126	7	2590,4184		804,982,1601	no	coding	KCNN2	NM_021614.2		1104,1385,2588	A1A1,A1R,RR		38.2344,29.6746,35.3851				3593,6561				SO:0001652	inframe_insertion	3781	exon1			AGCCGCTGCCGCC	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.169_171dupGCC	5.37:g.113698638_113698640dupGCC	ENSP00000427120:p.Ala58dup	6	0		69	21	NM_021614	0	0	0	0	0	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	In_Frame_Ins	INS	ENST00000512097.3	37	CCDS4114.1																																																																																			-|0.472;GCC|0.528		0.703	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534192	90534193	+	RNA	INS	-	-	TCTTGTCTCCCAGCGTCA	rs567658963|rs536300617	byFrequency	TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr9:90534192_90534193insTCTTGTCTCCCAGCGTCA	ENST00000602681.1	+	0	938_939							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCCAGCGTCATCTTGTCTCCC	0.594																																					p.H71delinsHLVSQRH		.											.	.	0			c.212_213insTCTTGTCTCCCAGCGTCA						.																																					441452	exon2			AGCGTCATCTTGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534192_90534193insTCTTGTCTCCCAGCGTCA		292	0		434	0	NM_001145124	0	0	0	0	0		In_Frame_Ins	INS	ENST00000602681.1	37																																																																																				.		0.594	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
NR1H2	7376	bcgsc.ca	37	19	50881865	50881866	+	Missense_Mutation	DNP	CC	CC	AA	rs376476625		TCGA-OR-A5K8-01A-11D-A29I-10	TCGA-OR-A5K8-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	104c32cd-f89e-4198-9108-033ace38f66b	6def7b38-71db-4a33-a6ca-bd7dda66512e	g.chr19:50881865_50881866CC>AA	ENST00000253727.5	+	6	794_795	c.559_560CC>AA	c.(559-561)CCg>AAg	p.P187K	NR1H2_ENST00000598168.1_Missense_Mutation_p.P187K|NR1H2_ENST00000411902.2_Missense_Mutation_p.P90K|NR1H2_ENST00000593926.1_Missense_Mutation_p.P187K|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Missense_Mutation_p.P187K	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	187					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		ACCTGTGGGGCCGCAGGGCAGC	0.624																																					p.P187K		.											.	NR1H2-186	0			c.C560A						.																																			SO:0001583	missense	7376	exon6			TGGGGCCGCAGGG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		Exception_encountered	19.37:g.50881865_50881866delinsAA	ENSP00000253727:p.Pro187Lys	57	0		66	4	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Missense_Mutation	DNP	ENST00000253727.5	37	CCDS42593.1																																																																																			.		0.624	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
