#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMEL1	79258	bcgsc.ca	37	1	2541269	2541269	+	Splice_Site	SNP	A	A	G	rs10797440	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:2541269A>G	ENST00000378412.3	-	5	455	c.294T>C	c.(292-294)gcT>gcC	p.A98A	MMEL1_ENST00000502556.1_Splice_Site_p.A98A|MMEL1_ENST00000288709.6_Splice_Site_p.A89A			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	98						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GGATCCTGGCAGCTGCTCGTC	0.627													g|||	2662	0.53155	0.7027	0.4885	5008	,	,		18168	0.5357		0.33	False		,,,				2504	0.5337				p.A98A		.											.	MMEL1-90	0			c.T294C						.	G		2887,1519		947,993,263	75.0	62.0	66.0		294	-3.0	0.8	1	dbSNP_120	66	2852,5748		475,1902,1923	yes	coding-synonymous-near-splice	MMEL1	NM_033467.3		1422,2895,2186	GG,GA,AA		33.1628,34.4757,44.1258		98/780	2541269	5739,7267	2203	4300	6503	SO:0001630	splice_region_variant	79258	exon5			CCTGGCAGCTGCT	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.293-1T>C	1.37:g.2541269A>G		168	2		133	6	NM_033467	0	0	0	0	0	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Silent	SNP	ENST00000378412.3	37	CCDS30569.2																																																																																			A|0.542;G|0.458		0.627	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	Silent
TNFRSF25	8718	hgsc.bcm.edu	37	1	6521701	6521701	+	Silent	SNP	C	C	T	rs149595085	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:6521701C>T	ENST00000356876.3	-	10	1134	c.1047G>A	c.(1045-1047)gaG>gaA	p.E349E	TNFRSF25_ENST00000377782.3_Silent_p.E358E|TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000351748.3_Silent_p.E166E|TNFRSF25_ENST00000351959.5_Silent_p.E312E|TNFRSF25_ENST00000348333.3_Silent_p.E304E	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	349	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		TGCGCACGAACTCCTTCCAGC	0.687													.|||	2	0.000399361	0.0	0.0	5008	,	,		15403	0.0		0.002	False		,,,				2504	0.0				p.E358E		.											.	TNFRSF25-714	0			c.G1074A						.	C	,,,,	0,4404		0,0,2202	18.0	19.0	19.0		1047,1074,936,912,498	4.2	1.0	1	dbSNP_134	19	9,8587		0,9,4289	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TNFRSF25	NM_003790.2,NM_148965.1,NM_148966.1,NM_148967.1,NM_148970.1	,,,,	0,9,6491	TT,TC,CC		0.1047,0.0,0.0692	,,,,	349/418,358/427,312/381,304/373,166/235	6521701	9,12991	2202	4298	6500	SO:0001819	synonymous_variant	8718	exon10			CACGAACTCCTTC	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.1047G>A	1.37:g.6521701C>T		0	0		37	35	NM_148965	0	0	0	0	0	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Silent	SNP	ENST00000356876.3	37	CCDS71.1																																																																																			C|0.999;T|0.001		0.687	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
LRRC38	126755	bcgsc.ca	37	1	13802437	13802437	+	Silent	SNP	G	G	A	rs3013106	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:13802437G>A	ENST00000376085.3	-	2	1216	c.762C>T	c.(760-762)tcC>tcT	p.S254S		NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	254					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CGGCCACACCGGAGAAAATGA	0.582													G|||	1626	0.324681	0.4221	0.2262	5008	,	,		19646	0.3879		0.2505	False		,,,				2504	0.274				p.S254S		.											.	.	0			c.C762T						.																																			SO:0001819	synonymous_variant	126755	exon2			CACACCGGAGAAA	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.762C>T	1.37:g.13802437G>A		363	4		250	7	NM_001010847	0	0	0	0	0	Q96B32	Silent	SNP	ENST00000376085.3	37	CCDS53269.1																																																																																			A|0.323;C|0.008		0.582	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
CROCC	9696	hgsc.bcm.edu	37	1	17266514	17266514	+	Silent	SNP	C	C	T	rs141271666	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:17266514C>T	ENST00000375541.5	+	13	1803	c.1734C>T	c.(1732-1734)gaC>gaT	p.D578D	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACAAGACCGACGGCGCCATGC	0.716													c|||	11	0.00219649	0.0	0.0	5008	,	,		18874	0.004		0.006	False		,,,				2504	0.001				p.D578D		.											.	CROCC-137	0			c.C1734T						.	T		9,4395		0,9,2193	25.0	25.0	25.0		1734	-10.0	0.0	1	dbSNP_134	25	54,8526		0,54,4236	no	coding-synonymous	CROCC	NM_014675.3		0,63,6429	TT,TC,CC		0.6294,0.2044,0.4852		578/2018	17266514	63,12921	2202	4290	6492	SO:0001819	synonymous_variant	9696	exon13			GACCGACGGCGCC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1734C>T	1.37:g.17266514C>T		1	0		48	4	NM_014675	0	0	0	0	0		Silent	SNP	ENST00000375541.5	37	CCDS30616.1																																																																																			C|0.995;T|0.005		0.716	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
RPA2	6118	broad.mit.edu;bcgsc.ca	37	1	28240630	28240630	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:28240630T>G	ENST00000373912.3	-	2	360	c.61A>C	c.(61-63)Acg>Ccg	p.T21P	RPA2_ENST00000313433.7_Missense_Mutation_p.T109P|RPA2_ENST00000373909.3_Missense_Mutation_p.T29P	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa	21	Gly/Ser-rich.				base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		GGGGACTGCGTGTAGCCGCCG	0.537								Direct reversal of damage;Nucleotide excision repair (NER)																													p.T21P		.											.	RPA2-228	0			c.A61C						.						42.0	51.0	48.0					1																	28240630		2203	4300	6503	SO:0001583	missense	6118	exon2			ACTGCGTGTAGCC	BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.61A>C	1.37:g.28240630T>G	ENSP00000363021:p.Thr21Pro	141	1		94	5	NM_002946	0	0	0	0	0	Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	ENST00000373912.3	37	CCDS314.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096389	0.76870	.	.	ENSG00000117748	ENST00000373912;ENST00000373909;ENST00000313433;ENST00000444045	T;T;T;T	0.24350	2.18;2.17;2.13;1.86	4.6	3.45	0.39498	.	0.048629	0.85682	D	0.000000	T	0.38639	0.1048	L	0.58101	1.795	0.44000	D	0.996702	B;D	0.61080	0.001;0.989	B;P	0.58454	0.0;0.839	T	0.07195	-1.0785	10	0.41790	T	0.15	-5.3297	10.6736	0.45772	0.0:0.0:0.1611:0.8389	.	21;29	P15927;P15927-2	RFA2_HUMAN;.	P	21;29;109;25	ENSP00000363021:T21P;ENSP00000363017:T29P;ENSP00000363015:T109P;ENSP00000387649:T25P	ENSP00000363015:T109P	T	-	1	0	RPA2	28113217	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	2.798000	0.47884	0.694000	0.31654	0.459000	0.35465	ACG	.		0.537	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011179.1	NM_002946	
DMAP1	55929	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	44684101	44684101	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:44684101T>G	ENST00000372289.2	+	4	775	c.512T>G	c.(511-513)tTt>tGt	p.F171C	DMAP1_ENST00000361745.6_Missense_Mutation_p.F171C|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Missense_Mutation_p.F171C	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	171	SANT.			F -> L (in Ref. 10; CAD97886). {ECO:0000305}.	chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					GACCTGCGTTTTGTTGTTATC	0.512											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F171C		.											.	DMAP1-226	0			c.T512G						.						166.0	138.0	147.0					1																	44684101		2203	4300	6503	SO:0001583	missense	55929	exon5			TGCGTTTTGTTGT	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.512T>G	1.37:g.44684101T>G	ENSP00000361363:p.Phe171Cys	238	2	925	243	220	NM_001034024	0	0	0	0	0	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Missense_Mutation	SNP	ENST00000372289.2	37	CCDS509.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.592618	0.86953	.	.	ENSG00000178028	ENST00000361745;ENST00000446292;ENST00000372283;ENST00000440641;ENST00000437511;ENST00000315913;ENST00000372289;ENST00000372290	.	.	.	5.26	5.26	0.73747	SANT domain, DNA binding (1);	0.000000	0.85682	D	0.000000	D	0.84005	0.5377	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.976	D	0.87399	0.2368	9	0.87932	D	0	-15.9291	15.3401	0.74290	0.0:0.0:0.0:1.0	.	161;171	B4DQG8;Q9NPF5	.;DMAP1_HUMAN	C	171;171;197;171;197;171;171;132	.	ENSP00000312697:F171C	F	+	2	0	DMAP1	44456688	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.490000	0.81461	2.208000	0.71279	0.533000	0.62120	TTT	.		0.512	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	BTBD19_ENST00000453418.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank|BTBD19_ENST00000450269.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.V171V			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		0	0		4	4	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
RAD54L	8438	bcgsc.ca	37	1	46743900	46743900	+	Silent	SNP	C	C	T	rs1048771	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:46743900C>T	ENST00000371975.4	+	18	2864	c.2190C>T	c.(2188-2190)gcC>gcT	p.A730A	RAD54L_ENST00000442598.1_Silent_p.A730A|LRRC41_ENST00000472710.1_5'Flank	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	730					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		CCTCCACTGCCATCACCTTCG	0.592								Direct reversal of damage;Homologous recombination					C|||	930	0.185703	0.0257	0.1167	5008	,	,		16392	0.2768		0.1382	False		,,,				2504	0.4059				p.A730A		.											.	RAD54L-229	0			c.C2190T						.	C	,	190,4216	120.4+/-158.0	4,182,2017	36.0	35.0	35.0		2190,2190	1.5	1.0	1	dbSNP_86	35	1045,7555	218.0+/-256.5	56,933,3311	no	coding-synonymous,coding-synonymous	RAD54L	NM_001142548.1,NM_003579.3	,	60,1115,5328	TT,TC,CC		12.1512,4.3123,9.4956	,	730/748,730/748	46743900	1235,11771	2203	4300	6503	SO:0001819	synonymous_variant	8438	exon18			CACTGCCATCACC	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.2190C>T	1.37:g.46743900C>T		155	1		119	5	NM_003579	0	0	0	0	0	Q5TE31|Q6IUY3	Silent	SNP	ENST00000371975.4	37	CCDS532.1																																																																																			C|0.877;T|0.123		0.592	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	NM_003579	
INADL	10207	bcgsc.ca	37	1	62261168	62261168	+	Missense_Mutation	SNP	A	A	G	rs7516332	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:62261168A>G	ENST00000371158.2	+	10	1312	c.1198A>G	c.(1198-1200)Ata>Gta	p.I400V	INADL_ENST00000316485.6_Missense_Mutation_p.I400V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	400	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.		I -> V (in dbSNP:rs7516332).		cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.I400V(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TGTGAAAAGTATAATACCTGG	0.383													A|||	2178	0.434904	0.1808	0.5634	5008	,	,		17382	0.4514		0.493	False		,,,				2504	0.6104				p.I400V		.											.	INADL-94	1	Substitution - Missense(1)	prostate(1)	c.A1198G						.	A	VAL/ILE	1074,3332	387.2+/-326.4	136,802,1265	118.0	106.0	110.0		1198	-3.3	0.2	1	dbSNP_116	110	4169,4431	566.8+/-388.7	1023,2123,1154	yes	missense	INADL	NM_176877.2	29	1159,2925,2419	GG,GA,AA		48.4767,24.3759,40.3122	benign	400/1802	62261168	5243,7763	2203	4300	6503	SO:0001583	missense	10207	exon10			AAAAGTATAATAC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1198A>G	1.37:g.62261168A>G	ENSP00000360200:p.Ile400Val	130	0		76	4	NM_176877	0	0	0	0	0	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	924	0.4230769230769231	122	0.24796747967479674	206	0.569060773480663	234	0.4090909090909091	362	0.47757255936675463	A	8.454	0.853778	0.17106	0.243759	0.484767	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.14266	2.52;2.52	5.29	-3.27	0.05048	PDZ/DHR/GLGF (4);	0.406531	0.24115	N	0.041412	T	0.00012	0.0000	N	0.13003	0.285	0.09310	P	0.9999999999995363	B;B;B	0.15473	0.013;0.008;0.008	B;B;B	0.21360	0.034;0.019;0.034	T	0.37619	-0.9698	9	0.21540	T	0.41	.	4.4158	0.11455	0.5466:0.0:0.2392:0.2142	rs7516332;rs52828363;rs56777942;rs7516332	400;400;400	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	400	ENSP00000360200:I400V;ENSP00000326199:I400V	ENSP00000255202:I400V	I	+	1	0	INADL	62033756	0.900000	0.30661	0.167000	0.22817	0.675000	0.39556	0.533000	0.23082	-0.790000	0.04492	-0.336000	0.08194	ATA	A|0.589;G|0.411		0.383	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
GBP2	2634	hgsc.bcm.edu;broad.mit.edu	37	1	89586906	89586912	+	Frame_Shift_Del	DEL	TCCAGAT	TCCAGAT	-			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	TCCAGAT	TCCAGAT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:89586906_89586912delTCCAGAT	ENST00000370466.3	-	3	500_506	c.232_238delATCTGGA	c.(232-240)atctggatgfs	p.IWM78fs	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	78	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		ACACACCACATCCAGATTCCCTTGGTG	0.44																																					p.78_80del		.											.	GBP2-91	0			c.232_238del						.																																			SO:0001589	frameshift_variant	2634	exon3			ACCACATCCAGAT	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.232_238delATCTGGA	1.37:g.89586906_89586912delTCCAGAT	ENSP00000359497:p.Ile78fs	61	0		87	11	NM_004120	0	0	0	0	0	Q6GPH0|Q6IAU2|Q86TB0	Frame_Shift_Del	DEL	ENST00000370466.3	37	CCDS719.1																																																																																			.		0.440	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
KPRP	448834	broad.mit.edu	37	1	152733496	152733496	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:152733496C>A	ENST00000606109.1	+	1	1460	c.1432C>A	c.(1432-1434)Cca>Aca	p.P478T	KPRP_ENST00000368773.1_Missense_Mutation_p.P478T			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	478	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACGACCAGAGCCAATTCCCCT	0.672																																					p.P478T		.											.	KPRP-95	0			c.C1432A						.						76.0	81.0	79.0					1																	152733496		2203	4300	6503	SO:0001583	missense	448834	exon2			CCAGAGCCAATTC	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1432C>A	1.37:g.152733496C>A	ENSP00000475216:p.Pro478Thr	14	0		35	4	NM_001025231	0	0	0	0	0		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	32	5.122653	0.94429	.	.	ENSG00000203786	ENST00000368773	T	0.14144	2.53	4.61	4.61	0.57282	.	0.000000	0.48286	D	0.000191	T	0.24470	0.0593	L	0.54323	1.7	0.53005	D	0.999968	D	0.89917	1.0	D	0.91635	0.999	T	0.00697	-1.1605	10	0.72032	D	0.01	-7.9264	15.329	0.74190	0.0:1.0:0.0:0.0	.	478	Q5T749	KPRP_HUMAN	T	478	ENSP00000357762:P478T	ENSP00000357762:P478T	P	+	1	0	KPRP	151000120	0.970000	0.33590	0.729000	0.30791	0.513000	0.34164	3.805000	0.55575	2.555000	0.86185	0.462000	0.41574	CCA	.		0.672	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181727162	181727162	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:181727162G>A	ENST00000367573.2	+	31	4409	c.4409G>A	c.(4408-4410)cGc>cAc	p.R1470H	CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1077H|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R1470H|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1451H|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R1421H|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R1451H|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1402H	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1470					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTCCAGTACCGCGTGTGGCAC	0.527																																					p.R1470H		.											.	CACNA1E-95	0			c.G4409A						.						132.0	139.0	137.0					1																	181727162		2148	4241	6389	SO:0001583	missense	777	exon31			AGTACCGCGTGTG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4409G>A	1.37:g.181727162G>A	ENSP00000356545:p.Arg1470His	132	1		163	135	NM_000721	0	0	0	0	0	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	34	5.364566	0.95877	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96967	-4.11;-4.11;-4.12;-4.11;-4.19;-4.11;-4.12	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97315	0.9122	L	0.48218	1.51	0.80722	D	1	D;P;D	0.89917	0.961;0.81;1.0	P;P;D	0.83275	0.814;0.468;0.996	D	0.98188	1.0461	10	0.72032	D	0.01	.	18.5085	0.90907	0.0:0.0:1.0:0.0	.	1451;1470;1470	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	H	1470;1451;1421;1402;1077;1451;1470	ENSP00000356542:R1470H;ENSP00000434814:R1451H;ENSP00000350183:R1421H;ENSP00000351101:R1402H;ENSP00000356539:R1077H;ENSP00000353222:R1451H;ENSP00000356545:R1470H	ENSP00000350183:R1421H	R	+	2	0	CACNA1E	179993785	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	6.633000	0.74286	2.465000	0.83290	0.655000	0.94253	CGC	.		0.527	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
JMJD4	65094	hgsc.bcm.edu	37	1	227923081	227923081	+	Missense_Mutation	SNP	G	G	A	rs7419238		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:227923081G>A	ENST00000366758.3	-	1	31	c.32C>T	c.(31-33)gCg>gTg	p.A11V	SNAP47_ENST00000315781.5_5'UTR|SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000366759.4_5'UTR|JMJD4_ENST00000438896.2_Missense_Mutation_p.A11V	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	11			A -> V (in dbSNP:rs7419238). {ECO:0000269|PubMed:14702039}.							endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TTTCTGCCCCGCCAGCGCCTG	0.741													A|||	5008	1.0	1.0	1.0	5008	,	,		11222	1.0		1.0	False		,,,				2504	1.0				p.A11V		.											.	JMJD4-226	0			c.C32T						.	A	VAL/ALA,VAL/ALA,	4035,1		2017,1,0	6.0	7.0	7.0		32,32,	2.0	0.0	1	dbSNP_116	7	8000,0		4000,0,0	yes	missense,missense,utr-5	JMJD4,SNAP47	NM_001161465.1,NM_023007.2,NM_053052.3	64,64,	6017,1,0	AA,AG,GG		0.0,0.0248,0.0083	benign,benign,	11/448,11/464,	227923081	12035,1	2018	4000	6018	SO:0001583	missense	65094	exon1			TGCCCCGCCAGCG	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.32C>T	1.37:g.227923081G>A	ENSP00000355720:p.Ala11Val	0	0		5	5	NM_023007	0	0	0	0	0	Q5TBZ1|Q5TBZ6|Q9H970	Missense_Mutation	SNP	ENST00000366758.3	37	CCDS1561.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	361|361	0.9972375690607734|0.9972375690607734	572|572	1.0|1.0	754|754	0.9947229551451188|0.9947229551451188	A|A	2.779|2.779	-0.253926|-0.253926	0.05829|0.05829	0.999752|0.999752	1.0|1.0	ENSG00000081692|ENSG00000081692	ENST00000366758|ENST00000438896	T|.	0.19806|.	2.12|.	3.58|3.58	1.99|1.99	0.26369|0.26369	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.27400|0.27400	-1.0075|-1.0075	8|4	0.02654|.	T|.	1|.	.|.	5.7765|5.7765	0.18281|0.18281	0.6536:0.0:0.3464:0.0|0.6536:0.0:0.3464:0.0	rs7419238;rs58641567;rs7419238|rs7419238;rs58641567;rs7419238	11;11|.	Q9H9V9-2;Q9H9V9|.	.;JMJD4_HUMAN|.	V|W	11|4	ENSP00000355720:A11V|.	ENSP00000355720:A11V|.	A|R	-|-	2|1	0|2	JMJD4|JMJD4	225989704|225989704	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.100000|-0.100000	0.10990|0.10990	-0.047000|-0.047000	0.13423|0.13423	-0.268000|-0.268000	0.10319|0.10319	GCG|CGG	G|0.002;A|0.998		0.741	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
RYR2	6262	broad.mit.edu	37	1	237754020	237754020	+	Silent	SNP	C	C	T	rs373721253	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:237754020C>T	ENST00000366574.2	+	31	4205	c.3888C>T	c.(3886-3888)aaC>aaT	p.N1296N	RYR2_ENST00000360064.6_Silent_p.N1294N|RYR2_ENST00000542537.1_Silent_p.N1280N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1296	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAACAGCAACACTGATATCA	0.522													c|||	3	0.000599042	0.0	0.0	5008	,	,		16778	0.0		0.003	False		,,,				2504	0.0				p.N1296N		.											.	RYR2-158	0			c.C3888T						.	C		0,3952		0,0,1976	250.0	238.0	242.0		3888	2.2	0.0	1		242	7,8313		0,7,4153	no	coding-synonymous	RYR2	NM_001035.2		0,7,6129	TT,TC,CC		0.0841,0.0,0.057		1296/4968	237754020	7,12265	1976	4160	6136	SO:0001819	synonymous_variant	6262	exon31			CAGCAACACTGAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3888C>T	1.37:g.237754020C>T		79	0		78	4	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
FMN2	56776	mdanderson.org	37	1	240371151	240371151	+	Silent	SNP	T	T	A	rs71646892	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:240371151T>A	ENST00000319653.9	+	5	3269	c.3039T>A	c.(3037-3039)ccT>ccA	p.P1013P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1013	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCCTCCCCCTCTTCCCGGAG	0.736																																					p.P1013P		.											.	FMN2-145	0			c.T3039A						.						3.0	3.0	3.0					1																	240371151		1579	3224	4803	SO:0001819	synonymous_variant	56776	exon5			TCCCCCTCTTCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3039T>A	1.37:g.240371151T>A		28	2		26	8	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			T|0.962;A|0.038		0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247587530	247587530	+	Missense_Mutation	SNP	G	G	A	rs180177442		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:247587530G>A	ENST00000336119.3	+	3	1531	c.785G>A	c.(784-786)cGa>cAa	p.R262Q	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.R262Q|NLRP3_ENST00000366496.2_Missense_Mutation_p.R262Q|NLRP3_ENST00000366497.2_Missense_Mutation_p.R262Q|NLRP3_ENST00000348069.2_Missense_Mutation_p.R262Q|NLRP3_ENST00000391828.3_Missense_Mutation_p.R262Q	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	262	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		R -> L (in CINCA). {ECO:0000269|PubMed:14630794}.|R -> P (in CINCA). {ECO:0000269|PubMed:14630794}.|R -> W (in FCAS1 and MWS). {ECO:0000269|PubMed:11992256, ECO:0000269|PubMed:12355493}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.R262L(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ATCCACTGTCGAGAGGTGAGC	0.547																																					p.R262Q		.											.	NLRP3-674	1	Substitution - Missense(1)	urinary_tract(1)	c.G785A						.						67.0	67.0	67.0					1																	247587530		2203	4300	6503	SO:0001583	missense	114548	exon3			ACTGTCGAGAGGT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.785G>A	1.37:g.247587530G>A	ENSP00000337383:p.Arg262Gln	106	0		90	16	NM_183395	0	0	0	0	0	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532307	0.64972	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	4.04	4.04	0.47022	NACHT nucleoside triphosphatase (1);	0.000000	0.46758	D	0.000269	D	0.89636	0.6772	M	0.76938	2.355	0.45452	D	0.99842	D;D;D;D;D	0.89917	1.0;0.995;1.0;0.999;0.998	D;P;D;D;D	0.97110	1.0;0.895;1.0;0.965;0.957	D	0.88876	0.3336	10	0.44086	T	0.13	.	11.9927	0.53184	0.0:0.0:1.0:0.0	.	262;262;262;262;262	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	Q	262	ENSP00000375704:R262Q;ENSP00000355453:R262Q;ENSP00000337383:R262Q;ENSP00000294752:R262Q;ENSP00000355452:R262Q;ENSP00000375703:R262Q	ENSP00000337383:R262Q	R	+	2	0	NLRP3	245654153	0.997000	0.39634	0.979000	0.43373	0.220000	0.24768	6.737000	0.74816	2.543000	0.85770	0.563000	0.77884	CGA	.		0.547	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
OR2M3	127062	bcgsc.ca	37	1	248366792	248366792	+	Silent	SNP	T	T	C	rs12562957	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:248366792T>C	ENST00000456743.1	+	1	461	c.423T>C	c.(421-423)tgT>tgC	p.C141C		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTAAAATTTGTGGACTTATGA	0.453													T|||	1232	0.246006	0.171	0.255	5008	,	,		19737	0.3542		0.1451	False		,,,				2504	0.3333				p.C141C		.											.	OR2M3-70	0			c.T423C						.	T		688,3718	290.4+/-280.9	61,566,1576	208.0	208.0	208.0		423	-0.0	0.0	1	dbSNP_120	208	1258,7342	251.1+/-277.7	90,1078,3132	no	coding-synonymous	OR2M3	NM_001004689.1		151,1644,4708	CC,CT,TT		14.6279,15.6151,14.9623		141/313	248366792	1946,11060	2203	4300	6503	SO:0001819	synonymous_variant	127062	exon1			AATTTGTGGACTT		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.423T>C	1.37:g.248366792T>C		272	1		283	8	NM_001004689	0	0	0	0	0	B9EH06|Q6IEY0	Silent	SNP	ENST00000456743.1	37	CCDS31107.1																																																																																			T|0.828;C|0.172		0.453	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
SVIL	6840	bcgsc.ca	37	10	29821523	29821523	+	Silent	SNP	T	T	C	rs1328323	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr10:29821523T>C	ENST00000355867.4	-	8	2525	c.1773A>G	c.(1771-1773)aaA>aaG	p.K591K	SVIL_ENST00000375398.2_Silent_p.K591K|SVIL_ENST00000375400.3_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	591					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CGACAGAGACTTTTGTGTCCA	0.577													C|||	1489	0.297324	0.3351	0.3818	5008	,	,		20218	0.0764		0.4245	False		,,,				2504	0.2832				p.K591K		.											.	SVIL-96	0			c.A1773G						.	C	,	1556,2850	669.8+/-402.2	283,990,930	71.0	65.0	67.0		,1773	4.5	1.0	10	dbSNP_88	67	3807,4793	611.6+/-395.8	843,2121,1336	no	intron,coding-synonymous	SVIL	NM_003174.3,NM_021738.2	,	1126,3111,2266	CC,CT,TT		44.2674,35.3155,41.2348	,	,591/2215	29821523	5363,7643	2203	4300	6503	SO:0001819	synonymous_variant	6840	exon8			AGAGACTTTTGTG	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1773A>G	10.37:g.29821523T>C		178	1		135	5	NM_021738	0	0	0	0	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																			C|0.381;G|0.000;T|0.619		0.577	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
SFTPD	6441	bcgsc.ca	37	10	81706324	81706324	+	Missense_Mutation	SNP	A	A	G	rs721917	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr10:81706324A>G	ENST00000372292.3	-	2	132	c.92T>C	c.(91-93)aTg>aCg	p.M31T		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	31			M -> T (in dbSNP:rs721917). {ECO:0000269|PubMed:1339284, ECO:0000269|PubMed:19100526, ECO:0000269|Ref.3, ECO:0000269|Ref.4}.		defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			AGCACTGGGCATTGTTCTGTG	0.617													g|||	2527	0.504593	0.4009	0.379	5008	,	,		20859	0.6151		0.4205	False		,,,				2504	0.7065				p.M31T		.											.	SFTPD-91	0			c.T92C	GRCh37	CM021324	SFTPD	M	rs721917	.	G	THR/MET	1769,2637	643.9+/-397.9	376,1017,810	122.0	102.0	109.0		92	-1.4	0.0	10	dbSNP_86	109	3610,4990	626.4+/-397.8	761,2088,1451	yes	missense	SFTPD	NM_003019.4	81	1137,3105,2261	GG,GA,AA		41.9767,40.1498,41.3578	benign	31/376	81706324	5379,7627	2203	4300	6503	SO:0001583	missense	6441	exon2			CTGGGCATTGTTC	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.92T>C	10.37:g.81706324A>G	ENSP00000361366:p.Met31Thr	127	0		99	5	NM_003019	0	0	0	0	0	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	ENST00000372292.3	37	CCDS7362.1	1021	0.4674908424908425	202	0.4105691056910569	149	0.4116022099447514	357	0.6241258741258742	313	0.4129287598944591	G	7.685	0.689886	0.15039	0.401498	0.419767	ENSG00000133661	ENST00000372292;ENST00000444384	D;D	0.91068	-2.62;-2.78	5.59	-1.35	0.09114	.	1.689840	0.03546	N	0.224694	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.25779	-1.0122	9	0.10636	T	0.68	0.1384	6.1062	0.20075	0.576:0.0:0.3085:0.1155	rs721917;rs3750874;rs17887190;rs52794086;rs58664997;rs721917	31	P35247	SFTPD_HUMAN	T	31;44	ENSP00000361366:M31T;ENSP00000394325:M44T	ENSP00000361366:M31T	M	-	2	0	SFTPD	81696304	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.298000	0.08265	-0.475000	0.06852	-1.088000	0.02184	ATG	A|0.559;G|0.441		0.617	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	0	0		6	6	NM_182765	0	0	0	0	0	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
NOC3L	64318	broad.mit.edu	37	10	96109888	96109888	+	Missense_Mutation	SNP	C	C	T	rs149695235	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr10:96109888C>T	ENST00000371361.3	-	9	1210	c.1110G>A	c.(1108-1110)atG>atA	p.M370I	NOC3L_ENST00000371350.1_Missense_Mutation_p.M370I|NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000543788.1_Missense_Mutation_p.M108I	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	370					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				ACATGTCATTCATGAGAGGGA	0.448													C|||	3	0.000599042	0.0	0.0014	5008	,	,		19745	0.0		0.001	False		,,,				2504	0.001				p.M370I		.											.	NOC3L-91	0			c.G1110A						.	C	ILE/MET	1,4405	2.1+/-5.4	0,1,2202	194.0	176.0	182.0		1110	5.8	1.0	10	dbSNP_134	182	21,8579	15.3+/-51.7	0,21,4279	yes	missense	NOC3L	NM_022451.9	10	0,22,6481	TT,TC,CC		0.2442,0.0227,0.1692	benign	370/801	96109888	22,12984	2203	4300	6503	SO:0001583	missense	64318	exon9			GTCATTCATGAGA	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1110G>A	10.37:g.96109888C>T	ENSP00000360412:p.Met370Ile	137	0		136	4	NM_022451	0	0	0	0	0	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	14.60	2.583027	0.46006	2.27E-4	0.002442	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.64991	-0.13;1.56;1.56	5.83	5.83	0.93111	Armadillo-like helical (1);	0.038085	0.85682	D	0.000000	T	0.53867	0.1823	L	0.51914	1.62	0.49051	D	0.999746	B	0.32939	0.391	B	0.20955	0.032	T	0.52646	-0.8548	10	0.34782	T	0.22	-20.8105	15.5825	0.76455	0.0:0.863:0.137:0.0	.	370	Q8WTT2	NOC3L_HUMAN	I	108;370;370	ENSP00000437838:M108I;ENSP00000360412:M370I;ENSP00000360401:M370I	ENSP00000360401:M370I	M	-	3	0	NOC3L	96099878	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	5.696000	0.68287	2.775000	0.95449	0.650000	0.86243	ATG	C|0.998;T|0.002		0.448	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
LZTS2	84445	broad.mit.edu	37	10	102766682	102766682	+	Silent	SNP	T	T	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr10:102766682T>G	ENST00000370220.1	+	4	4830	c.1767T>G	c.(1765-1767)ggT>ggG	p.G589G	LZTS2_ENST00000370223.3_Silent_p.G589G					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GGCGGCGGGGTGAGGAGCAGC	0.682																																					p.G589G	Esophageal Squamous(8;38 437 13604 19902 37640)	.											.	LZTS2-155	0			c.T1767G						.						21.0	13.0	16.0					10																	102766682		2080	4135	6215	SO:0001819	synonymous_variant	84445	exon5			GCGGGGTGAGGAG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1767T>G	10.37:g.102766682T>G		17	0		104	26	NM_032429	0	0	0	0	0		Silent	SNP	ENST00000370220.1	37	CCDS7507.1																																																																																			.		0.682	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
MUC2	4583	bcgsc.ca	37	11	1093312	1093312	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:1093312C>G	ENST00000441003.2	+	30	5158	c.5131C>G	c.(5131-5133)Cca>Gca	p.P1711A	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1678A|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccaacacccac	0.637																																					p.P1711A		.											.	MUC2-90	0			c.C5131G						.						145.0	191.0	175.0					11																	1093312		1907	3560	5467	SO:0001583	missense	4583	exon30			CCAACCCCAACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5131C>G	11.37:g.1093312C>G	ENSP00000415183:p.Pro1711Ala	115	3		152	11	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.304	-0.972196	0.02215	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08458	3.09;3.11	1.4	-2.79	0.05841	.	0.190326	0.20108	U	0.099085	T	0.02533	0.0077	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.41106	-0.9527	9	0.08179	T	0.78	.	2.4144	0.04432	0.4935:0.3028:0.0:0.2036	.	1711	E7EUV1	.	A	1711;1678	ENSP00000415183:P1711A;ENSP00000351956:P1678A	ENSP00000351956:P1678A	P	+	1	0	MUC2	1083312	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-5.838000	0.00095	-0.673000	0.05259	-1.098000	0.02139	CCA	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093375	1093375	+	Missense_Mutation	SNP	C	C	T	rs552937801	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:1093375C>T	ENST00000441003.2	+	30	5221	c.5194C>T	c.(5194-5196)Cca>Tca	p.P1732S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1699S|MUC2_ENST00000333592.6_Missense_Mutation_p.P20S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tacggtgaccccaaccccaac	0.657																																					p.P1732S		.											.	MUC2-90	0			c.C5194T						.																																			SO:0001583	missense	4583	exon30			GTGACCCCAACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5194C>T	11.37:g.1093375C>T	ENSP00000415183:p.Pro1732Ser	132	2		172	14	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214378	0.01555	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.10288	3.1;3.17;2.89	1.49	-1.27	0.09347	.	498.391000	0.02047	N	0.049780	T	0.06050	0.0157	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28902	-1.0029	9	0.20519	T	0.43	.	2.7543	0.05288	0.4674:0.3566:0.0:0.176	.	1732	E7EUV1	.	S	1732;1699;20	ENSP00000415183:P1732S;ENSP00000351956:P1699S;ENSP00000331373:P20S	ENSP00000331373:P20S	P	+	1	0	MUC2	1083375	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.627000	0.00874	-0.601000	0.05783	-1.152000	0.01820	CCA	.		0.657	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-5	439915	broad.mit.edu	37	11	1651157	1651157	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:1651157delA	ENST00000399676.2	+	1	125	c.87delA	c.(85-87)ggafs	p.G30fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggct	0.711																																					p.G29fs		.											.	KRTAP5-5-23	0			c.87delA						.						25.0	36.0	33.0					11																	1651157		2116	4203	6319	SO:0001589	frameshift_variant	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.87delA	11.37:g.1651157delA	ENSP00000382584:p.Gly30fs	5	0		114	7	NM_001001480	0	0	0	0	0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
KRTAP5-5	439915	broad.mit.edu	37	11	1651159	1651169	+	Frame_Shift_Del	DEL	GCTGTGGCTCT	GCTGTGGCTCT	-	rs71454095|rs71454094	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:1651159_1651169delGCTGTGGCTCT	ENST00000399676.2	+	1	127_137	c.89_99delGCTGTGGCTCT	c.(88-99)ggctgtggctctfs	p.GCGS30fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtggaggctgtggctctggctgtgggg	0.711																																					p.30_33del		.											.	KRTAP5-5-23	0			c.89_99del						.			98,3952		6,86,1933						0.1	0.0			32	211,7787		8,195,3796	no	frameshift	KRTAP5-5	NM_001001480.2		14,281,5729	A1A1,A1R,RR		2.6382,2.4198,2.5647				309,11739				SO:0001589	frameshift_variant	439915	exon1			GTGGAGGCTGTGG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.89_99delGCTGTGGCTCT	11.37:g.1651159_1651169delGCTGTGGCTCT	ENSP00000382584:p.Gly30fs	5	0		110	7	NM_001001480	0	0	0	0	0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	0	0		19	19	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
OR52R1	119695	bcgsc.ca	37	11	4825349	4825349	+	Missense_Mutation	SNP	A	A	G	rs17327254	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:4825349A>G	ENST00000356069.2	-	1	261	c.262T>C	c.(262-264)Ttc>Ctc	p.F88L	OR52R1_ENST00000380382.1_Missense_Mutation_p.F167L|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	88			F -> L (in dbSNP:rs17327254).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGAAACCAGAATATGGCCAAC	0.517													A|||	157	0.0313498	0.0053	0.0548	5008	,	,		23740	0.0		0.0964	False		,,,				2504	0.0153				p.F88L		.											.	OR52R1-69	0			c.T262C						.	A	LEU/PHE	107,4295	82.4+/-120.9	1,105,2095	143.0	127.0	133.0		262	-2.7	0.5	11	dbSNP_123	133	845,7751	194.8+/-240.1	47,751,3500	yes	missense	OR52R1	NM_001005177.3	22	48,856,5595	GG,GA,AA		9.8302,2.4307,7.3242	benign	88/316	4825349	952,12046	2201	4298	6499	SO:0001583	missense	119695	exon1			ACCAGAATATGGC	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.262T>C	11.37:g.4825349A>G	ENSP00000348368:p.Phe88Leu	210	2		195	7	NM_001005177	0	0	0	0	0	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	101	0.04624542124542125	2	0.0040650406504065045	25	0.06906077348066299	0	0.0	74	0.09762532981530343	A	12.39	1.922678	0.33908	0.024307	0.098302	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00912	5.55;5.55	5.57	-2.66	0.06077	GPCR, rhodopsin-like superfamily (1);	0.443885	0.19125	N	0.122063	T	0.00039	0.0001	L	0.31845	0.965	0.53688	P	2.6999999999999247E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.38714	-0.9648	9	0.46703	T	0.11	.	13.3316	0.60490	0.8457:0.0:0.1543:0.0	rs17327254;rs52793345;rs17327254	88	Q8NGF1	O52R1_HUMAN	L	88;167	ENSP00000348368:F88L;ENSP00000369742:F167L	ENSP00000348368:F88L	F	-	1	0	OR52R1	4781925	0.013000	0.17824	0.458000	0.27068	0.944000	0.59088	0.193000	0.17116	-0.316000	0.08690	0.528000	0.53228	TTC	A|0.937;G|0.063		0.517	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
OR52E2	119678	bcgsc.ca	37	11	5080844	5080844	+	Missense_Mutation	SNP	T	T	C	rs16909440	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:5080844T>C	ENST00000321522.2	-	1	13	c.14A>G	c.(13-15)aAt>aGt	p.N5S		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	5			N -> S (in dbSNP:rs16909440).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		CTGGGTGTCATTGGGAAGGAA	0.498													T|||	1548	0.309105	0.1853	0.353	5008	,	,		20137	0.3829		0.3241	False		,,,				2504	0.3538				p.N5S		.											.	OR52E2-71	0			c.A14G						.	T	SER/ASN	969,3433	364.4+/-316.9	112,745,1344	86.0	78.0	81.0		14	3.6	0.1	11	dbSNP_123	81	3017,5579	465.4+/-366.5	536,1945,1817	yes	missense	OR52E2	NM_001005164.2	46	648,2690,3161	CC,CT,TT		35.0977,22.0127,30.6663	probably-damaging	5/326	5080844	3986,9012	2201	4298	6499	SO:0001583	missense	119678	exon1			GTGTCATTGGGAA	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.14A>G	11.37:g.5080844T>C	ENSP00000322088:p.Asn5Ser	115	0		96	6	NM_001005164	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321522.2	37	CCDS31371.1	703	0.3218864468864469	102	0.2073170731707317	141	0.38950276243093923	219	0.38286713286713286	241	0.3179419525065963	T	14.76	2.632936	0.47049	0.220127	0.350977	ENSG00000176787	ENST00000321522	T	0.63913	-0.07	3.61	3.61	0.41365	.	0.000000	0.51477	D	0.000083	T	0.00012	0.0000	M	0.69823	2.125	0.38469	P	0.05258499999999999	D	0.53885	0.963	P	0.49140	0.601	T	0.34428	-0.9829	9	0.72032	D	0.01	.	7.0024	0.24817	0.0:0.1073:0.0:0.8927	rs16909440;rs52834501;rs16909440	5	Q8NGJ4	O52E2_HUMAN	S	5	ENSP00000322088:N5S	ENSP00000322088:N5S	N	-	2	0	OR52E2	5037420	0.130000	0.22417	0.051000	0.19133	0.011000	0.07611	0.736000	0.26130	1.885000	0.54596	0.533000	0.62120	AAT	C|0.306;N|0.000		0.498	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000478367.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		0	0		6	4	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
CKAP5	9793	bcgsc.ca	37	11	46784697	46784697	+	Silent	SNP	A	A	C	rs7928445	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:46784697A>C	ENST00000529230.1	-	30	3766	c.3720T>G	c.(3718-3720)ggT>ggG	p.G1240G	CKAP5_ENST00000354558.3_Silent_p.G1240G|CKAP5_ENST00000312055.5_Silent_p.G1240G|SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000415402.1_Silent_p.G1240G			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1240					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GATCCAGGCAACCAATAACTC	0.343													A|||	638	0.127396	0.3381	0.049	5008	,	,		19215	0.001		0.0875	False		,,,				2504	0.0695				p.G1240G	Ovarian(4;85 273 2202 4844 13323)	.											.	CKAP5-92	0			c.T3720G						.	A	,	1356,3046	441.0+/-346.2	216,924,1061	149.0	164.0	159.0		3720,3720	1.8	1.0	11	dbSNP_116	159	793,7805	183.5+/-231.7	43,707,3549	no	coding-synonymous,coding-synonymous	CKAP5	NM_001008938.3,NM_014756.3	,	259,1631,4610	CC,CA,AA		9.2231,30.8042,16.5308	,	1240/2033,1240/1973	46784697	2149,10851	2201	4299	6500	SO:0001819	synonymous_variant	9793	exon30			CAGGCAACCAATA		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.3720T>G	11.37:g.46784697A>C		136	0		84	5	NM_001008938	0	0	0	0	0	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	37	CCDS31477.1																																																																																			A|0.851;C|0.149		0.343	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
OR5M11	219487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56310261	56310261	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:56310261T>C	ENST00000528616.2	-	1	496	c.473A>G	c.(472-474)cAg>cGg	p.Q158R		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CAGGATGGCCTGGAAGAGTCC	0.493																																					p.Q158R		.											.	.	0			c.A473G						.						42.0	45.0	44.0					11																	56310261		2093	4240	6333	SO:0001583	missense	219487	exon1			ATGGCCTGGAAGA	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.473A>G	11.37:g.56310261T>C	ENSP00000432417:p.Gln158Arg	169	0		120	38	NM_001005245	0	0	0	0	0	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	37	CCDS53629.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964706	0.53507	.	.	ENSG00000255223	ENST00000528616	T	0.00115	8.71	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00328	0.0010	L	0.51914	1.62	0.35051	D	0.760685	D	0.60575	0.988	D	0.64877	0.93	T	0.82754	-0.0301	9	0.87932	D	0	.	12.7091	0.57080	0.0:0.0:0.0:1.0	.	158	Q96RB7	OR5MB_HUMAN	R	158	ENSP00000432417:Q158R	ENSP00000432417:Q158R	Q	-	2	0	OR5M11	56066837	0.075000	0.21258	0.688000	0.30117	0.258000	0.26162	2.734000	0.47368	2.227000	0.72691	0.514000	0.50259	CAG	.		0.493	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		0	0		4	4	NM_003273	0	0	0	0	0	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
RHOD	29984	ucsc.edu	37	11	66834252	66834252	+	Silent	SNP	C	C	T	rs2282502	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:66834252C>T	ENST00000308831.2	+	3	349	c.264C>T	c.(262-264)gaC>gaT	p.D88D	RHOD_ENST00000532559.1_Intron|RHOD_ENST00000533360.1_Silent_p.D88D	NM_014578.3	NP_055393	O00212	RHOD_HUMAN	ras homolog family member D	88					actin filament bundle assembly (GO:0051017)|focal adhesion assembly (GO:0048041)|GTP catabolic process (GO:0006184)|lamellipodium assembly (GO:0030032)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			lung(3)	3						TCTACCCTGACGCCAGCGTCC	0.617													c|||	1912	0.381789	0.1566	0.5115	5008	,	,		19622	0.4524		0.3628	False		,,,				2504	0.5409				p.D88D		.											.	RHOD-659	0			c.C264T						.	T		832,3568	327.7+/-300.2	82,668,1450	160.0	144.0	149.0		264	-9.8	0.1	11	dbSNP_100	149	3126,5464	476.4+/-369.4	574,1978,1743	no	coding-synonymous	RHOD	NM_014578.3		656,2646,3193	TT,TC,CC		36.3912,18.9091,30.4696		88/211	66834252	3958,9032	2200	4295	6495	SO:0001819	synonymous_variant	29984	exon3			CCCTGACGCCAGC	D85815	CCDS8155.1, CCDS73330.1	11q14.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000173156	ENSG00000173156			670	protein-coding gene	gene with protein product	"""Rho-related protein HP1"", ""Rho-related GTP-binding protein RhoD"""	605781	"""ras homolog gene family, member D"""	ARHD		9116026	Standard	NM_014578		Approved	RhoHP1, RhoD, Rho	uc001ojv.3	O00212	OTTHUMG00000167102	ENST00000308831.2:c.264C>T	11.37:g.66834252C>T		84	1		53	6	NM_014578	0	0	0	0	0		Silent	SNP	ENST00000308831.2	37	CCDS8155.1																																																																																			C|0.683;G|0.000;T|0.317		0.617	RHOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393136.1	NM_014578	
UNC93B1	81622	broad.mit.edu	37	11	67763107	67763107	+	Silent	SNP	A	A	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:67763107A>G	ENST00000227471.2	-	10	1414	c.1335T>C	c.(1333-1335)agT>agC	p.S445S	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	446					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGTTCAGGGCACTGCCCACAC	0.617																																					.		.											.	.	0			.						.						10.0	10.0	10.0					11																	67763107		1758	3730	5488	SO:0001819	synonymous_variant	81622	.			CAGGGCACTGCCC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1335T>C	11.37:g.67763107A>G		82	1		77	7	.	0	0	0	0	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																				.		0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_030930	
ARHGAP20	57569	bcgsc.ca	37	11	110450453	110450453	+	Missense_Mutation	SNP	G	G	T	rs149514977		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:110450453G>T	ENST00000260283.4	-	16	3501	c.3217C>A	c.(3217-3219)Cca>Aca	p.P1073T	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.P1047T|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.P1047T|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.P1037T|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.P1037T|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.P1050T|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.P616T	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1073					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		TGTGGGGGTGGCTCTAAGGGT	0.498																																					p.P1073T		.											.	ARHGAP20-230	0			c.C3217A						.						90.0	100.0	97.0					11																	110450453		2201	4298	6499	SO:0001583	missense	57569	exon16			GGGGTGGCTCTAA	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.3217C>A	11.37:g.110450453G>T	ENSP00000260283:p.Pro1073Thr	48	0		65	4	NM_020809	0	0	0	0	0	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.387991	0.42308	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.09073	3.02;3.02;3.08;3.02;3.03;3.02;3.03	5.9	2.86	0.33363	.	0.866215	0.09950	N	0.734827	T	0.06781	0.0173	L	0.40543	1.245	0.09310	N	1	B;B;B	0.31548	0.328;0.1;0.328	B;B;B	0.30495	0.079;0.054;0.116	T	0.44251	-0.9340	10	0.13853	T	0.58	.	5.4232	0.16411	0.2668:0.1465:0.5867:0.0	.	1047;1073;1050	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	T	1073;1047;616;1050;1037;1047;1037	ENSP00000260283:P1073T;ENSP00000349660:P1047T;ENSP00000437905:P616T;ENSP00000432076:P1050T;ENSP00000436319:P1037T;ENSP00000436522:P1047T;ENSP00000431399:P1037T	ENSP00000260283:P1073T	P	-	1	0	ARHGAP20	109955663	0.376000	0.25098	0.018000	0.16275	0.558000	0.35554	0.954000	0.29175	0.320000	0.23234	0.650000	0.86243	CCA	G|1.000;C|0.000		0.498	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
DRD2	1813	bcgsc.ca	37	11	113283459	113283459	+	Silent	SNP	G	G	A	rs6277	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr11:113283459G>A	ENST00000362072.3	-	7	1301	c.957C>T	c.(955-957)ccC>ccT	p.P319P	DRD2_ENST00000346454.3_Silent_p.P290P|DRD2_ENST00000535984.1_5'Flank|DRD2_ENST00000542968.1_Silent_p.P319P|DRD2_ENST00000544518.1_Silent_p.P318P|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000355319.2_Silent_p.P321P|DRD2_ENST00000538967.1_Silent_p.P321P	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	319	Interaction with PPP1R9B. {ECO:0000250}.				activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGGGGCTGTCGGGAGTGCTGT	0.617													G|||	1222	0.24401	0.0552	0.3256	5008	,	,		14821	0.0625		0.5437	False		,,,				2504	0.32				p.P319P		.											.	DRD2-92	0			c.C957T	GRCh37	CM030215	DRD2	M	rs6277	.	G	,	628,3774	272.8+/-271.0	49,530,1622	116.0	98.0	104.0		957,870	-9.2	0.0	11	dbSNP_52	104	4685,3907	604.2+/-394.8	1292,2101,903	no	coding-synonymous,coding-synonymous	DRD2	NM_000795.3,NM_016574.3	,	1341,2631,2525	AA,AG,GG		45.4725,14.2662,40.8881	,	319/444,290/415	113283459	5313,7681	2201	4296	6497	SO:0001819	synonymous_variant	1813	exon7			GCTGTCGGGAGTG	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.957C>T	11.37:g.113283459G>A		186	0		158	7	NM_000795	0	0	0	0	0	Q9NZR3|Q9UPA9	Silent	SNP	ENST00000362072.3	37	CCDS8361.1																																																																																			G|0.641;A|0.359		0.617	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
NCAPD2	9918	bcgsc.ca	37	12	6632430	6632430	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr12:6632430C>A	ENST00000315579.5	+	17	2931	c.2132C>A	c.(2131-2133)gCc>gAc	p.A711D	NCAPD2_ENST00000545962.1_Missense_Mutation_p.A666D|NCAPD2_ENST00000542492.1_3'UTR	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	711					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						TCCCACAGAGCCAAGGCCCAG	0.498																																					p.A711D		.											.	NCAPD2-660	0			c.C2132A						.						127.0	123.0	124.0					12																	6632430		2203	4300	6503	SO:0001583	missense	9918	exon17			ACAGAGCCAAGGC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2132C>A	12.37:g.6632430C>A	ENSP00000325017:p.Ala711Asp	66	0		66	4	NM_014865	0	0	0	0	0	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	37	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080797	0.76528	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.52754	0.65;0.65;0.65	5.74	5.74	0.90152	Armadillo-type fold (1);	0.328747	0.37437	N	0.002088	T	0.52484	0.1737	L	0.54323	1.7	0.58432	D	0.999992	P;P;D	0.54601	0.935;0.941;0.967	P;P;P	0.57009	0.681;0.811;0.701	T	0.41288	-0.9517	10	0.12766	T	0.61	-20.1971	9.9538	0.41655	0.0:0.7887:0.1396:0.0718	.	666;672;711	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	D	711;583;666;583	ENSP00000325017:A711D;ENSP00000371895:A583D;ENSP00000444417:A666D	ENSP00000325017:A711D	A	+	2	0	NCAPD2	6502691	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	1.191000	0.32138	2.873000	0.98535	0.561000	0.74099	GCC	.		0.498	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
RERG	85004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	15262053	15262053	+	Silent	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr12:15262053G>A	ENST00000256953.2	-	5	927	c.591C>T	c.(589-591)atC>atT	p.I197I	RERG_ENST00000546331.1_Silent_p.I178I|RERG_ENST00000538313.1_Silent_p.I197I|RERG_ENST00000536465.1_Silent_p.I197I	NM_032918.2	NP_116307.1	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	197					negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to hormone (GO:0009725)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	estrogen receptor binding (GO:0030331)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.I197I(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16						CCTAACTACTGATTTTGGTGA	0.493																																					p.I197I		.											.	RERG-659	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C591T						.						142.0	131.0	135.0					12																	15262053		2203	4300	6503	SO:0001819	synonymous_variant	85004	exon5			ACTACTGATTTTG	AF339750	CCDS8673.1, CCDS53753.1	12p13.1	2014-05-09			ENSG00000134533	ENSG00000134533			15980	protein-coding gene	gene with protein product		612664				11533059	Standard	NM_032918		Approved	MGC15754	uc001rct.3	Q96A58	OTTHUMG00000168745	ENST00000256953.2:c.591C>T	12.37:g.15262053G>A		163	0		342	57	NM_032918	0	0	0	0	0	B2R9R0|B4DI02	Silent	SNP	ENST00000256953.2	37	CCDS8673.1																																																																																			.		0.493	RERG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400882.1	NM_032918	
NFE2	4778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54686624	54686624	+	Missense_Mutation	SNP	C	C	T	rs139796996		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr12:54686624C>T	ENST00000540264.2	-	2	1165	c.656G>A	c.(655-657)cGg>cAg	p.R219Q	NFE2_ENST00000435572.2_Missense_Mutation_p.R219Q|NFE2_ENST00000312156.4_Missense_Mutation_p.R219Q|NFE2_ENST00000553070.1_Missense_Mutation_p.R219Q|RP11-968A15.8_ENST00000553061.1_RNA			Q16621	NFE2_HUMAN	nuclear factor, erythroid 2	219					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|hemostasis (GO:0007599)|labyrinthine layer blood vessel development (GO:0060716)|multicellular organismal development (GO:0007275)|negative regulation of bone mineralization (GO:0030502)|negative regulation of syncytium formation by plasma membrane fusion (GO:0034242)|nucleosome disassembly (GO:0006337)|positive regulation of peptidyl-lysine acetylation (GO:2000758)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(7)|upper_aerodigestive_tract(2)	16						TGCCTCCCCCCGTGCAGTGGG	0.582																																					p.R219Q		.											.	NFE2-226	0			c.G656A						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	36.0	33.0	34.0		656,656	4.9	1.0	12	dbSNP_134	34	0,8600		0,0,4300	no	missense,missense	NFE2	NM_001136023.1,NM_006163.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	219/374,219/374	54686624	1,13005	2203	4300	6503	SO:0001583	missense	4778	exon4			TCCCCCCGTGCAG	BC005044	CCDS8876.1	12q13	2013-08-23	2013-08-23			ENSG00000123405		"""basic leucine zipper proteins"""	7780	protein-coding gene	gene with protein product		601490	"""nuclear factor (erythroid-derived 2), 45kD"", ""nuclear factor (erythroid-derived 2), 45kDa"""			8355703	Standard	NM_001136023		Approved	NF-E2	uc001sfr.5	Q16621		ENST00000540264.2:c.656G>A	12.37:g.54686624C>T	ENSP00000439120:p.Arg219Gln	161	0		164	45	NM_001261461	0	0	0	0	0	Q07720|Q6ICV9	Missense_Mutation	SNP	ENST00000540264.2	37	CCDS8876.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502389	0.85176	2.27E-4	0.0	ENSG00000123405	ENST00000312156;ENST00000435572;ENST00000540264;ENST00000553070;ENST00000553198	.	.	.	4.9	4.9	0.64082	.	0.395534	0.23734	N	0.045094	T	0.19604	0.0471	N	0.08118	0	0.28762	N	0.900867	D	0.57571	0.98	P	0.47603	0.551	T	0.03717	-1.1010	9	0.45353	T	0.12	-15.7595	9.3534	0.38151	0.0:0.9046:0.0:0.0954	.	219	Q16621	NFE2_HUMAN	Q	219	.	ENSP00000312436:R219Q	R	-	2	0	NFE2	52972891	0.063000	0.20901	0.995000	0.50966	0.998000	0.95712	2.064000	0.41432	2.711000	0.92665	0.655000	0.94253	CGG	C|1.000;T|0.000		0.582	NFE2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405747.1	NM_006163	
C12orf29	91298	hgsc.bcm.edu;bcgsc.ca	37	12	88434018	88434020	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	TGT	TGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr12:88434018_88434020delTGT	ENST00000356891.3	+	2	387_389	c.184_186delTGT	c.(184-186)tgtdel	p.C63del	C12orf29_ENST00000548757.2_3'UTR	NM_001009894.2	NP_001009894.2	Q8N999	CL029_HUMAN	chromosome 12 open reading frame 29	63					hematopoietic progenitor cell differentiation (GO:0002244)					large_intestine(3)|lung(1)|ovary(1)	5						GGATGGAACATGTTGTTATGTTA	0.291																																					p.62_62del		.											.	C12orf29-90	0			c.184_186del						.																																			SO:0001651	inframe_deletion	91298	exon2			GGAACATGTTGTT	AL137488	CCDS31866.1	12q21.32	2012-05-30			ENSG00000133641	ENSG00000133641			25322	protein-coding gene	gene with protein product						14702039	Standard	NM_001009894		Approved	DKFZp434N2030	uc001tao.3	Q8N999	OTTHUMG00000169870	ENST00000356891.3:c.184_186delTGT	12.37:g.88434021_88434023delTGT	ENSP00000349358:p.Cys63del	259	2		485	172	NM_001009894	0	0	0	0	0	Q569K5|Q6AWA8|Q6PEK5|Q8IYQ5|Q9NT75	In_Frame_Del	DEL	ENST00000356891.3	37	CCDS31866.1																																																																																			.		0.291	C12orf29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406335.1	NM_001009894	
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	128900026	128900026	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr12:128900026G>A	ENST00000435159.2	+	2	835	c.835G>A	c.(835-837)Gac>Aac	p.D279N		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	279						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCGGGCCCAGGACAGCGCCCA	0.627																																					p.D279N		.											.	TMEM132C-68	0			c.G835A						.						52.0	59.0	57.0					12																	128900026		692	1591	2283	SO:0001583	missense	92293	exon2			GCCCAGGACAGCG	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.835G>A	12.37:g.128900026G>A	ENSP00000410852:p.Asp279Asn	242	0		652	144	NM_001136103	0	0	0	0	0	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	G	15.18	2.757253	0.49468	.	.	ENSG00000181234	ENST00000435159	T	0.10763	2.84	5.09	4.2	0.49525	.	.	.	.	.	T	0.12390	0.0301	M	0.65498	2.005	0.27592	N	0.949254	P	0.43094	0.799	B	0.36092	0.217	T	0.11470	-1.0586	9	0.15952	T	0.53	.	13.6908	0.62544	0.0747:0.0:0.9253:0.0	.	279	Q8N3T6	T132C_HUMAN	N	279	ENSP00000410852:D279N	ENSP00000410852:D279N	D	+	1	0	TMEM132C	127465979	0.988000	0.35896	0.597000	0.28824	0.972000	0.66771	5.295000	0.65692	1.274000	0.44362	0.655000	0.94253	GAC	.		0.627	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
GPC5	2262	bcgsc.ca	37	13	92345579	92345579	+	Missense_Mutation	SNP	C	C	T	rs553717	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr13:92345579C>T	ENST00000377067.3	+	3	836	c.464C>T	c.(463-465)gCg>gTg	p.A155V		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	155			A -> V (in dbSNP:rs553717).		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTATTTGGTGCGGATGTTAAT	0.443													C|||	986	0.196885	0.1936	0.1513	5008	,	,		18441	0.2897		0.1481	False		,,,				2504	0.1881				p.A155V		.											.	GPC5-519	0			c.C464T						.	C	VAL/ALA	822,3584	328.5+/-300.6	67,688,1448	153.0	156.0	155.0		464	4.2	0.8	13	dbSNP_83	155	970,7630	211.4+/-252.0	45,880,3375	yes	missense	GPC5	NM_004466.4	64	112,1568,4823	TT,TC,CC		11.2791,18.6564,13.7783	benign	155/573	92345579	1792,11214	2203	4300	6503	SO:0001583	missense	2262	exon3			TTGGTGCGGATGT	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.464C>T	13.37:g.92345579C>T	ENSP00000366267:p.Ala155Val	84	0		110	5	NM_004466	0	0	0	0	0	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	379	0.17353479853479853	78	0.15853658536585366	44	0.12154696132596685	165	0.28846153846153844	92	0.12137203166226913	C	14.72	2.620512	0.46736	0.186564	0.112791	ENSG00000179399	ENST00000377067	T	0.54071	0.59	5.07	4.19	0.49359	.	0.330872	0.32518	N	0.005993	T	0.00012	0.0000	L	0.46157	1.445	0.27994	P	0.9355561	B	0.15473	0.013	B	0.15870	0.014	T	0.09862	-1.0655	9	0.59425	D	0.04	.	11.2088	0.48786	0.0:0.9046:0.0:0.0954	rs553717;rs52808980;rs57920264;rs553717	155	P78333	GPC5_HUMAN	V	155	ENSP00000366267:A155V	ENSP00000366267:A155V	A	+	2	0	GPC5	91143580	0.601000	0.26907	0.790000	0.31976	0.620000	0.37586	2.728000	0.47319	1.044000	0.40200	0.467000	0.42956	GCG	T|0.121;G|0.170		0.443	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
RBM23	55147	broad.mit.edu	37	14	23374128	23374128	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr14:23374128T>C	ENST00000359890.3	-	9	1015	c.820A>G	c.(820-822)Atc>Gtc	p.I274V	RBM23_ENST00000555209.1_Missense_Mutation_p.I24V|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000542016.2_Missense_Mutation_p.I104V|RBM23_ENST00000346528.5_Missense_Mutation_p.I240V|RBM23_ENST00000399922.2_Missense_Mutation_p.I258V	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	274	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		TCTTCAGTGATATTGAAGTGC	0.522																																					p.I274V		.											.	RBM23-91	0			c.A820G						.						183.0	185.0	185.0					14																	23374128		1921	4125	6046	SO:0001583	missense	55147	exon9			CAGTGATATTGAA	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.820A>G	14.37:g.23374128T>C	ENSP00000352956:p.Ile274Val	143	1		109	4	NM_001077351	0	0	0	0	0	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Missense_Mutation	SNP	ENST00000359890.3	37	CCDS41921.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.6|25.6	4.653239|4.653239	0.88056|0.88056	.|.	.|.	ENSG00000100461|ENSG00000100461	ENST00000555209;ENST00000359890;ENST00000338980;ENST00000399922;ENST00000346528;ENST00000542016;ENST00000557403|ENST00000553884	T;T;T;T;T;T|.	0.14893|.	2.47;2.47;2.47;2.47;2.47;3.48|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.49201|0.49201	0.1543|0.1543	N|N	0.16602|0.16602	0.42|0.42	0.50632|0.50632	D|D	0.999886|0.999886	P;P;P;P|.	0.50710|.	0.542;0.505;0.505;0.938|.	P;P;P;P|.	0.61874|.	0.493;0.493;0.493;0.895|.	T|T	0.46414|0.46414	-0.9193|-0.9193	10|5	0.87932|.	D|.	0|.	-17.566|-17.566	14.7419|14.7419	0.69461|0.69461	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	274;240;258;274|.	Q86U06-3;Q86U06-4;Q86U06-2;Q86U06|.	.;.;.;RBM23_HUMAN|.	V|C	24;274;251;258;240;104;104|48	ENSP00000452602:I24V;ENSP00000352956:I274V;ENSP00000382806:I258V;ENSP00000339220:I240V;ENSP00000438504:I104V;ENSP00000452171:I104V|.	ENSP00000305783:I274V|.	I|Y	-|-	1|2	0|0	RBM23|RBM23	22443968|22443968	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	5.628000|5.628000	0.67791|0.67791	2.127000|2.127000	0.65507|0.65507	0.533000|0.533000	0.62120|0.62120	ATC|TAT	.		0.522	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3		
TMEM63C	57156	bcgsc.ca	37	14	77708804	77708804	+	Silent	SNP	C	C	T	rs61731611	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr14:77708804C>T	ENST00000298351.4	+	14	1323	c.1179C>T	c.(1177-1179)gaC>gaT	p.D393D		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	393					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		ACCCCAAAGACATTATTTGGT	0.542													C|||	733	0.146366	0.0106	0.1902	5008	,	,		19087	0.1042		0.2555	False		,,,				2504	0.2301				p.D393D		.											.	.	0			c.C1179T						.	C		190,3786		4,182,1802	178.0	173.0	175.0		1179	4.1	1.0	14	dbSNP_129	175	2000,6328		234,1532,2398	no	coding-synonymous	TMEM63C	NM_020431.2		238,1714,4200	TT,TC,CC		24.0154,4.7787,17.7991		393/807	77708804	2190,10114	1988	4164	6152	SO:0001819	synonymous_variant	57156	exon14			CAAAGACATTATT		CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.1179C>T	14.37:g.77708804C>T		171	2		139	8	NM_020431	0	0	0	0	0	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Silent	SNP	ENST00000298351.4	37	CCDS45141.1																																																																																			C|0.813;T|0.187		0.542	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414193.1		
AHNAK2	113146	bcgsc.ca	37	14	105410183	105410183	+	Missense_Mutation	SNP	T	T	C	rs10438246	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr14:105410183T>C	ENST00000333244.5	-	7	11724	c.11605A>G	c.(11605-11607)Atg>Gtg	p.M3869V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3869			M -> V (in dbSNP:rs10438246).			costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGAGTTTCATGTCCACCTGG	0.602													.|||	2784	0.555911	0.643	0.5144	5008	,	,		18090	0.4127		0.5348	False		,,,				2504	0.637				p.M3869V		.											.	AHNAK2-47	0			c.A11605G						.	C	VAL/MET	2678,1266		920,838,214	130.0	137.0	135.0		11605	-2.0	0.0	14	dbSNP_119	135	4528,3782		1252,2024,879	yes	missense	AHNAK2	NM_138420.2	21	2172,2862,1093	CC,CT,TT		45.5114,32.0994,41.1947	benign	3869/5796	105410183	7206,5048	1972	4155	6127	SO:0001583	missense	113146	exon7			GTTTCATGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11605A>G	14.37:g.105410183T>C	ENSP00000353114:p.Met3869Val	249	3		212	10	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	1148	0.5256410256410257	324	0.6585365853658537	200	0.5524861878453039	222	0.3881118881118881	402	0.5303430079155673	t	0.010	-1.780679	0.00634	0.679006	0.544886	ENSG00000185567	ENST00000333244	T	0.00882	5.58	3.67	-2.03	0.07365	.	.	.	.	.	T	0.00012	0.0000	N	0.00985	-1.075	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.01834	-1.1264	8	0.12430	T	0.62	.	6.3549	0.21397	0.0:0.5117:0.1168:0.3714	rs10438246;rs59225031;rs10438246	3869	Q8IVF2	AHNK2_HUMAN	V	3869	ENSP00000353114:M3869V	ENSP00000353114:M3869V	M	-	1	0	AHNAK2	104481228	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.234000	0.00546	-0.909000	0.03852	-2.717000	0.00132	ATG	T|0.456;C|0.544		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	bcgsc.ca	37	14	105416010	105416010	+	Silent	SNP	T	T	C	rs2582511	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr14:105416010T>C	ENST00000333244.5	-	7	5897	c.5778A>G	c.(5776-5778)acA>acG	p.T1926T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1926						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTTAACATCTGTCTGGGGGC	0.622													.|||	2922	0.583466	0.7057	0.4755	5008	,	,		16374	0.3998		0.6014	False		,,,				2504	0.6656				p.T1926T		.											.	AHNAK2-47	0			c.A5778G						.	C		2698,1050		1055,588,231	126.0	138.0	134.0		5778	-2.6	0.0	14	dbSNP_100	134	4926,3192		1693,1540,826	no	coding-synonymous	AHNAK2	NM_138420.2		2748,2128,1057	CC,CT,TT		39.32,28.0149,35.7492		1926/5796	105416010	7624,4242	1874	4059	5933	SO:0001819	synonymous_variant	113146	exon7			AACATCTGTCTGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5778A>G	14.37:g.105416010T>C		125	0		153	7	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			T|0.428;C|0.572		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DMXL2	23312	broad.mit.edu	37	15	51756879	51756879	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr15:51756879G>T	ENST00000251076.5	-	32	8085	c.7798C>A	c.(7798-7800)Cca>Aca	p.P2600T	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.P2601T|DMXL2_ENST00000449909.3_Missense_Mutation_p.P1964T	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2600						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TACTTGAATGGGGTATTTTCA	0.378																																					p.P2601T		.											.	DMXL2-99	0			c.C7801A						.						72.0	70.0	71.0					15																	51756879		2196	4293	6489	SO:0001583	missense	23312	exon32			TGAATGGGGTATT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7798C>A	15.37:g.51756879G>T	ENSP00000251076:p.Pro2600Thr	52	0		70	3	NM_001174116	0	0	0	0	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671578	0.88348	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.49720	0.86;0.85;0.77	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.74038	0.3664	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.991;0.997;1.0	T	0.77035	-0.2737	10	0.87932	D	0	.	19.6873	0.95984	0.0:0.0:1.0:0.0	.	2601;1964;2600;2601	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	T	2600;2601;1964;145	ENSP00000251076:P2600T;ENSP00000441858:P2601T;ENSP00000400855:P1964T	ENSP00000251076:P2600T	P	-	1	0	DMXL2	49544171	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.263000	0.95617	2.890000	0.99128	0.585000	0.79938	CCA	.		0.378	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		6	6	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
MTFMT	123263	hgsc.bcm.edu	37	15	65321780	65321780	+	Missense_Mutation	SNP	A	A	T	rs188718836	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr15:65321780A>T	ENST00000220058.4	-	1	185	c.172T>A	c.(172-174)Ttc>Atc	p.F58I	MTFMT_ENST00000561025.1_5'Flank	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	58						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TCGCGGGCGAACTGGTCCGTG	0.761													A|||	27	0.00539137	0.0008	0.0058	5008	,	,		9222	0.0		0.0119	False		,,,				2504	0.0102				p.F58I		.											.	MTFMT-24	0			c.T172A						.	A	ILE/PHE	5,2325		0,5,1160	2.0	3.0	2.0		172	3.6	0.5	15		2	49,5611		0,49,2781	yes	missense	MTFMT	NM_139242.3	21	0,54,3941	TT,TA,AA		0.8657,0.2146,0.6758	probably-damaging	58/390	65321780	54,7936	1165	2830	3995	SO:0001583	missense	123263	exon1			GGGCGAACTGGTC	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.172T>A	15.37:g.65321780A>T	ENSP00000220058:p.Phe58Ile	0	0		20	18	NM_139242	0	0	0	0	0	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	10	0.004578754578754579	0	0.0	2	0.0055248618784530384	0	0.0	8	0.010554089709762533	A	20.5	3.997572	0.74818	0.002146	0.008657	ENSG00000103707	ENST00000220058;ENST00000543678	T;T	0.77877	-1.13;-1.13	4.83	3.62	0.41486	Formyl transferase, N-terminal (2);	0.049940	0.85682	D	0.000000	T	0.78629	0.4313	M	0.66378	2.025	0.42564	D	0.993154	D	0.57899	0.981	D	0.63033	0.91	T	0.82299	-0.0526	10	0.87932	D	0	-19.2998	8.2755	0.31871	0.8231:0.0:0.0:0.1769	.	58	Q96DP5	FMT_HUMAN	I	58	ENSP00000220058:F58I;ENSP00000443754:F58I	ENSP00000220058:F58I	F	-	1	0	MTFMT	63108833	0.988000	0.35896	0.512000	0.27736	0.150000	0.21749	3.146000	0.50631	1.802000	0.52723	0.528000	0.53228	TTC	A|0.995;T|0.005		0.761	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
HAPLN3	145864	bcgsc.ca	37	15	89430506	89430506	+	Silent	SNP	C	C	T	rs3743395	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr15:89430506C>T	ENST00000359595.3	-	2	238	c.24G>A	c.(22-24)ccG>ccA	p.P8P	HAPLN3_ENST00000562889.1_Silent_p.P70P	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	8					cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GCAGGAGCAACGGGACCAGGA	0.612													C|||	1020	0.203674	0.1755	0.2248	5008	,	,		18625	0.2222		0.2505	False		,,,				2504	0.1595				p.P8P		.											.	HAPLN3-90	0			c.G24A						.	C		815,3585	322.6+/-297.7	86,643,1471	107.0	95.0	99.0		24	-0.2	0.0	15	dbSNP_107	99	2267,6331	382.7+/-340.5	277,1713,2309	no	coding-synonymous	HAPLN3	NM_178232.2		363,2356,3780	TT,TC,CC		26.3666,18.5227,23.7113		8/361	89430506	3082,9916	2200	4299	6499	SO:0001819	synonymous_variant	145864	exon2			GAGCAACGGGACC	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.24G>A	15.37:g.89430506C>T		206	2		119	5	NM_178232	0	0	0	0	0	A8K7P0	Silent	SNP	ENST00000359595.3	37	CCDS10346.1																																																																																			C|0.770;T|0.230		0.612	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	EME2_ENST00000307394.7_Silent_p.V72V|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000177742.3_5'Flank|NME3_ENST00000563498.1_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		8	8	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		5	5	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
C16orf71	146562	bcgsc.ca	37	16	4797457	4797457	+	Missense_Mutation	SNP	C	C	T	rs17853375	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:4797457C>T	ENST00000299320.5	+	9	1872	c.1394C>T	c.(1393-1395)cCt>cTt	p.P465L	RP11-127I20.7_ENST00000588099.1_RNA|C16orf71_ENST00000590191.1_Missense_Mutation_p.P482L	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	465			P -> L (in dbSNP:rs17853375). {ECO:0000269|PubMed:15489334}.							breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						GCTCAGGCCCCTGAAGACACA	0.647													C|||	2143	0.427915	0.0582	0.5086	5008	,	,		17368	0.6528		0.5994	False		,,,				2504	0.4622				p.P465L		.											.	C16orf71-68	0			c.C1394T						.	C	LEU/PRO	621,3769		53,515,1627	30.0	35.0	33.0		1394	0.6	0.0	16	dbSNP_123	33	5119,3475		1552,2015,730	yes	missense	C16orf71	NM_139170.2	98	1605,2530,2357	TT,TC,CC		40.4352,14.1458,44.2083	probably-damaging	465/521	4797457	5740,7244	2195	4297	6492	SO:0001583	missense	146562	exon9			AGGCCCCTGAAGA	AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.1394C>T	16.37:g.4797457C>T	ENSP00000299320:p.Pro465Leu	99	1		188	6	NM_139170	0	0	0	0	0	Q8NCV0	Missense_Mutation	SNP	ENST00000299320.5	37	CCDS10521.1	1068	0.489010989010989	36	0.07317073170731707	187	0.5165745856353591	393	0.6870629370629371	452	0.5963060686015831	C	12.94	2.087887	0.36855	0.141458	0.595648	ENSG00000166246	ENST00000299320;ENST00000411541	T	0.33654	1.4	4.89	0.549	0.17213	.	1.628840	0.03628	N	0.237451	T	0.00012	0.0000	L	0.50333	1.59	0.80722	P	0.0	B	0.14805	0.011	B	0.11329	0.006	T	0.48328	-0.9045	9	0.51188	T	0.08	0.0573	4.3323	0.11069	0.3111:0.5144:0.0:0.1745	rs17853375	465	Q8IYS4	CP071_HUMAN	L	465;220	ENSP00000299320:P465L	ENSP00000299320:P465L	P	+	2	0	C16orf71	4737458	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.107000	0.10873	-0.045000	0.13468	-0.521000	0.04368	CCT	C|0.555;G|0.000;T|0.445		0.647	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1	NM_139170	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P|SEZ6L2_ENST00000562159.1_5'UTR	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	0	0		10	10	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
TAF1C	9013	ucsc.edu	37	16	84213114	84213114	+	Silent	SNP	C	C	T	rs2230130	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr16:84213114C>T	ENST00000567759.1	-	14	2225	c.2043G>A	c.(2041-2043)gtG>gtA	p.V681V	TAF1C_ENST00000378541.4_Silent_p.V681V|TAF1C_ENST00000541676.1_Silent_p.V588V|TAF1C_ENST00000566732.1_Silent_p.V655V|TAF1C_ENST00000570117.1_Silent_p.V349V|TAF1C_ENST00000341690.6_Silent_p.V587V	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	681					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CCTTGCGGAGCACACCCAGCC	0.687													C|||	1436	0.286741	0.1256	0.4135	5008	,	,		15010	0.371		0.3469	False		,,,				2504	0.2658				p.V681V		.											.	TAF1C-91	0			c.G2043A						.	C	,	749,3647		65,619,1514	24.0	25.0	24.0		2043,1761	-2.0	0.0	16	dbSNP_98	24	3086,5510		583,1920,1795	no	coding-synonymous,coding-synonymous	TAF1C	NM_005679.3,NM_139353.2	,	648,2539,3309	TT,TC,CC		35.9004,17.0382,29.5182	,	681/870,587/776	84213114	3835,9157	2198	4298	6496	SO:0001819	synonymous_variant	9013	exon14			GCGGAGCACACCC	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2043G>A	16.37:g.84213114C>T		11	1		64	22	NM_005679	0	0	0	0	0	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	CCDS32496.1																																																																																			C|0.709;T|0.291		0.687	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
OVCA2	124641	hgsc.bcm.edu	37	17	1945354	1945354	+	Silent	SNP	C	C	A	rs145234879	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:1945354C>A	ENST00000572195.1	+	1	28	c.13C>A	c.(13-15)Cga>Aga	p.R5R	RP11-667K14.4_ENST00000572404.1_RNA|DPH1_ENST00000570477.1_Intron|RP11-667K14.3_ENST00000572790.1_lincRNA|DPH1_ENST00000263083.6_Intron	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	5					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)										GGCCGCGCAGCGACCCCTGCG	0.706											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	35	0.00698882	0.0008	0.0101	5008	,	,		12991	0.0		0.0179	False		,,,				2504	0.0092				p.R5R		.											.	.	0			c.C13A						.	C	,	15,3905		0,15,1945	4.0	5.0	4.0		,13	3.8	0.0	17	dbSNP_134	4	137,7773		1,135,3819	no	intron,coding-synonymous	DPH1,OVCA2	NM_001383.3,NM_080822.2	,	1,150,5764	AA,AC,CC		1.732,0.3827,1.2849	,	,5/228	1945354	152,11678	1960	3955	5915	SO:0001819	synonymous_variant	124641	exon1			GCGCAGCGACCCC	AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.13C>A	17.37:g.1945354C>A		0	0	599	18	17	NM_080822	0	0	0	0	0	Q86XN3|Q8IW87|Q9UCX9	Silent	SNP	ENST00000572195.1	37	CCDS11015.1																																																																																			C|0.991;A|0.009		0.706	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255636.5	NM_080822	
ZZEF1	23140	bcgsc.ca	37	17	3916823	3916823	+	Silent	SNP	G	G	A	rs8075562	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:3916823G>A	ENST00000381638.2	-	52	8623	c.8499C>T	c.(8497-8499)ggC>ggT	p.G2833G		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2833							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GACAGGCCACGCCCACCAGCC	0.537													G|||	1011	0.201877	0.3033	0.2061	5008	,	,		14586	0.0734		0.2048	False		,,,				2504	0.1912				p.G2833G		.											.	ZZEF1-93	0			c.C8499T						.	G		1143,3263	406.6+/-333.9	156,831,1216	82.0	77.0	78.0		8499	-10.9	0.4	17	dbSNP_116	78	1659,6941	306.1+/-307.8	156,1347,2797	no	coding-synonymous	ZZEF1	NM_015113.3		312,2178,4013	AA,AG,GG		19.2907,25.9419,21.5439		2833/2962	3916823	2802,10204	2203	4300	6503	SO:0001819	synonymous_variant	23140	exon52			GGCCACGCCCACC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8499C>T	17.37:g.3916823G>A		100	0		76	5	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	37	CCDS11043.1																																																																																			G|0.778;A|0.222		0.537	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
CDRT15L2	256223	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	20483953	20483953	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:20483953C>T	ENST00000399044.1	+	2	777	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	253						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						TGCTCTCAGACGCAATCTTCT	0.532																																					p.R253C		.											.	.	0			c.C757T						.																																			SO:0001583	missense	256223	exon2			CTCAGACGCAATC		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.757C>T	17.37:g.20483953C>T	ENSP00000382000:p.Arg253Cys	226	0		135	111	NM_001190790	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399044.1	37	CCDS54096.1	.	.	.	.	.	.	.	.	.	.	.	0.452	-0.893113	0.02491	.	.	ENSG00000214819	ENST00000399044	T	0.51574	0.7	0.118	-0.237	0.13061	.	.	.	.	.	T	0.20007	0.0481	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.10382	-1.0632	6	0.46703	T	0.11	.	.	.	.	.	.	.	.	C	253	ENSP00000382000:R253C	ENSP00000382000:R253C	R	+	1	0	CDRT15L2	20424545	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.913000	0.04042	-2.872000	0.00322	-2.888000	0.00096	CGC	.		0.532	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132432.3	XM_170840	
VTN	7448	broad.mit.edu	37	17	26694766	26694766	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:26694766G>T	ENST00000226218.4	-	7	1912	c.1294C>A	c.(1294-1296)Ccc>Acc	p.P432T	VTN_ENST00000438614.1_Missense_Mutation_p.N15K|CTB-96E2.2_ENST00000555059.2_Missense_Mutation_p.P90T|TMEM199_ENST00000509083.1_Intron|VTN_ENST00000431468.1_5'Flank|VTN_ENST00000536498.1_Missense_Mutation_p.N15K|SARM1_ENST00000379061.4_Intron|CTB-96E2.3_ENST00000591482.1_RNA	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	432					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CTCTGGATGGGTTCACAGGTG	0.567																																					p.P432T		.											.	VTN-227	0			c.C1294A						.						84.0	78.0	80.0					17																	26694766		2203	4300	6503	SO:0001583	missense	7448	exon7			GGATGGGTTCACA	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.1294C>A	17.37:g.26694766G>T	ENSP00000226218:p.Pro432Thr	59	4		60	9	NM_000638	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.10|19.10	3.762215|3.762215	0.69763|0.69763	.|.	.|.	ENSG00000109072;ENSG00000109072;ENSG00000258852|ENSG00000255604	ENST00000536498;ENST00000438614;ENST00000555059|ENST00000226218	D;D|T	0.91351|0.02787	-2.83;-2.83|4.16	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Hemopexin/matrixin (2);	.|0.053333	.|0.85682	.|D	.|0.000000	T|T	0.04272|0.04272	0.0118|0.0118	L|L	0.41124|0.41124	1.26|1.26	0.58432|0.58432	D|D	0.999996|0.999996	B|P	0.29716|0.47034	0.255|0.889	B|B	0.22152|0.43658	0.038|0.426	T|T	0.47129|0.47129	-0.9141|-0.9141	9|10	0.05959|0.52906	T|T	0.93|0.07	-28.5166|-28.5166	12.8717|12.8717	0.57968|0.57968	0.0:0.0:0.8267:0.1733|0.0:0.0:0.8267:0.1733	.|.	15|432	C9JDG5|P04004	.|VTNC_HUMAN	K|T	15;15;41|432	ENSP00000444503:N15K;ENSP00000395142:N15K|ENSP00000226218:P432T	ENSP00000395142:N15K|ENSP00000226218:P432T	N|P	-|-	3|1	2|0	VTN;CTB-96E2.2|AC002094.1	23718893|23718893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	5.801000|5.801000	0.69115|0.69115	2.645000|2.645000	0.89757|0.89757	0.460000|0.460000	0.39030|0.39030	AAC|CCC	.		0.567	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
RNF135	84282	hgsc.bcm.edu	37	17	29298390	29298390	+	Missense_Mutation	SNP	A	A	G	rs368080023	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:29298390A>G	ENST00000328381.5	+	1	1172	c.299A>G	c.(298-300)cAc>cGc	p.H100R	RNF135_ENST00000443677.2_Missense_Mutation_p.H100R|RNF135_ENST00000535306.2_Missense_Mutation_p.H100R|RNF135_ENST00000324689.4_Missense_Mutation_p.H100R|RP11-848P1.2_ENST00000580979.1_RNA	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	100					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				GACCCTGCCCACTGCCCCTGC	0.756													A|||	6	0.00119808	0.0	0.0029	5008	,	,		10218	0.0		0.004	False		,,,				2504	0.0				p.H100R		.											.	RNF135-227	1	Unknown(1)	central_nervous_system(1)	c.A299G						.	A	ARG/HIS,ARG/HIS,ARG/HIS	0,2936		0,0,1468	2.0	2.0	2.0		299,299,299	-1.2	0.0	17		2	12,5934		0,12,2961	no	missense,missense,missense	RNF135	NM_001184992.1,NM_032322.3,NM_197939.1	29,29,29	0,12,4429	GG,GA,AA		0.2018,0.0,0.1351	benign,benign,benign	100/287,100/433,100/211	29298390	12,8870	1468	2973	4441	SO:0001583	missense	84282	exon1			CTGCCCACTGCCC	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.299A>G	17.37:g.29298390A>G	ENSP00000328340:p.His100Arg	0	0		6	6	NM_197939	0	0	0	0	0	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	.	.	.	.	.	.	.	.	.	.	a	0.017	-1.494607	0.01009	0.0	0.002018	ENSG00000181481	ENST00000328381;ENST00000324689;ENST00000535306;ENST00000443677	T;T;T	0.55588	0.51;3.04;3.0	0.605	-1.21	0.09524	Zinc finger, RING/FYVE/PHD-type (1);	0.542584	0.13900	N	0.354951	T	0.25644	0.0624	N	0.08118	0	0.09310	N	1	B;B;B;B	0.14012	0.003;0.009;0.005;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.10543	-1.0625	10	0.25106	T	0.35	-2.718	6.0937	0.20008	0.7348:0.2652:0.0:0.0	.	100;100;100;100	F5GX60;Q8IUD6-2;B2R7G9;Q8IUD6	.;.;.;RN135_HUMAN	R	100;100;100;34	ENSP00000328340:H100R;ENSP00000323693:H100R;ENSP00000440470:H100R	ENSP00000323693:H100R	H	+	2	0	RNF135	26322516	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.954000	0.03873	-1.399000	0.02063	-0.708000	0.03648	CAC	.		0.756	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
KRTAP4-8	728224	ucsc.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																					p.C95S		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T283A						.						7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224	exon1			AGATGCAGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	17	1		121	21	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	A|0.500;T|0.500		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
KRTAP4-11	653240	broad.mit.edu	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	G	C	rs141357429		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:39274087G>C	ENST00000391413.2	-	1	519	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.L161V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.657																																					p.L161V		.											.	.	1	Substitution - Missense(1)	prostate(1)	c.C481G						.						17.0	21.0	20.0					17																	39274087		692	1589	2281	SO:0001583	missense	653240	exon1			GACGCAGGCAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.481C>G	17.37:g.39274087G>C	ENSP00000375232:p.Leu161Val	48	1		159	23	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	249	0.11401098901098901	67	0.13617886178861788	40	0.11049723756906077	104	0.18181818181818182	38	0.05013192612137203	.	1.347	-0.592411	0.03799	.	.	ENSG00000212721	ENST00000391413	T	0.00614	6.21	4.35	0.986	0.19784	.	.	.	.	.	T	0.00012	0.0000	L	0.31752	0.955	0.80722	P	0.0	B	0.30068	0.267	B	0.18871	0.023	T	0.19063	-1.0317	8	0.11794	T	0.64	.	5.8913	0.18915	0.1751:0.0:0.6569:0.168	.	161	Q9BYQ6	KR411_HUMAN	V	161	ENSP00000375232:L161V	ENSP00000375232:L161V	L	-	1	2	KRTAP4-11	36527613	0.671000	0.27521	0.912000	0.35992	0.970000	0.65996	0.971000	0.29396	0.348000	0.23949	0.609000	0.83330	CTG	G|0.500;C|0.500		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
CDC27	996	hgsc.bcm.edu;bcgsc.ca	37	17	45234327	45234327	+	Missense_Mutation	SNP	C	C	T	rs7350889		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:45234327C>T	ENST00000066544.3	-	7	887	c.794G>A	c.(793-795)gGt>gAt	p.G265D	CDC27_ENST00000527547.1_Missense_Mutation_p.G265D|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.G204D|CDC27_ENST00000531206.1_Missense_Mutation_p.G265D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	265					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.G265D(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAACTTCGACCAGTTTTTGG	0.368																																					p.G265D		.											.	CDC27-291	2	Substitution - Missense(2)	skin(2)	c.G794A						.						60.0	65.0	63.0					17																	45234327		2201	4295	6496	SO:0001583	missense	996	exon7			CTTCGACCAGTTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.794G>A	17.37:g.45234327C>T	ENSP00000066544:p.Gly265Asp	45	0		28	5	NM_001114091	0	0	0	0	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725453	0.48833	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.3;-0.11;-0.31;0.86	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.32350	0.251;0.366;0.247;0.251	B;B;B;B	0.27076	0.045;0.056;0.076;0.055	T	0.51694	-0.8673	10	0.33141	T	0.24	1.6987	17.2083	0.86924	0.0:1.0:0.0:0.0	rs7350889;rs7350889	204;265;265;265	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	265;265;204;265;265	ENSP00000066544:G265D;ENSP00000434614:G265D;ENSP00000392802:G204D;ENSP00000437339:G265D;ENSP00000432105:G265D	ENSP00000066544:G265D	G	-	2	0	CDC27	42589326	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.618000	0.67722	2.665000	0.90641	0.460000	0.39030	GGT	C|1.000;|0.000		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
KPNA2	3838	bcgsc.ca	37	17	66039350	66039350	+	Silent	SNP	A	A	G	rs4638	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr17:66039350A>G	ENST00000537025.2	+	7	1421	c.801A>G	c.(799-801)gtA>gtG	p.V267V	KPNA2_ENST00000330459.3_Silent_p.V267V			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	267					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATCCAGAAGTATTAGCAGATA	0.473													a|||	2597	0.51857	0.4024	0.6585	5008	,	,		19618	0.2847		0.7276	False		,,,				2504	0.6022				p.V267V		.											.	KPNA2-560	0			c.A801G						.	A		1967,2439	555.1+/-379.2	455,1057,691	167.0	174.0	172.0		801	-6.0	1.0	17	dbSNP_52	172	6375,2225	709.1+/-405.7	2367,1641,292	no	coding-synonymous	KPNA2	NM_002266.2		2822,2698,983	GG,GA,AA		25.8721,44.6437,35.8604		267/530	66039350	8342,4664	2203	4300	6503	SO:0001819	synonymous_variant	3838	exon7			AGAAGTATTAGCA	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.801A>G	17.37:g.66039350A>G		102	0		57	4	NM_002266	0	0	0	0	0	B9EJD6|Q53YE3|Q9BRU5	Silent	SNP	ENST00000537025.2	37	CCDS32713.1																																																																																			A|0.406;G|0.594		0.473	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266	
EMILIN2	84034	bcgsc.ca	37	18	2885118	2885118	+	Silent	SNP	C	C	T	rs592120	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr18:2885118C>T	ENST00000254528.3	+	3	573	c.414C>T	c.(412-414)aaC>aaT	p.N138N		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	138					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GGCCTCGAAACAGCTTGAAGA	0.507													C|||	854	0.170527	0.1014	0.2406	5008	,	,		19637	0.0119		0.3668	False		,,,				2504	0.1759				p.N138N		.											.	EMILIN2-93	0			c.C414T						.	C		659,3747	276.6+/-273.2	67,525,1611	60.0	61.0	61.0		414	2.7	0.0	18	dbSNP_83	61	3165,5435	478.8+/-370.0	578,2009,1713	no	coding-synonymous	EMILIN2	NM_032048.2		645,2534,3324	TT,TC,CC		36.8023,14.9569,29.4018		138/1054	2885118	3824,9182	2203	4300	6503	SO:0001819	synonymous_variant	84034	exon3			TCGAAACAGCTTG	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.414C>T	18.37:g.2885118C>T		105	1		59	6	NM_032048	0	0	0	0	0	B2RMY3|Q8NBH3|Q96JQ4	Silent	SNP	ENST00000254528.3	37	CCDS11828.1																																																																																			C|0.763;T|0.237		0.507	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
TWSG1	57045	hgsc.bcm.edu	37	18	9399488	9399488	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr18:9399488G>T	ENST00000262120.5	+	5	826	c.635G>T	c.(634-636)gGt>gTt	p.G212V		NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	212					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						ATTGACTATGGTAGTAAAACT	0.358																																					p.G212V		.											.	TWSG1-92	0			c.G635T						.						99.0	94.0	96.0					18																	9399488		2203	4300	6503	SO:0001583	missense	57045	exon5			ACTATGGTAGTAA	AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.635G>T	18.37:g.9399488G>T	ENSP00000262120:p.Gly212Val	85	0		51	4	NM_020648	0	0	0	0	0	B2RE08|D3DUH9|Q8NBI7|Q96K46	Missense_Mutation	SNP	ENST00000262120.5	37	CCDS11844.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768316	0.90020	.	.	ENSG00000128791	ENST00000262120	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.83825	0.5338	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86867	0.2033	9	0.87932	D	0	-31.1142	17.3385	0.87289	0.0:0.0:1.0:0.0	.	212	Q9GZX9	TWSG1_HUMAN	V	212	.	ENSP00000262120:G212V	G	+	2	0	TWSG1	9389488	1.000000	0.71417	0.972000	0.41901	0.986000	0.74619	9.771000	0.98977	2.341000	0.79615	0.455000	0.32223	GGT	.		0.358	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2		
ST8SIA5	29906	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	44260305	44260305	+	Silent	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr18:44260305G>A	ENST00000315087.7	-	7	1491	c.831C>T	c.(829-831)ttC>ttT	p.F277F	ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000538168.1_Silent_p.F313F|ST8SIA5_ENST00000536490.1_Silent_p.F246F	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	277					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						ACTGCGGATGGAAGTAGTAGA	0.622																																					p.F277F		.											.	ST8SIA5-517	0			c.C831T						.						121.0	80.0	94.0					18																	44260305		2203	4300	6503	SO:0001819	synonymous_variant	29906	exon7			CGGATGGAAGTAG	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.831C>T	18.37:g.44260305G>A		124	2		203	81	NM_013305	0	0	0	0	0	B7Z1K9|Q6IAW7	Silent	SNP	ENST00000315087.7	37	CCDS11930.1																																																																																			.		0.622	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
CDH7	1005	bcgsc.ca	37	18	63511176	63511176	+	Silent	SNP	T	T	C	rs2306675	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr18:63511176T>C	ENST00000397968.2	+	7	1536	c.1110T>C	c.(1108-1110)gaT>gaC	p.D370D	CDH7_ENST00000323011.3_Silent_p.D370D|CDH7_ENST00000536984.2_Silent_p.D370D	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		D -> E (in dbSNP:rs2306675).		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D370D(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTGTGGAAGATGTAGATGAGC	0.502													T|||	932	0.186102	0.1528	0.2205	5008	,	,		12857	0.0377		0.3489	False		,,,				2504	0.1922				p.D370D		.											.	CDH7-94	1	Substitution - coding silent(1)	stomach(1)	c.T1110C						.	T	,	856,3550	334.9+/-303.7	88,680,1435	188.0	156.0	167.0		1110,1110	-7.5	0.8	18	dbSNP_100	167	2914,5686	455.7+/-363.9	488,1938,1874	no	coding-synonymous,coding-synonymous	CDH7	NM_004361.2,NM_033646.1	,	576,2618,3309	CC,CT,TT		33.8837,19.4281,28.9866	,	370/786,370/786	63511176	3770,9236	2203	4300	6503	SO:0001819	synonymous_variant	1005	exon7			GGAAGATGTAGAT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1110T>C	18.37:g.63511176T>C		189	2		210	6	NM_004361	0	0	0	0	0	Q9H157	Silent	SNP	ENST00000397968.2	37	CCDS11993.1																																																																																			T|0.756;C|0.244		0.502	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CCDC102B	79839	broad.mit.edu;ucsc.edu	37	18	66721363	66721363	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr18:66721363C>T	ENST00000360242.5	+	8	1648	c.1531C>T	c.(1531-1533)Caa>Taa	p.Q511*	CCDC102B_ENST00000319445.6_Nonsense_Mutation_p.Q511*	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	511										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CAGGCACTTGCAAAACTGGTA	0.338																																					p.Q511X		.											.	CCDC102B-93	0			c.C1531T						.						57.0	59.0	59.0					18																	66721363		2203	4300	6503	SO:0001587	stop_gained	79839	exon10			CACTTGCAAAACT	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1531C>T	18.37:g.66721363C>T	ENSP00000353377:p.Gln511*	12	0		12	5	NM_001093729	0	0	0	0	0	Q7Z467|Q8NDK7|Q9H5C1	Nonsense_Mutation	SNP	ENST00000360242.5	37	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216356	0.39201	.	.	ENSG00000150636	ENST00000319445;ENST00000360242	.	.	.	4.94	2.1	0.27182	.	0.481828	0.15372	U	0.265804	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.6949	3.5635	0.07890	0.1739:0.565:0.168:0.0931	.	.	.	.	X	511	.	ENSP00000316237:Q511X	Q	+	1	0	CCDC102B	64872343	0.836000	0.29430	0.064000	0.19789	0.114000	0.19823	0.599000	0.24089	0.138000	0.18790	0.454000	0.30748	CAA	.		0.338	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		9	9	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
GRIN3B	116444	hgsc.bcm.edu	37	19	1003374	1003374	+	Silent	SNP	G	G	A	rs34585248	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:1003374G>A	ENST00000234389.3	+	2	691	c.672G>A	c.(670-672)gcG>gcA	p.A224A	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	224					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGATGGCGGCGCCAGTGGGGG	0.746													g|||	158	0.0315495	0.0015	0.0173	5008	,	,		11320	0.0754		0.0338	False		,,,				2504	0.0348				p.A224A		.											.	GRIN3B-90	0			c.G672A						.	G		37,3905		0,37,1934	4.0	6.0	5.0		672	-8.1	0.0	19	dbSNP_126	5	211,7611		3,205,3703	no	coding-synonymous	GRIN3B	NM_138690.1		3,242,5637	AA,AG,GG		2.6975,0.9386,2.1081		224/1044	1003374	248,11516	1971	3911	5882	SO:0001819	synonymous_variant	116444	exon2			GGCGGCGCCAGTG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.672G>A	19.37:g.1003374G>A		0	0		21	15	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Silent	SNP	ENST00000234389.3	37	CCDS32861.1																																																																																			G|0.966;A|0.034		0.746	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
GRIN3B	116444	hgsc.bcm.edu	37	19	1004687	1004687	+	Missense_Mutation	SNP	T	T	C	rs12978900	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:1004687T>C	ENST00000234389.3	+	3	1206	c.1187T>C	c.(1186-1188)tTg>tCg	p.L396S	GRIN3B_ENST00000588335.1_Intron|AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	396					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CAGCTGGACTTGGAACCGGGA	0.682													t|||	166	0.033147	0.0015	0.0173	5008	,	,		10955	0.0784		0.0338	False		,,,				2504	0.0399				p.L396S		.											.	GRIN3B-90	0			c.T1187C						.	T	SER/LEU	38,4326		0,38,2144	16.0	16.0	16.0		1187	-0.1	0.0	19	dbSNP_121	16	239,8321		2,235,4043	no	missense	GRIN3B	NM_138690.1	145	2,273,6187	CC,CT,TT		2.7921,0.8708,2.1433	benign	396/1044	1004687	277,12647	2182	4280	6462	SO:0001583	missense	116444	exon3			TGGACTTGGAACC		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1187T>C	19.37:g.1004687T>C	ENSP00000234389:p.Leu396Ser	0	0		40	18	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	70	0.03205128205128205	1	0.0020325203252032522	4	0.011049723756906077	39	0.06818181818181818	26	0.03430079155672823	T	2.347	-0.349767	0.05173	0.008708	0.027921	ENSG00000116032	ENST00000234389	T	0.12465	2.68	4.41	-0.073	0.13737	.	49.635500	0.01261	U	0.009180	T	0.00496	0.0016	N	0.02539	-0.55	0.09310	N	0.99999	B	0.18741	0.03	B	0.12837	0.008	T	0.32107	-0.9919	10	0.42905	T	0.14	.	8.5979	0.33727	0.0:0.271:0.0:0.729	rs12978900	396	O60391	NMD3B_HUMAN	S	396	ENSP00000234389:L396S	ENSP00000234389:L396S	L	+	2	0	GRIN3B	955687	0.231000	0.23751	0.001000	0.08648	0.017000	0.09413	0.570000	0.23653	-0.027000	0.13873	0.386000	0.25728	TTG	T|0.967;C|0.033		0.682	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
TMEM259	91304	hgsc.bcm.edu	37	19	1010673	1010673	+	Silent	SNP	G	G	A	rs11540362	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:1010673G>A	ENST00000356663.3	-	11	1660	c.1539C>T	c.(1537-1539)ccC>ccT	p.P513P	TMEM259_ENST00000333175.5_3'UTR	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	513						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CCACAGGCCCGGGACTCCCGC	0.731													N|||	173	0.0345447	0.0008	0.013	5008	,	,		9671	0.0962		0.0239	False		,,,				2504	0.0429				p.P513P		.											.	.	0			c.C1539T						.						2.0	2.0	2.0					19																	1010673		1290	3063	4353	SO:0001819	synonymous_variant	91304	exon11			AGGCCCGGGACTC	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1539C>T	19.37:g.1010673G>A		0	0		8	7	NM_001033026	0	0	0	0	0	O60392|Q8NF79|Q96H30	Silent	SNP	ENST00000356663.3	37	CCDS32862.1																																																																																			T|0.037;C|0.963		0.731	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		4	4	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
CHAF1A	10036	bcgsc.ca	37	19	4428809	4428809	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:4428809T>C	ENST00000301280.5	+	8	1627	c.1526T>C	c.(1525-1527)tTg>tCg	p.L509S	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	509					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTCCTTCTTGAAAGACCTC	0.612								Chromatin Structure																													p.L509S		.											.	CHAF1A-92	0			c.T1526C						.						40.0	43.0	42.0					19																	4428809		2203	4300	6503	SO:0001583	missense	10036	exon8			CCTTCTTGAAAGA	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1526T>C	19.37:g.4428809T>C	ENSP00000301280:p.Leu509Ser	75	0		52	4	NM_005483	0	0	0	0	0	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	T	16.65	3.181771	0.57800	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.21191	2.02	5.24	5.24	0.73138	.	.	.	.	.	T	0.44808	0.1311	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.43861	-0.9365	9	0.87932	D	0	-23.9892	14.2938	0.66298	0.0:0.0:0.0:1.0	.	509	Q13111	CAF1A_HUMAN	S	509	ENSP00000301280:L509S	ENSP00000301280:L509S	L	+	2	0	CHAF1A	4379809	1.000000	0.71417	0.878000	0.34440	0.104000	0.19210	6.906000	0.75719	1.969000	0.57287	0.454000	0.30748	TTG	.		0.612	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
PLIN4	729359	hgsc.bcm.edu	37	19	4499666	4499680	+	IGR	DEL	TGGCCGGGGAGGAGG	TGGCCGGGGAGGAGG	-	rs372794408		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	TGGCCGGGGAGGAGG	TGGCCGGGGAGGAGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:4499666_4499680delTGGCCGGGGAGGAGG	ENST00000301286.3	-	0	6341				HDGFRP2_ENST00000301284.4_In_Frame_Del_p.585_590LAGEEA>P|HDGFRP2_ENST00000586684.1_In_Frame_Del_p.585_590LAGEEA>P	NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4							cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						ggggaggagctggccggggaggaggccccccagga	0.66																																					p.580_585del		.											.	.	0			c.1739_1753del						.																																			SO:0001628	intergenic_variant	0	exon15			AGGAGCTGGCCGG	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571		19.37:g.4499666_4499680delTGGCCGGGGAGGAGG		12	0		25	15	NM_032631	0	0	0	0	0	A6NEI2	In_Frame_Del	DEL	ENST00000301286.3	37	CCDS45927.1																																																																																			.		0.660	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ZNF414	84330	hgsc.bcm.edu	37	19	8576670	8576670	+	Silent	SNP	C	C	T	rs7175	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:8576670C>T	ENST00000255616.8	-	5	806	c.705G>A	c.(703-705)ccG>ccA	p.P235P	ZNF414_ENST00000393927.4_Silent_p.P235P	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GCAGCGGGAACGGCAGGCCCG	0.771													C|||	1010	0.201677	0.2897	0.1686	5008	,	,		8403	0.1746		0.1988	False		,,,				2504	0.137				p.P235P		.											.	ZNF414-90	0			c.G705A						.	C	,	887,3039		132,623,1208	4.0	6.0	5.0		705,705	-2.0	0.0	19	dbSNP_52	5	1238,6388		127,984,2702	no	coding-synonymous,coding-synonymous	ZNF414	NM_001146175.1,NM_032370.2	,	259,1607,3910	TT,TC,CC		16.2339,22.593,18.3951	,	235/391,235/313	8576670	2125,9427	1963	3813	5776	SO:0001819	synonymous_variant	84330	exon5			CGGGAACGGCAGG	AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.705G>A	19.37:g.8576670C>T		0	0		16	15	NM_032370	0	0	0	0	0	A8MY94	Silent	SNP	ENST00000255616.8	37	CCDS12205.1																																																																																			C|0.788;T|0.212		0.771	ZNF414-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460199.2	NM_032370	
MUC16	94025	bcgsc.ca	37	19	9086318	9086318	+	Missense_Mutation	SNP	G	G	A	rs4520945	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:9086318G>A	ENST00000397910.4	-	1	5700	c.5497C>T	c.(5497-5499)Ctc>Ttc	p.L1833F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1833	Ser-rich.|Thr-rich.		L -> F (in dbSNP:rs4520945).		cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGAGAGTGAGAGAAATCCAT	0.478													G|||	952	0.190096	0.0711	0.2709	5008	,	,		22597	0.3036		0.172	False		,,,				2504	0.1953				p.L1833F		.											.	MUC16-566	0			c.C5497T						.	G	PHE/LEU	280,3662		5,270,1696	146.0	141.0	142.0		5497	0.7	0.0	19	dbSNP_111	142	1489,6845		126,1237,2804	yes	missense	MUC16	NM_024690.2	22	131,1507,4500	AA,AG,GG		17.8666,7.103,14.4102	probably-damaging	1833/14508	9086318	1769,10507	1971	4167	6138	SO:0001583	missense	94025	exon1			GAGTGAGAGAAAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5497C>T	19.37:g.9086318G>A	ENSP00000381008:p.Leu1833Phe	141	0		143	5	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	450	0.20604395604395603	37	0.07520325203252033	89	0.24585635359116023	193	0.3374125874125874	131	0.17282321899736147	g	2.939	-0.219341	0.06061	0.07103	0.178666	ENSG00000181143	ENST00000397910	T	0.03124	4.04	0.732	0.732	0.18283	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	.	.	.	D	0.62365	0.991	D	0.65323	0.934	T	0.55159	-0.8184	7	0.87932	D	0	.	.	.	.	rs4520945;rs52791576;rs60060127;rs4520945	1833	B5ME49	.	F	1833	ENSP00000381008:L1833F	ENSP00000381008:L1833F	L	-	1	0	MUC16	8947318	0.000000	0.05858	0.002000	0.10522	0.158000	0.22134	0.004000	0.13106	0.648000	0.30732	0.305000	0.20034	CTC	G|0.812;A|0.188		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
AP1M1	8907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16338981	16338981	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:16338981G>A	ENST00000291439.3	+	8	1299	c.850G>A	c.(850-852)Gag>Aag	p.E284K	AP1M1_ENST00000429941.2_Missense_Mutation_p.E284K|AP1M1_ENST00000541844.1_Missense_Mutation_p.E212K|AP1M1_ENST00000444449.2_Missense_Mutation_p.E296K|AP1M1_ENST00000590756.1_Missense_Mutation_p.E212K	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	284	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						GTCGGTGATCGAGAAGCACTC	0.592																																					p.E296K		.											.	AP1M1-156	0			c.G886A						.						96.0	72.0	80.0					19																	16338981		2203	4300	6503	SO:0001583	missense	8907	exon9			GTGATCGAGAAGC		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.850G>A	19.37:g.16338981G>A	ENSP00000291439:p.Glu284Lys	86	0		137	27	NM_001130524	0	0	0	0	0	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268988	0.59540	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	3.78	3.78	0.43462	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.24967	0.0606	N	0.25957	0.775	0.80722	D	1	B;D;D	0.69078	0.102;0.997;0.995	B;P;P	0.62813	0.037;0.907;0.9	T	0.02691	-1.1123	10	0.33141	T	0.24	-25.951	14.8184	0.70052	0.0:0.0:1.0:0.0	.	284;296;284	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	K	296;284;212;284	ENSP00000388996:E296K;ENSP00000291439:E284K;ENSP00000445682:E212K;ENSP00000411498:E284K	ENSP00000291439:E284K	E	+	1	0	AP1M1	16199981	1.000000	0.71417	0.956000	0.39512	0.973000	0.67179	9.356000	0.97091	1.955000	0.56771	0.561000	0.74099	GAG	.		0.592	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000540746.2_Silent_p.A226A|LSM14A_ENST00000544216.3_Silent_p.A267A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A		.											.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		68	1		84	5	NM_001114093	0	0	0	0	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
CYP2A13	1553	hgsc.bcm.edu	37	19	41596013	41596013	+	Silent	SNP	A	A	G	rs199984436		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:41596013A>G	ENST00000330436.3	+	3	405	c.405A>G	c.(403-405)ctA>ctG	p.L135L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	135					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TCGCCACCCTAAGGGGTTTTG	0.692																																					p.L135L		.											.	CYP2A13-93	0			c.A405G						.						23.0	24.0	24.0					19																	41596013		2201	4294	6495	SO:0001819	synonymous_variant	1553	exon3			CACCCTAAGGGGT	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.405A>G	19.37:g.41596013A>G		22	0		215	11	NM_000766	0	0	0	0	0	Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	ENST00000330436.3	37	CCDS12571.1																																																																																			A|0.999;G|0.001		0.692	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
CEACAM1	634	bcgsc.ca	37	19	43031407	43031407	+	Silent	SNP	C	C	G	rs79326931	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:43031407C>G	ENST00000161559.6	-	2	344	c.210G>C	c.(208-210)ggG>ggC	p.G70G	LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000358394.3_Silent_p.G70G|LIPE-AS1_ENST00000457234.2_RNA|CEACAM1_ENST00000308072.4_Silent_p.G30G|CEACAM1_ENST00000352591.5_Silent_p.G70G|CEACAM1_ENST00000599389.1_Silent_p.G70G|CEACAM1_ENST00000403444.3_Silent_p.G70G|CEACAM1_ENST00000351134.3_Silent_p.G70G|CEACAM1_ENST00000403461.1_Silent_p.G70G|LIPE-AS1_ENST00000594624.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	70	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	CCACTCTTTCCCCTTTGTACC	0.498																																					p.G70G		.											.	CEACAM1-515	0			c.G210C						.						235.0	189.0	205.0					19																	43031407		2203	4300	6503	SO:0001819	synonymous_variant	634	exon2			TCTTTCCCCTTTG	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.210G>C	19.37:g.43031407C>G		357	8		563	48	NM_001184816	0	0	0	0	0	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	ENST00000161559.6	37	CCDS12609.1																																																																																			C|0.939;G|0.061		0.498	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
CEACAM1	634	bcgsc.ca	37	19	43031434	43031434	+	Missense_Mutation	SNP	T	T	A	rs140316654		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:43031434T>A	ENST00000161559.6	-	2	317	c.183A>T	c.(181-183)caA>caT	p.Q61H	LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000358394.3_Missense_Mutation_p.Q61H|LIPE-AS1_ENST00000457234.2_RNA|CEACAM1_ENST00000308072.4_Missense_Mutation_p.Q21H|CEACAM1_ENST00000352591.5_Missense_Mutation_p.Q61H|CEACAM1_ENST00000599389.1_Missense_Mutation_p.Q61H|CEACAM1_ENST00000403444.3_Missense_Mutation_p.Q61H|CEACAM1_ENST00000351134.3_Missense_Mutation_p.Q61H|CEACAM1_ENST00000403461.1_Missense_Mutation_p.Q61H|LIPE-AS1_ENST00000594624.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	61	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	AGCCAAAAAGTTGCTGGGGCA	0.522																																					p.Q61H		.											.	CEACAM1-515	0			c.A183T						.						205.0	169.0	181.0					19																	43031434		2203	4300	6503	SO:0001583	missense	634	exon2			AAAAAGTTGCTGG	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.183A>T	19.37:g.43031434T>A	ENSP00000161559:p.Gln61His	316	6		511	36	NM_001184816	0	0	0	0	0	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Missense_Mutation	SNP	ENST00000161559.6	37	CCDS12609.1	.	.	.	.	.	.	.	.	.	.	a	9.737	1.163731	0.21538	.	.	ENSG00000079385	ENST00000161559;ENST00000358394;ENST00000351134;ENST00000446434;ENST00000378065;ENST00000352591;ENST00000403444;ENST00000403461;ENST00000308072;ENST00000377806;ENST00000344391;ENST00000403136	T;T;T;T;T;T;T	0.01527	4.8;4.8;4.8;4.8;4.8;4.8;4.8	3.6	-2.71	0.05986	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00637	0.0021	N	0.01048	-1.04	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B	0.08055	0.003;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.45804	-0.9236	9	0.41790	T	0.15	.	1.0812	0.01643	0.3:0.1745:0.3535:0.172	.	61;61;61;61;61;61;61;61;61;61	P13688-7;P13688-10;P13688-3;P13688-4;P13688-2;P13688-11;P13688-6;P13688-5;P13688-8;P13688	.;.;.;.;.;.;.;.;.;CEAM1_HUMAN	H	61;61;61;88;21;61;61;61;21;61;61;61	ENSP00000161559:Q61H;ENSP00000351165:Q61H;ENSP00000325946:Q61H;ENSP00000244291:Q61H;ENSP00000384709:Q61H;ENSP00000384083:Q61H;ENSP00000312184:Q21H	ENSP00000161559:Q61H	Q	-	3	2	CEACAM1	47723274	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.340000	0.02650	-0.660000	0.05352	-0.508000	0.04489	CAA	T|0.979;A|0.021		0.522	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
APOE	348	hgsc.bcm.edu	37	19	45411941	45411941	+	Missense_Mutation	SNP	T	T	C	rs429358	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:45411941T>C	ENST00000252486.4	+	4	499	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	130	8 X 22 AA approximate tandem repeats.		C -> R (in HLPP3; form E3**, form E4, form E4/3 and some forms E5-type; only form E3** is disease-linked; dbSNP:rs429358). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539, ECO:0000269|PubMed:9360638}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GGAGGACGTGTGCGGCCGCCT	0.736													c|||	754	0.150559	0.2678	0.1037	5008	,	,		8484	0.0863		0.1551	False		,,,				2504	0.0869				p.C130R		.											.	APOE-90	0			c.T388C	GRCh37	CM900020	APOE	M	rs429358	.	C	ARG/CYS	808,3460		86,636,1412	12.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	388	3.0	0.4	19	dbSNP_80	12	961,7261		66,829,3216	no	missense	APOE	NM_000041.2	180	152,1465,4628	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	11.6882,18.9316,14.1633	benign	130/318	45411941	1769,10721	2134	4111	6245	SO:0001583	missense	348	exon4			GACGTGTGCGGCC	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.388T>C	19.37:g.45411941T>C	ENSP00000252486:p.Cys130Arg	2	0		21	8	NM_000041	0	0	0	0	0	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	326	0.14926739926739926	128	0.2601626016260163	40	0.11049723756906077	50	0.08741258741258741	108	0.1424802110817942	C	0.007	-1.965077	0.00461	0.189316	0.116882	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.81078	-0.24;-1.45;-1.45	5.25	3.02	0.34903	Apolipoprotein/apolipophorin (1);	0.486559	0.18187	N	0.148941	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	0.02654	T	1	-8.1152	3.0382	0.06129	0.1694:0.5443:0.1863:0.1001	rs429358;rs630496;rs61228756	130	P02649	APOE_HUMAN	R	130;130;175;130	ENSP00000252486:C130R;ENSP00000413135:C130R;ENSP00000410423:C130R	ENSP00000252486:C130R	C	+	1	0	APOE	50103781	0.019000	0.18553	0.404000	0.26397	0.109000	0.19521	0.121000	0.15667	1.239000	0.43787	-0.215000	0.12644	TGC	T|0.861;C|0.139		0.736	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
CLASRP	11129	hgsc.bcm.edu	37	19	45567668	45567668	+	Missense_Mutation	SNP	C	C	A	rs71352251	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:45567668C>A	ENST00000221455.3	+	13	1287	c.1189C>A	c.(1189-1191)Cgc>Agc	p.R397S	CLASRP_ENST00000544944.2_Missense_Mutation_p.R397S|CLASRP_ENST00000391953.4_Missense_Mutation_p.R335S	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	397	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						ctccagctctcgctccagctc	0.751													C|||	9	0.00179712	0.0	0.0014	5008	,	,		8999	0.0		0.008	False		,,,				2504	0.0				p.R397S		.											.	CLASRP-154	0			c.C1189A						.	C	SER/ARG	15,3921		0,15,1953	7.0	8.0	8.0		1189	2.2	0.9	19	dbSNP_130	8	110,7628		0,110,3759	yes	missense	CLASRP	NM_007056.2	110	0,125,5712	AA,AC,CC		1.4216,0.3811,1.0708	benign	397/675	45567668	125,11549	1968	3869	5837	SO:0001583	missense	11129	exon13			AGCTCTCGCTCCA	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1189C>A	19.37:g.45567668C>A	ENSP00000221455:p.Arg397Ser	0	0		26	13	NM_007056	0	0	0	0	0	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	8	0.003663003663003663	0	0.0	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	C	9.225	1.034325	0.19590	0.003811	0.014216	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.10960	2.82;2.83;2.82;2.82	4.39	2.19	0.27852	.	0.442461	0.16641	N	0.205652	T	0.03695	0.0105	N	0.19112	0.55	0.47698	D	0.999495	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.0	T	0.29305	-1.0016	10	0.02654	T	1	-2.0521	9.152	0.36969	0.4644:0.5356:0.0:0.0	.	335;397;397	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	S	397;397;335;397	ENSP00000221455:R397S;ENSP00000375814:R397S;ENSP00000375815:R335S;ENSP00000438702:R397S	ENSP00000221455:R397S	R	+	1	0	CLASRP	50259508	0.075000	0.21258	0.922000	0.36590	0.800000	0.45204	0.653000	0.24902	0.414000	0.25790	0.563000	0.77884	CGC	C|0.996;A|0.004		0.751	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
ZNF610	162963	bcgsc.ca	37	19	52856955	52856955	+	Silent	SNP	C	C	T	rs1961205	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:52856955C>T	ENST00000403906.3	+	4	540	c.84C>T	c.(82-84)gaC>gaT	p.D28D	ZNF610_ENST00000327920.8_Silent_p.D28D|ZNF610_ENST00000321287.8_Silent_p.D28D|ZNF610_ENST00000601151.1_Silent_p.D28D	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D28D(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CATTCATGGACGTGGCCATCG	0.418													c|||	2073	0.413938	0.3903	0.3357	5008	,	,		17553	0.4504		0.3926	False		,,,				2504	0.4857				p.D28D		.											.	ZNF610-93	1	Substitution - coding silent(1)	stomach(1)	c.C84T						.	T	,,,	1815,2591	533.0+/-373.6	373,1069,761	96.0	96.0	96.0		84,84,84,84	-2.9	0.6	19	dbSNP_92	96	3259,5341	489.0+/-372.5	619,2021,1660	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF610	NM_001161425.1,NM_001161426.1,NM_001161427.1,NM_173530.2	,,,	992,3090,2421	TT,TC,CC		37.8953,41.1938,39.0128	,,,	28/463,28/463,28/420,28/463	52856955	5074,7932	2203	4300	6503	SO:0001819	synonymous_variant	162963	exon4			CATGGACGTGGCC	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.84C>T	19.37:g.52856955C>T		48	0		65	5	NM_001161427	0	0	0	0	0	A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	ENST00000403906.3	37	CCDS12851.1																																																																																			C|0.610;T|0.390		0.418	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530	
NAT14	57106	hgsc.bcm.edu	37	19	55998262	55998262	+	Missense_Mutation	SNP	C	C	T	rs77664073	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:55998262C>T	ENST00000205194.4	+	3	863	c.560C>T	c.(559-561)gCc>gTc	p.A187V	SSC5D_ENST00000587166.1_5'Flank|NAT14_ENST00000592719.1_Intron|NAT14_ENST00000587400.1_Intron|SSC5D_ENST00000389623.6_5'Flank	NM_020378.3	NP_065111.1	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14 (GCN5-related, putative)	187	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.			A -> V (in Ref. 1; BAB03716). {ECO:0000305}.	DNA-templated transcription, initiation (GO:0006352)|positive regulation of transcription, DNA-templated (GO:0045893)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|N-acetyltransferase activity (GO:0008080)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		GGCTACCAGGCCGAGGGGGGC	0.711													c|||	554	0.110623	0.0386	0.1441	5008	,	,		9391	0.0169		0.2237	False		,,,				2504	0.1646				p.A187V		.											.	NAT14-91	0			c.C560T						.	C	VAL/ALA	215,3605		12,191,1707	4.0	5.0	5.0		560	4.4	0.9	19	dbSNP_131	5	1480,6252		141,1198,2527	yes	missense	NAT14	NM_020378.3	64	153,1389,4234	TT,TC,CC		19.1412,5.6283,14.6728	benign	187/207	55998262	1695,9857	1910	3866	5776	SO:0001583	missense	57106	exon3			ACCAGGCCGAGGG	AB055059	CCDS12926.1	19q13.42	2011-11-25	2008-09-24		ENSG00000090971	ENSG00000090971			28918	protein-coding gene	gene with protein product	"""K562 cells-derived leucine zipper-like protein 1"""		"""N-acetyltransferase 14"""			10873651	Standard	NM_020378		Approved	KLP1	uc002qle.2	Q8WUY8		ENST00000205194.4:c.560C>T	19.37:g.55998262C>T	ENSP00000205194:p.Ala187Val	2	0		10	6	NM_020378	0	0	0	0	0	Q8TDY7|Q9NS72	Missense_Mutation	SNP	ENST00000205194.4	37	CCDS12926.1	265	0.12133699633699634	16	0.032520325203252036	68	0.1878453038674033	9	0.015734265734265736	172	0.22691292875989447	.	12.63	1.996150	0.35226	0.056283	0.191412	ENSG00000090971	ENST00000205194	.	.	.	4.45	4.45	0.53987	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.650048	0.13405	N	0.390290	T	0.00012	0.0000	N	0.05487	-0.04	0.36105	P	0.15562399999999998	B	0.09022	0.002	B	0.04013	0.001	T	0.11842	-1.0571	8	0.02654	T	1	-32.8565	8.7563	0.34648	0.0:0.8938:0.0:0.1062	.	187	Q8WUY8	NAT14_HUMAN	V	187	.	ENSP00000205194:A187V	A	+	2	0	NAT14	60690074	0.000000	0.05858	0.929000	0.37066	0.863000	0.49368	0.495000	0.22483	2.207000	0.71202	0.462000	0.41574	GCC	C|0.873;T|0.127		0.711	NAT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453339.1	NM_020378	
ZSCAN1	284312	hgsc.bcm.edu	37	19	58549354	58549354	+	Silent	SNP	C	C	T	rs113374422	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr19:58549354C>T	ENST00000282326.1	+	3	397	c.150C>T	c.(148-150)agC>agT	p.S50S	ZSCAN1_ENST00000601162.1_Silent_p.S50S|ZSCAN1_ENST00000391700.1_Silent_p.S50S	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	50	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ACGTGGCGAGCGGGCCGCACC	0.706													C|||	83	0.0165735	0.0038	0.0187	5008	,	,		10978	0.0		0.0586	False		,,,				2504	0.0061				p.S50S		.											.	ZSCAN1-92	0			c.C150T						.	C		34,4340		0,34,2153	14.0	16.0	15.0		150	-3.9	0.0	19	dbSNP_132	15	319,8239		2,315,3962	no	coding-synonymous	ZSCAN1	NM_182572.3		2,349,6115	TT,TC,CC		3.7275,0.7773,2.7297		50/409	58549354	353,12579	2187	4279	6466	SO:0001819	synonymous_variant	284312	exon3			GGCGAGCGGGCCG	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.150C>T	19.37:g.58549354C>T		0	0		41	29	NM_182572	0	0	0	0	0	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	ENST00000282326.1	37	CCDS12969.1																																																																																			C|0.975;T|0.025		0.706	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
Unknown	0	bcgsc.ca	37	2	98129815	98129815	+	IGR	SNP	T	T	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr2:98129815T>G								AC159540.1 (38766 upstream) : ANKRD36B (34212 downstream)																							TTTTTCTTGCTGTATGGCAAA	0.333																																					p.Q878P		.											.	.	0			c.A2633C						.						13.0	15.0	15.0					2																	98129815		1506	3684	5190	SO:0001628	intergenic_variant	57730	exon38			TCTTGCTGTATGG																													2.37:g.98129815T>G		238	6		249	27	NM_025190	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.333								
RGPD4	285190	broad.mit.edu	37	2	108475928	108475928	+	Missense_Mutation	SNP	C	C	T	rs143215949	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr2:108475928C>T	ENST00000408999.3	+	11	1629	c.1552C>T	c.(1552-1554)Ctt>Ttt	p.L518F	RGPD4_ENST00000354986.4_Missense_Mutation_p.L518F	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	518					protein targeting to Golgi (GO:0000042)			p.L518F(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ATGCCTGCCCCTTCCTGTATG	0.393																																					p.L518F		.											.	RGPD4-2	1	Substitution - Missense(1)	skin(1)	c.C1552T						.	C	PHE/LEU	20,1364		0,20,672	115.0	99.0	104.0		1552	1.7	1.0	2	dbSNP_134	104	15,3167		0,15,1576	no	missense	RGPD4	NM_182588.2	22	0,35,2248	TT,TC,CC		0.4714,1.4451,0.7665	probably-damaging	518/1759	108475928	35,4531	692	1591	2283	SO:0001583	missense	285190	exon11			CTGCCCCTTCCTG	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.1552C>T	2.37:g.108475928C>T	ENSP00000386810:p.Leu518Phe	256	0		187	6	NM_182588	0	0	0	0	0	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	5.511	0.279200	0.10458	0.014451	0.004714	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.50548	0.74;0.74	2.6	1.7	0.24286	.	.	.	.	.	T	0.34803	0.0910	M	0.69823	2.125	0.27171	N	0.960928	B	0.06786	0.001	B	0.06405	0.002	T	0.33317	-0.9873	9	0.38643	T	0.18	-11.7549	6.3947	0.21605	0.0:0.7319:0.0:0.2681	.	518	Q7Z3J3	RGPD4_HUMAN	F	518;518;276	ENSP00000347081:L518F;ENSP00000386810:L518F	ENSP00000347081:L518F	L	+	1	0	RGPD4	107842360	0.830000	0.29337	0.968000	0.41197	0.263000	0.26337	1.503000	0.35715	0.308000	0.22923	0.152000	0.16155	CTT	.		0.393	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
CLK1	1195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201726549	201726549	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr2:201726549C>T	ENST00000321356.4	-	2	172	c.37G>A	c.(37-39)Gat>Aat	p.D13N	CLK1_ENST00000434813.2_Missense_Mutation_p.D55N|CLK1_ENST00000492793.1_Intron|Y_RNA_ENST00000516950.1_RNA	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	13					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TCCTTGTCATCCCAATCAGGA	0.413																																					p.D55N		.											.	CLK1-784	0			c.G163A						.						143.0	130.0	135.0					2																	201726549		2203	4300	6503	SO:0001583	missense	1195	exon2			TGTCATCCCAATC	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.37G>A	2.37:g.201726549C>T	ENSP00000326830:p.Asp13Asn	112	0		177	63	NM_001162407	0	0	0	0	0	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	37	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589301	0.86851	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000434813	T;T	0.66995	-0.2;-0.24	5.27	4.34	0.51931	.	0.327983	0.31734	N	0.007159	T	0.74199	0.3685	M	0.62723	1.935	0.33377	D	0.574299	D;D	0.65815	0.995;0.979	P;P	0.57468	0.821;0.69	T	0.77930	-0.2403	10	0.28530	T	0.3	.	15.4775	0.75497	0.1387:0.8613:0.0:0.0	.	55;13	B4DFW7;P49759	.;CLK1_HUMAN	N	13;13;55	ENSP00000326830:D13N;ENSP00000394734:D55N	ENSP00000326830:D13N	D	-	1	0	CLK1	201434794	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.837000	0.39201	2.613000	0.88420	0.637000	0.83480	GAT	.		0.413	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
COL6A3	1293	bcgsc.ca	37	2	238243464	238243464	+	Missense_Mutation	SNP	C	C	G	rs2270669	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr2:238243464C>G	ENST00000295550.4	-	41	9486	c.9034G>C	c.(9034-9036)Gct>Cct	p.A3012P	COL6A3_ENST00000472056.1_Missense_Mutation_p.A2405P|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2806P|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2806P|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2812P|COL6A3_ENST00000347401.3_Missense_Mutation_p.A2811P	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	3012	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region.		A -> P (in dbSNP:rs2270669). {ECO:0000269|PubMed:1689238}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGGGGCTCAGCCCTCTCCCAG	0.512													G|||	3968	0.792332	0.9841	0.67	5008	,	,		17731	0.7312		0.7873	False		,,,				2504	0.6881				p.A3012P		.											.	COL6A3-526	0			c.G9034C						.	G	PRO/ALA,PRO/ALA,PRO/ALA	4167,239	138.4+/-174.2	1968,231,4	79.0	85.0	83.0		8416,7213,9034	5.3	1.0	2	dbSNP_100	83	6694,1906	338.7+/-322.9	2619,1456,225	yes	missense,missense,missense	COL6A3	NM_057167.3,NM_057166.4,NM_004369.3	27,27,27	4587,1687,229	GG,GC,CC		22.1628,5.4244,16.4924	benign,benign,benign	2806/2972,2405/2571,3012/3178	238243464	10861,2145	2203	4300	6503	SO:0001583	missense	1293	exon41			GCTCAGCCCTCTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.9034G>C	2.37:g.238243464C>G	ENSP00000295550:p.Ala3012Pro	176	1		190	7	NM_004369	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	1754	0.8031135531135531	479	0.9735772357723578	255	0.7044198895027625	426	0.7447552447552448	594	0.783641160949868	G	13.26	2.183382	0.38511	0.945756	0.778372	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08	5.29	5.29	0.74685	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.53938	N	0.000045	T	0.00012	0.0000	N	0.00146	-1.995	0.42989	P	0.005514000000000019	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43426	-0.9392	9	0.02654	T	1	.	16.1489	0.81599	0.0:0.1337:0.8663:0.0	rs2270669;rs52811857;rs58929103;rs2270669	2405;2806;3012	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	P	3012;2811;2806;2405;2806;2812	ENSP00000295550:A3012P;ENSP00000315609:A2811P;ENSP00000315873:A2806P;ENSP00000418285:A2405P;ENSP00000386844:A2806P;ENSP00000295546:A2812P	ENSP00000295550:A3012P	A	-	1	0	COL6A3	237908203	1.000000	0.71417	0.956000	0.39512	0.486000	0.33341	5.502000	0.66956	1.247000	0.43917	-0.215000	0.12644	GCT	C|0.334;G|0.666		0.512	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
COL6A3	1293	bcgsc.ca	37	2	238249630	238249630	+	Silent	SNP	C	C	T	rs4433949	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr2:238249630C>T	ENST00000295550.4	-	38	8381	c.7929G>A	c.(7927-7929)gcG>gcA	p.A2643A	COL6A3_ENST00000472056.1_Silent_p.A2036A|COL6A3_ENST00000409809.1_Silent_p.A2437A|COL6A3_ENST00000353578.4_Silent_p.A2437A|COL6A3_ENST00000346358.4_Silent_p.A2443A|COL6A3_ENST00000347401.3_Silent_p.A2442A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2643	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGACCAGGTACGCTATGTACT	0.567													C|||	1715	0.342452	0.2133	0.3329	5008	,	,		21379	0.4802		0.4284	False		,,,				2504	0.2935				p.A2643A		.											.	COL6A3-526	0			c.G7929A						.	C	,,	1138,3268	405.1+/-333.4	155,828,1220	158.0	146.0	150.0		7929,6108,7311	-5.4	0.0	2	dbSNP_111	150	3646,4954	524.7+/-380.6	769,2108,1423	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	,,	924,2936,2643	TT,TC,CC		42.3953,25.8284,36.783	,,	2643/3178,2036/2571,2437/2972	238249630	4784,8222	2203	4300	6503	SO:0001819	synonymous_variant	1293	exon38			CAGGTACGCTATG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7929G>A	2.37:g.238249630C>T		165	1		187	12	NM_004369	0	0	0	0	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			C|0.625;T|0.375		0.567	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		0	0		9	4	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
ZCCHC3	85364	hgsc.bcm.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	CGG	CGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del		.											.	ZCCHC3-90	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del						.																																			SO:0001651	inframe_deletion	85364	exon1			ATGAGCCGGCGGC	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	0	0		14	14	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																			.		0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		5	5	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
IFT52	51098	bcgsc.ca	37	20	42264653	42264653	+	Splice_Site	SNP	G	G	A	rs41296223	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr20:42264653G>A	ENST00000373030.3	+	11	1141	c.1011G>A	c.(1009-1011)gcG>gcA	p.A337A	IFT52_ENST00000373039.4_Splice_Site_p.A337A	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	337					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TTCAGCCTGCGGTGAGTAGGT	0.547													G|||	57	0.0113818	0.0015	0.0159	5008	,	,		20237	0.0		0.0417	False		,,,				2504	0.002				p.A337A		.											.	IFT52-92	0			c.G1011A						.	G		29,4377	35.2+/-66.4	0,29,2174	77.0	72.0	74.0		1011	-0.1	1.0	20	dbSNP_127	74	333,8267	115.5+/-175.4	7,319,3974	yes	coding-synonymous-near-splice	IFT52	NM_016004.2		7,348,6148	AA,AG,GG		3.8721,0.6582,2.7833		337/438	42264653	362,12644	2203	4300	6503	SO:0001630	splice_region_variant	51098	exon11			GCCTGCGGTGAGT	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1011+1G>A	20.37:g.42264653G>A		97	0		54	4	NM_016004	0	0	0	0	0	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	ENST00000373030.3	37	CCDS33470.1																																																																																			G|0.975;A|0.025		0.547	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1	NM_016004	Silent
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	1	0		10	7	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		1	0		13	10	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
COL6A2	1292	hgsc.bcm.edu	37	21	47532288	47532288	+	Missense_Mutation	SNP	G	G	A	rs200710788	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr21:47532288G>A	ENST00000300527.4	+	3	615	c.511G>A	c.(511-513)Ggg>Agg	p.G171R	COL6A2_ENST00000409416.1_Missense_Mutation_p.G171R|COL6A2_ENST00000397763.1_Missense_Mutation_p.G171R|COL6A2_ENST00000310645.5_Missense_Mutation_p.G171R|COL6A2_ENST00000357838.4_Missense_Mutation_p.G171R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	171	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAGCCCCTGCGGGGGCATCAA	0.701													G|||	3	0.000599042	0.0	0.0014	5008	,	,		12603	0.0		0.002	False		,,,				2504	0.0				p.G171R		.											.	COL6A2-515	0			c.G511A						.	G	ARG/GLY,ARG/GLY,ARG/GLY	0,4298		0,0,2149	10.0	13.0	12.0		511,511,511	4.3	0.9	21		12	7,8393		0,7,4193	yes	missense,missense,missense	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	125,125,125	0,7,6342	AA,AG,GG		0.0833,0.0,0.0551	probably-damaging,probably-damaging,probably-damaging	171/1020,171/919,171/829	47532288	7,12691	2149	4200	6349	SO:0001583	missense	1292	exon3			CCCTGCGGGGGCA	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.511G>A	21.37:g.47532288G>A	ENSP00000300527:p.Gly171Arg	0	0		17	15	NM_058175	0	0	0	0	0	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166238	0.57476	0.0	8.33E-4	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000436769;ENST00000409416;ENST00000397763	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	4.34	4.34	0.51931	von Willebrand factor, type A (3);	0.056517	0.64402	D	0.000001	D	0.86814	0.6023	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.989	D	0.88259	0.2922	10	0.59425	D	0.04	-21.3107	17.2361	0.86999	0.0:0.0:1.0:0.0	.	171;171;171	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	R	171	ENSP00000300527:G171R;ENSP00000350497:G171R;ENSP00000312529:G171R;ENSP00000390418:G171R;ENSP00000387115:G171R;ENSP00000380870:G171R	ENSP00000300527:G171R	G	+	1	0	COL6A2	46356716	1.000000	0.71417	0.864000	0.33941	0.959000	0.62525	3.490000	0.53245	2.142000	0.66516	0.467000	0.42956	GGG	.		0.701	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
SNAP29	9342	bcgsc.ca	37	22	21213416	21213416	+	Silent	SNP	A	A	G	rs1061064	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr22:21213416A>G	ENST00000215730.7	+	1	146	c.18A>G	c.(16-18)aaA>aaG	p.K6K	PI4KA_ENST00000572273.1_5'Flank|PI4KA_ENST00000255882.6_5'Flank	NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	6					autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			CTTACCCTAAAAGCTACAATC	0.731													A|||	2021	0.403554	0.1604	0.4323	5008	,	,		12279	0.372		0.5249	False		,,,				2504	0.6196				p.K6K		.											.	SNAP29-278	0			c.A18G						.	A		909,3459		120,669,1395	10.0	12.0	12.0		18	-2.2	0.2	22	dbSNP_86	12	4457,4057		1243,1971,1043	no	coding-synonymous	SNAP29	NM_004782.3		1363,2640,2438	GG,GA,AA		47.6509,20.8104,41.655		6/259	21213416	5366,7516	2184	4257	6441	SO:0001819	synonymous_variant	9342	exon1			CCCTAAAAGCTAC	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.18A>G	22.37:g.21213416A>G		66	0		188	6	NM_004782	0	0	0	0	0		Silent	SNP	ENST00000215730.7	37	CCDS13784.1																																																																																			A|0.600;G|0.400		0.731	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	NM_004782	
TGFBR2	7048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	30713517	30713517	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:30713517A>G	ENST00000295754.5	+	4	1224	c.842A>G	c.(841-843)tAt>tGt	p.Y281C	TGFBR2_ENST00000359013.4_Missense_Mutation_p.Y306C	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	281	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						ATCTTTCCCTATGAGGAGTAT	0.498																																					p.Y306C		.											.	TGFBR2-1698	0			c.A917G						.						138.0	131.0	133.0					3																	30713517		2203	4300	6503	SO:0001583	missense	7048	exon5			TTCCCTATGAGGA		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.842A>G	3.37:g.30713517A>G	ENSP00000295754:p.Tyr281Cys	202	1		356	208	NM_001024847	0	0	0	0	0	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	A	9.496	1.101847	0.20632	.	.	ENSG00000163513	ENST00000295754;ENST00000359013	T;T	0.66099	-0.19;-0.19	5.02	3.82	0.43975	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.172480	0.53938	D	0.000057	T	0.48040	0.1478	N	0.25380	0.74	0.49687	D	0.999815	B;B	0.18863	0.011;0.031	B;B	0.27608	0.048;0.081	T	0.34030	-0.9845	10	0.37606	T	0.19	.	9.0967	0.36642	0.7066:0.0:0.0:0.2934	.	281;306	P37173;D2JYI1	TGFR2_HUMAN;.	C	281;306	ENSP00000295754:Y281C;ENSP00000351905:Y306C	ENSP00000295754:Y281C	Y	+	2	0	TGFBR2	30688521	0.995000	0.38212	0.873000	0.34254	0.954000	0.61252	3.433000	0.52834	0.707000	0.31934	0.533000	0.62120	TAT	.		0.498	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
CCR2	729230	broad.mit.edu	37	3	46400062	46400062	+	Intron	SNP	G	G	A	rs3092960	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:46400062G>A	ENST00000400888.2	+	1	980				CCR2_ENST00000292301.4_Intron|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Silent_p.T348T			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2						blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		CAACAAACACGCCTTCCACTG	0.438													G|||	221	0.0441294	0.0053	0.098	5008	,	,		20507	0.0		0.1332	False		,,,				2504	0.0123				p.T348T		.											.	CCR2-568	0			c.G1044A						.	G	,	39,1345		0,39,653	62.0	59.0	60.0		,1044	-5.9	0.0	3	dbSNP_103	60	463,2719		31,401,1159	no	intron,coding-synonymous	CCR2	NM_001123041.2,NM_001123396.1	,	31,440,1812	AA,AG,GG		14.5506,2.8179,10.9943	,	,348/361	46400062	502,4064	692	1591	2283	SO:0001627	intron_variant	729230	exon2			AAACACGCCTTCC		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.941+103G>A	3.37:g.46400062G>A		58	0		86	5	NM_001123396	0	0	0	0	0	A0AVQ3|B2RMT0|Q4VBL2	Silent	SNP	ENST00000400888.2	37	CCDS43078.1																																																																																			G|0.929;A|0.071		0.438	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		4	4	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		4	4	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CHST13	166012	hgsc.bcm.edu	37	3	126260995	126260995	+	Silent	SNP	C	C	T	rs7614066	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:126260995C>T	ENST00000319340.2	+	3	650	c.600C>T	c.(598-600)taC>taT	p.Y200Y		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	200					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		AGAGGCGCTACGGTGCACGCA	0.721													C|||	273	0.0545128	0.1248	0.0288	5008	,	,		7896	0.002		0.0258	False		,,,				2504	0.0613				p.Y200Y		.											.	CHST13-90	0			c.C600T						.	C		331,3793		10,311,1741	6.0	7.0	6.0		600	-5.3	0.2	3	dbSNP_116	6	189,7819		2,185,3817	no	coding-synonymous	CHST13	NM_152889.2		12,496,5558	TT,TC,CC		2.3601,8.0262,4.2862		200/342	126260995	520,11612	2062	4004	6066	SO:0001819	synonymous_variant	166012	exon3			GCGCTACGGTGCA	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.600C>T	3.37:g.126260995C>T		0	0		12	7	NM_152889	0	0	0	0	0	Q3SYA3|Q3SYA5	Silent	SNP	ENST00000319340.2	37	CCDS3039.1																																																																																			C|0.956;T|0.044		0.721	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
EEFSEC	60678	hgsc.bcm.edu	37	3	127872494	127872494	+	Silent	SNP	G	G	T	rs148745324	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:127872494G>T	ENST00000254730.6	+	1	198	c.144G>T	c.(142-144)acG>acT	p.T48T	EEFSEC_ENST00000483457.1_Silent_p.T48T|RUVBL1_ENST00000464873.1_5'UTR	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	48	G2. {ECO:0000255|PROSITE- ProRule:PRU01059}.|tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						GCGGCATCACGCTCGATCTGG	0.716													G|||	3	0.000599042	0.0	0.0014	5008	,	,		11738	0.0		0.0	False		,,,				2504	0.002				p.T48T		.											.	EEFSEC-91	0			c.G144T						.	G		6,4334		0,6,2164	11.0	13.0	12.0		144	2.3	1.0	3	dbSNP_134	12	34,8492		0,34,4229	no	coding-synonymous	EEFSEC	NM_021937.3		0,40,6393	TT,TG,GG		0.3988,0.1382,0.3109		48/597	127872494	40,12826	2170	4263	6433	SO:0001819	synonymous_variant	60678	exon1			CATCACGCTCGAT		CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.144G>T	3.37:g.127872494G>T		2	0		37	18	NM_021937	0	0	0	0	0	Q96HZ6	Silent	SNP	ENST00000254730.6	37	CCDS33849.1																																																																																			G|0.996;T|0.004		0.716	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
DNAJC13	23317	bcgsc.ca	37	3	132166266	132166266	+	Silent	SNP	T	T	G	rs11917172	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:132166266T>G	ENST00000260818.6	+	4	494	c.246T>G	c.(244-246)acT>acG	p.T82T	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	82					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						AGTCAGAAACTTTAAAATTTT	0.363													T|||	538	0.107428	0.0053	0.1398	5008	,	,		14416	0.1419		0.1292	False		,,,				2504	0.1646				p.T82T		.											.	DNAJC13-272	0			c.T246G						.	T		118,4288	81.9+/-120.4	1,116,2086	48.0	53.0	51.0		246	1.8	1.0	3	dbSNP_120	51	1048,7552	218.3+/-256.7	66,916,3318	no	coding-synonymous	DNAJC13	NM_015268.3		67,1032,5404	GG,GT,TT		12.186,2.6782,8.9651		82/2244	132166266	1166,11840	2203	4300	6503	SO:0001819	synonymous_variant	23317	exon4			AGAAACTTTAAAA	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.246T>G	3.37:g.132166266T>G		176	0		307	8	NM_015268	0	0	0	0	0	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	37	CCDS33857.1																																																																																			T|0.900;G|0.100		0.363	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
YEATS2	55689	broad.mit.edu;bcgsc.ca	37	3	183469993	183469993	+	Missense_Mutation	SNP	C	C	T	rs368005924		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:183469993C>T	ENST00000305135.5	+	10	1297	c.1102C>T	c.(1102-1104)Cca>Tca	p.P368S		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	368					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGCTTCTTCACCAATAAAGCA	0.488																																					p.P368S		.											.	YEATS2-138	0			c.C1102T						.	C	SER/PRO	0,3884		0,0,1942	150.0	142.0	145.0		1102	4.3	0.9	3		145	3,8293		0,3,4145	no	missense	YEATS2	NM_018023.4	74	0,3,6087	TT,TC,CC		0.0362,0.0,0.0246	benign	368/1423	183469993	3,12177	1942	4148	6090	SO:0001583	missense	55689	exon10			TCTTCACCAATAA	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1102C>T	3.37:g.183469993C>T	ENSP00000306983:p.Pro368Ser	180	1		146	6	NM_018023	0	0	0	0	0	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913122	0.52439	0.0	3.62E-4	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.27104	1.69	5.15	4.27	0.50696	.	0.258185	0.31542	N	0.007476	T	0.21186	0.0510	L	0.32530	0.975	0.36568	D	0.872845	B	0.26744	0.158	B	0.20767	0.031	T	0.13602	-1.0503	10	0.72032	D	0.01	-8.0897	14.2553	0.66048	0.0:0.8517:0.1483:0.0	.	368	Q9ULM3	YETS2_HUMAN	S	368	ENSP00000306983:P368S	ENSP00000306983:P368S	P	+	1	0	YEATS2	184952687	0.971000	0.33674	0.901000	0.35422	0.997000	0.91878	3.584000	0.53936	1.156000	0.42514	0.655000	0.94253	CCA	.		0.488	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
TBC1D1	23216	hgsc.bcm.edu	37	4	38016372	38016372	+	Silent	SNP	G	G	A	rs61731587	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:38016372G>A	ENST00000261439.4	+	3	1015	c.660G>A	c.(658-660)gcG>gcA	p.A220A	TBC1D1_ENST00000508802.1_Silent_p.A220A	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	220					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CCCATGCCGCGCCCACAGGGA	0.701													G|||	159	0.0317492	0.0575	0.0389	5008	,	,		10588	0.0258		0.0149	False		,,,				2504	0.0153				p.A220A		.											.	TBC1D1-91	0			c.G660A						.	G		182,4022		2,178,1922	11.0	15.0	14.0		660	-2.7	0.0	4	dbSNP_129	14	83,8373		0,83,4145	no	coding-synonymous	TBC1D1	NM_015173.2		2,261,6067	AA,AG,GG		0.9816,4.3292,2.0932		220/1169	38016372	265,12395	2102	4228	6330	SO:0001819	synonymous_variant	23216	exon3			TGCCGCGCCCACA	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.660G>A	4.37:g.38016372G>A		0	0		31	23	NM_015173	0	0	0	0	0	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	ENST00000261439.4	37	CCDS33972.1																																																																																			G|0.968;A|0.032		0.701	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
SHROOM3	57619	bcgsc.ca	37	4	77660731	77660731	+	Missense_Mutation	SNP	C	C	G	rs344141	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:77660731C>G	ENST00000296043.6	+	5	2358	c.1405C>G	c.(1405-1407)Ccg>Gcg	p.P469A		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	469			P -> A (in dbSNP:rs344141). {ECO:0000269|Ref.1}.		actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CAGCATCTACCCGGTACCTTC	0.577													C|||	2196	0.438498	0.4213	0.4856	5008	,	,		19043	0.2688		0.6064	False		,,,				2504	0.4305				p.P469A		.											.	SHROOM3-93	0			c.C1405G						.	C	ALA/PRO	1943,2463	551.7+/-378.3	444,1055,704	92.0	96.0	94.0		1405	4.6	1.0	4	dbSNP_79	94	5282,3318	645.4+/-400.2	1624,2034,642	yes	missense	SHROOM3	NM_020859.3	27	2068,3089,1346	GG,GC,CC		38.5814,44.099,44.4487	probably-damaging	469/1997	77660731	7225,5781	2203	4300	6503	SO:0001583	missense	57619	exon5			ATCTACCCGGTAC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1405C>G	4.37:g.77660731C>G	ENSP00000296043:p.Pro469Ala	135	1		214	7	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	1032	0.4725274725274725	231	0.4695121951219512	190	0.5248618784530387	152	0.26573426573426573	459	0.6055408970976254	C	13.65	2.300121	0.40694	0.44099	0.614186	ENSG00000138771	ENST00000296043	T	0.47177	0.85	5.49	4.63	0.57726	.	0.083333	0.51477	N	0.000090	T	0.00012	0.0000	M	0.74258	2.255	0.23602	P	0.99731606	D;P	0.89917	1.0;0.668	D;B	0.83275	0.996;0.15	T	0.49214	-0.8963	9	0.51188	T	0.08	-14.476	15.816	0.78599	0.0:0.7438:0.2562:0.0	rs344141;rs60679804;rs344141	293;469	B4E244;Q8TF72	.;SHRM3_HUMAN	A	469	ENSP00000296043:P469A	ENSP00000296043:P469A	P	+	1	0	SHROOM3	77879755	1.000000	0.71417	0.988000	0.46212	0.150000	0.21749	3.257000	0.51500	1.265000	0.44215	0.563000	0.77884	CCG	C|0.486;G|0.514		0.577	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
HELQ	113510	broad.mit.edu	37	4	84376805	84376806	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:84376805_84376806delGA	ENST00000295488.3	-	1	203_204	c.41_42delTC	c.(40-42)ctcfs	p.L14fs	HELQ_ENST00000510985.1_Frame_Shift_Del_p.L14fs|MRPS18C_ENST00000507019.1_5'Flank|HELQ_ENST00000440639.2_5'UTR|MRPS18C_ENST00000295491.4_5'Flank|MRPS18C_ENST00000507349.1_5'Flank	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	14					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TCCTTTTGGGGAGAGACACCCG	0.604								Other identified genes with known or suspected DNA repair function			OREG0016254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.14_14del		.											.	HELQ-155	0			c.41_42del						.																																			SO:0001589	frameshift_variant	113510	exon1			TTTGGGGAGAGAC	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.41_42delTC	4.37:g.84376809_84376810delGA	ENSP00000295488:p.Leu14fs	30	0	1228	53	12	NM_133636	0	0	0	0	0	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Frame_Shift_Del	DEL	ENST00000295488.3	37	CCDS3603.1																																																																																			.		0.604	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
NUDT9	53343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88379078	88379078	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:88379078C>G	ENST00000302174.4	+	8	1282	c.958C>G	c.(958-960)Ctt>Gtt	p.L320V	RP11-710E1.2_ENST00000609450.1_lincRNA|NUDT9_ENST00000473942.1_Missense_Mutation_p.L270V	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	320	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TAAACTGAAGCTTTATGCCAG	0.438																																					p.L320V		.											.	NUDT9-90	0			c.C958G						.						120.0	108.0	112.0					4																	88379078		2203	4300	6503	SO:0001583	missense	53343	exon8			CTGAAGCTTTATG	AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.958C>G	4.37:g.88379078C>G	ENSP00000303575:p.Leu320Val	165	0		193	41	NM_024047	0	0	0	0	0	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000302174.4	37	CCDS3620.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524590	0.44969	.	.	ENSG00000170502	ENST00000302174;ENST00000473942	T;T	0.15834	2.39;2.39	5.09	4.23	0.50019	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.39306	0.1073	M	0.74258	2.255	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.71656	0.955;0.974	T	0.28073	-1.0055	10	0.87932	D	0	-18.8243	11.3489	0.49577	0.0:0.9129:0.0:0.0871	.	320;320	Q96KB3;Q9BW91	.;NUDT9_HUMAN	V	320;270	ENSP00000303575:L320V;ENSP00000421811:L270V	ENSP00000303575:L320V	L	+	1	0	NUDT9	88598102	1.000000	0.71417	0.997000	0.53966	0.026000	0.11368	2.819000	0.48049	1.235000	0.43724	0.557000	0.71058	CTT	.		0.438	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2		
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Silent	SNP	C	C	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:88537027C>T	ENST00000282478.7	+	4	3246	c.3213C>T	c.(3211-3213)gaC>gaT	p.D1071D	DSPP_ENST00000399271.1_Silent_p.D1071D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071D		.											.	DSPP-90	0			c.C3213T						.						56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>T	4.37:g.88537027C>T		543	10		1036	35	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185339341	185339341	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr4:185339341C>T	ENST00000393593.3	-	5	598	c.391G>A	c.(391-393)Gac>Aac	p.D131N	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	131					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TTAACTTTGTCTTCTTTTTCT	0.368																																					p.D131N		.											.	IRF2-91	0			c.G391A						.						309.0	256.0	274.0					4																	185339341		2203	4300	6503	SO:0001583	missense	3660	exon5			CTTTGTCTTCTTT		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.391G>A	4.37:g.185339341C>T	ENSP00000377218:p.Asp131Asn	135	0		120	32	NM_002199	0	0	0	0	0	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.81|14.81	2.646355|2.646355	0.47258|0.47258	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316|ENST00000505067	D;D;D;D|.	0.97959|.	-4.63;-4.61;-4.59;-4.6|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.700955|.	0.15281|.	N|.	0.270695|.	T|T	0.71022|0.71022	0.3291|0.3291	L|L	0.47716|0.47716	1.5|1.5	0.50632|0.50632	D|D	0.999884|0.999884	P|.	0.34462|.	0.454|.	B|.	0.32677|.	0.15|.	T|T	0.63721|0.63721	-0.6573|-0.6573	10|5	0.17369|.	T|.	0.5|.	-18.0748|-18.0748	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	131|.	P14316|.	IRF2_HUMAN|.	N|K	131|29	ENSP00000377218:D131N;ENSP00000427204:D131N;ENSP00000424552:D131N;ENSP00000422860:D131N|.	ENSP00000377218:D131N|.	D|R	-|-	1|2	0|0	IRF2|IRF2	185576335|185576335	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.476000|5.476000	0.66793|0.66793	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAC|AGA	.		0.368	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
LRRC14B	389257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	194841	194841	+	Silent	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr5:194841G>A	ENST00000328278.3	+	2	946	c.918G>A	c.(916-918)ctG>ctA	p.L306L	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	306										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						AGACCCCGCTGCGAGTACTGG	0.642																																					p.L306L		.											.	LRRC14B-69	0			c.G918A						.						33.0	37.0	36.0					5																	194841		2089	4213	6302	SO:0001819	synonymous_variant	389257	exon2			CCCGCTGCGAGTA		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.918G>A	5.37:g.194841G>A		180	0		411	120	NM_001080478	0	0	0	0	0		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			.		0.642	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000515003.1_RNA|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000498871.2_RNA|RGMB-AS1_ENST00000505362.1_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		4	4	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
NIPAL4	348938	broad.mit.edu;bcgsc.ca	37	5	156899408	156899408	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr5:156899408T>C	ENST00000311946.7	+	6	957	c.841T>C	c.(841-843)Tac>Cac	p.Y281H	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Missense_Mutation_p.Y262H	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	281						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						TGCCCCACGTTACGGGCAAAG	0.517											OREG0016979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y281H		.											.	NIPAL4-68	0			c.T841C						.						224.0	224.0	224.0					5																	156899408		2149	4259	6408	SO:0001583	missense	348938	exon6			CCACGTTACGGGC	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.841T>C	5.37:g.156899408T>C	ENSP00000311687:p.Tyr281His	50	1	1782	72	33	NM_001099287	0	0	0	0	0	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	37	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.390623	0.62066	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.89875	-2.58;-2.58	6.04	6.04	0.98038	.	0.296123	0.38605	N	0.001640	D	0.92473	0.7610	L	0.55481	1.735	0.58432	D	0.999994	P;D	0.71674	0.859;0.998	B;D	0.68353	0.274;0.957	D	0.91106	0.4918	10	0.31617	T	0.26	-11.7063	16.5763	0.84648	0.0:0.0:0.0:1.0	.	262;281	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	H	262;281	ENSP00000406456:Y262H;ENSP00000311687:Y281H	ENSP00000311687:Y281H	Y	+	1	0	NIPAL4	156831986	1.000000	0.71417	0.543000	0.28128	0.777000	0.43975	4.812000	0.62613	2.317000	0.78254	0.459000	0.35465	TAC	.		0.517	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
BTNL3	10917	bcgsc.ca	37	5	180432416	180432416	+	Silent	SNP	C	C	T	rs7726150	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr5:180432416C>T	ENST00000342868.6	+	8	1129	c.945C>T	c.(943-945)ccC>ccT	p.P315P	RNU6-1036P_ENST00000383959.1_RNA	NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	315	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GAAAAGCTCCCCAGGAGGTGC	0.547													C|||	2313	0.461861	0.6135	0.4856	5008	,	,		19347	0.3621		0.4414	False		,,,				2504	0.364				p.P315P		.											.	.	0			c.C945T						.						57.0	63.0	61.0					5																	180432416		2193	4295	6488	SO:0001819	synonymous_variant	10917	exon8			AGCTCCCCAGGAG	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.945C>T	5.37:g.180432416C>T		219	0		206	8	NM_197975	0	0	0	0	0	Q496L7|Q9Y2C7	Silent	SNP	ENST00000342868.6	37	CCDS47358.1																																																																																			T|1.000;|0.000		0.547	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975	
OR2J2	26707	bcgsc.ca	37	6	29141849	29141849	+	Missense_Mutation	SNP	T	T	C	rs3116856	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:29141849T>C	ENST00000377167.2	+	1	539	c.437T>C	c.(436-438)gTt>gCt	p.V146A		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	146			A -> V (in allele 6M1-6*02 and allele 6M1-6*03; dbSNP:rs3116856). {ECO:0000269|PubMed:14574404, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CACTTGTTGGTTGCGGCTTCT	0.463													C|||	1893	0.377995	0.112	0.451	5008	,	,		21396	0.378		0.5477	False		,,,				2504	0.5112				p.V146A		.											.	OR2J2-68	0			c.T437C						.	C	ALA/VAL	748,3250		75,598,1326	301.0	276.0	284.0		437	2.3	0.4	6	dbSNP_103	284	4513,3831		1237,2039,896	no	missense	OR2J2	NM_030905.2	64	1312,2637,2222	CC,CT,TT		45.9132,18.7094,42.6268	probably-damaging	146/313	29141849	5261,7081	1999	4172	6171	SO:0001583	missense	26707	exon1			TGTTGGTTGCGGC		CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.437T>C	6.37:g.29141849T>C	ENSP00000366372:p.Val146Ala	254	3		206	6	NM_030905	0	0	0	0	0	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	CCDS43434.1	870	0.3983516483516483	59	0.11991869918699187	166	0.4585635359116022	209	0.36538461538461536	436	0.575197889182058	C	0	-2.819406	0.00072	0.187094	0.540868	ENSG00000204700	ENST00000377167	T	0.39056	1.1	2.3	2.3	0.28687	.	.	.	.	.	T	0.05364	0.0142	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.36163	-0.9759	5	0.02654	T	1	.	7.9731	0.30138	0.0:0.8633:0.0:0.1367	rs3116856;rs17737530;rs52793747;rs3116856	.	.	.	A	146	ENSP00000366372:V146A	ENSP00000366372:V146A	V	+	2	0	OR2J2	29249828	0.000000	0.05858	0.369000	0.25952	0.019000	0.09904	-0.161000	0.10026	0.290000	0.22444	-0.971000	0.02607	GTT	T|0.566;C|0.434		0.463	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2		
HCG9	10255	broad.mit.edu	37	6	29943178	29943178	+	lincRNA	SNP	A	A	G	rs6903753	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:29943178A>G	ENST00000376800.3	+	0	290									HLA complex group 9 (non-protein coding)																		GGGGGATGTGACTGCCTCAGC	0.642													a|||	1284	0.25639	0.1944	0.3271	5008	,	,		16177	0.3095		0.3231	False		,,,				2504	0.1667				.		.											.	HCG9-68	0			.						.	G		525,2443		58,409,1017	5.0	5.0	5.0			-0.3	0.0	6	dbSNP_116	5	1327,3985		189,949,1518	no	intergenic				247,1358,2535	GG,GA,AA		24.9812,17.6887,22.3671			29943178	1852,6428	1484	2656	4140			10255	.			GATGTGACTGCCT	AB088085		6p21.3	2012-10-16	2011-04-11		ENSG00000204625	ENSG00000204625		"""Long non-coding RNAs"""	21243	non-coding RNA	RNA, long non-coding		615797	"""HLA complex group 9"""			10727083, 10557312	Standard	NR_028032		Approved	PERB11, HCGIX, HCGIX4, HCGIX-4	uc003rth.3		OTTHUMG00000031119		6.37:g.29943178A>G		154	2		174	7	.	0	0	0	0	0		RNA	SNP	ENST00000376800.3	37																																																																																				A|0.714;G|0.286		0.642	HCG9-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000076199.4	NR_028032	
MUC21	394263	bcgsc.ca	37	6	30954659	30954659	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:30954659G>A	ENST00000376296.3	+	2	948	c.707G>A	c.(706-708)gGg>gAg	p.G236E	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	236	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACCTCCAGTGGGGCCAGCACA	0.647																																					p.G236E		.											.	MUC21-92	0			c.G707A						.																																			SO:0001583	missense	394263	exon2			CCAGTGGGGCCAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.707G>A	6.37:g.30954659G>A	ENSP00000365473:p.Gly236Glu	153	2		140	10	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	3.324	-0.138033	0.06711	.	.	ENSG00000204544	ENST00000376296	T	0.01947	4.54	3.42	-5.17	0.02849	.	.	.	.	.	T	0.00468	0.0015	L	0.32530	0.975	0.09310	N	1	B	0.28713	0.22	B	0.27887	0.084	T	0.45977	-0.9224	8	.	.	.	-0.1505	1.9355	0.03336	0.3313:0.3546:0.1943:0.1198	.	236	Q5SSG8	MUC21_HUMAN	E	236	ENSP00000365473:G236E	.	G	+	2	0	MUC21	31062638	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.388000	0.01059	-1.361000	0.02169	-0.327000	0.08410	GGG	.		0.647	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
FGD2	221472	bcgsc.ca	37	6	36976637	36976637	+	Missense_Mutation	SNP	G	G	C	rs831510	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:36976637G>C	ENST00000274963.8	+	2	267	c.96G>C	c.(94-96)caG>caC	p.Q32H		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	32			Q -> H (in dbSNP:rs831510). {ECO:0000269|PubMed:15489334}.		actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.Q32H(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						CCAGAGGCCAGAGGCTAGAGG	0.637													C|||	1632	0.325879	0.264	0.3761	5008	,	,		18864	0.5417		0.2575	False		,,,				2504	0.2219				p.Q32H		.											.	FGD2-229	1	Substitution - Missense(1)	prostate(1)	c.G96C						.	C	HIS/GLN	1276,3130	680.9+/-403.9	197,882,1124	50.0	57.0	55.0		96	2.2	0.0	6	dbSNP_86	55	2137,6463	696.1+/-404.9	281,1575,2444	yes	missense	FGD2	NM_173558.3	24	478,2457,3568	CC,CG,GG		24.8488,28.9605,26.2417	benign	32/656	36976637	3413,9593	2203	4300	6503	SO:0001583	missense	221472	exon2			AGGCCAGAGGCTA	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.96G>C	6.37:g.36976637G>C	ENSP00000274963:p.Gln32His	260	3		235	8	NM_173558	0	0	0	0	0	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	777	0.3557692307692308	142	0.2886178861788618	122	0.3370165745856354	311	0.5437062937062938	202	0.26649076517150394	C	0.024	-1.385287	0.01194	0.289605	0.248488	ENSG00000146192	ENST00000274963	T	0.58210	0.35	5.0	2.16	0.27623	.	0.767167	0.11414	N	0.566460	T	0.06142	0.0159	N	0.01352	-0.895	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33954	-0.9848	9	0.12766	T	0.61	.	4.6034	0.12364	0.0:0.5542:0.1599:0.2858	rs831510;rs17855748;rs17856702;rs52822242;rs57642495;rs831510	32;32	Q7Z6J4;F8WEZ2	FGD2_HUMAN;.	H	32	ENSP00000274963:Q32H	ENSP00000274963:Q32H	Q	+	3	2	FGD2	37084615	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.243000	0.18106	0.157000	0.19338	-0.647000	0.03941	CAG	G|0.699;C|0.301		0.637	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
SLC17A5	26503	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	74345205	74345205	+	Nonsense_Mutation	SNP	C	C	T	rs386833993		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:74345205C>T	ENST00000355773.5	-	6	987	c.719G>A	c.(718-720)tGg>tAg	p.W240*	SLC17A5_ENST00000481996.1_5'UTR|SLC17A5_ENST00000393019.3_3'UTR	NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	240					amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CAAAAGAAACCAAAATATTCC	0.264																																					p.W240X		.											.	SLC17A5-190	0			c.G719A	GRCh37	CM003477	SLC17A5	M		.						63.0	56.0	59.0					6																	74345205		2199	4290	6489	SO:0001587	stop_gained	26503	exon6			AGAAACCAAAATA	AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.719G>A	6.37:g.74345205C>T	ENSP00000348019:p.Trp240*	12	0		9	9	NM_012434	0	0	0	0	0	Q5SZ76|Q8NBR5|Q9UGH0	Nonsense_Mutation	SNP	ENST00000355773.5	37	CCDS4981.1	.	.	.	.	.	.	.	.	.	.	C	38	6.785212	0.97837	.	.	ENSG00000119899	ENST00000355773	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0753	0.93159	0.0:1.0:0.0:0.0	.	.	.	.	X	240	.	ENSP00000348019:W240X	W	-	2	0	SLC17A5	74401926	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.888000	0.69758	2.515000	0.84797	0.650000	0.86243	TGG	.		0.264	SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1		
FAM46A	55603	broad.mit.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G|FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																					p.39_44del		.											.	FAM46A-90	0			c.117_131del						.																																			SO:0001651	inframe_deletion	55603	exon2			CCGCCACCGCCGA	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del	10	0		142	42	NM_017633	0	0	0	0	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
HEBP2	23593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138726347	138726347	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:138726347G>A	ENST00000607197.1	+	2	445	c.168G>A	c.(166-168)atG>atA	p.M56I	HEBP2_ENST00000448741.1_Missense_Mutation_p.M67I|HEBP2_ENST00000367697.3_Missense_Mutation_p.M56I	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	56					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		TGGAGTCTATGGACTGGGATT	0.458																																					p.M56I		.											.	HEBP2-90	0			c.G168A						.						132.0	125.0	127.0					6																	138726347		2203	4300	6503	SO:0001583	missense	23593	exon2			GTCTATGGACTGG	AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.168G>A	6.37:g.138726347G>A	ENSP00000475750:p.Met56Ile	105	0		81	29	NM_014320	0	0	0	0	0	Q96P57	Missense_Mutation	SNP	ENST00000607197.1	37	CCDS5191.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.688470	0.29962	.	.	ENSG00000051620	ENST00000448741;ENST00000058691;ENST00000367697	T;T;T	0.21361	2.01;2.01;2.01	5.11	5.11	0.69529	Regulatory factor, effector, bacterial (1);	1.096180	0.06819	N	0.791911	T	0.05914	0.0154	N	0.04508	-0.205	0.38021	D	0.934844	B	0.13594	0.008	B	0.12156	0.007	T	0.15263	-1.0443	10	0.35671	T	0.21	.	15.4595	0.75342	0.0:0.0:1.0:0.0	.	56	Q9Y5Z4	HEBP2_HUMAN	I	67;56;56	ENSP00000392101:M67I;ENSP00000058691:M56I;ENSP00000356670:M56I	ENSP00000058691:M56I	M	+	3	0	HEBP2	138768040	1.000000	0.71417	0.944000	0.38274	0.998000	0.95712	4.988000	0.63863	2.377000	0.81083	0.555000	0.69702	ATG	.		0.458	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042426.2		
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		45	0		76	7	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	hgsc.bcm.edu	37	6	170871097	170871097	+	Silent	SNP	G	G	A	rs200496051	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr6:170871097G>A	ENST00000392092.2	+	3	552	c.273G>A	c.(271-273)caG>caA	p.Q91Q	TBP_ENST00000540980.1_Silent_p.Q71Q|TBP_ENST00000230354.6_Silent_p.Q91Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	91	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcaac	0.617													G|||	38	0.00758786	0.0015	0.0014	5008	,	,		13915	0.0159		0.002	False		,,,				2504	0.0174				p.Q91Q		.											.	TBP-91	0			c.G273A						.						24.0	30.0	28.0					6																	170871097		1944	3761	5705	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.273G>A	6.37:g.170871097G>A		92	0		132	9	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.617	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		7	7	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
PABPC1	26986	broad.mit.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																					p.T319I		.											.	PABPC1-68	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C956T						.						154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986	exon7			GTGATTGTACCAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	125	1		148	6	NM_002568	0	0	0	0	0	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		11	11	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
KCNQ3	3786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133144473	133144473	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr8:133144473A>T	ENST00000388996.4	-	14	2258	c.1838T>A	c.(1837-1839)aTc>aAc	p.I613N	KCNQ3_ENST00000521134.1_Missense_Mutation_p.I493N|KCNQ3_ENST00000519445.1_Missense_Mutation_p.I601N	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	613					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TTGGTCTTCGATTTCTGATGT	0.353																																					p.I613N		.											.	KCNQ3-138	0			c.T1838A						.						144.0	138.0	140.0					8																	133144473		2203	4300	6503	SO:0001583	missense	3786	exon14			TCTTCGATTTCTG	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1838T>A	8.37:g.133144473A>T	ENSP00000373648:p.Ile613Asn	79	0		135	56	NM_004519	0	0	0	0	0	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	A	12.40	1.926094	0.34002	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99586	-6.23;-6.23;-6.23	5.68	-8.43	0.00953	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	1.292170	0.04732	N	0.421233	D	0.97841	0.9291	N	0.17474	0.49	0.09310	N	1	B;B	0.21381	0.055;0.055	B;B	0.21546	0.035;0.035	D	0.88186	0.2874	10	0.33141	T	0.24	0.6746	20.9464	0.99942	0.2576:0.0:0.7424:0.0	.	601;613	E7ET42;O43525	.;KCNQ3_HUMAN	N	613;493;601;590;492	ENSP00000373648:I613N;ENSP00000429799:I493N;ENSP00000428790:I601N	ENSP00000373648:I613N	I	-	2	0	KCNQ3	133213655	0.003000	0.15002	0.000000	0.03702	0.800000	0.45204	0.431000	0.21444	-1.546000	0.01717	-1.317000	0.01298	ATC	.		0.353	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		6	6	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
AQP7	364	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	33386976	33386976	+	Missense_Mutation	SNP	G	G	A	rs143391243	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr9:33386976G>A	ENST00000539936.1	-	4	497	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	AQP7_ENST00000537089.1_Intron|AQP7_ENST00000377425.4_Missense_Mutation_p.R30C|AQP7_ENST00000541274.1_Intron			O14520	AQP7_HUMAN	aquaporin 7	87					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CCAGAGATGCGGCCTGCCACG	0.577													g|||	13	0.00259585	0.0098	0.0	5008	,	,		19052	0.0		0.0	False		,,,				2504	0.0				p.R87C		.											.	AQP7-90	0			c.C259T						.	A	CYS/ARG	17,4389	16.8+/-37.8	0,17,2186	100.0	98.0	99.0		259	-2.7	0.8	9	dbSNP_134	99	0,8600		0,0,4300	no	missense	AQP7	NM_001170.1	180	0,17,6486	AA,AG,GG		0.0,0.3858,0.1307	benign	87/343	33386976	17,12989	2203	4300	6503	SO:0001583	missense	364	exon4			AGATGCGGCCTGC	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.259C>T	9.37:g.33386976G>A	ENSP00000439534:p.Arg87Cys	237	0		242	33	NM_001170	0	0	0	0	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000539936.1	37		.	.	.	.	.	.	.	.	.	.	g	7.041	0.562480	0.13498	0.003858	0.0	ENSG00000165269	ENST00000379507;ENST00000297988;ENST00000377425;ENST00000379506;ENST00000539936	D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99	3.41	-2.72	0.05968	Aquaporin-like (2);	0.688639	0.14629	N	0.307953	T	0.75421	0.3847	L	0.43701	1.375	0.50171	D	0.999855	B;B;B;B	0.19331	0.005;0.001;0.035;0.004	B;B;B;B	0.18561	0.004;0.008;0.022;0.008	T	0.59434	-0.7455	10	0.62326	D	0.03	-0.5471	6.8112	0.23805	0.0:0.5909:0.1844:0.2247	.	86;87;30;87	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	C	86;87;30;86;87	ENSP00000368821:R86C;ENSP00000297988:R87C;ENSP00000396111:R30C;ENSP00000368820:R86C;ENSP00000439534:R87C	ENSP00000297988:R87C	R	-	1	0	AQP7	33376976	0.000000	0.05858	0.828000	0.32881	0.068000	0.16541	0.104000	0.15313	-0.501000	0.06605	-1.103000	0.02113	CGC	G|0.999;A|0.001		0.577	AQP7-203	KNOWN	basic	protein_coding	protein_coding		NM_001170	
AKNA	80709	bcgsc.ca	37	9	117124731	117124731	+	Missense_Mutation	SNP	G	G	A	rs3748176	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr9:117124731G>A	ENST00000307564.4	-	8	2032	c.1871C>T	c.(1870-1872)cCg>cTg	p.P624L	AKNA_ENST00000223791.3_Missense_Mutation_p.P84L|AKNA_ENST00000374088.3_Missense_Mutation_p.P624L|AKNA_ENST00000374075.5_Missense_Mutation_p.P543L|AKNA_ENST00000312033.3_Missense_Mutation_p.P624L	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	624			P -> L (in dbSNP:rs3748176). {ECO:0000269|PubMed:11853319, ECO:0000269|PubMed:14702039}.		positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P624L(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GCCGGCAAGCGGCTGGGCAGG	0.657													g|||	1924	0.384185	0.115	0.4798	5008	,	,		16480	0.3869		0.506	False		,,,				2504	0.5521				p.P624L		.											.	AKNA-94	1	Substitution - Missense(1)	stomach(1)	c.C1871T						.		LEU/PRO	828,3578	320.2+/-296.5	83,662,1458	30.0	35.0	33.0		1871	-0.4	0.0	9	dbSNP_107	33	4570,4030	582.2+/-391.4	1195,2180,925	yes	missense	AKNA	NM_030767.4	98	1278,2842,2383	AA,AG,GG		46.8605,18.7926,41.5039	possibly-damaging	624/1440	117124731	5398,7608	2203	4300	6503	SO:0001583	missense	80709	exon8			GCAAGCGGCTGGG	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1871C>T	9.37:g.117124731G>A	ENSP00000303769:p.Pro624Leu	40	0		54	4	NM_030767	0	0	0	0	0	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	833	0.3814102564102564	55	0.11178861788617886	179	0.494475138121547	218	0.3811188811188811	381	0.5026385224274407	g	10.14	1.267287	0.23136	0.187926	0.531395	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	4.7	-0.371	0.12525	.	0.691128	0.12739	N	0.443148	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	P;B	0.38110	0.618;0.072	B;B	0.31946	0.138;0.009	T	0.44847	-0.9301	9	0.07990	T	0.79	-4.3767	4.4668	0.11692	0.0:0.1894:0.3545:0.4561	rs3748176;rs3748176	624;543	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	L	624;465;624;84;543;624	ENSP00000303769:P624L;ENSP00000363201:P624L;ENSP00000223791:P84L;ENSP00000363188:P543L;ENSP00000309222:P624L	ENSP00000223791:P84L	P	-	2	0	AKNA	116164552	0.048000	0.20356	0.001000	0.08648	0.003000	0.03518	0.347000	0.20014	-0.219000	0.10003	-0.422000	0.05995	CCG	G|0.599;A|0.401		0.657	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
ASTN2	23245	broad.mit.edu	37	9	119448979	119448979	+	Intron	SNP	C	C	T	rs10983304	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr9:119448979C>T	ENST00000313400.4	-	17	2907				TRIM32_ENST00000373983.2_5'Flank|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000450136.1_5'Flank|ASTN2_ENST00000288520.5_Missense_Mutation_p.E36K|ASTN2_ENST00000341734.4_Intron|ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000358637.4_Intron			O75129	ASTN2_HUMAN	astrotactin 2						negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CGGGTACCTTCAGTCTGCAGG	0.542													C|||	60	0.0119808	0.0015	0.013	5008	,	,		19721	0.0		0.0288	False		,,,				2504	0.0204				p.E36K		.											.	ASTN2-161	0			c.G106A						.																																			SO:0001627	intron_variant	23245	exon1			TACCTTCAGTCTG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2807-34907G>A	9.37:g.119448979C>T		71	0		121	4	NM_198186	0	0	0	0	0	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		33	0.01510989010989011	1	0.0020325203252032522	6	0.016574585635359115	0	0.0	26	0.03430079155672823	C	13.53	2.264293	0.39995	.	.	ENSG00000148219	ENST00000288520	T	0.13307	2.6	3.9	0.998	0.19857	.	.	.	.	.	T	0.02012	0.0063	.	.	.	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.41770	-0.9490	7	.	.	.	.	4.1278	0.10134	0.0:0.5889:0.1934:0.2177	rs10983304;rs52793392;rs10983304	36	O75129-4	.	K	36	ENSP00000288520:E36K	.	E	-	1	0	ASTN2	118488800	0.041000	0.20044	0.006000	0.13384	0.020000	0.10135	0.363000	0.20301	0.224000	0.20940	0.555000	0.69702	GAA	C|0.979;T|0.021		0.542	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
SLC38A5	92745	bcgsc.ca	37	X	48317386	48317386	+	Missense_Mutation	SNP	A	A	G	rs17281188	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chrX:48317386A>G	ENST00000376876.3	-	16	2195	c.1352T>C	c.(1351-1353)aTg>aCg	p.M451T	SLC38A5_ENST00000317669.5_Missense_Mutation_p.M451T|SLC38A5_ENST00000480105.1_5'Flank|SLC38A5_ENST00000376875.1_Missense_Mutation_p.M400T			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	451			M -> T (in dbSNP:rs17281188). {ECO:0000269|PubMed:11243884}.		amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)			breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						ACTGACGGCCATGAAGAGGAC	0.592													A|||	321	0.0850331	0.0272	0.1441	3775	,	,		12194	0.0685		0.0517	False		,,,				2504	0.0654				p.M451T		.											.	SLC38A5-133	0			c.T1352C						.	A	THR/MET	124,3707		4,99,17,1527,554	49.0	41.0	44.0		1352	3.9	1.0	X	dbSNP_123	44	500,6218		10,338,142,2078,1724	yes	missense	SLC38A5	NM_033518.2	81	14,437,159,3605,2278	GG,GA,G,AA,A		7.4427,3.2368,5.9153	possibly-damaging	451/473	48317386	624,9925	2201	4292	6493	SO:0001583	missense	92745	exon17			ACGGCCATGAAGA	AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.1352T>C	X.37:g.48317386A>G	ENSP00000366073:p.Met451Thr	244	2		239	10	NM_033518	0	0	0	0	0	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	ENST00000376876.3	37	CCDS14293.1	143	0.0861965039180229	14	0.028688524590163935	32	0.09937888198757763	20	0.037037037037037035	28	0.03804347826086957	a	13.51	2.257794	0.39896	0.032368	0.074427	ENSG00000017483	ENST00000376876;ENST00000376875;ENST00000317669	T;T;T	0.02525	4.26;4.26;4.26	5.08	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.00384	0.0012	M	0.90145	3.09	0.09310	P	0.99999108501	D	0.71674	0.998	D	0.73380	0.98	T	0.04140	-1.0974	9	0.35671	T	0.21	.	8.5502	0.33447	0.825:0.0:0.0:0.175	rs17281188;rs61481118;rs17281188	451	Q8WUX1	S38A5_HUMAN	T	451;400;451	ENSP00000366073:M451T;ENSP00000366071:M400T;ENSP00000313740:M451T	ENSP00000313740:M451T	M	-	2	0	SLC38A5	48202330	1.000000	0.71417	0.979000	0.43373	0.376000	0.30014	8.322000	0.90000	0.570000	0.29347	0.425000	0.28330	ATG	A|0.906;0|0.027		0.592	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060724.1	NM_033518	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Start_Codon_Del	DEL	TCCTCGAGGCAGCC	TCCTCGAGGCAGCC	-	rs78182391		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	ENST00000375992.3	-	0	139_152					NM_018159.3	NP_060629.2	Q96G61	NUD11_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 11						inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)	p.?(5)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	9	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.692										HNSCC(48;0.14)				2406	0.637351	0.497	0.4928	3775	,	,		5662	0.4464		0.4553	False		,,,				2504	0.5102					GBM(38;198 791 1498 11752 13599)	.											.	NUDT11-130	5	Unknown(5)	upper_aerodigestive_tract(2)|prostate(1)|breast(1)|central_nervous_system(1)							.			1710,202		758,11,183,87,17						3.0	1.0		dbSNP_131	12	3133,173		1220,1,692,66,40	no	frameshift	NUDT11	NM_018159.3		1978,12,875,153,57	A1A1,A1R,A1,RR,R		5.2329,10.5649,7.1867				4843,375				SO:0001582	initiator_codon_variant	55190	wholegene			ACTTCATCCTCGA	AK001490	CCDS43952.1	Xp11.22-p11.1	2014-05-20			ENSG00000196368	ENSG00000196368		"""Nudix motif containing"""	18011	protein-coding gene	gene with protein product						12105228	Standard	NM_018159		Approved	DIPP3b, FLJ10628, hDIPP3beta	uc010njt.3	Q96G61	OTTHUMG00000021531		X.37:g.51239296_51239309delTCCTCGAGGCAGCC		20	0		221	66	NM_018159	0	0	0	0	0	Q9NVN0	Frame_Shift_Del	DEL	ENST00000375992.3	37	CCDS43952.1																																																																																			.		0.692	NUDT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056579.1		
SLC7A3	84889	bcgsc.ca	37	X	70146475	70146475	+	Missense_Mutation	SNP	G	G	C	rs6525447	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chrX:70146475G>C	ENST00000374299.3	-	10	1666	c.1522C>G	c.(1522-1524)Ctg>Gtg	p.L508V	SLC7A3_ENST00000298085.4_Missense_Mutation_p.L508V			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	508			L -> V (in dbSNP:rs6525447). {ECO:0000269|PubMed:15489334}.		amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GCAGTCCACAGCAGGTCTCCA	0.517													C|||	1513	0.400795	0.4463	0.304	3775	,	,		14389	0.3512		0.0616	False		,,,				2504	0.3027				p.L508V		.											.	SLC7A3-132	0			c.C1522G						.	C	VAL/LEU,VAL/LEU	2165,1669		533,772,327,327,243	45.0	37.0	40.0		1522,1522	4.2	1.0	X	dbSNP_116	40	638,6088		31,406,170,1991,1700	yes	missense,missense	SLC7A3	NM_001048164.2,NM_032803.5	32,32	564,1178,497,2318,1943	CC,CG,C,GG,G		9.4856,43.5316,26.5436	benign,benign	508/620,508/620	70146475	2803,7757	2202	4298	6500	SO:0001583	missense	84889	exon10			TCCACAGCAGGTC	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1522C>G	X.37:g.70146475G>C	ENSP00000363417:p.Leu508Val	147	1		221	7	NM_032803	0	0	0	0	0	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	575	0.3465943339361061	149	0.4281609195402299	77	0.275	115	0.279126213592233	34	0.04607046070460705	C	0.012	-1.681666	0.00745	0.564684	0.094856	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.87571	-2.27;-2.27	5.01	4.15	0.48705	.	0.695584	0.14611	N	0.309011	T	0.00012	0.0000	N	0.00162	-1.95	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44174	-0.9345	9	0.12430	T	0.62	.	7.8134	0.29245	0.0:0.612:0.3015:0.0866	rs6525447;rs17265153;rs17856987;rs52796906;rs6525447	508	Q8WY07	CTR3_HUMAN	V	508	ENSP00000363417:L508V;ENSP00000298085:L508V	ENSP00000298085:L508V	L	-	1	2	SLC7A3	70063200	0.000000	0.05858	0.999000	0.59377	0.016000	0.09150	-0.142000	0.10311	0.632000	0.30432	-0.252000	0.11476	CTG	0|0.018;C|0.306		0.517	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803	
CTAG2	30848	bcgsc.ca	37	X	153881525	153881525	+	Missense_Mutation	SNP	G	G	C	rs17328091	byFrequency	TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chrX:153881525G>C	ENST00000247306.4	-	1	328	c.265C>G	c.(265-267)Cag>Gag	p.Q89E	CTAG2_ENST00000369585.3_Missense_Mutation_p.Q89E	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	89			Q -> E (in dbSNP:rs17328091). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17899192, ECO:0000269|PubMed:9626360}.			centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGATACAACTGAAGCAGGCGG	0.682													g|||	1923	0.509404	0.6634	0.3069	3775	,	,		6030	0.1796		0.2604	False		,,,				2504	0.3988				p.Q89E		.											.	CTAG2-131	0			c.C265G						.	G	GLU/GLN,GLU/GLN	3117,713		1081,480,475,69,95	40.0	39.0	39.0		265,265	-3.3	0.0	X	dbSNP_123	39	2554,4171		366,1121,701,941,1168	yes	missense,missense	CTAG2	NM_020994.3,NM_172377.3	29,29	1447,1601,1176,1010,1263	CC,CG,C,GG,G		37.9777,18.6162,46.2719	benign,benign	89/211,89/181	153881525	5671,4884	2200	4297	6497	SO:0001583	missense	30848	exon1			ACAACTGAAGCAG	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.265C>G	X.37:g.153881525G>C	ENSP00000247306:p.Gln89Glu	84	0		221	10	NM_020994	0	0	0	0	0	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	ENST00000247306.4	37	CCDS14759.1	750	0.45207956600361665	229	0.8357664233576643	84	0.28378378378378377	58	0.116	141	0.22100313479623823	g	0.001	-3.347120	0.00016	0.813838	0.379777	ENSG00000126890	ENST00000247306;ENST00000369585;ENST00000454505	T;T	0.27256	1.68;1.68	1.65	-3.31	0.04988	.	.	.	.	.	T	0.00012	0.0000	N	0.00308	-1.67	0.80722	P	0.0	B;B	0.24618	0.107;0.087	B;B	0.16722	0.016;0.01	T	0.39014	-0.9634	8	0.02654	T	1	.	1.7181	0.02905	0.2303:0.3703:0.2625:0.1369	rs17328091;rs17855366	89;89	O75638;O75638-2	CTAG2_HUMAN;.	E	89;89;31	ENSP00000247306:Q89E;ENSP00000358598:Q89E	ENSP00000247306:Q89E	Q	-	1	0	CTAG2	153534719	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.469000	0.06648	-3.244000	0.00206	-1.390000	0.01156	CAG	0|0.004;C|0.526		0.682	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061176.1	NM_020994	
KCNN3	3782	broad.mit.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	-	GCTGCTGCT	rs56352724|rs3831942|rs367921715|rs58327065		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr1:154842199_154842200insGCTGCTGCT	ENST00000271915.4	-	1	556_557	c.241_242insAGCAGCAGC	c.(241-243)cca>cAGCAGCAGCca	p.80_81insQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGGATGCGGTGgctgctgctgc	0.698																																					p.P81delinsQQQP		.											.	KCNN3-91	2	Insertion - In frame(2)	prostate(2)	c.242_243insAGCAGCAGC						.																																			SO:0001652	inframe_insertion	3782	exon1			TGCGGTGGCTGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.233_241dupAGCAGCAGC	1.37:g.154842200_154842208dupGCTGCTGCT	ENSP00000271915:p.Gln78_Gln80dup	28	0		116	40	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
NDUFB5	4711	broad.mit.edu	37	3	179322628	179322629	+	Frame_Shift_Ins	INS	-	-	G	rs144873631|rs11539673		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr3:179322628_179322629insG	ENST00000259037.3	+	1	139_140	c.25_26insG	c.(25-27)cggfs	p.R9fs	MRPL47_ENST00000392659.2_5'Flank|MRPL47_ENST00000476781.1_5'Flank|MRPL47_ENST00000259038.2_5'Flank|NDUFB5_ENST00000472629.1_Frame_Shift_Ins_p.R9fs|NDUFB5_ENST00000493866.1_Frame_Shift_Ins_p.R9fs	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	9					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.R9P(1)		endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			TTTGTTGCGGCGGGTTTCGGTT	0.609																																					p.R9fs		.											.	NDUFB5-91	1	Substitution - Missense(1)	lung(1)	c.25_26insG						.																																			SO:0001589	frameshift_variant	4711	exon1			TTGCGGCGGGTTT	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.28dupG	3.37:g.179322631_179322631dupG	ENSP00000259037:p.Arg9fs	79	0		107	7	NM_001199958	0	0	0	0	0	Q561V6	Frame_Shift_Ins	INS	ENST00000259037.3	37	CCDS3234.1																																																																																			.		0.609	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348937.2	NM_002492	
CCDC132	55610	broad.mit.edu	37	7	92923947	92923948	+	Splice_Site	INS	-	-	G	rs140810598		TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr7:92923947_92923948insG	ENST00000305866.5	+	14	1294_1295	c.1166_1167insG	c.(1165-1170)caggat>caGggat	p.D390fs	CCDC132_ENST00000535481.1_Splice_Site_p.D110fs|CCDC132_ENST00000544910.1_Splice_Site_p.D360fs|CCDC132_ENST00000541136.1_Splice_Site_p.D201fs|CCDC132_ENST00000317751.6_Splice_Site_p.D121fs	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	390						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CGAATATGGCAGGTTTGGtttt	0.272																																					p.Q389fs		.											.	CCDC132-90	0			c.1166_1167insG						.																																			SO:0001630	splice_region_variant	55610	exon14			TATGGCAGGTTTG	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1167+1->G	7.37:g.92923949_92923949dupG		122	0		236	37	NM_017667	0	0	0	0	0	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Frame_Shift_Ins	INS	ENST00000305866.5	37	CCDS43617.1																																																																																			.		0.272	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	Frame_Shift_Ins
LMX1B	4010	broad.mit.edu	37	9	129376842	129376843	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5KS-01A-11D-A30A-10	TCGA-OR-A5KS-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66cd2c9e-018a-45ed-bc81-96e043cf32cb	325dd1e8-4b64-4e67-a7e0-4496272625cd	g.chr9:129376842_129376843insC	ENST00000373474.4	+	1	121_122	c.114_115insC	c.(115-117)cccfs	p.P39fs	LMX1B_ENST00000561065.1_Frame_Shift_Ins_p.P16fs|LMX1B_ENST00000425646.2_Frame_Shift_Ins_p.P16fs|LMX1B_ENST00000355497.5_Frame_Shift_Ins_p.P39fs|RP11-123K19.1_ENST00000451449.2_RNA|RP11-123K19.1_ENST00000425370.1_RNA|RP11-123K19.1_ENST00000432418.1_RNA|LMX1B_ENST00000526117.1_Frame_Shift_Ins_p.P39fs			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	39					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						TGCGCCCCGGGCCCGCCACTCT	0.708									Nail-Patella Syndrome																												p.G38fs	Pancreas(110;1796 2278 18357 20466)	.											.	LMX1B-90	0			c.114_115insC						.																																			SO:0001589	frameshift_variant	4010	exon1	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	CCCCGGGCCCGCC	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.117dupC	9.37:g.129376845_129376845dupC	ENSP00000362573:p.Pro39fs	5	0		104	8	NM_002316	0	0	0	0	0	F8W7W6|O75463|Q5JU95|Q6ISC9	Frame_Shift_Ins	INS	ENST00000373474.4	37	CCDS55342.1																																																																																			.		0.708	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
