#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	0	0		6	6	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
CNR2	1269	bcgsc.ca	37	1	24201357	24201357	+	Silent	SNP	A	A	G	rs4649124	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:24201357A>G	ENST00000374472.4	-	2	912	c.751T>C	c.(751-753)Ttg>Ctg	p.L251L	CNR2_ENST00000536471.1_Silent_p.L251L	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	251					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	AGCACAGCCAACACTAGCCCT	0.597													G|||	3272	0.653355	0.7943	0.6383	5008	,	,		21118	0.502		0.5875	False		,,,				2504	0.6973				p.L251L		.											.	CNR2-228	0			c.T751C						.	G		3310,1096	396.0+/-329.9	1261,788,154	93.0	74.0	80.0		751	1.7	1.0	1	dbSNP_111	80	4935,3665	526.0+/-380.9	1402,2131,767	no	coding-synonymous	CNR2	NM_001841.2		2663,2919,921	GG,GA,AA		42.6163,24.8752,36.6062		251/361	24201357	8245,4761	2203	4300	6503	SO:0001819	synonymous_variant	1269	exon2			CAGCCAACACTAG	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.751T>C	1.37:g.24201357A>G		197	4		203	7	NM_001841	0	0	0	0	0	C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	ENST00000374472.4	37	CCDS245.1																																																																																			A|0.358;G|0.642		0.597	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841	
SFN	2810	broad.mit.edu	37	1	27189835	27189835	+	Silent	SNP	C	C	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:27189835C>G	ENST00000339276.4	+	1	203	c.132C>G	c.(130-132)ctC>ctG	p.L44L		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0	Exonuclease.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		GAAACCTGCTCTCAGTAGCCT	0.602																																					p.L44L		.											.	SFN-658	0			c.C132G						.						48.0	50.0	49.0					1																	27189835		2203	4300	6503	SO:0001819	synonymous_variant	2810	exon1			CCTGCTCTCAGTA	BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.132C>G	1.37:g.27189835C>G		265	0		263	7	NM_006142	0	0	0	0	0	B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Silent	SNP	ENST00000339276.4	37	CCDS288.1																																																																																			.		0.602	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011709.1	NM_006142	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		7	7	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
PRPF38A	84950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	52878204	52878204	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:52878204G>A	ENST00000257181.9	+	5	703	c.517G>A	c.(517-519)Gaa>Aaa	p.E173K	PRPF38A_ENST00000474048.1_3'UTR|snoU13_ENST00000458879.1_RNA	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	173					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						TGTATTAGAGGAAGCTGAGCA	0.478																																					p.E173K		.											.	PRPF38A-90	0			c.G517A						.						82.0	85.0	84.0					1																	52878204		2203	4300	6503	SO:0001583	missense	84950	exon5			TTAGAGGAAGCTG	AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.517G>A	1.37:g.52878204G>A	ENSP00000257181:p.Glu173Lys	115	0		98	7	NM_032864	0	0	47	50	3	Q96JW1|Q9BVZ8	Missense_Mutation	SNP	ENST00000257181.9	37	CCDS567.1	.	.	.	.	.	.	.	.	.	.	G	35	5.444230	0.96187	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	M	0.75264	2.295	0.80722	D	1	P	0.38250	0.624	P	0.46718	0.525	T	0.64972	-0.6281	9	0.07030	T	0.85	-16.8095	19.9161	0.97063	0.0:0.0:1.0:0.0	.	173	Q8NAV1	PR38A_HUMAN	K	173	.	ENSP00000257181:E173K	E	+	1	0	PRPF38A	52650792	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.059000	0.93902	2.710000	0.92621	0.650000	0.86243	GAA	.		0.478	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022459.2	NM_032864	
CTBS	1486	broad.mit.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538				p.31_34del		.											.	CTBS-90	0			c.92_100del						.			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				SO:0001651	inframe_deletion	1486	exon1			CGAGCCGCAGCGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	13	0		65	11	NM_004388	0	0	0	0	0	Q5VX50	In_Frame_Del	DEL	ENST00000370630.5	37	CCDS698.1																																																																																			.		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		4	0		19	7	NM_018364	0	0	0	0	0	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		7	6	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
SPRR3	6707	ucsc.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		171	0		172	41	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		0	0		7	6	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
CENPF	1063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	214816610	214816610	+	Silent	SNP	C	C	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:214816610C>G	ENST00000366955.3	+	12	5097	c.4929C>G	c.(4927-4929)ctC>ctG	p.L1643L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1739					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TAGCACGACTCCAGCTACAAG	0.473																																					p.L1643L	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.C4929G						.						88.0	79.0	82.0					1																	214816610		2203	4300	6503	SO:0001819	synonymous_variant	1063	exon12			ACGACTCCAGCTA	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4929C>G	1.37:g.214816610C>G		145	0		140	71	NM_016343	0	0	0	1	1	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1																																																																																			.		0.473	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	0	0		12	9	NM_001271223	0	0	1	1	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	237811822	237811822	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr1:237811822delG	ENST00000366574.2	+	49	7738	c.7421delG	c.(7420-7422)aggfs	p.R2474fs	RYR2_ENST00000542537.1_Frame_Shift_Del_p.R2458fs|RYR2_ENST00000360064.6_Frame_Shift_Del_p.R2472fs	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2474	4 X approximate repeats.		R -> S (in CPVT1). {ECO:0000269|PubMed:11208676, ECO:0000269|PubMed:12093772}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCCTTGACAGGGTCTATGGG	0.483																																					p.R2474fs		.											.	RYR2-158	0			c.7421delG						.						108.0	100.0	103.0					1																	237811822		1919	4143	6062	SO:0001589	frameshift_variant	6262	exon49			TTGACAGGGTCTA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7421delG	1.37:g.237811822delG	ENSP00000355533:p.Arg2474fs	217	0		213	94	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Frame_Shift_Del	DEL	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.483	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
ABI1	10006	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	27040664	27040664	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr10:27040664G>A	ENST00000376142.2	-	11	1285	c.1214C>T	c.(1213-1215)cCc>cTc	p.P405L	ABI1_ENST00000376138.3_Missense_Mutation_p.P349L|ABI1_ENST00000376160.1_Missense_Mutation_p.P372L|ABI1_ENST00000376170.4_Missense_Mutation_p.P348L|ABI1_ENST00000346832.5_Missense_Mutation_p.P393L|ABI1_ENST00000376166.1_Missense_Mutation_p.P343L|ABI1_ENST00000376139.2_Missense_Mutation_p.P373L|ABI1_ENST00000490841.2_Missense_Mutation_p.P226L|ABI1_ENST00000376137.4_Missense_Mutation_p.P320L|ABI1_ENST00000376134.3_Missense_Mutation_p.P379L|ABI1_ENST00000536334.1_Missense_Mutation_p.P291L|ABI1_ENST00000359188.4_Missense_Mutation_p.P377L|ABI1_ENST00000355394.4_Missense_Mutation_p.P406L|ABI1_ENST00000376140.3_Missense_Mutation_p.P378L	NM_005470.3	NP_005461.2	Q8IZP0	ABI1_HUMAN	abl-interactor 1	405	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium morphogenesis (GO:0072673)|megakaryocyte development (GO:0035855)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|SCAR complex (GO:0031209)	cytoskeletal protein binding (GO:0008092)|protein complex binding (GO:0032403)|protein tyrosine kinase activator activity (GO:0030296)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATCAAACATGGGAATGTCATC	0.443																																					p.P405L		.											.	ABI1-1082	0			c.C1214T						.						139.0	150.0	146.0					10																	27040664		2203	4300	6503	SO:0001583	missense	10006	exon11			AACATGGGAATGT	U87166	CCDS7150.1, CCDS31169.1, CCDS31170.1, CCDS31171.1, CCDS53497.1, CCDS53498.1, CCDS53499.1, CCDS53500.1, CCDS53501.1, CCDS73077.1, CCDS73078.1	10p12.1	2009-05-29	2004-03-17	2004-03-19	ENSG00000136754	ENSG00000136754			11320	protein-coding gene	gene with protein product		603050	"""spectrin SH3 domain binding protein 1"""	SSH3BP1		9593709, 9010225	Standard	NM_005470		Approved	E3B1, ABI-1	uc001isx.3	Q8IZP0	OTTHUMG00000017848	ENST00000376142.2:c.1214C>T	10.37:g.27040664G>A	ENSP00000365312:p.Pro405Leu	110	1		105	46	NM_005470	0	0	11	12	1	A9Z1Y6|B3KX62|B4DQ58|H7BXI6|O15147|O76049|O95060|Q5T2R3|Q5T2R4|Q5T2R6|Q5T2R7|Q5T2R9|Q5W070|Q5W072|Q8TB63|Q96S81|Q9NXZ9|Q9NYB8	Missense_Mutation	SNP	ENST00000376142.2	37	CCDS7150.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.224804	0.58668	.	.	ENSG00000136754	ENST00000376138;ENST00000376170;ENST00000376166;ENST00000376160;ENST00000376142;ENST00000359188;ENST00000376139;ENST00000355394;ENST00000346832;ENST00000376134;ENST00000376137;ENST00000536334;ENST00000490841;ENST00000376140	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	2.36;2.36;2.36;0.98;0.95;0.95;0.96;1.06;2.36;0.86;1.09;2.36;0.99;0.97	5.31	5.31	0.75309	Src homology-3 domain (1);	0.727226	0.14738	N	0.301356	T	0.52289	0.1725	M	0.77313	2.365	0.41197	D	0.98634	B;B;B;B;B;B;B;B;B;B;B;B;B	0.34264	0.043;0.043;0.043;0.073;0.446;0.194;0.172;0.053;0.017;0.376;0.01;0.053;0.151	B;B;B;B;B;B;B;B;B;B;B;B;B	0.28784	0.006;0.006;0.011;0.015;0.094;0.04;0.023;0.059;0.027;0.073;0.015;0.059;0.088	T	0.57177	-0.7856	10	0.44086	T	0.13	-4.6766	19.3231	0.94250	0.0:0.0:1.0:0.0	.	290;319;226;285;215;343;373;377;393;349;373;378;405	B6VEX4;B6VEX3;B4DQ58;Q8IZP0-10;B4DKX2;Q5T2R9;Q59G41;Q8IZP0-6;B3KX62;Q8IZP0-3;Q8IZP0-5;Q8IZP0-9;Q8IZP0	.;.;.;.;.;.;.;.;.;.;.;.;ABI1_HUMAN	L	349;348;343;372;405;377;373;406;393;379;320;291;226;378	ENSP00000365308:P349L;ENSP00000365340:P348L;ENSP00000365336:P343L;ENSP00000365330:P372L;ENSP00000365312:P405L;ENSP00000352114:P377L;ENSP00000365309:P373L;ENSP00000347555:P406L;ENSP00000279599:P393L;ENSP00000365304:P379L;ENSP00000365307:P320L;ENSP00000439646:P291L;ENSP00000440101:P226L;ENSP00000365310:P378L	ENSP00000279599:P393L	P	-	2	0	ABI1	27080670	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.621000	0.74228	2.640000	0.89533	0.655000	0.94253	CCC	.		0.443	ABI1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047287.1	NM_005470	
SYNPO2L	79933	broad.mit.edu	37	10	75407622	75407622	+	Silent	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr10:75407622C>A	ENST00000394810.2	-	4	1937	c.1788G>T	c.(1786-1788)gcG>gcT	p.A596A	SYNPO2L_ENST00000372873.4_Silent_p.A372A	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	596	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CTGGGGCAGGCGCCTCTGGGC	0.711																																					p.A596A		.											.	SYNPO2L-91	0			c.G1788T						.						15.0	18.0	17.0					10																	75407622		2059	4187	6246	SO:0001819	synonymous_variant	79933	exon4			GGCAGGCGCCTCT	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.1788G>T	10.37:g.75407622C>A		28	0		55	5	NM_001114133	0	0	0	0	0	A5PKV9|Q68A20	Silent	SNP	ENST00000394810.2	37	CCDS44438.1																																																																																			.		0.711	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316562.2	NM_024875	
ARMS2	387715	bcgsc.ca	37	10	124214448	124214448	+	Missense_Mutation	SNP	G	G	T	rs10490924	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr10:124214448G>T	ENST00000528446.1	+	1	280	c.205G>T	c.(205-207)Gct>Tct	p.A69S		NM_001099667.1	NP_001093137.1	P0C7Q2	ARMS2_HUMAN	age-related maculopathy susceptibility 2	69			A -> S (in dbSNP:rs10490924). {ECO:0000269|PubMed:16174643, ECO:0000269|PubMed:16642439, ECO:0000269|PubMed:16936732, ECO:0000269|PubMed:17000705, ECO:0000269|PubMed:17053108, ECO:0000269|PubMed:17210852, ECO:0000269|PubMed:17675241, ECO:0000269|PubMed:17884985, ECO:0000269|PubMed:18423869, ECO:0000269|PubMed:18436811, ECO:0000269|PubMed:18452766}.		retina homeostasis (GO:0001895)	mitochondrion (GO:0005739)|photoreceptor inner segment (GO:0001917)				ovary(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GATCCCAGCTGCTAAAATCCA	0.537													G|||	1435	0.286542	0.2458	0.2478	5008	,	,		19203	0.4038		0.1948	False		,,,				2504	0.3425				p.A69S		.											.	ARMS2-1	0			c.G205T	GRCh37	CM066533	ARMS2	M	rs10490924	.	G	SER/ALA	824,3200		89,646,1277	95.0	94.0	94.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	205	1.0	0.0	10	dbSNP_119	94	1724,6652		182,1360,2646	yes	missense	ARMS2	NM_001099667.1	99	271,2006,3923	TT,TG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	20.5826,20.4771,20.5484	benign	69/108	124214448	2548,9852	2012	4188	6200	SO:0001583	missense	387715	exon1			CCAGCTGCTAAAA	BC066349	CCDS53585.1	10q26.13	2013-01-23			ENSG00000254636	ENSG00000254636			32685	protein-coding gene	gene with protein product		611313				16080115, 16174643	Standard	NM_001099667		Approved	LOC387715, ARMD8	uc001lgi.3	P0C7Q2	OTTHUMG00000048232	ENST00000528446.1:c.205G>T	10.37:g.124214448G>T	ENSP00000436682:p.Ala69Ser	137	3		157	6	NM_001099667	0	0	0	0	0	B2Y7I5	Missense_Mutation	SNP	ENST00000528446.1	37	CCDS53585.1	597	0.2733516483516483	126	0.25609756097560976	90	0.24861878453038674	230	0.4020979020979021	151	0.19920844327176782	G	8.897	0.955517	0.18507	0.204771	0.205826	ENSG00000254636	ENST00000528446	T	0.38401	1.14	1.97	0.998	0.19857	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.64830	0.994	D	0.68353	0.957	T	0.41822	-0.9487	8	0.87932	D	0	.	6.1676	0.20398	0.0:0.3219:0.6781:0.0	rs10490924;rs10490924	69	P0C7Q2	ARMS2_HUMAN	S	69	ENSP00000436682:A69S	ENSP00000436682:A69S	A	+	1	0	ARMS2	124204438	0.006000	0.16342	0.005000	0.12908	0.078000	0.17371	0.208000	0.17415	0.370000	0.24538	0.491000	0.48974	GCT	G|0.712;T|0.288		0.537	ARMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109727.2		
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		0	0		8	7	NM_001323	0	0	0	1	1	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
TMEM151A	256472	hgsc.bcm.edu	37	11	66062454	66062454	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr11:66062454A>G	ENST00000327259.4	+	2	881	c.737A>G	c.(736-738)aAc>aGc	p.N246S		NM_153266.3	NP_694998.1	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	246						integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(4)|lung(6)	11						TTCAGCGCCAACGAGGGCCTG	0.692																																					p.N246S		.											.	TMEM151A-90	0			c.A737G						.						13.0	11.0	12.0					11																	66062454		2131	4136	6267	SO:0001583	missense	256472	exon2			GCGCCAACGAGGG	BC033898	CCDS8133.1	11q13.2	2007-10-25	2007-10-25	2007-10-25	ENSG00000179292	ENSG00000179292			28497	protein-coding gene	gene with protein product			"""transmembrane protein 151"""	TMEM151		12477932	Standard	NM_153266		Approved	MGC33486	uc001ohl.3	Q8N4L1	OTTHUMG00000166920	ENST00000327259.4:c.737A>G	11.37:g.66062454A>G	ENSP00000326244:p.Asn246Ser	3	0		49	23	NM_153266	0	0	4	8	4	Q8ND14	Missense_Mutation	SNP	ENST00000327259.4	37	CCDS8133.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165812	0.78339	.	.	ENSG00000179292	ENST00000327259	.	.	.	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000001	T	0.54271	0.1848	M	0.67397	2.05	0.48511	D	0.999669	P	0.37864	0.61	B	0.35240	0.198	T	0.61540	-0.7042	9	0.59425	D	0.04	.	12.3981	0.55397	1.0:0.0:0.0:0.0	.	246	Q8N4L1	T151A_HUMAN	S	246	.	ENSP00000326244:N246S	N	+	2	0	TMEM151A	65819030	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.014000	0.93635	1.759000	0.51996	0.533000	0.62120	AAC	.		0.692	TMEM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391897.1	NM_153266	
SORL1	6653	ucsc.edu;bcgsc.ca	37	11	121429444	121429444	+	Silent	SNP	G	G	A	rs370296806		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr11:121429444G>A	ENST00000260197.7	+	20	2937	c.2808G>A	c.(2806-2808)acG>acA	p.T936T		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	936					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTTACTGGACGGATGCCTACC	0.542																																					p.T936T		.											.	SORL1-228	0			c.G2808A						.	A		0,4406		0,0,2203	222.0	181.0	195.0		2808	-11.1	0.0	11		195	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	SORL1	NM_003105.5		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		936/2215	121429444	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	6653	exon20			CTGGACGGATGCC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2808G>A	11.37:g.121429444G>A		360	2		294	131	NM_003105	0	0	0	0	0	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1																																																																																			.		0.542	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
ETV6	2120	bcgsc.ca	37	12	11992168	11992168	+	Silent	SNP	G	G	A	rs11611479	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:11992168G>A	ENST00000396373.4	+	3	532	c.258G>A	c.(256-258)acG>acA	p.T86T		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	86	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				ACAGCAACACGTTTGAAATGA	0.488			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""								G|||	1066	0.212859	0.23	0.111	5008	,	,		21183	0.2192		0.1093	False		,,,				2504	0.362				p.T86T		.		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	ETV6-1674	0			c.G258A						.	G		815,3591	326.9+/-299.8	75,665,1463	114.0	106.0	109.0		258	-6.2	0.6	12	dbSNP_120	109	887,7713	199.3+/-243.4	53,781,3466	no	coding-synonymous	ETV6	NM_001987.4		128,1446,4929	AA,AG,GG		10.314,18.4975,13.0863		86/453	11992168	1702,11304	2203	4300	6503	SO:0001819	synonymous_variant	2120	exon3			CAACACGTTTGAA	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.258G>A	12.37:g.11992168G>A		264	1		265	8	NM_001987	0	0	4	4	0	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Silent	SNP	ENST00000396373.4	37	CCDS8643.1																																																																																			G|0.850;A|0.150		0.488	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987	
C2CD5	9847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	22635541	22635541	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:22635541C>T	ENST00000333957.4	-	14	1942	c.1687G>A	c.(1687-1689)Gga>Aga	p.G563R	C2CD5_ENST00000544930.1_Missense_Mutation_p.G378R|C2CD5_ENST00000545552.1_Missense_Mutation_p.G576R|C2CD5_ENST00000536386.1_Missense_Mutation_p.G565R|C2CD5_ENST00000446597.1_Missense_Mutation_p.G563R|C2CD5_ENST00000396028.2_Missense_Mutation_p.G554R|C2CD5_ENST00000542676.1_Missense_Mutation_p.G563R	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	563					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)	p.G563*(1)|p.G378*(1)									ATTCTTAGTCCAAACAAAGCA	0.323																																					p.G563R		.											.	.	2	Substitution - Nonsense(2)	lung(2)	c.G1687A						.						179.0	166.0	170.0					12																	22635541		2203	4300	6503	SO:0001583	missense	9847	exon14			TTAGTCCAAACAA	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1687G>A	12.37:g.22635541C>T	ENSP00000334229:p.Gly563Arg	132	0		146	52	NM_014802	0	0	1	2	1	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978228	0.92982	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930	T;T;T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7;2.7;2.7	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	M	0.76170	2.325	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.996;0.997;0.992;0.992;1.0;0.982	T	0.24190	-1.0167	10	0.87932	D	0	-22.6347	19.6014	0.95563	0.0:1.0:0.0:0.0	.	565;563;378;565;554;563	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;.;K0528_HUMAN	R	563;563;565;554;563;576;378	ENSP00000334229:G563R;ENSP00000388756:G563R;ENSP00000439392:G565R;ENSP00000379345:G554R;ENSP00000441951:G563R;ENSP00000443204:G576R;ENSP00000445288:G378R	ENSP00000334229:G563R	G	-	1	0	KIAA0528	22526808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.109000	0.77062	2.622000	0.88805	0.650000	0.86243	GGA	.		0.323	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
KANSL2	54934	broad.mit.edu	37	12	49054319	49054319	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:49054319T>C	ENST00000420613.2	-	8	1104	c.1057A>G	c.(1057-1059)Agc>Ggc	p.S353G	KANSL2_ENST00000550347.1_Missense_Mutation_p.S536G|KANSL2_ENST00000553086.1_Missense_Mutation_p.S353G|KANSL2_ENST00000548701.1_5'UTR	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	353					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											TCAGAGAGGCTTACAGGAACA	0.507																																					p.S353G		.											.	.	0			c.A1057G						.						58.0	62.0	61.0					12																	49054319		1880	4127	6007	SO:0001583	missense	54934	exon8			AGAGGCTTACAGG	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.1057A>G	12.37:g.49054319T>C	ENSP00000415436:p.Ser353Gly	138	0		169	5	NM_017822	0	0	40	40	0	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	ENST00000420613.2	37	CCDS44869.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.314443	0.40996	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000547087;ENST00000553086	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.38	5.38	0.77491	.	0.091257	0.85682	D	0.000000	T	0.31295	0.0792	N	0.21282	0.65	0.80722	D	1	B;B;B;B	0.20368	0.008;0.009;0.044;0.002	B;B;B;B	0.17722	0.009;0.008;0.019;0.003	T	0.06899	-1.0801	10	0.40728	T	0.16	-3.502	14.3762	0.66879	0.0:0.0:0.0:1.0	.	536;353;158;353	F8VX10;Q9H9L4;Q9H9L4-2;F8VXI8	.;CL041_HUMAN;.;.	G	536;353;101;353	ENSP00000449747:S536G;ENSP00000415436:S353G;ENSP00000447608:S101G;ENSP00000448833:S353G	ENSP00000415436:S353G	S	-	1	0	C12orf41	47340586	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.128000	0.64733	2.041000	0.60428	0.377000	0.23210	AGC	.		0.507	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		265	17		294	11	NM_032704	0	0	442	642	200		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		0	0		13	6	NM_152435	0	0	1	1	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		0	0		9	4	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
KSR2	283455	bcgsc.ca	37	12	117993064	117993064	+	Silent	SNP	C	C	T	rs7955803	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:117993064C>T	ENST00000339824.5	-	9	2155	c.1428G>A	c.(1426-1428)ccG>ccA	p.P476P	KSR2_ENST00000302438.5_Silent_p.P173P|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Silent_p.P447P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	476					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGATGTCACACGGAACGGACT	0.488													C|||	1264	0.252396	0.2799	0.2003	5008	,	,		20620	0.1587		0.2684	False		,,,				2504	0.3323				p.P447P		.											.	KSR2-1449	0			c.G1341A						.	C		1045,2909		143,759,1075	130.0	135.0	134.0		1341	-10.2	0.3	12	dbSNP_116	134	2125,6185		286,1553,2316	no	coding-synonymous	KSR2	NM_173598.4		429,2312,3391	TT,TC,CC		25.5716,26.4289,25.848		447/922	117993064	3170,9094	1977	4155	6132	SO:0001819	synonymous_variant	283455	exon9			GTCACACGGAACG	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1428G>A	12.37:g.117993064C>T		266	3		278	10	NM_173598	0	0	0	0	0	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																				C|0.758;T|0.242		0.488	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000536002.1_Silent_p.P565P|RIMBP2_ENST00000535703.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		0	0		34	32	NM_015347	0	0	0	3	3	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
MICU2	221154	hgsc.bcm.edu	37	13	22178258	22178258	+	Silent	SNP	C	C	T	rs9509812	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr13:22178258C>T	ENST00000382374.4	-	1	95	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	10	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGGCCGCCACCCGCGCGCAGC	0.751													C|||	455	0.0908546	0.0113	0.1441	5008	,	,		12694	0.002		0.2545	False		,,,				2504	0.0838				p.R10R		.											.	EFHA1-90	0			c.G30A						.	C		108,3144		5,98,1523	3.0	3.0	3.0		30	-1.6	0.0	13	dbSNP_119	3	1216,5514		95,1026,2244	no	coding-synonymous	EFHA1	NM_152726.2		100,1124,3767	TT,TC,CC		18.0684,3.321,13.2639		10/435	22178258	1324,8658	1626	3365	4991	SO:0001819	synonymous_variant	221154	exon1			CGCCACCCGCGCG	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.30G>A	13.37:g.22178258C>T		0	0		15	15	NM_152726	0	0	0	11	11	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			C|0.873;T|0.127		0.751	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		24	0		49	4	NM_080687	0	0	19	19	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
LRRC16B	90668	broad.mit.edu	37	14	24527267	24527267	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr14:24527267C>A	ENST00000342740.5	+	16	1470	c.1316C>A	c.(1315-1317)gCc>gAc	p.A439D	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	439						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CCCCTGGAGGCCCTCAGGTCG	0.662											OREG0022615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A439D		.											.	LRRC16B-139	0			c.C1316A						.						46.0	50.0	49.0					14																	24527267		2203	4300	6503	SO:0001583	missense	90668	exon16			TGGAGGCCCTCAG	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1316C>A	14.37:g.24527267C>A	ENSP00000340467:p.Ala439Asp	98	1	772	129	5	NM_138360	0	0	0	0	0	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001283	0.54254	.	.	ENSG00000186648	ENST00000342740	T	0.52983	0.64	4.8	4.8	0.61643	.	0.689522	0.14267	N	0.330452	T	0.39860	0.1094	L	0.46157	1.445	0.80722	D	1	P	0.40476	0.718	B	0.33750	0.169	T	0.35051	-0.9804	10	0.41790	T	0.15	-17.5985	13.4393	0.61104	0.0:1.0:0.0:0.0	.	439	Q8ND23	LR16B_HUMAN	D	439	ENSP00000340467:A439D	ENSP00000340467:A439D	A	+	2	0	LRRC16B	23597107	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.114000	0.50383	2.213000	0.71641	0.456000	0.33151	GCC	.		0.662	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		7	7	NM_001127258	0	0	0	2	2	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
PHGR1	644844	hgsc.bcm.edu	37	15	40648372	40648372	+	Silent	SNP	T	T	C	rs12900982		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr15:40648372T>C	ENST00000448599.2	+	4	173	c.117T>C	c.(115-117)ggT>ggC	p.G39G	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	39	Gly-rich.																CCCACCATGGTCCAGGGCCCT	0.776																																					p.G39G		.											.	.	0			c.T117C						.						1.0	2.0	2.0					15																	40648372		356	1106	1462	SO:0001819	synonymous_variant	644844	exon3			CCATGGTCCAGGG		CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.117T>C	15.37:g.40648372T>C		7	0		18	4	NM_001145643	0	0	0	0	0		Silent	SNP	ENST00000448599.2	37	CCDS45225.1																																																																																			T|0.839;C|0.161		0.776	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418450.1	NM_001145643	
WDR72	256764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	53998158	53998158	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr15:53998158A>T	ENST00000396328.1	-	10	1307	c.1068T>A	c.(1066-1068)gaT>gaA	p.D356E	WDR72_ENST00000557913.1_Missense_Mutation_p.D353E|WDR72_ENST00000360509.5_Missense_Mutation_p.D356E|WDR72_ENST00000559418.1_Missense_Mutation_p.D366E	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	356										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		ATACAGGAACATCAGGGATGT	0.373																																					p.D356E		.											.	WDR72-92	0			c.T1068A						.						109.0	108.0	108.0					15																	53998158		2194	4293	6487	SO:0001583	missense	256764	exon10			AGGAACATCAGGG	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1068T>A	15.37:g.53998158A>T	ENSP00000379619:p.Asp356Glu	66	0		71	31	NM_182758	0	0	0	0	0	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.120294	0.77323	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.71698	-0.59;-0.59	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.82061	0.4955	M	0.65975	2.015	0.42414	D	0.992611	D	0.76494	0.999	D	0.85130	0.997	T	0.80970	-0.1144	10	0.33141	T	0.24	.	15.2683	0.73681	1.0:0.0:0.0:0.0	.	356	Q3MJ13	WDR72_HUMAN	E	356	ENSP00000379619:D356E;ENSP00000353699:D356E	ENSP00000353699:D356E	D	-	3	2	WDR72	51785450	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.458000	0.60095	2.202000	0.70862	0.533000	0.62120	GAT	.		0.373	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	0	0		8	4	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
PARP6	56965	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	72543246	72543246	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr15:72543246G>A	ENST00000569795.1	-	18	2045	c.1358C>T	c.(1357-1359)cCt>cTt	p.P453L	PARP6_ENST00000413097.2_Intron|PARP6_ENST00000287196.9_Missense_Mutation_p.P453L|PARP6_ENST00000260376.7_Missense_Mutation_p.P453L			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	453	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						CTCCTTGGCAGGAGGGCTGCT	0.612																																					p.P453L		.											.	PARP6-522	0			c.C1358T						.						28.0	30.0	29.0					15																	72543246		1984	4157	6141	SO:0001583	missense	56965	exon17			TTGGCAGGAGGGC	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.1358C>T	15.37:g.72543246G>A	ENSP00000456348:p.Pro453Leu	175	0		172	78	NM_020214	0	0	9	20	11	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	ENST00000569795.1	37	CCDS10241.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832988	0.91036	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376	.	.	.	5.43	4.49	0.54785	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.055104	0.85682	D	0.000000	T	0.80188	0.4577	M	0.85542	2.76	0.80722	D	1	D;B;D	0.89917	1.0;0.001;1.0	D;B;D	0.97110	1.0;0.005;0.999	T	0.82782	-0.0287	9	0.87932	D	0	-16.0921	13.8714	0.63622	0.0747:0.0:0.9253:0.0	.	454;453;386	Q0VDG0;Q2NL67;A0PJ50	.;PARP6_HUMAN;.	L	454;453;453	.	ENSP00000260376:P453L	P	-	2	0	PARP6	70330300	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.742000	0.85008	2.824000	0.97209	0.655000	0.94253	CCT	.		0.612	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	NM_020214	
UBL7	84993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74740854	74740854	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr15:74740854G>A	ENST00000567435.1	-	10	1433	c.970C>T	c.(970-972)Cat>Tat	p.H324Y	UBL7_ENST00000565335.1_Missense_Mutation_p.H324Y|UBL7_ENST00000564488.1_Missense_Mutation_p.H324Y|UBL7_ENST00000395081.2_Missense_Mutation_p.H324Y|UBL7_ENST00000361351.4_Missense_Mutation_p.H324Y			Q96S82	UBL7_HUMAN	ubiquitin-like 7	324										endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						TGAAGGGCATGCTGTAGGGCT	0.542																																					p.H324Y		.											.	UBL7-91	0			c.C970T						.						227.0	206.0	213.0					15																	74740854		2197	4296	6493	SO:0001583	missense	84993	exon10			GGGCATGCTGTAG	BC007913	CCDS10263.1	15q23	2014-03-06	2014-03-06		ENSG00000138629	ENSG00000138629			28221	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived ubiquitin-like"", "" ubiquitin-like protein SB132"""	609748	"""ubiquitin-like 7 (bone marrow stromal cell-derived)"""			12644319	Standard	NM_201265		Approved	BMSC-UbP, MGC14421	uc002axy.1	Q96S82	OTTHUMG00000139001	ENST00000567435.1:c.970C>T	15.37:g.74740854G>A	ENSP00000457703:p.His324Tyr	225	0		225	101	NM_201265	0	0	44	89	45	D3DW57|Q96I03	Missense_Mutation	SNP	ENST00000567435.1	37	CCDS10263.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516381	0.64634	.	.	ENSG00000138629	ENST00000361351;ENST00000395081	T;T	0.43688	0.94;0.94	4.99	4.99	0.66335	.	0.053002	0.85682	D	0.000000	T	0.26991	0.0661	N	0.14661	0.345	0.58432	D	0.99999	B;P	0.39282	0.0;0.666	B;B	0.35114	0.0;0.196	T	0.07102	-1.0790	10	0.27082	T	0.32	-27.9937	16.8509	0.85993	0.0:0.0:1.0:0.0	.	364;324	D3DW56;Q96S82	.;UBL7_HUMAN	Y	324	ENSP00000354883:H324Y;ENSP00000378518:H324Y	ENSP00000354883:H324Y	H	-	1	0	UBL7	72527907	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.363000	0.97131	2.307000	0.77673	0.462000	0.41574	CAT	.		0.542	UBL7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419627.1	NM_032907, NM_201265	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	EME2_ENST00000307394.7_Silent_p.V72V|NME3_ENST00000563498.1_5'Flank|NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		4	4	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ALG1	56052	bcgsc.ca	37	16	5132636	5132636	+	Silent	SNP	C	C	T	rs1047732	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr16:5132636C>T	ENST00000262374.5	+	11	1180	c.1149C>T	c.(1147-1149)ttC>ttT	p.F383F	ALG1_ENST00000588623.1_Silent_p.F272F|ALG1_ENST00000544428.1_Silent_p.F272F	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase	383					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				TGGACATGTTCGGGTGCTGTT	0.592													C|||	2603	0.519768	0.3903	0.415	5008	,	,		20459	0.629		0.495	False		,,,				2504	0.682				p.F383F		.											.	ALG1-92	0			c.C1149T						.	C		1679,2475		348,983,746	87.0	66.0	73.0		1149	-3.4	1.0	16	dbSNP_86	73	3990,3934		1038,1914,1010	no	coding-synonymous	ALG1	NM_019109.4		1386,2897,1756	TT,TC,CC		49.6466,40.4189,46.9366		383/465	5132636	5669,6409	2077	3962	6039	SO:0001819	synonymous_variant	56052	exon11			CATGTTCGGGTGC	AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.1149C>T	16.37:g.5132636C>T		63	0		48	5	NM_019109	0	0	30	30	0	B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Silent	SNP	ENST00000262374.5	37	CCDS10528.1																																																																																			C|0.537;T|0.463		0.592	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251716.2	NM_019109	
NUTF2	10204	broad.mit.edu	37	16	67899046	67899046	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr16:67899046C>A	ENST00000219169.4	+	2	296	c.13C>A	c.(13-15)Cca>Aca	p.P5T	NUTF2_ENST00000568396.2_Missense_Mutation_p.P5T|NUTF2_ENST00000569436.2_Missense_Mutation_p.P5T	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	5					protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)	p.P5T(1)		kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		GGGAGACAAGCCAATTTGGGA	0.488																																					p.P5T		.											.	NUTF2-68	1	Substitution - Missense(1)	kidney(1)	c.C13A						.						65.0	55.0	59.0					16																	67899046		2198	4300	6498	SO:0001583	missense	10204	exon2			GACAAGCCAATTT	U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.13C>A	16.37:g.67899046C>A	ENSP00000219169:p.Pro5Thr	89	2		122	10	NM_005796	0	0	140	142	2	B2R4G7|P13662|Q6IB67	Missense_Mutation	SNP	ENST00000219169.4	37	CCDS10848.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857640	0.91433	.	.	ENSG00000102898	ENST00000219169	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83617	0.5293	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.85130	0.997;0.88	D	0.85761	0.1349	9	0.72032	D	0.01	.	18.0088	0.89217	0.0:1.0:0.0:0.0	.	5;5	B4DEQ2;P61970	.;NTF2_HUMAN	T	5	.	ENSP00000219169:P5T	P	+	1	0	NUTF2	66456547	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.137000	0.77295	2.557000	0.86248	0.555000	0.69702	CCA	.		0.488	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268871.1		
NECAB2	54550	bcgsc.ca	37	16	84035446	84035446	+	Missense_Mutation	SNP	C	C	G	rs2271298	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr16:84035446C>G	ENST00000305202.4	+	12	1074	c.1057C>G	c.(1057-1059)Ctg>Gtg	p.L353V	NECAB2_ENST00000565691.1_Missense_Mutation_p.L270V	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	353	ABM.		L -> V (in dbSNP:rs2271298).			cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						GCAGAGCCCCCTGTGTAAGGC	0.632													G|||	1955	0.390375	0.7307	0.2839	5008	,	,		17594	0.4683		0.1093	False		,,,				2504	0.2147				p.L353V		.											.	NECAB2-70	0			c.C1057G						.	G	VAL/LEU	2891,1509	474.6+/-357.0	944,1003,253	59.0	50.0	53.0		1057	4.1	0.2	16	dbSNP_100	53	956,7644	772.5+/-407.7	54,848,3398	yes	missense	NECAB2	NM_019065.2	32	998,1851,3651	GG,GC,CC		11.1163,34.2955,29.5923	benign	353/387	84035446	3847,9153	2200	4300	6500	SO:0001583	missense	54550	exon12			AGCCCCCTGTGTA	AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.1057C>G	16.37:g.84035446C>G	ENSP00000307449:p.Leu353Val	250	2		221	7	NM_019065	0	0	69	69	0	A2RRG3|O75547|Q6ZSK0	Missense_Mutation	SNP	ENST00000305202.4	37	CCDS10940.1	749	0.34294871794871795	342	0.6951219512195121	82	0.2265193370165746	254	0.44405594405594406	71	0.09366754617414248	G	0	-2.609746	0.00121	0.657045	0.111163	ENSG00000103154	ENST00000305202	T	0.29142	1.58	5.09	4.14	0.48551	Dimeric alpha-beta barrel (1);Antibiotic biosynthesis monooxygenase (1);	0.662303	0.14800	N	0.297668	T	0.00012	0.0000	N	0.00146	-1.995	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	9	0.10902	T	0.67	-12.3086	5.5934	0.17313	0.1763:0.1641:0.6597:0.0	rs2271298;rs2271298	353	Q7Z6G3	NECA2_HUMAN	V	353	ENSP00000307449:L353V	ENSP00000307449:L353V	L	+	1	2	NECAB2	82592947	0.036000	0.19791	0.205000	0.23548	0.012000	0.07955	0.591000	0.23969	0.565000	0.29255	-0.216000	0.12614	CTG	C|0.697;G|0.303		0.632	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269077.2	NM_019065	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599659	88599659	+	Missense_Mutation	SNP	G	G	T	rs71395304	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr16:88599659G>T	ENST00000319555.3	+	10	1615	c.1293G>T	c.(1291-1293)aaG>aaT	p.K431N	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	431					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		TGGACAGAAAGGCCCTGGCCG	0.721													G|||	612	0.122204	0.0091	0.1398	5008	,	,		9175	0.3294		0.0915	False		,,,				2504	0.0808				p.K431N	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.G1293T						.	G	ASN/LYS	61,3871		0,61,1905	4.0	5.0	4.0		1293	-1.2	0.1	16	dbSNP_130	4	544,7434		10,524,3455	yes	missense	ZFPM1	NM_153813.2	94	10,585,5360	TT,TG,GG		6.8188,1.5514,5.0798	probably-damaging	431/1007	88599659	605,11305	1966	3989	5955	SO:0001583	missense	161882	exon10			CAGAAAGGCCCTG	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1293G>T	16.37:g.88599659G>T	ENSP00000326630:p.Lys431Asn	1	0		25	20	NM_153813	0	0	20	35	15		Missense_Mutation	SNP	ENST00000319555.3	37	CCDS32502.1	308	0.14102564102564102	9	0.018292682926829267	49	0.13535911602209943	192	0.3356643356643357	58	0.07651715039577836	G	10.12	1.262467	0.23051	0.015514	0.068188	ENSG00000179588	ENST00000319555	T	0.08008	3.14	3.39	-1.17	0.09648	.	1.163550	0.06454	U	0.728227	T	0.00012	0.0000	L	0.60455	1.87	0.40357	P	0.02080599999999999	D	0.69078	0.997	P	0.57911	0.829	T	0.41161	-0.9524	9	0.42905	T	0.14	-7.9024	6.4423	0.21856	0.5249:0.0:0.4751:0.0	.	431	Q8IX07	FOG1_HUMAN	N	431	ENSP00000326630:K431N	ENSP00000326630:K431N	K	+	3	2	ZFPM1	87127160	0.522000	0.26266	0.089000	0.20774	0.599000	0.36880	0.335000	0.19806	-0.105000	0.12132	0.289000	0.19496	AAG	G|0.858;T|0.142		0.721	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
KIAA0753	9851	broad.mit.edu	37	17	6493296	6493296	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:6493296C>A	ENST00000361413.3	-	18	2947	c.2589G>T	c.(2587-2589)gaG>gaT	p.E863D	KIAA0753_ENST00000575027.1_5'UTR|KIAA0753_ENST00000572370.1_Missense_Mutation_p.E564D|KIAA0753_ENST00000542606.1_Missense_Mutation_p.E564D|KIAA0753_ENST00000589033.1_Missense_Mutation_p.E319D	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	863						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		CTGATCCTTCCTCTGTTCCCA	0.458																																					p.E863D		.											.	KIAA0753-90	0			c.G2589T						.						55.0	56.0	56.0					17																	6493296		1840	4081	5921	SO:0001583	missense	9851	exon18			TCCTTCCTCTGTT		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.2589G>T	17.37:g.6493296C>A	ENSP00000355250:p.Glu863Asp	56	0		70	4	NM_014804	0	0	5	5	0	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	ENST00000361413.3	37	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098879	0.76870	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	T;T	0.44881	0.91;0.91	5.42	-0.227	0.13102	.	0.425256	0.27715	N	0.018154	T	0.20577	0.0495	N	0.17674	0.51	0.21020	N	0.999809	B	0.13594	0.008	B	0.14578	0.011	T	0.15150	-1.0447	10	0.19147	T	0.46	-8.7621	5.3767	0.16170	0.0:0.4777:0.2869:0.2354	.	863	Q2KHM9	K0753_HUMAN	D	863;564;319	ENSP00000355250:E863D;ENSP00000444634:E564D	ENSP00000355250:E863D	E	-	3	2	KIAA0753	6434020	0.889000	0.30405	0.482000	0.27366	0.989000	0.77384	-0.227000	0.09126	-0.132000	0.11557	-0.136000	0.14681	GAG	.		0.458	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
SLC2A4	6517	broad.mit.edu	37	17	7187306	7187306	+	Silent	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:7187306G>T	ENST00000317370.8	+	5	730	c.462G>T	c.(460-462)ggG>ggT	p.G154G	SLC2A4_ENST00000424875.2_Silent_p.G144G|SLC2A4_ENST00000571308.1_Silent_p.G154G|RP1-4G17.2_ENST00000576271.1_RNA	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	154				Missing (in Ref. 2; AAA52569). {ECO:0000305}.	amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						TGACATCAGGGCTGGTGCCCA	0.617																																					p.G154G		.											.	SLC2A4-90	0			c.G462T						.						30.0	30.0	30.0					17																	7187306		2203	4299	6502	SO:0001819	synonymous_variant	6517	exon5			ATCAGGGCTGGTG	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.462G>T	17.37:g.7187306G>T		76	0		77	4	NM_001042	0	0	60	60	0	Q05BQ3|Q14CX2	Silent	SNP	ENST00000317370.8	37	CCDS11097.1																																																																																			.		0.617	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3		
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	0	0		9	5	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
NDEL1	81565	ucsc.edu	37	17	8354151	8354151	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:8354151T>C	ENST00000334527.7	+	6	777	c.580T>C	c.(580-582)Tcg>Ccg	p.S194P	NDEL1_ENST00000380025.4_Missense_Mutation_p.S194P|NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000402554.3_Missense_Mutation_p.S194P|NDEL1_ENST00000299734.7_Missense_Mutation_p.S194P	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	194	Interaction with CENPF.|Interaction with NEFL. {ECO:0000250}.|Interaction with YWHAE. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						AACTAGAAAGTCGGCTCCTAG	0.468																																					p.S194P		.											.	NDEL1-90	0			c.T580C						.						75.0	65.0	68.0					17																	8354151		2203	4300	6503	SO:0001583	missense	81565	exon6			AGAAAGTCGGCTC	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.580T>C	17.37:g.8354151T>C	ENSP00000333982:p.Ser194Pro	119	1		113	2	NM_001025579	0	0	28	29	1	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Missense_Mutation	SNP	ENST00000334527.7	37	CCDS11143.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.140031	0.56936	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	4.98	4.98	0.66077	NUDE protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60222	0.2252	L	0.60455	1.87	0.80722	D	1	B;B	0.20671	0.047;0.004	B;B	0.28465	0.09;0.023	T	0.56673	-0.7940	9	0.25751	T	0.34	-2.6516	15.1274	0.72494	0.0:0.0:0.0:1.0	.	194;194	Q9GZM8;A6NIZ0	NDEL1_HUMAN;.	P	194;194;249;194	.	ENSP00000299734:S194P	S	+	1	0	NDEL1	8294876	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.338000	0.79269	2.216000	0.71823	0.533000	0.62120	TCG	.		0.468	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
ARHGAP44	9912	broad.mit.edu	37	17	12852499	12852499	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:12852499C>A	ENST00000379672.5	+	11	1204	c.904C>A	c.(904-906)Ctg>Atg	p.L302M	ARHGAP44_ENST00000262444.9_Missense_Mutation_p.L302M|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.L302M	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	302	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						ACTGAAGAAGCTGAAAGCGGC	0.592																																					p.L302M		.											.	ARHGAP44-90	0			c.C904A						.						30.0	32.0	32.0					17																	12852499		2046	4188	6234	SO:0001583	missense	9912	exon11			AAGAAGCTGAAAG		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.904C>A	17.37:g.12852499C>A	ENSP00000368994:p.Leu302Met	59	0		51	4	NM_014859	0	0	0	0	0	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	37	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256708	0.39896	.	.	ENSG00000006740	ENST00000379672;ENST00000340825;ENST00000538915	T;T	0.29142	1.58;1.58	5.94	5.94	0.96194	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	M	0.73372	2.23	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	T	0.52335	-0.8589	10	0.56958	D	0.05	.	11.1734	0.48584	0.0:0.9171:0.0:0.0829	.	302;302	A6NCP5;Q17R89	.;RHG44_HUMAN	M	302;302;25	ENSP00000368994:L302M;ENSP00000342566:L302M	ENSP00000342566:L302M	L	+	1	2	ARHGAP44	12793224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.710000	0.47169	2.823000	0.97156	0.637000	0.83480	CTG	.		0.592	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	366	15		354	14	NM_145301	0	0	4	15	11	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
PSMD3	5709	broad.mit.edu	37	17	38144959	38144959	+	Silent	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:38144959G>T	ENST00000264639.4	+	4	747	c.573G>T	c.(571-573)ctG>ctT	p.L191L	PSMD3_ENST00000541736.1_Silent_p.L53L	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	191					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					CTGATGATCTGATGCAGAAGA	0.493																																					p.L191L	Ovarian(186;531 2051 6385 19668 48409)	.											.	PSMD3-92	0			c.G573T						.						62.0	63.0	63.0					17																	38144959		2203	4300	6503	SO:0001819	synonymous_variant	5709	exon4			TGATCTGATGCAG	D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.573G>T	17.37:g.38144959G>T		79	0		70	3	NM_002809	0	0	117	117	0	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Silent	SNP	ENST00000264639.4	37	CCDS11356.1																																																																																			.		0.493	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257018.1	NM_002809	
LLGL2	3993	broad.mit.edu	37	17	73565071	73565071	+	Silent	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr17:73565071C>A	ENST00000392550.3	+	13	1452	c.1335C>A	c.(1333-1335)ggC>ggA	p.G445G	LLGL2_ENST00000577200.1_Silent_p.G445G|LLGL2_ENST00000167462.5_Silent_p.G445G	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	445					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			ACGAGGACGGCACGGTGCGGT	0.667																																					p.G445G		.											.	LLGL2-251	0			c.C1335A						.						41.0	42.0	41.0					17																	73565071		2203	4300	6503	SO:0001819	synonymous_variant	3993	exon13			GGACGGCACGGTG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1335C>A	17.37:g.73565071C>A		52	2		95	8	NM_004524	0	0	2	2	0	Q14521|Q9BR62	Silent	SNP	ENST00000392550.3	37	CCDS32733.1																																																																																			.		0.667	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
SMCHD1	23347	bcgsc.ca	37	18	2688477	2688477	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr18:2688477G>T	ENST00000320876.6	+	6	1062	c.724G>T	c.(724-726)Gct>Tct	p.A242S	SMCHD1_ENST00000261598.8_Missense_Mutation_p.A242S|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	242					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GGGCAAGCAAGCTGTCTTCTT	0.343																																					p.A242S		.											.	SMCHD1-46	0			c.G724T						.						94.0	88.0	90.0					18																	2688477		1854	4098	5952	SO:0001583	missense	23347	exon6			AAGCAAGCTGTCT	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.724G>T	18.37:g.2688477G>T	ENSP00000326603:p.Ala242Ser	78	0		54	4	NM_015295	0	0	1	1	0	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761050	0.69763	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	D;D	0.98280	-4.84;-4.84	5.08	5.08	0.68730	ATPase-like, ATP-binding domain (2);	0.063987	0.64402	D	0.000008	D	0.98086	0.9369	L	0.31476	0.935	0.44539	D	0.997497	D	0.89917	1.0	D	0.87578	0.998	D	0.99914	1.1217	10	0.87932	D	0	.	18.8289	0.92130	0.0:0.0:1.0:0.0	.	242	A6NHR9	SMHD1_HUMAN	S	242	ENSP00000326603:A242S;ENSP00000261598:A242S	ENSP00000261598:A242S	A	+	1	0	SMCHD1	2678477	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.927000	0.92846	2.502000	0.84385	0.655000	0.94253	GCT	.		0.343	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
RAX	30062	hgsc.bcm.edu	37	18	56940307	56940307	+	Missense_Mutation	SNP	G	G	T	rs2271733	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr18:56940307G>T	ENST00000334889.3	-	1	318	c.132C>A	c.(130-132)gaC>gaA	p.D44E	RAX_ENST00000256852.7_Missense_Mutation_p.D44E	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	44			D -> E (in dbSNP:rs2271733). {ECO:0000269|PubMed:14662654}.		camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GGATCCCGTCGTCCTTGGTAA	0.746													G|||	980	0.195687	0.1452	0.1571	5008	,	,		10556	0.128		0.3002	False		,,,				2504	0.2536				p.D44E	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.C132A						.	G	GLU/ASP	490,2640		39,412,1114	11.0	9.0	10.0		132	0.1	1.0	18	dbSNP_100	10	1484,4096		212,1060,1518	yes	missense	RAX	NM_013435.2	45	251,1472,2632	TT,TG,GG		26.595,15.655,22.6636	benign	44/347	56940307	1974,6736	1565	2790	4355	SO:0001583	missense	30062	exon1			CCCGTCGTCCTTG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.132C>A	18.37:g.56940307G>T	ENSP00000334813:p.Asp44Glu	4	0		7	4	NM_013435	0	0	0	0	0	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	37	CCDS11972.1	453	0.20741758241758243	75	0.1524390243902439	69	0.19060773480662985	76	0.13286713286713286	233	0.3073878627968338	G	12.43	1.936984	0.34189	0.15655	0.26595	ENSG00000134438	ENST00000256852;ENST00000334889;ENST00000555288	T;D;T	0.87966	0.09;-2.32;0.09	5.56	0.117	0.14652	.	0.213892	0.50627	N	0.000107	T	0.00012	0.0000	N	0.12182	0.205	0.42455	P	0.0072349999999999914	B;B	0.22800	0.075;0.004	B;B	0.23574	0.047;0.009	T	0.06481	-1.0824	9	0.06365	T	0.9	.	0.4639	0.00520	0.2353:0.2064:0.3162:0.2421	rs2271733;rs58469971;rs2271733	44;44	Q86V11;Q9Y2V3	.;RX_HUMAN	E	44	ENSP00000256852:D44E;ENSP00000334813:D44E;ENSP00000450583:D44E	ENSP00000256852:D44E	D	-	3	2	RAX	55091287	0.002000	0.14202	0.999000	0.59377	0.992000	0.81027	-0.819000	0.04462	0.271000	0.22005	0.561000	0.74099	GAC	G|0.801;T|0.199		0.746	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000585159.1_Silent_p.P25P|CBLN2_ENST00000583651.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		0	0		6	6	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000313093.2_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		11	8	NM_019112	0	0	19	36	17	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
REEP6	92840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1488279	1488279	+	5'Flank	SNP	C	C	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:1488279C>A	ENST00000233596.3	+	0	0				PCSK4_ENST00000587784.1_5'UTR|PCSK4_ENST00000300954.5_Splice_Site_p.V99L	NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6						regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACCACTGCACCTGCAGAGCA	0.662																																					p.V99L		.											.	PCSK4-90	0			c.G295T						.						34.0	32.0	33.0					19																	1488279		2203	4300	6503	SO:0001631	upstream_gene_variant	54760	exon3			ACTGCACCTGCAG	BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072		19.37:g.1488279C>A	Exception_encountered	110	0		139	49	NM_017573	0	0	0	0	0	B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	ENST00000233596.3	37	CCDS12070.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317758	0.40996	.	.	ENSG00000115257	ENST00000300954	T	0.52983	0.64	2.29	2.29	0.28610	Proteinase inhibitor, propeptide (1);	0.000000	0.44902	D	0.000406	T	0.53948	0.1828	M	0.89534	3.04	0.47737	D	0.999508	B	0.28512	0.214	B	0.28232	0.087	T	0.64457	-0.6403	10	0.87932	D	0	.	11.4341	0.50058	0.0:1.0:0.0:0.0	.	99	Q6UW60	PCSK4_HUMAN	L	99	ENSP00000300954:V99L	ENSP00000300954:V99L	V	-	1	0	PCSK4	1439279	1.000000	0.71417	0.992000	0.48379	0.494000	0.33585	3.250000	0.51445	1.272000	0.44329	0.205000	0.17691	GTG	.		0.662	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449623.1	NM_138393	
JSRP1	126306	hgsc.bcm.edu	37	19	2253732	2253732	+	Missense_Mutation	SNP	G	G	A	rs74521370	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:2253732G>A	ENST00000300961.6	-	5	387	c.323C>T	c.(322-324)cCg>cTg	p.P108L	JSRP1_ENST00000586471.2_Missense_Mutation_p.P108L	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	108	Pro-rich.		P -> L (polymorphism affecting excitation/contraction coupling in muscle fibers; the sensitivity of CACNA1S voltage sensor is shifted to higher depolarizing voltages in cells carrying this variant; dbSNP:rs74521370). {ECO:0000269|PubMed:22927026}.		protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cgggggcggcggcggcggctg	0.751													G|||	27	0.00539137	0.0015	0.0043	5008	,	,		11527	0.0		0.0159	False		,,,				2504	0.0061				p.P108L		.											.	JSRP1-91	0			c.C323T						.	G	LEU/PRO	11,3173		0,11,1581	3.0	5.0	4.0		323	1.2	0.9	19	dbSNP_131	4	94,6418		0,94,3162	no	missense	JSRP1	NM_144616.3	98	0,105,4743	AA,AG,GG		1.4435,0.3455,1.0829	benign	108/332	2253732	105,9591	1592	3256	4848	SO:0001583	missense	126306	exon5			GGCGGCGGCGGCG	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.323C>T	19.37:g.2253732G>A	ENSP00000300961:p.Pro108Leu	0	0		8	4	NM_144616	0	0	0	0	0		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	14	0.00641025641025641	0	0.0	5	0.013812154696132596	0	0.0	9	0.011873350923482849	G	9.861	1.196429	0.22037	0.003455	0.014435	ENSG00000167476	ENST00000300961	T	0.16073	2.37	4.61	1.22	0.21188	.	0.304893	0.23985	N	0.042624	T	0.04227	0.0117	N	0.12746	0.255	0.09310	N	1	P	0.44195	0.828	B	0.32342	0.144	T	0.32903	-0.9889	10	0.52906	T	0.07	.	6.4814	0.22065	0.3832:0.0:0.6168:0.0	.	108	Q96MG2	JSPR1_HUMAN	L	108	ENSP00000300961:P108L	ENSP00000300961:P108L	P	-	2	0	JSRP1	2204732	0.004000	0.15560	0.888000	0.34837	0.023000	0.10783	0.186000	0.16978	0.899000	0.36444	0.561000	0.74099	CCG	G|0.994;A|0.006		0.751	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	0	0		8	5	NM_019107	0	0	2	8	6	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
KANK3	256949	hgsc.bcm.edu	37	19	8400651	8400651	+	Silent	SNP	C	C	G	rs11669559	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:8400651C>G	ENST00000593649.1	-	3	125	c.60G>C	c.(58-60)ccG>ccC	p.P20P	KANK3_ENST00000330915.3_Silent_p.P20P			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	20										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						cggcggggaccgggcacaggc	0.692													C|||	700	0.139776	0.2466	0.1297	5008	,	,		8967	0.0327		0.1272	False		,,,				2504	0.1258				p.P20P		.											.	KANK3-90	0			c.G60C						.						1.0	1.0	1.0					19																	8400651		1078	2073	3151	SO:0001819	synonymous_variant	256949	exon3			GGGGACCGGGCAC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.60G>C	19.37:g.8400651C>G		0	0		9	6	NM_198471	0	0	1	1	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				C|0.880;G|0.120		0.692	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
ACP5	54	broad.mit.edu	37	19	11687251	11687251	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:11687251G>T	ENST00000592828.1	-	6	944	c.542C>A	c.(541-543)gCc>gAc	p.A181D	ACP5_ENST00000433365.2_Missense_Mutation_p.A181D|ACP5_ENST00000218758.5_Missense_Mutation_p.A181D|ACP5_ENST00000590420.1_Intron|ACP5_ENST00000412435.2_Missense_Mutation_p.A181D	NM_001111034.1	NP_001104504.1	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	181					bone morphogenesis (GO:0060349)|bone resorption (GO:0045453)|defense response to Gram-positive bacterium (GO:0050830)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of superoxide anion generation (GO:0032929)|negative regulation of tumor necrosis factor production (GO:0032720)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	acid phosphatase activity (GO:0003993)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	9						CTGTGTGCGGGCCAGCTTCAC	0.607																																					p.A181D		.											.	ACP5-90	0			c.C542A						.						44.0	43.0	43.0					19																	11687251		2203	4300	6503	SO:0001583	missense	54	exon5			GTGCGGGCCAGCT	X14618	CCDS12265.1	19p13.2	2012-10-02			ENSG00000102575	ENSG00000102575	3.1.3.2		124	protein-coding gene	gene with protein product	"""tartrate-resistant acid phosphatase"""	171640				8449511, 2338077	Standard	NM_001611		Approved	TRAP	uc002msj.4	P13686	OTTHUMG00000182036	ENST00000592828.1:c.542C>A	19.37:g.11687251G>T	ENSP00000468767:p.Ala181Asp	98	0		89	3	NM_001111034	0	0	4	4	0	A8K3V2|Q2TAB1|Q6IAS6|Q9UCJ5|Q9UCJ6|Q9UCJ7	Missense_Mutation	SNP	ENST00000592828.1	37	CCDS12265.1	.	.	.	.	.	.	.	.	.	.	g	18.63	3.665005	0.67700	.	.	ENSG00000102575	ENST00000218758;ENST00000412435;ENST00000433365	D;D;D	0.85088	-1.94;-1.94;-1.94	5.18	5.18	0.71444	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.90109	0.6910	L	0.46670	1.46	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91041	0.4871	10	0.72032	D	0.01	-34.527	17.445	0.87575	0.0:0.0:1.0:0.0	.	181	P13686	PPA5_HUMAN	D	181	ENSP00000218758:A181D;ENSP00000392374:A181D;ENSP00000413456:A181D	ENSP00000218758:A181D	A	-	2	0	ACP5	11548251	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	8.698000	0.91311	2.411000	0.81874	0.561000	0.74099	GCC	.		0.607	ACP5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458881.1		
FBXW9	84261	broad.mit.edu	37	19	12800811	12800813	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:12800811_12800813delCCA	ENST00000380339.3	-	6	1121_1123	c.1085_1087delTGG	c.(1084-1089)gtggac>gac	p.V362del	FBXW9_ENST00000587955.1_In_Frame_Del_p.V352del|CTD-2192J16.26_ENST00000593554.1_lincRNA|FBXW9_ENST00000544494.1_In_Frame_Del_p.V70del|CTD-2659N19.2_ENST00000585742.1_RNA|FBXW9_ENST00000393261.3_In_Frame_Del_p.V332del			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	362					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						GCTCGGCGGTCCACCACCACCAG	0.67																																					p.332_333del		.											.	FBXW9-227	0			c.995_997del						.																																			SO:0001651	inframe_deletion	84261	exon6			GGCGGTCCACCAC	BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.1085_1087delTGG	19.37:g.12800820_12800822delCCA	ENSP00000369696:p.Val362del	83	0		93	7	NM_032301	0	0	0	0	0	B3KVP7|Q9BT89	In_Frame_Del	DEL	ENST00000380339.3	37																																																																																				.		0.670	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
TSHZ3	57616	broad.mit.edu	37	19	31770238	31770240	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:31770238_31770240delCTG	ENST00000240587.4	-	2	786_788	c.459_461delCAG	c.(457-462)agcagt>agt	p.153_154SS>S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	153	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					gctgctgctactgctgctgctgc	0.611																																					p.153_154del		.											.	TSHZ3-232	0			c.459_461del						.																																			SO:0001651	inframe_deletion	57616	exon2			CTGCTACTGCTGC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.459_461delCAG	19.37:g.31770247_31770249delCTG	ENSP00000240587:p.Ser159del	320	0		321	7	NM_020856	0	0	0	0	0	Q9H0G6|Q9P254	In_Frame_Del	DEL	ENST00000240587.4	37	CCDS12421.2																																																																																			.		0.611	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.P288L			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	0	0		16	16	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
LTBP4	8425	broad.mit.edu	37	19	41119074	41119074	+	Silent	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:41119074G>T	ENST00000308370.7	+	19	2604	c.2604G>T	c.(2602-2604)gcG>gcT	p.A868A	LTBP4_ENST00000396819.3_Silent_p.A801A|LTBP4_ENST00000545697.1_Silent_p.A321A|LTBP4_ENST00000204005.9_Silent_p.A831A|LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000602240.1_3'UTR	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	868	Cys-rich.|EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A868A(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTACCGGGCGCCGTCGGGTC	0.692																																					.		.											.	LTBP4-93	1	Substitution - coding silent(1)	prostate(1)	.						.						14.0	15.0	14.0					19																	41119074		1885	4101	5986	SO:0001819	synonymous_variant	8425	.			CCGGGCGCCGTCG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2604G>T	19.37:g.41119074G>T		11	0		48	8	.	0	0	17	18	1	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.692	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
DMWD	1762	broad.mit.edu	37	19	46289402	46289402	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:46289402T>G	ENST00000270223.6	-	3	1397	c.1352A>C	c.(1351-1353)tAc>tCc	p.Y451S	DMWD_ENST00000377735.3_Missense_Mutation_p.Y451S|DMWD_ENST00000601370.1_5'Flank|AC011530.4_ENST00000593999.1_5'Flank	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	451										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		GGGGTGCGGGTAGAGCACGTC	0.701																																					p.Y451S		.											.	DMWD-90	0			c.A1352C						.						7.0	7.0	7.0					19																	46289402		2139	4195	6334	SO:0001583	missense	1762	exon3			TGCGGGTAGAGCA	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1352A>C	19.37:g.46289402T>G	ENSP00000270223:p.Tyr451Ser	61	12		205	54	NM_004943	0	0	0	0	0		Missense_Mutation	SNP	ENST00000270223.6	37	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	T	6.920	0.539321	0.13250	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.57436	0.4;0.4	4.12	3.08	0.35506	WD40 repeat-like-containing domain (1);	0.237680	0.35772	N	0.002984	T	0.30135	0.0755	N	0.19112	0.55	0.34182	D	0.671074	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.19811	-1.0294	10	0.22109	T	0.4	-14.2592	4.3652	0.11222	0.1653:0.0:0.2767:0.558	.	136;451;451	Q8WUW6;G5E9A7;Q09019	.;.;DMWD_HUMAN	S	451	ENSP00000366964:Y451S;ENSP00000270223:Y451S	ENSP00000270223:Y451S	Y	-	2	0	DMWD	50981242	0.999000	0.42202	0.724000	0.30704	0.109000	0.19521	0.803000	0.27083	0.819000	0.34492	0.379000	0.24179	TAC	.		0.701	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258717	48258717	+	Missense_Mutation	SNP	A	A	G	rs1804994	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:48258717A>G	ENST00000246802.5	+	9	1204	c.1166A>G	c.(1165-1167)cAg>cGg	p.Q389R	GLTSCR2_ENST00000598681.1_3'UTR|CTD-2571L23.6_ENST00000602048.1_RNA|SNORD23_ENST00000408876.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	389			Q -> R (in dbSNP:rs1804994). {ECO:0000269|PubMed:10708517, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		gcgcggcggcagaggcggcgg	0.761													G|||	3570	0.712859	0.857	0.6888	5008	,	,		6528	0.5546		0.6799	False		,,,				2504	0.7321				p.Q389R	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.A1166G						.						1.0	2.0	1.0					19																	48258717		823	2228	3051	SO:0001583	missense	29997	exon9			GGCGGCAGAGGCG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1166A>G	19.37:g.48258717A>G	ENSP00000246802:p.Gln389Arg	0	0		4	4	NM_015710	0	0	0	25	25	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	1513	0.6927655677655677	424	0.8617886178861789	252	0.6961325966850829	316	0.5524475524475524	521	0.6873350923482849	G	0.092	-1.166361	0.01660	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.39229	1.09	3.93	2.86	0.33363	.	0.430291	0.24226	N	0.040398	T	0.00012	0.0000	N	0.00289	-1.7	0.54753	P	1.2000000000012001E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.35450	-0.9788	9	0.05620	T	0.96	-11.9316	6.8245	0.23874	0.2235:0.0:0.7765:0.0	rs1804994;rs3211363;rs16949619;rs17343460;rs17856180;rs17856325;rs57240470	389	Q9NZM5	GSCR2_HUMAN	R	389;383	ENSP00000246802:Q389R	ENSP00000246802:Q389R	Q	+	2	0	GLTSCR2	52950529	0.025000	0.19082	0.815000	0.32552	0.328000	0.28507	0.153000	0.16323	0.415000	0.25817	-0.231000	0.12243	CAG	A|0.308;G|0.692		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
TPRX1	284355	bcgsc.ca	37	19	48305555	48305555	+	Missense_Mutation	SNP	G	G	A	rs147380237		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:48305555G>A	ENST00000322175.3	-	2	868	c.713C>T	c.(712-714)cCg>cTg	p.P238L	TPRX1_ENST00000535759.1_Missense_Mutation_p.P335L|TPRX1_ENST00000543508.1_Missense_Mutation_p.P228L	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	238	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgggatcgggcctgggtt	0.662																																					p.P238L	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.C713T						.						10.0	8.0	9.0					19																	48305555		2095	4129	6224	SO:0001583	missense	284355	exon2			GGGATCGGGCCTG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.713C>T	19.37:g.48305555G>A	ENSP00000323455:p.Pro238Leu	38	0		41	6	NM_198479	0	0	0	0	0	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	24	0.01098901098901099	0	0.0	3	0.008287292817679558	0	0.0	21	0.027704485488126648	g	8.014	0.758252	0.15846	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.93659	-2.01;-3.26	0.495	0.495	0.16890	.	.	.	.	.	T	0.79936	0.4532	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	P	0.60286	0.872	T	0.76977	-0.2759	8	0.45353	T	0.12	.	.	.	.	.	238	Q8N7U7	TPRX1_HUMAN	L	238;335;228	ENSP00000323455:P238L;ENSP00000438832:P335L	ENSP00000323455:P238L	P	-	2	0	TPRX1	52997367	0.000000	0.05858	0.020000	0.16555	0.015000	0.08874	-2.180000	0.01258	0.561000	0.29186	0.420000	0.28162	CCG	G|0.989;A|0.011		0.662	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
KCNA7	3743	hgsc.bcm.edu	37	19	49575618	49575618	+	Silent	SNP	A	A	G	rs71352730	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:49575618A>G	ENST00000221444.1	-	1	580	c.225T>C	c.(223-225)ggT>ggC	p.G75G		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	75					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GCAGCCGCCCACCGGACTGGT	0.731													a|||	708	0.141374	0.2837	0.1398	5008	,	,		7174	0.0486		0.0875	False		,,,				2504	0.1012				p.G75G	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7-90	0			c.T225C						.			790,3356		66,658,1349	9.0	12.0	11.0		225	-0.4	1.0	19	dbSNP_130	11	613,7491		29,555,3468	no	coding-synonymous	KCNA7	NM_031886.2		95,1213,4817	GG,GA,AA		7.5642,19.0545,11.4531		75/457	49575618	1403,10847	2073	4052	6125	SO:0001819	synonymous_variant	3743	exon1			CCGCCCACCGGAC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.225T>C	19.37:g.49575618A>G		2	0		21	11	NM_031886	0	0	0	0	0	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																			A|0.868;G|0.132		0.731	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
LRRC4B	94030	hgsc.bcm.edu	37	19	51021057	51021057	+	Missense_Mutation	SNP	A	A	G	rs61751957	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:51021057A>G	ENST00000599957.1	-	3	2110	c.1913T>C	c.(1912-1914)gTg>gCg	p.V638A	LRRC4B_ENST00000389201.3_Missense_Mutation_p.V638A			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	638	Poly-Ala.			AV -> TA (in Ref. 2; AAH56207). {ECO:0000305}.	positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCCACTGGCCACGGCGGCCGC	0.726													A|||	1071	0.213858	0.1702	0.2579	5008	,	,		10941	0.125		0.2893	False		,,,				2504	0.2556				p.V638A		.											.	LRRC4B-205	0			c.T1913C						.	A	ALA/VAL	591,3051		57,477,1287	13.0	15.0	14.0		1913	-0.8	0.0	19	dbSNP_129	14	2294,5564		347,1600,1982	no	missense	LRRC4B	NM_001080457.1	64	404,2077,3269	GG,GA,AA		29.1932,16.2273,25.087	benign	638/714	51021057	2885,8615	1821	3929	5750	SO:0001583	missense	94030	exon3			CTGGCCACGGCGG	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1913T>C	19.37:g.51021057A>G	ENSP00000471502:p.Val638Ala	2	0		20	7	NM_001080457	0	0	7	10	3	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	484	0.2216117216117216	86	0.17479674796747968	89	0.24585635359116023	74	0.12937062937062938	235	0.3100263852242744	A	2.037	-0.421084	0.04734	0.162273	0.291932	ENSG00000131409	ENST00000389201	T	0.27402	1.67	2.86	-0.757	0.11054	.	0.245138	0.17282	U	0.179967	T	0.00012	0.0000	L	0.36672	1.1	0.47183	P	6.540000000000434E-4	B	0.06786	0.001	B	0.04013	0.001	T	0.44982	-0.9292	9	0.12430	T	0.62	.	6.0652	0.19860	0.596:0.0:0.404:0.0	rs61751957	638	Q9NT99	LRC4B_HUMAN	A	638	ENSP00000373853:V638A	ENSP00000373853:V638A	V	-	2	0	LRRC4B	55712869	1.000000	0.71417	0.038000	0.18304	0.337000	0.28794	2.356000	0.44116	-0.425000	0.07371	-1.467000	0.01014	GTG	A|0.777;G|0.223		0.726	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
CDC42EP5	148170	hgsc.bcm.edu	37	19	54976403	54976403	+	Missense_Mutation	SNP	G	G	A	rs78611575	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:54976403G>A	ENST00000301200.2	-	3	670	c.329C>T	c.(328-330)gCg>gTg	p.A110V	LENG9_ENST00000333834.4_5'Flank	NM_145057.2	NP_659494.2	Q6NZY7	BORG3_HUMAN	CDC42 effector protein (Rho GTPase binding) 5	110					JNK cascade (GO:0007254)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)			lung(1)|skin(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		CTCCGGGCGCGCCGCGTCCAT	0.771													G|||	203	0.0405351	0.0817	0.0173	5008	,	,		6067	0.0337		0.0268	False		,,,				2504	0.0225				p.A110V		.											.	CDC42EP5-90	0			c.C329T						.	G	VAL/ALA	169,2839		3,163,1338	2.0	2.0	2.0		329	-4.2	0.5	19	dbSNP_131	2	122,6168		1,120,3024	no	missense	CDC42EP5	NM_145057.2	64	4,283,4362	AA,AG,GG		1.9396,5.6184,3.1297	benign	110/149	54976403	291,9007	1504	3145	4649	SO:0001583	missense	148170	exon3			GGGCGCGCCGCGT	BC024327	CCDS12896.1	19q13.42	2008-02-05			ENSG00000167617	ENSG00000167617			17408	protein-coding gene	gene with protein product		609171					Standard	NM_145057		Approved	CEP5, Borg3	uc002qfz.1	Q6NZY7	OTTHUMG00000065699	ENST00000301200.2:c.329C>T	19.37:g.54976403G>A	ENSP00000301200:p.Ala110Val	0	0		6	6	NM_145057	0	0	1	2	1	B0VJZ2|Q8TB51	Missense_Mutation	SNP	ENST00000301200.2	37	CCDS12896.1	114	0.0521978021978022	62	0.12601626016260162	9	0.024861878453038673	12	0.02097902097902098	31	0.040897097625329816	G	10.75	1.439212	0.25900	0.056184	0.019396	ENSG00000167617	ENST00000301200	T	0.30448	1.53	3.07	-4.23	0.03789	.	0.413150	0.15662	U	0.250838	T	0.00109	0.0003	N	0.08118	0	0.48830	P	2.8399999999995096E-4	B	0.25105	0.118	B	0.17979	0.02	T	0.24333	-1.0163	9	0.05620	T	0.96	-2.6299	5.147	0.14991	0.0:0.2446:0.451:0.3044	.	110	Q6NZY7	BORG3_HUMAN	V	110	ENSP00000301200:A110V	ENSP00000301200:A110V	A	-	2	0	CDC42EP5	59668215	0.000000	0.05858	0.477000	0.27303	0.399000	0.30720	-0.258000	0.08733	-0.814000	0.04352	-0.276000	0.10085	GCG	G|0.948;A|0.052		0.771	CDC42EP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140804.1	NM_145057	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		.											.	PPP1R12C-227	0			c.T303C						.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		0	0		7	5	NM_017607	0	0	1	3	2		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		12	12	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	0	0		8	4	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
MYT1L	23040	bcgsc.ca	37	2	1805503	1805503	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:1805503G>T	ENST00000399161.2	-	23	3988	c.3241C>A	c.(3241-3243)Cag>Aag	p.Q1081K	MYT1L_ENST00000428368.2_Missense_Mutation_p.Q1079K|MYT1L_ENST00000407844.1_Missense_Mutation_p.Q77K	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1081					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTTCCATCTGGGAATTGGAT	0.348																																					p.Q1079K		.											.	MYT1L-95	0			c.C3235A						.						220.0	220.0	220.0					2																	1805503		1807	4084	5891	SO:0001583	missense	23040	exon23			CCATCTGGGAATT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3241C>A	2.37:g.1805503G>T	ENSP00000382114:p.Gln1081Lys	43	0		56	4	NM_015025	0	0	0	0	0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	10.68	1.417498	0.25552	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T;T	0.42131	0.98;2.49;0.98	5.03	5.03	0.67393	.	0.106394	0.64402	D	0.000003	T	0.24586	0.0596	N	0.16790	0.44	0.80722	D	1	B;P;P	0.47910	0.073;0.842;0.902	B;B;B	0.38264	0.059;0.138;0.269	T	0.15093	-1.0449	10	0.02654	T	1	-37.2138	18.558	0.91091	0.0:0.0:1.0:0.0	.	77;1081;1079	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	K	1081;1027;77;135;1079	ENSP00000382114:Q1081K;ENSP00000382111:Q135K;ENSP00000396103:Q1079K	ENSP00000295067:Q1027K	Q	-	1	0	MYT1L	1784510	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.562000	0.98145	2.581000	0.87130	0.655000	0.94253	CAG	.		0.348	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NTSR2	23620	hgsc.bcm.edu	37	2	11809650	11809650	+	Silent	SNP	C	C	G	rs199659575	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:11809650C>G	ENST00000306928.5	-	1	640	c.606G>C	c.(604-606)gcG>gcC	p.A202A		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	202					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	AGACTTGGAGCGCGGTGCGGC	0.706													C|||	5	0.000998403	0.0	0.0	5008	,	,		8018	0.0		0.003	False		,,,				2504	0.002				p.A202A		.											.	NTSR2-946	0			c.G606C						.	C		3,3319		0,3,1658	11.0	13.0	13.0		606	1.2	0.5	2		13	22,6698		0,22,3338	no	coding-synonymous	NTSR2	NM_012344.3		0,25,4996	GG,GC,CC		0.3274,0.0903,0.249		202/411	11809650	25,10017	1661	3360	5021	SO:0001819	synonymous_variant	23620	exon1			TTGGAGCGCGGTG	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.606G>C	2.37:g.11809650C>G		4	0		20	14	NM_012344	0	0	0	0	0	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	37	CCDS1681.1																																																																																			C|0.994;G|0.006		0.706	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
TMEM247	388946	bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	253	3		375	23	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
TMEM247	388946	hgsc.bcm.edu	37	2	46707887	46707887	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:46707887A>C	ENST00000434431.1	+	2	461	c.461A>C	c.(460-462)gAg>gCg	p.E154A		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	154						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CTGCAGCAAGAGGCGGCGCCC	0.687																																					p.E154A		.											.	.	0			c.A461C						.						16.0	20.0	19.0					2																	46707887		690	1590	2280	SO:0001583	missense	388946	exon2			AGCAAGAGGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.461A>C	2.37:g.46707887A>C	ENSP00000388684:p.Glu154Ala	82	0		181	16	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	A	4.562	0.104456	0.08731	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.12	1.52	0.23074	.	.	.	.	.	T	0.25531	0.0621	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.18967	-1.0320	7	0.37606	T	0.19	.	8.7168	0.34416	0.6235:0.3765:0.0:0.0	.	154	A6NEH6	YB028_HUMAN	A	154	.	ENSP00000388684:E154A	E	+	2	0	AC018682.6	46561391	0.914000	0.31030	0.027000	0.17364	0.000000	0.00434	2.075000	0.41538	0.127000	0.18452	-0.461000	0.05368	GAG	.		0.687	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	49	6		128	38	NM_001145054	0	0	3	3	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
TEKT4	150483	ucsc.edu	37	2	95542377	95542377	+	Missense_Mutation	SNP	C	C	T	rs72817671	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:95542377C>T	ENST00000295201.4	+	6	1308	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	391					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GCAGTCCCTGCGCAACCTCGA	0.587																																					p.R391C		.											.	TEKT4-155	0			c.C1171T						.						71.0	55.0	60.0					2																	95542377		2203	4300	6503	SO:0001583	missense	150483	exon6			TCCCTGCGCAACC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1171C>T	2.37:g.95542377C>T	ENSP00000295201:p.Arg391Cys	63	6		72	9	NM_144705	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	9.848	1.192966	0.21954	.	.	ENSG00000163060	ENST00000295201	T	0.02709	4.19	2.43	1.05	0.20165	.	0.502966	0.19838	N	0.104906	T	0.03136	0.0092	L	0.52364	1.645	0.80722	D	1	B	0.20780	0.048	B	0.17098	0.017	T	0.40365	-0.9567	10	0.56958	D	0.05	-8.5236	6.0949	0.20015	0.5496:0.4504:0.0:0.0	.	391	Q8WW24	TEKT4_HUMAN	C	391	ENSP00000295201:R391C	ENSP00000295201:R391C	R	+	1	0	TEKT4	94906104	0.584000	0.26766	0.970000	0.41538	0.573000	0.36030	0.077000	0.14738	1.049000	0.40321	0.281000	0.19383	CGC	C|0.704;T|0.296		0.587	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
UBR3	130507	broad.mit.edu;bcgsc.ca	37	2	170762566	170762566	+	Silent	SNP	A	A	T	rs10194785	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:170762566A>T	ENST00000272793.5	+	10	1721	c.1671A>T	c.(1669-1671)ctA>ctT	p.L557L	UBR3_ENST00000418381.1_Silent_p.L557L			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	557					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AGCGAGAACTAAACGAGCATG	0.408													A|||	1388	0.277157	0.2663	0.1945	5008	,	,		16538	0.376		0.1581	False		,,,				2504	0.3712				p.L557L		.											.	UBR3-68	0			c.A1671T						.	A		383,1001		58,267,367	119.0	103.0	108.0		1671	1.6	1.0	2	dbSNP_119	108	545,2637		49,447,1095	no	coding-synonymous	UBR3	NM_172070.3		107,714,1462	TT,TA,AA		17.1276,27.6734,20.3241		557/1889	170762566	928,3638	692	1591	2283	SO:0001819	synonymous_variant	130507	exon10			AGAACTAAACGAG	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1671A>T	2.37:g.170762566A>T		112	1		92	6	NM_172070	0	0	3	3	0	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Silent	SNP	ENST00000272793.5	37																																																																																				A|0.748;T|0.252		0.408	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
CCDC150	284992	hgsc.bcm.edu	37	2	197531519	197531519	+	Frame_Shift_Del	DEL	A	A	-	rs75642251|rs376590781		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:197531519delA	ENST00000389175.4	+	7	974	c.839delA	c.(838-840)caafs	p.Q280fs	CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	280										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GCCCAGGAACAAAAAAAAAAA	0.373																																					p.Q280fs		.											.	.	0			c.839delA						.			178,205,3109		1,0,176,1,203,1365	43.0	43.0	43.0			4.6	0.7	2		34	430,361,7013		2,0,426,2,357,3115	no	codingComplex	CCDC150	NM_001080539.1		3,0,602,3,560,4480	A1A1,A1A2,A1R,A2A2,A2R,RR		10.1358,10.9679,10.3931			197531519	608,566,10122	1807	4072	5879	SO:0001589	frameshift_variant	284992	exon7			AGGAACAAAAAAA		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.839delA	2.37:g.197531519delA	ENSP00000373827:p.Gln280fs	157	0		217	15	NM_001080539	0	0	0	0	0	Q6P5U6|Q6P663|Q8N8V5	Frame_Shift_Del	DEL	ENST00000389175.4	37	CCDS46478.1																																																																																			.		0.373	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
ALPPL2	251	hgsc.bcm.edu	37	2	233274476	233274476	+	Missense_Mutation	SNP	G	G	C	rs114768772		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:233274476G>C	ENST00000295453.3	+	11	1545	c.1493G>C	c.(1492-1494)cGc>cCc	p.R498P		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CTGGCGCCCCGCGCCGGCACC	0.726																																					p.R498P		.											.	ALPPL2-91	0			c.G1493C						.						12.0	16.0	15.0					2																	233274476		2172	4236	6408	SO:0001583	missense	251	exon11			CGCCCCGCGCCGG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1493G>C	2.37:g.233274476G>C	ENSP00000295453:p.Arg498Pro	0	0		17	12	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	194	0.08882783882783883	42	0.08536585365853659	21	0.058011049723756904	71	0.12412587412587413	60	0.079155672823219	a	0.009	-1.842776	0.00568	.	.	ENSG00000163286	ENST00000295453	D	0.95622	-3.76	2.39	1.49	0.22878	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.05640	0.0148	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55425	-0.8143	10	0.02654	T	1	.	6.1524	0.20318	0.3771:0.4391:0.1839:0.0	.	498	P10696	PPBN_HUMAN	P	498	ENSP00000295453:R498P	ENSP00000295453:R498P	R	+	2	0	ALPPL2	232982720	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.066000	0.11598	-0.037000	0.13646	-2.747000	0.00125	CGC	G|0.946;C|0.054		0.726	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
SNED1	25992	hgsc.bcm.edu	37	2	242011084	242011084	+	Missense_Mutation	SNP	T	T	C	rs17440466	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr2:242011084T>C	ENST00000310397.8	+	25	3683	c.3683T>C	c.(3682-3684)cTg>cCg	p.L1228P	SNED1_ENST00000401884.1_Missense_Mutation_p.L1228P|SNED1_ENST00000342631.6_Missense_Mutation_p.L1228P|MTERFD2_ENST00000464344.2_5'Flank|SNED1_ENST00000405547.3_Missense_Mutation_p.L1228P	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1228			L -> P (in dbSNP:rs17440466).		cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGCCGGAGCTGCGCCTGCTC	0.726													T|||	550	0.109824	0.0227	0.0821	5008	,	,		7723	0.1885		0.171	False		,,,				2504	0.1033				p.L1228P		.											.	SNED1-72	0			c.T3683C						.	T	PRO/LEU	148,3636		7,134,1751	5.0	6.0	6.0		3683	4.4	1.0	2	dbSNP_123	6	1058,6892		57,944,2974	no	missense	SNED1	NM_001080437.1	98	64,1078,4725	CC,CT,TT		13.3082,3.9112,10.2778	probably-damaging	1228/1414	242011084	1206,10528	1892	3975	5867	SO:0001583	missense	25992	exon25			CGGAGCTGCGCCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3683T>C	2.37:g.242011084T>C	ENSP00000308893:p.Leu1228Pro	5	0		19	10	NM_001080437	0	0	4	10	6	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	255	0.11675824175824176	17	0.034552845528455285	27	0.07458563535911603	105	0.18356643356643357	106	0.13984168865435356	T	13.43	2.236189	0.39498	0.039112	0.133082	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.83992	-1.72;-1.79;-1.76;-1.72	4.36	4.36	0.52297	.	0.000000	0.34025	N	0.004340	T	0.01156	0.0038	M	0.67953	2.075	0.09310	P	0.99999566469	D;D;D;D	0.76494	0.992;0.996;0.999;0.96	P;D;D;P	0.83275	0.857;0.918;0.996;0.613	T	0.33904	-0.9850	9	0.37606	T	0.19	.	11.3537	0.49602	0.0:0.0:0.0:1.0	rs17440466;rs17440466	1228;1228;1228;1228	Q8TER0-3;Q8TER0-5;B5MEF5;Q8TER0	.;.;.;SNED1_HUMAN	P	1228	ENSP00000384871:L1228P;ENSP00000386007:L1228P;ENSP00000308893:L1228P;ENSP00000342992:L1228P	ENSP00000308893:L1228P	L	+	2	0	SNED1	241659757	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	1.160000	0.31761	1.727000	0.51537	0.383000	0.25322	CTG	T|0.877;C|0.123		0.726	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57484420	57484420	+	Missense_Mutation	SNP	C	C	T	rs11554273		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr20:57484420C>T	ENST00000371085.3	+	8	1025	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R202C|GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201C(228)|p.R844C(9)|p.R201S(5)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCGCTGCCGTGTCCTGAC	0.428			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R844C	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS-4767	242	Substitution - Missense(242)	pituitary(141)|pancreas(35)|large_intestine(14)|ovary(12)|thyroid(10)|adrenal_gland(7)|biliary_tract(6)|parathyroid(5)|liver(3)|kidney(3)|testis(2)|upper_aerodigestive_tract(2)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)	c.C2530T						.						80.0	78.0	79.0					20																	57484420		2203	4300	6503	SO:0001583	missense	2778	exon8			CGCTGCCGTGTCC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.601C>T	20.37:g.57484420C>T	ENSP00000360126:p.Arg201Cys	143	0		133	64	NM_080425	0	1	1242	2456	1213	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215896	0.79352	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99466	-5.95;-5.95;-5.95;-5.95;-5.95;-2.99;-5.95	5.53	4.53	0.55603	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.983;0.979;1.0	D;P;P;D	0.97110	0.939;0.845;0.643;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	13.0593	0.58997	0.2437:0.7563:0.0:0.0	rs11554273	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	C	844;830;187;201;202;186;187	ENSP00000360141:R844C;ENSP00000360143:R830C;ENSP00000360136:R187C;ENSP00000360126:R201C;ENSP00000346328:R202C;ENSP00000265620:R186C;ENSP00000304472:R187C	ENSP00000265620:R186C	R	+	1	0	GNAS	56917815	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.055000	0.57441	2.596000	0.87737	0.563000	0.77884	CGT	C|1.000		0.428	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
KRTAP10-2	386679	hgsc.bcm.edu;ucsc.edu	37	21	45970774	45970774	+	Missense_Mutation	SNP	G	G	A	rs76536096|rs67692969|rs71199610	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr21:45970774G>A	ENST00000391621.1	-	1	614	c.568C>T	c.(568-570)Cct>Tct	p.P190S	KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CAGCAGACAGGCTTGCAGCAG	0.607																																					p.P190S		.											.	KRTAP10-2-135	0			c.C568T						.						110.0	112.0	111.0					21																	45970774		2192	4279	6471	SO:0001583	missense	386679	exon1			AGACAGGCTTGCA	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.568C>T	21.37:g.45970774G>A	ENSP00000375479:p.Pro190Ser	206	0		208	24	NM_198693	0	0	0	0	0	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	9.523	1.108901	0.20714	.	.	ENSG00000205445	ENST00000391621	T	0.01705	4.68	3.28	0.222	0.15288	.	.	.	.	.	T	0.02083	0.0065	L	0.49455	1.56	0.09310	N	1	B	0.26672	0.156	B	0.24394	0.053	T	0.42310	-0.9459	9	0.62326	D	0.03	.	4.9369	0.13944	0.2108:0.1755:0.6137:0.0	.	190	P60368	KR102_HUMAN	S	190	ENSP00000375479:P190S	ENSP00000375479:P190S	P	-	1	0	KRTAP10-2	44795202	0.105000	0.21958	0.000000	0.03702	0.002000	0.02628	1.284000	0.33249	-0.177000	0.10690	0.462000	0.41574	CCT	G|0.917;A|0.083		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
PCNT	5116	hgsc.bcm.edu	37	21	47831845	47831845	+	Missense_Mutation	SNP	G	G	A	rs34268261	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr21:47831845G>A	ENST00000359568.5	+	28	5965	c.5858G>A	c.(5857-5859)cGc>cAc	p.R1953H	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1953			R -> H (in dbSNP:rs34268261).		brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CGGCAGGCCCGCAGAGCCACA	0.716													G|||	117	0.0233626	0.0197	0.0303	5008	,	,		11671	0.001		0.0646	False		,,,				2504	0.0041				p.R1953H		.											.	PCNT-141	0			c.G5858A						.	G	HIS/ARG	143,4171		2,139,2016	8.0	9.0	9.0		5858	-10.6	0.0	21	dbSNP_126	9	487,7963		13,461,3751	no	missense	PCNT	NM_006031.5	29	15,600,5767	AA,AG,GG		5.7633,3.3148,4.9358	benign	1953/3337	47831845	630,12134	2157	4225	6382	SO:0001583	missense	5116	exon28			AGGCCCGCAGAGC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5858G>A	21.37:g.47831845G>A	ENSP00000352572:p.Arg1953His	0	0		15	9	NM_006031	0	0	0	0	0	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	95	0.043498168498168496	24	0.04878048780487805	16	0.04419889502762431	1	0.0017482517482517483	54	0.0712401055408971	G	9.958	1.222045	0.22457	0.033148	0.057633	ENSG00000160299	ENST00000359568	T	0.01484	4.84	5.31	-10.6	0.00265	.	3.261980	0.01350	N	0.011890	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.38001	-0.9681	10	0.25751	T	0.34	.	5.4775	0.16704	0.5814:0.173:0.1581:0.0875	rs34268261	1835;1953	O95613-2;O95613	.;PCNT_HUMAN	H	1953	ENSP00000352572:R1953H	ENSP00000352572:R1953H	R	+	2	0	PCNT	46656273	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.310000	0.08135	-4.139000	0.00070	-0.997000	0.02515	CGC	G|0.955;A|0.045		0.716	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
LZTR1	8216	broad.mit.edu	37	22	21343966	21344002	+	Splice_Site	DEL	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	-	rs138025454|rs4822786|rs372705680|rs544346603|rs7410444|rs398036571|rs541944601|rs550797478|rs59718704	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr22:21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	ENST00000215739.8	+	7	1005_1010	c.646_651delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	c.(646-651)gaggagdel	p.EE216fs	LZTR1_ENST00000389355.3_Splice_Site_p.EE197fs|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	216					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCTGCTgggaggaggtgaggggcgtggggagccagggcgcaggtagaggaggtga	0.662														897	0.179113	0.1354	0.1859	5008	,	,		20879	0.2907		0.166	False		,,,				2504	0.1319				p.216_217del		.											.	LZTR1-280	0			c.646_651del						.																																			SO:0001630	splice_region_variant	8216	exon7			TGCTGGGAGGAGG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.651+1GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA>-	22.37:g.21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA		62	0		58	7	NM_006767	0	0	0	0	0	Q14776|Q20WK0	In_Frame_Del	DEL	ENST00000215739.8	37	CCDS33606.1																																																																																			.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Frame_Shift_Del
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	1	0		19	13	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	391155	391155	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr3:391155A>T	ENST00000256509.2	+	10	1604	c.962A>T	c.(961-963)aAa>aTa	p.K321I	CHL1_ENST00000397491.2_Missense_Mutation_p.K305I	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	811	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TACCAGGACAAAGGAAATTAT	0.408																																					p.K321I		.											.	CHL1-583	0			c.A962T						.						109.0	110.0	110.0					3																	391155		2203	4300	6503	SO:0001583	missense	10752	exon8			AGGACAAAGGAAA	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.962A>T	3.37:g.391155A>T	ENSP00000256509:p.Lys321Ile	83	0		134	59	NM_001253388	0	0	0	0	0	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451242	0.43531	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.68331	-0.32;-0.32	5.46	-3.14	0.05250	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.482216	0.24347	N	0.039303	T	0.45074	0.1324	N	0.13043	0.29	0.27120	N	0.962165	B;B;P	0.35542	0.101;0.101;0.508	B;B;B	0.39503	0.119;0.119;0.301	T	0.45454	-0.9260	10	0.56958	D	0.05	.	7.9619	0.30076	0.4381:0.1233:0.4386:0.0	.	305;305;321	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	I	321;305	ENSP00000256509:K321I;ENSP00000380628:K305I	ENSP00000256509:K321I	K	+	2	0	CHL1	366155	1.000000	0.71417	0.927000	0.36925	0.653000	0.38743	1.482000	0.35486	-0.721000	0.04929	-0.297000	0.09499	AAA	.		0.408	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	0	0		5	5	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
PLXNA1	5361	hgsc.bcm.edu	37	3	126733053	126733053	+	Silent	SNP	C	C	T	rs11719489	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr3:126733053C>T	ENST00000393409.2	+	11	2439	c.2439C>T	c.(2437-2439)cgC>cgT	p.R813R	PLXNA1_ENST00000251772.4_Silent_p.R790R	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	813					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CGGCCCTGCGCGAGAGCTGCG	0.741													C|||	327	0.0652955	0.0809	0.0793	5008	,	,		11902	0.002		0.1402	False		,,,				2504	0.0225				p.R813R		.											.	PLXNA1-93	0			c.C2439T						.			339,4057		23,293,1882	18.0	21.0	20.0		2439	-4.7	0.9	3	dbSNP_120	20	1112,7424		88,936,3244	no	coding-synonymous	PLXNA1	NM_032242.3		111,1229,5126	TT,TC,CC		13.0272,7.7116,11.2202		813/1897	126733053	1451,11481	2198	4268	6466	SO:0001819	synonymous_variant	5361	exon11			CCTGCGCGAGAGC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2439C>T	3.37:g.126733053C>T		0	0		21	18	NM_032242	0	0	0	1	1		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			C|0.900;T|0.100		0.741	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
FAM157A	728262	bcgsc.ca	37	3	197880136	197880136	+	lincRNA	SNP	A	A	G	rs56683636		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr3:197880136A>G	ENST00000437428.2	+	0	16							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						AACTGgcagcagcagcagcag	0.532																																					p.Q72R		.											.	.	0			c.A215G						.						20.0	17.0	18.0					3																	197880136		692	1591	2283			728262	exon2			GGCAGCAGCAGCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880136A>G		543	9		518	16	NM_001145248	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.645	-0.811867	0.02798	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32393	0.145	T	0.32052	-0.9921	5	.	.	.	.	.	.	.	.	72	C9JC47	F157A_HUMAN	R	72	.	.	Q	+	2	0	FAM157A	199364533	0.007000	0.16637	0.114000	0.21550	0.115000	0.19883	0.370000	0.20433	0.103000	0.17682	0.102000	0.15555	CAG	.		0.532	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
TNIP2	79155	hgsc.bcm.edu	37	4	2757800	2757800	+	Missense_Mutation	SNP	G	G	C	rs74548850	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr4:2757800G>C	ENST00000315423.7	-	1	303	c.217C>G	c.(217-219)Cgc>Ggc	p.R73G	TNIP2_ENST00000510267.1_5'UTR|TNIP2_ENST00000503235.1_Missense_Mutation_p.R73G	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCCGGAAGCGCGCAACCTGC	0.756													G|||	210	0.0419329	0.025	0.0447	5008	,	,		6355	0.0288		0.0408	False		,,,				2504	0.0777				p.R73G		.											.	TNIP2-90	0			c.C217G						.	G	GLY/ARG	60,3592		0,60,1766	5.0	7.0	6.0		217	2.8	1.0	4	dbSNP_131	6	267,7455		4,259,3598	no	missense	TNIP2	NM_024309.3	125	4,319,5364	CC,CG,GG		3.4577,1.6429,2.875	probably-damaging	73/430	2757800	327,11047	1826	3861	5687	SO:0001583	missense	79155	exon1			GGAAGCGCGCAAC	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.217C>G	4.37:g.2757800G>C	ENSP00000321203:p.Arg73Gly	0	0		15	8	NM_024309	0	0	1	1	0		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	94	0.04304029304029304	17	0.034552845528455285	18	0.049723756906077346	18	0.03146853146853147	41	0.05408970976253298	G	19.51	3.841781	0.71488	0.016429	0.034577	ENSG00000168884	ENST00000315423;ENST00000503235	T;T	0.48522	0.82;0.81	3.62	2.75	0.32379	.	0.480578	0.20050	N	0.100314	T	0.14399	0.0348	M	0.65975	2.015	0.27856	N	0.940558	D;P	0.62365	0.991;0.481	P;B	0.52217	0.693;0.071	T	0.11299	-1.0593	10	0.23302	T	0.38	-8.2753	9.2129	0.37328	0.0:0.0:0.7823:0.2177	.	73;73	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	G	73	ENSP00000321203:R73G;ENSP00000426314:R73G	ENSP00000321203:R73G	R	-	1	0	TNIP2	2727598	0.882000	0.30256	1.000000	0.80357	0.927000	0.56198	1.083000	0.30815	0.689000	0.31550	0.498000	0.49722	CGC	G|0.957;C|0.043		0.756	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		0	0		5	5	NM_153376	0	0	0	0	0	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		0	0		5	5	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
NSUN2	54888	hgsc.bcm.edu	37	5	6633042	6633042	+	Silent	SNP	C	C	T	rs10062086	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:6633042C>T	ENST00000264670.6	-	1	362	c.51G>A	c.(49-51)gaG>gaA	p.E17E	SRD5A1_ENST00000538824.1_5'Flank|SRD5A1_ENST00000537411.1_5'Flank|NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000274192.5_5'Flank|NSUN2_ENST00000506139.1_Silent_p.E17E	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	17					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCTCCGCGTCCTCCGGCCGCT	0.781													C|||	1385	0.276558	0.2829	0.3905	5008	,	,		9693	0.1587		0.3917	False		,,,				2504	0.1902				p.E17E		.											.	NSUN2-91	0			c.G51A						.						2.0	3.0	2.0					5																	6633042		1293	2804	4097	SO:0001819	synonymous_variant	54888	exon1			CGCGTCCTCCGGC	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.51G>A	5.37:g.6633042C>T		1	0		8	7	NM_017755	0	0	0	6	6	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			C|0.687;T|0.313		0.781	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
NPR3	4883	broad.mit.edu	37	5	32712221	32712221	+	Silent	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:32712221C>T	ENST00000265074.8	+	1	682	c.339C>T	c.(337-339)ctC>ctT	p.L113L	NPR3_ENST00000415167.2_Silent_p.L113L|NPR3_ENST00000415685.2_Intron|NPR3_ENST00000434067.2_Intron	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	113					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	ACCGTGCGCTCTTCAGCTTGG	0.687																																					p.L113L		.											.	NPR3-91	0			c.C339T						.						55.0	62.0	60.0					5																	32712221		1978	4157	6135	SO:0001819	synonymous_variant	4883	exon1			TGCGCTCTTCAGC		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.339C>T	5.37:g.32712221C>T		141	0		261	7	NM_000908	0	0	0	0	0	A2RRD1|B4DT84|E7EPG9	Silent	SNP	ENST00000265074.8	37	CCDS56357.1																																																																																			.		0.687	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
C5orf42	65250	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	37196023	37196023	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:37196023C>T	ENST00000508244.1	-	20	3841	c.3748G>A	c.(3748-3750)Gca>Aca	p.A1250T	C5orf42_ENST00000425232.2_Missense_Mutation_p.A1250T|C5orf42_ENST00000274258.7_Missense_Mutation_p.A131T			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1250						integral component of membrane (GO:0016021)		p.A131T(1)|p.A1250T(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTAAAAAATGCGATACCTCCT	0.383																																					p.A1250T		.											.	C5orf42-94	2	Substitution - Missense(2)	large_intestine(2)	c.G3748A						.						107.0	103.0	105.0					5																	37196023		2203	4300	6503	SO:0001583	missense	65250	exon21			AAAATGCGATACC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3748G>A	5.37:g.37196023C>T	ENSP00000421690:p.Ala1250Thr	342	0		320	19	NM_023073	0	0	1	1	0	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	6.122	0.390827	0.11581	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.25414	1.85;1.85;1.8;1.81	5.21	0.283	0.15696	.	1.862560	0.02967	N	0.143909	T	0.13586	0.0329	N	0.12182	0.205	0.09310	N	1	B;B	0.22541	0.021;0.071	B;B	0.15870	0.014;0.014	T	0.15178	-1.0446	10	0.24483	T	0.36	.	3.554	0.07857	0.2388:0.5158:0.1154:0.13	.	1250;131	E9PH94;Q9H799	.;CE042_HUMAN	T	1250;1250;131;298;131	ENSP00000421690:A1250T;ENSP00000389014:A1250T;ENSP00000274258:A131T;ENSP00000424223:A298T	ENSP00000274258:A131T	A	-	1	0	C5orf42	37231780	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.381000	0.20619	-0.176000	0.10707	-0.755000	0.03482	GCA	.		0.383	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
RAD17	5884	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	68670480	68670480	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:68670480A>T	ENST00000509734.1	+	5	1004	c.326A>T	c.(325-327)aAa>aTa	p.K109I	RAD17_ENST00000361732.2_Missense_Mutation_p.K98I|RAD17_ENST00000305138.4_Missense_Mutation_p.K98I|RAD17_ENST00000521422.1_5'UTR|RAD17_ENST00000354868.5_Missense_Mutation_p.K98I|RAD17_ENST00000354312.3_Missense_Mutation_p.K98I|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000282891.6_Missense_Mutation_p.K12I|RAD17_ENST00000358030.2_5'UTR|RAD17_ENST00000345306.6_Missense_Mutation_p.K98I|RAD17_ENST00000380774.3_Missense_Mutation_p.K109I			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	109					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		CATAAAAAGAAAATTGAAGAA	0.284								Other conserved DNA damage response genes																													p.K109I		.											.	RAD17-205	0			c.A326T						.						51.0	56.0	54.0					5																	68670480		2203	4293	6496	SO:0001583	missense	5884	exon3			AAAAGAAAATTGA	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.326A>T	5.37:g.68670480A>T	ENSP00000426191:p.Lys109Ile	266	0		304	100	NM_133339	0	0	2	3	1	A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	ENST00000509734.1	37	CCDS4003.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.342999	0.82022	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000354312;ENST00000345306;ENST00000506564;ENST00000305138;ENST00000282891;ENST00000380774	T;T;T;T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.70343	0.3213	M	0.90483	3.12	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;1.0;1.0	T	0.77678	-0.2498	10	0.87932	D	0	-28.2745	14.3504	0.66697	1.0:0.0:0.0:0.0	.	109;12;98	O75943;O75943-4;O75943-2	RAD17_HUMAN;.;.	I	98;109;98;98;98;98;98;12;109	ENSP00000355226:K98I;ENSP00000426191:K109I;ENSP00000346938:K98I;ENSP00000346271:K98I;ENSP00000311227:K98I;ENSP00000424696:K98I;ENSP00000303134:K98I;ENSP00000282891:K12I;ENSP00000370151:K109I	ENSP00000282891:K12I	K	+	2	0	RAD17	68706236	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.282000	0.78630	2.101000	0.63845	0.496000	0.49642	AAA	.		0.284	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344	
ARHGEF28	64283	broad.mit.edu;bcgsc.ca	37	5	73165981	73165981	+	Nonsense_Mutation	SNP	C	C	A	rs371533538		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:73165981C>A	ENST00000426542.2	+	20	2533	c.2513C>A	c.(2512-2514)tCa>tAa	p.S838*	ARHGEF28_ENST00000296799.4_Nonsense_Mutation_p.S525*|ARHGEF28_ENST00000513042.2_Nonsense_Mutation_p.S838*|ARHGEF28_ENST00000545377.1_Nonsense_Mutation_p.S838*|ARHGEF28_ENST00000437974.1_Nonsense_Mutation_p.S838*|ARHGEF28_ENST00000296794.6_Nonsense_Mutation_p.S838*|ARHGEF28_ENST00000287898.5_Nonsense_Mutation_p.S838*			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	838					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GTGGATCCCTCATTTTGTAAT	0.438																																					p.S838X		.											.	.	0			c.C2513A						.						152.0	143.0	146.0					5																	73165981		1908	4129	6037	SO:0001587	stop_gained	64283	exon21			ATCCCTCATTTTG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2513C>A	5.37:g.73165981C>A	ENSP00000412175:p.Ser838*	233	0		254	11	NM_001080479	0	0	5	5	0	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Nonsense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	39	7.300385	0.98196	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	.	.	.	5.77	3.93	0.45458	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	8.1113	0.30916	0.0:0.6586:0.0:0.3414	.	.	.	.	X	838;838;838;838;838;838;525	.	ENSP00000287898:S838X	S	+	2	0	RP11-428C6.1	73201737	0.000000	0.05858	0.365000	0.25901	0.868000	0.49771	1.057000	0.30492	0.726000	0.32339	0.655000	0.94253	TCA	.		0.438	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
MCC	4163	bcgsc.ca	37	5	112458382	112458382	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:112458382C>T	ENST00000302475.4	-	4	1019	c.456G>A	c.(454-456)atG>atA	p.M152I	MCC_ENST00000408903.3_Splice_Site_p.M342I|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Splice_Site_p.M89I	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	152					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CAGACTCACCCATGTCAGCAG	0.458																																					p.M342I		.											.	MCC-69	0			c.G1026A						.						130.0	106.0	114.0					5																	112458382		2202	4300	6502	SO:0001630	splice_region_variant	4163	exon6			CTCACCCATGTCA		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.457+1G>A	5.37:g.112458382C>T		218	4		232	108	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000302475.4	37	CCDS4111.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724175	0.48728	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.77750	-1.12;2.56;1.38	5.61	5.61	0.85477	.	0.090338	0.64402	D	0.000001	T	0.63022	0.2476	N	0.08118	0	0.80722	D	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.11329	0.001;0.001;0.006;0.003	T	0.56733	-0.7930	10	0.26408	T	0.33	-27.1204	19.2399	0.93877	0.0:1.0:0.0:0.0	.	152;114;342;152	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	I	152;89;342	ENSP00000305617:M152I;ENSP00000421615:M89I;ENSP00000386227:M342I	ENSP00000305617:M152I	M	-	3	0	MCC	112486281	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.532000	0.60608	2.633000	0.89246	0.557000	0.71058	ATG	.		0.458	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	Missense_Mutation
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		6	6	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
STC2	8614	broad.mit.edu	37	5	172745086	172745086	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr5:172745086G>T	ENST00000265087.4	-	4	1982	c.673C>A	c.(673-675)Cgc>Agc	p.R225S	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	225					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)	p.R225C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGGGGCTGGCGCTCGGGGGGC	0.657																																					p.R225S		.											.	STC2-93	1	Substitution - Missense(1)	prostate(1)	c.C673A						.						43.0	48.0	46.0					5																	172745086		2203	4300	6503	SO:0001583	missense	8614	exon4			GCTGGCGCTCGGG	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.673C>A	5.37:g.172745086G>T	ENSP00000265087:p.Arg225Ser	87	0		79	3	NM_003714	0	0	58	58	0		Missense_Mutation	SNP	ENST00000265087.4	37	CCDS4388.1	.	.	.	.	.	.	.	.	.	.	G	9.343	1.063428	0.20067	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.4	3.37	0.38596	.	0.677681	0.13963	N	0.350692	T	0.31040	0.0784	N	0.19112	0.55	0.09310	N	1	B	0.23937	0.094	B	0.20384	0.029	T	0.30475	-0.9977	9	0.62326	D	0.03	-10.057	14.6485	0.68777	0.0:0.0:0.6668:0.3332	.	225	O76061	STC2_HUMAN	S	225	.	ENSP00000265087:R225S	R	-	1	0	STC2	172677692	0.263000	0.24083	0.227000	0.23927	0.152000	0.21847	3.301000	0.51842	1.226000	0.43582	0.650000	0.86243	CGC	.		0.657	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		6	6	NM_001145115	0	0	0	21	21		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		5	5	NM_001145115	0	0	0	17	17		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
TULP1	7287	bcgsc.ca	37	6	35477025	35477025	+	Missense_Mutation	SNP	C	C	G	rs2064318	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:35477025C>G	ENST00000229771.6	-	8	862	c.783G>C	c.(781-783)aaG>aaC	p.K261N	TULP1_ENST00000322263.4_Missense_Mutation_p.K208N	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	261			K -> N (in dbSNP:rs2064318). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17962469, ECO:0000269|PubMed:9096357, ECO:0000269|PubMed:9462751}.|K -> T (in RP14).		dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						TTTGATTGCTCTTCTTTATCA	0.587													G|||	4199	0.838458	0.913	0.8833	5008	,	,		19103	0.8641		0.7863	False		,,,				2504	0.7331				p.K261N	GBM(55;1027 1091 11115 23439)	.											.	TULP1-92	0			c.G783C						.	G	ASN/LYS	3921,485	226.2+/-241.8	1746,429,28	378.0	350.0	359.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	783	3.7	1.0	6	dbSNP_94	359	7033,1567	295.0+/-302.2	2879,1275,146	yes	missense	TULP1	NM_003322.3	94	4625,1704,174	GG,GC,CC		18.2209,11.0077,15.7773	benign	261/543	35477025	10954,2052	2203	4300	6503	SO:0001583	missense	7287	exon8			ATTGCTCTTCTTT	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.783G>C	6.37:g.35477025C>G	ENSP00000229771:p.Lys261Asn	118	0		127	8	NM_003322	0	0	0	0	0	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	CCDS4807.1	1865	0.8539377289377289	448	0.9105691056910569	324	0.8950276243093923	494	0.8636363636363636	599	0.7902374670184696	G	0.119	-1.127509	0.01770	0.889923	0.817791	ENSG00000112041	ENST00000229771;ENST00000322263	T;T	0.80123	-1.32;-1.34	4.6	3.73	0.42828	.	0.386813	0.27807	N	0.017773	T	0.16171	0.0389	N	0.00186	-1.895	0.42916	P	0.005730000000000013	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18398	-1.0338	9	0.02654	T	1	.	6.5805	0.22591	0.0977:0.1794:0.7229:0.0	rs2064318;rs57875686	208;261	O00294-2;O00294	.;TULP1_HUMAN	N	261;208	ENSP00000229771:K261N;ENSP00000319414:K208N	ENSP00000229771:K261N	K	-	3	2	TULP1	35585003	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	0.813000	0.27225	0.571000	0.29365	-0.357000	0.07601	AAG	C|0.349;G|0.651		0.587	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
TULP1	7287	bcgsc.ca	37	6	35477032	35477032	+	Missense_Mutation	SNP	A	A	G	rs2064317	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:35477032A>G	ENST00000229771.6	-	8	855	c.776T>C	c.(775-777)aTa>aCa	p.I259T	TULP1_ENST00000322263.4_Missense_Mutation_p.I206T	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	259			I -> T (in dbSNP:rs2064317). {ECO:0000269|PubMed:17962469}.		dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.I259T(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GCTCTTCTTTATCACCGTAGC	0.587													G|||	1973	0.39397	0.3449	0.3329	5008	,	,		19111	0.499		0.3648	False		,,,				2504	0.4254				p.I259T	GBM(55;1027 1091 11115 23439)	.											.	TULP1-92	1	Substitution - Missense(1)	stomach(1)	c.T776C						.	G	THR/ILE	1564,2842	669.1+/-402.1	254,1056,893	371.0	345.0	354.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	776	3.6	0.3	6	dbSNP_94	354	3190,5410	653.8+/-401.1	609,1972,1719	yes	missense	TULP1	NM_003322.3	89	863,3028,2612	GG,GA,AA		37.093,35.497,36.5524	benign	259/543	35477032	4754,8252	2203	4300	6503	SO:0001583	missense	7287	exon8			TTCTTTATCACCG	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.776T>C	6.37:g.35477032A>G	ENSP00000229771:p.Ile259Thr	122	0		136	5	NM_003322	0	0	0	0	0	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	CCDS4807.1	837	0.38324175824175827	172	0.34959349593495936	137	0.3784530386740331	256	0.44755244755244755	272	0.35883905013192613	G	0.004	-2.320881	0.00232	0.35497	0.37093	ENSG00000112041	ENST00000229771;ENST00000322263	T;T	0.79352	-1.25;-1.26	4.5	3.62	0.41486	.	0.891546	0.09851	N	0.747564	T	0.16128	0.0388	N	0.00413	-1.525	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.11966	-1.0566	9	0.02654	T	1	-11.6502	6.4263	0.21772	0.2277:0.0:0.7723:0.0	rs2064317;rs41539122;rs41539440;rs41539748;rs45630406;rs45632076;rs57520700;rs61726639;rs2064317	206;259	O00294-2;O00294	.;TULP1_HUMAN	T	259;206	ENSP00000229771:I259T;ENSP00000319414:I206T	ENSP00000229771:I259T	I	-	2	0	TULP1	35585010	0.662000	0.27439	0.260000	0.24451	0.137000	0.21094	0.696000	0.25541	0.513000	0.28278	-0.355000	0.07637	ATA	A|0.641;G|0.359		0.587	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
RPF2	84154	broad.mit.edu	37	6	111346773	111346773	+	Silent	SNP	T	T	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:111346773T>A	ENST00000441448.2	+	10	1001	c.909T>A	c.(907-909)atT>atA	p.I303I		NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	303						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I303I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						CAAAAAGAATTAAAAAAAATT	0.368																																					p.I303I		.											.	RPF2-92	1	Substitution - coding silent(1)	central_nervous_system(1)	c.T909A						.						29.0	33.0	31.0					6																	111346773		2199	4300	6499	SO:0001819	synonymous_variant	84154	exon10			AAGAATTAAAAAA	AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.909T>A	6.37:g.111346773T>A		54	2		58	8	NM_032194	0	0	34	34	0	Q5VXN1|Q8N4A1	Silent	SNP	ENST00000441448.2	37	CCDS5088.1																																																																																			.		0.368	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041813.2	NM_032194	
ENPP3	5169	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	132014711	132014711	+	Silent	SNP	C	C	T	rs368371746		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr6:132014711C>T	ENST00000414305.1	+	16	1687	c.1359C>T	c.(1357-1359)aaC>aaT	p.N453N	ENPP3_ENST00000358229.5_Silent_p.N453N|ENPP3_ENST00000357639.3_Silent_p.N453N			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	453	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ATGCCAAGAACGTCAGAATCG	0.393																																					p.N453N		.											.	ENPP3-95	0			c.C1359T						.	C		1,4405	2.1+/-5.4	0,1,2202	211.0	185.0	194.0		1359	-1.1	0.0	6		194	0,8600		0,0,4300	no	coding-synonymous	ENPP3	NM_005021.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		453/876	132014711	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5169	exon15			CAAGAACGTCAGA	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1359C>T	6.37:g.132014711C>T		309	2		273	108	NM_005021	0	0	10	19	9	Q5JTL3	Silent	SNP	ENST00000414305.1	37	CCDS5148.1																																																																																			.		0.393	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		
GIGYF1	64599	broad.mit.edu	37	7	100283970	100283970	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr7:100283970A>C	ENST00000275732.5	-	8	1990	c.781T>G	c.(781-783)Tgt>Ggt	p.C261G	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	261					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TCTTCACCACACCCTCCTCGA	0.637																																					p.C261G		.											.	GIGYF1-136	0			c.T781G						.						58.0	59.0	59.0					7																	100283970		2203	4299	6502	SO:0001583	missense	64599	exon8			CACCACACCCTCC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.781T>G	7.37:g.100283970A>C	ENSP00000275732:p.Cys261Gly	62	7		81	14	NM_022574	0	0	0	0	0	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	37	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	4.987	0.183350	0.09495	.	.	ENSG00000146830	ENST00000275732	D	0.81579	-1.51	4.94	3.78	0.43462	.	0.100331	0.45606	D	0.000357	T	0.49795	0.1578	N	0.01048	-1.04	0.34173	D	0.67003	B	0.02656	0.0	B	0.01281	0.0	T	0.55685	-0.8102	10	0.22706	T	0.39	-11.6996	8.0977	0.30837	0.7764:0.2236:0.0:0.0	.	261	O75420	PERQ1_HUMAN	G	261	ENSP00000275732:C261G	ENSP00000275732:C261G	C	-	1	0	GIGYF1	100121906	0.999000	0.42202	1.000000	0.80357	0.318000	0.28184	2.337000	0.43947	2.076000	0.62316	0.460000	0.39030	TGT	.		0.637	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
CPA1	1357	broad.mit.edu	37	7	130021608	130021608	+	Silent	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr7:130021608G>A	ENST00000011292.3	+	3	435	c.285G>A	c.(283-285)tcG>tcA	p.S95S	CPA1_ENST00000484324.1_Silent_p.S7S	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	95					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					ACGTGCAGTCGCTGCTGGACG	0.612											OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S95S		.											.	CPA1-91	0			c.G285A						.						71.0	60.0	64.0					7																	130021608		2203	4300	6503	SO:0001819	synonymous_variant	1357	exon3			GCAGTCGCTGCTG		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.285G>A	7.37:g.130021608G>A		179	1	1576	176	4	NM_001868	0	0	0	0	0	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	ENST00000011292.3	37	CCDS5820.1																																																																																			.		0.612	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
RP1L1	94137	hgsc.bcm.edu	37	8	10468964	10468964	+	Missense_Mutation	SNP	G	G	A	rs148936402	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:10468964G>A	ENST00000382483.3	-	4	2867	c.2644C>T	c.(2644-2646)Cgg>Tgg	p.R882W		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	882					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCTGGCCCCCGGGCAGTGCTT	0.721													G|||	4	0.000798722	0.0	0.0014	5008	,	,		13003	0.0		0.003	False		,,,				2504	0.0				p.R882W		.											.	RP1L1-139	0			c.C2644T						.	G	TRP/ARG	4,3252		0,4,1624	3.0	5.0	4.0		2644	-10.2	0.0	8	dbSNP_134	4	25,7483		1,23,3730	yes	missense	RP1L1	NM_178857.5	101	1,27,5354	AA,AG,GG		0.333,0.1229,0.2694	probably-damaging	882/2401	10468964	29,10735	1628	3754	5382	SO:0001583	missense	94137	exon4			GCCCCCGGGCAGT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2644C>T	8.37:g.10468964G>A	ENSP00000371923:p.Arg882Trp	1	0		28	16	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	17.55	3.417786	0.62622	0.001229	0.00333	ENSG00000183638	ENST00000382483	T	0.04275	3.66	5.11	-10.2	0.00374	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.47471	-0.9115	9	0.66056	D	0.02	0.0532	0.2196	0.00166	0.2056:0.2404:0.2206:0.3333	.	882	A6NKC6	.	W	882	ENSP00000371923:R882W	ENSP00000371923:R882W	R	-	1	2	RP1L1	10506374	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.088000	0.03379	-2.316000	0.00645	-0.379000	0.06801	CGG	G|0.999;A|0.001		0.721	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
NKX3-1	4824	hgsc.bcm.edu	37	8	23540249	23540249	+	Missense_Mutation	SNP	G	G	A	rs2228013	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:23540249G>A	ENST00000380871.4	-	1	191	c.154C>T	c.(154-156)Cgc>Tgc	p.R52C	NKX3-1_ENST00000523261.1_Intron	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	52			R -> C (in dbSNP:rs2228013). {ECO:0000269|PubMed:9377551}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TCCGGGTCGCGCTGTCTCTGG	0.756													G|||	111	0.0221645	0.0008	0.0519	5008	,	,		11150	0.001		0.0467	False		,,,				2504	0.0266				p.R52C		.											.	NKX3-1-90	0			c.C154T						.	G	CYS/ARG	33,3943		0,33,1955	8.0	9.0	9.0		154	2.4	0.0	8	dbSNP_98	9	337,7623		5,327,3648	no	missense	NKX3-1	NM_006167.3	180	5,360,5603	AA,AG,GG		4.2337,0.83,3.0999	possibly-damaging	52/235	23540249	370,11566	1988	3980	5968	SO:0001583	missense	4824	exon1			GGTCGCGCTGTCT		CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.154C>T	8.37:g.23540249G>A	ENSP00000370253:p.Arg52Cys	0	0		9	8	NM_006167	0	0	0	0	0	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	CCDS6042.1	49	0.022435897435897436	1	0.0020325203252032522	16	0.04419889502762431	0	0.0	32	0.04221635883905013	G	13.18	2.161019	0.38119	0.0083	0.042337	ENSG00000167034	ENST00000380871	D	0.91011	-2.77	4.28	2.43	0.29744	.	7739.210000	0.00166	N	0.000000	T	0.50820	0.1638	N	0.08118	0	0.18873	N	0.999983	D	0.53151	0.958	B	0.35182	0.197	T	0.70066	-0.4974	10	0.56958	D	0.05	.	4.8592	0.13575	0.1031:0.0:0.5205:0.3765	rs2228013	52	Q99801	NKX31_HUMAN	C	52	ENSP00000370253:R52C	ENSP00000370253:R52C	R	-	1	0	NKX3-1	23596194	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.180000	0.16860	0.410000	0.25675	0.484000	0.47621	CGC	G|0.977;A|0.023		0.756	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
SFRP1	6422	broad.mit.edu	37	8	41166547	41166547	+	Silent	SNP	G	G	T	rs551082706		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:41166547G>T	ENST00000220772.3	-	1	469	c.132C>A	c.(130-132)ggC>ggA	p.G44G	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	44					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G44G(3)		breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			TCTGGTACGGGCCGATGTCCG	0.687																																					p.G44G		.											.	SFRP1-1082	3	Substitution - coding silent(3)	endometrium(2)|lung(1)	c.C132A						.						41.0	42.0	42.0					8																	41166547		2202	4300	6502	SO:0001819	synonymous_variant	6422	exon1			GTACGGGCCGATG	AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.132C>A	8.37:g.41166547G>T		82	2		97	9	NM_003012	0	0	0	0	0	O00546|O14779	Silent	SNP	ENST00000220772.3	37	CCDS34886.1																																																																																			.		0.687	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377132.1	NM_003012	
C8orf22	492307	broad.mit.edu;bcgsc.ca	37	8	49985442	49985442	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:49985442G>A	ENST00000303202.8	+	2	226	c.53G>A	c.(52-54)cGa>cAa	p.R18Q	C8orf22_ENST00000517663.1_Missense_Mutation_p.R18Q|C8orf22_ENST00000522267.1_Missense_Mutation_p.R18Q|C8orf22_ENST00000399653.4_Missense_Mutation_p.R18Q	NM_001256598.1	NP_001243527.1	Q8WWR9	PDPFL_HUMAN	chromosome 8 open reading frame 22	18					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					large_intestine(1)|lung(7)|prostate(1)	9		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CAGTATTATCGAAGTAAGTTG	0.413																																					p.R18Q		.											.	.	0			c.G53A						.						179.0	167.0	171.0					8																	49985442		1896	4124	6020	SO:0001583	missense	492307	exon2			ATTATCGAAGTAA	BC017981	CCDS47854.1, CCDS59101.1, CCDS59102.1	8q11.21	2012-04-11			ENSG00000168333	ENSG00000168333			31745	protein-coding gene	gene with protein product							Standard	NM_001007176		Approved		uc031tba.1	Q8WWR9	OTTHUMG00000164217	ENST00000303202.8:c.53G>A	8.37:g.49985442G>A	ENSP00000304926:p.Arg18Gln	265	1		213	9	NM_001256598	0	0	0	0	0	G3V137|Q8WVI1	Missense_Mutation	SNP	ENST00000303202.8	37	CCDS59101.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.355047	0.24512	.	.	ENSG00000168333	ENST00000517663;ENST00000522267;ENST00000399653;ENST00000303202	.	.	.	4.36	2.52	0.30459	.	0.000000	0.35207	U	0.003367	T	0.18130	0.0435	.	.	.	0.20307	N	0.999911	P	0.34462	0.454	B	0.23852	0.049	T	0.12477	-1.0546	7	.	.	.	-15.5651	5.9936	0.19480	0.1076:0.1932:0.6992:0.0	.	18	Q8WWR9-2	.	Q	18	.	.	R	+	2	0	C8orf22	50147995	1.000000	0.71417	0.991000	0.47740	0.112000	0.19704	1.780000	0.38634	0.299000	0.22661	-0.302000	0.09304	CGA	.		0.413	C8orf22-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377837.1	NM_001007176	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000356346.3_Silent_p.L1170L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		11	11	NM_201380	0	0	0	11	11	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		5	5	NM_213605	0	0	0	4	4		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
RUSC2	9853	broad.mit.edu	37	9	35546626	35546626	+	Silent	SNP	T	T	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:35546626T>G	ENST00000455600.1	+	2	677	c.108T>G	c.(106-108)ggT>ggG	p.G36G	RUSC2_ENST00000468041.1_3'UTR	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	36						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CAGGTGGAGGTGGTGGGAGCA	0.602																																					p.G36G		.											.	RUSC2-91	0			c.T108G						.						74.0	70.0	72.0					9																	35546626		2203	4300	6503	SO:0001819	synonymous_variant	9853	exon2			TGGAGGTGGTGGG	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.108T>G	9.37:g.35546626T>G		203	24		191	19	NM_014806	0	0	0	0	0	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	37	CCDS35008.1																																																																																			.		0.602	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
IKBKAP	8518	broad.mit.edu;bcgsc.ca	37	9	111674681	111674681	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:111674681C>T	ENST00000374647.5	-	11	1359	c.1052G>A	c.(1051-1053)tGg>tAg	p.W351*	IKBKAP_ENST00000537196.1_Nonsense_Mutation_p.W2*	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	351					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CACAGGGTCCCACATCAGAGA	0.517																																					p.W351X		.											.	IKBKAP-318	0			c.G1052A						.						123.0	111.0	115.0					9																	111674681		2203	4300	6503	SO:0001587	stop_gained	8518	exon11			GGGTCCCACATCA	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1052G>A	9.37:g.111674681C>T	ENSP00000363779:p.Trp351*	260	0		293	13	NM_003640	0	0	8	8	0	Q5JSV2|Q9H327|Q9UG87	Nonsense_Mutation	SNP	ENST00000374647.5	37	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	C	39	7.678943	0.98428	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5186	17.5517	0.87878	0.0:1.0:0.0:0.0	.	.	.	.	X	351;2	.	ENSP00000363779:W351X	W	-	2	0	IKBKAP	110714502	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.419000	0.80179	2.822000	0.97130	0.557000	0.71058	TGG	.		0.517	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113196694	113196694	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:113196694C>G	ENST00000401783.2	-	30	5317	c.4981G>C	c.(4981-4983)Ggc>Cgc	p.G1661R	SVEP1_ENST00000374469.1_Missense_Mutation_p.G1638R	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1661	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AGCTGGAAGCCTGGATCACAG	0.517																																					p.G1661R		.											.	SVEP1-75	0			c.G4981C						.						62.0	61.0	62.0					9																	113196694		1937	4144	6081	SO:0001583	missense	79987	exon30			GGAAGCCTGGATC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4981G>C	9.37:g.113196694C>G	ENSP00000384917:p.Gly1661Arg	216	0		161	59	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	32	5.157137	0.94686	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.76709	-1.04;-1.04	5.69	5.69	0.88448	Complement control module (2);Sushi/SCR/CCP (3);	0.105591	0.64402	D	0.000004	D	0.91429	0.7295	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92839	0.6287	10	0.87932	D	0	.	19.8199	0.96589	0.0:1.0:0.0:0.0	.	1661	Q4LDE5	SVEP1_HUMAN	R	1661;1638	ENSP00000384917:G1661R;ENSP00000363593:G1638R	ENSP00000363593:G1638R	G	-	1	0	SVEP1	112236515	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.763000	0.68818	2.677000	0.91161	0.655000	0.94253	GGC	.		0.517	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MUSK	4593	bcgsc.ca	37	9	113538122	113538122	+	Missense_Mutation	SNP	G	G	A	rs2274419	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:113538122G>A	ENST00000374448.4	+	10	1373	c.1239G>A	c.(1237-1239)atG>atA	p.M413I	MUSK_ENST00000189978.5_Missense_Mutation_p.M413I|MUSK_ENST00000374438.1_Missense_Mutation_p.G5R|MUSK_ENST00000416899.2_Missense_Mutation_p.M413I	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	413	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.		M -> I (in dbSNP:rs2274419). {ECO:0000269|PubMed:17344846}.		cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GGCTGGTAATGGAAGAGAAGA	0.468													G|||	503	0.100439	0.0045	0.0389	5008	,	,		17692	0.1895		0.1252	False		,,,				2504	0.1564				p.M413I		.											.	MUSK-1379	0			c.G1239A						.	G	ILE/MET,ILE/MET,ILE/MET	83,3709		0,83,1813	84.0	85.0	85.0		1005,975,1239	1.1	0.9	9	dbSNP_100	85	1094,7152		73,948,3102	yes	missense,missense,missense	MUSK	NM_001166280.1,NM_001166281.1,NM_005592.3	10,10,10	73,1031,4915	AA,AG,GG		13.267,2.1888,9.7774	benign,benign,benign	335/784,325/774,413/870	113538122	1177,10861	1896	4123	6019	SO:0001583	missense	4593	exon9			GGTAATGGAAGAG	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1239G>A	9.37:g.113538122G>A	ENSP00000363571:p.Met413Ile	237	0		248	8	NM_005592	0	0	0	0	0	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	224|224	0.10256410256410256|0.10256410256410256	3|3	0.006097560975609756|0.006097560975609756	14|14	0.03867403314917127|0.03867403314917127	119|119	0.20804195804195805|0.20804195804195805	88|88	0.11609498680738786|0.11609498680738786	G|G	5.688|5.688	0.311434|0.311434	0.10789|0.10789	0.021888|0.021888	0.13267|0.13267	ENSG00000030304|ENSG00000030304	ENST00000374441;ENST00000374438|ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	D|T	0.84442|0.71817	-1.85|-0.6	5.43|5.43	1.08|1.08	0.20341|0.20341	.|Frizzled domain (2);	.|0.533746	.|0.23008	.|N	.|0.052987	T|T	0.00039|0.00039	0.0001|0.0001	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	P|P	1.0|1.0	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.04229|0.04229	-1.0967|-1.0967	6|9	0.87932|0.10377	D|T	0|0.69	.|.	7.3856|7.3856	0.26880|0.26880	0.2043:0.139:0.6568:0.0|0.2043:0.139:0.6568:0.0	rs2274419;rs52816297;rs56547888;rs59906813;rs2274419|rs2274419;rs52816297;rs56547888;rs59906813;rs2274419	.|413	.|O15146	.|MUSK_HUMAN	R|I	5|419;413;413;335;335;419	ENSP00000363561:G5R|ENSP00000363571:M413I	ENSP00000363561:G5R|ENSP00000189978:M419I	G|M	+|+	1|3	0|0	MUSK|MUSK	112577943|112577943	1.000000|1.000000	0.71417|0.71417	0.924000|0.924000	0.36721|0.36721	0.605000|0.605000	0.37080|0.37080	0.809000|0.809000	0.27168|0.27168	0.259000|0.259000	0.21709|0.21709	0.655000|0.655000	0.94253|0.94253	GGA|ATG	G|0.885;A|0.115		0.468	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SLC2A6	11182	broad.mit.edu	37	9	136340732	136340732	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:136340732G>T	ENST00000371899.4	-	5	641	c.564C>A	c.(562-564)ggC>ggA	p.G188G	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Splice_Site_p.G188G	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	188					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		GCAGCAGGAGGCCTGGGGGCG	0.662																																					p.G188G		.											.	SLC2A6-90	0			c.C564A						.						6.0	7.0	7.0					9																	136340732		2122	4198	6320	SO:0001630	splice_region_variant	11182	exon5			CAGGAGGCCTGGG	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.563-1C>A	9.37:g.136340732G>T		10	0		87	8	NM_017585	0	0	0	0	0	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1																																																																																			.		0.662	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	Silent
LRRC26	389816	hgsc.bcm.edu	37	9	140064315	140064315	+	Missense_Mutation	SNP	C	C	A	rs7019671	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr9:140064315C>A	ENST00000371542.3	-	1	188	c.81G>T	c.(79-81)caG>caT	p.Q27H	TMEM210_ENST00000430332.1_5'Flank|RP11-350O14.18_ENST00000568665.1_RNA|MIR3621_ENST00000580529.1_RNA	NM_001013653.2	NP_001013675.1	Q2I0M4	LRC26_HUMAN	leucine rich repeat containing 26	27				Q -> H (in Ref. 1; ABC79623 and 3; AAI40912). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|voltage-gated potassium channel complex (GO:0008076)	potassium channel regulator activity (GO:0015459)					all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TGGCCGACACCTGGGCCCAGA	0.766													C|||	1433	0.286142	0.1415	0.3833	5008	,	,		11222	0.1567		0.3857	False		,,,				2504	0.4438				p.Q27H		.											.	LRRC26-22	0			c.G81T						.	C	HIS/GLN	338,2078		47,244,917	2.0	2.0	2.0		81	-5.4	0.0	9	dbSNP_116	2	1741,3449		368,1005,1222	no	missense	LRRC26	NM_001013653.2	24	415,1249,2139	AA,AC,CC		33.5453,13.9901,27.3337	probably-damaging	27/335	140064315	2079,5527	1208	2595	3803	SO:0001583	missense	389816	exon1			CGACACCTGGGCC	DQ355157	CCDS35184.1	9q34.3	2007-06-13			ENSG00000184709	ENSG00000184709			31409	protein-coding gene	gene with protein product		613505					Standard	NM_001013653		Approved	bA350O14.10, OTTHUMG00000020980	uc004clp.2	Q2I0M4	OTTHUMG00000020980	ENST00000371542.3:c.81G>T	9.37:g.140064315C>A	ENSP00000360597:p.Gln27His	0	0		4	4	NM_001013653	0	0	0	0	0	B9EIR7|C3RUL3|Q5VSG2	Missense_Mutation	SNP	ENST00000371542.3	37	CCDS35184.1	582	0.2664835164835165	61	0.12398373983739837	140	0.3867403314917127	77	0.1346153846153846	304	0.40105540897097625	C	12.58	1.979230	0.34942	0.139901	0.335453	ENSG00000184709	ENST00000371542	T	0.66280	-0.2	3.5	-5.42	0.02640	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.37220	-0.9715	8	0.46703	T	0.11	.	1.2009	0.01884	0.1317:0.2276:0.2613:0.3794	rs7019671	27	Q2I0M4	LRC26_HUMAN	H	27	ENSP00000360597:Q27H	ENSP00000360597:Q27H	Q	-	3	2	LRRC26	139184136	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.219000	0.09228	-1.024000	0.03338	-0.379000	0.06801	CAG	C|0.733;A|0.267		0.766	LRRC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055307.1	NM_001013653	
SSX3	10214	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48214670	48214670	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chrX:48214670G>T	ENST00000298396.2	-	2	67	c.15C>A	c.(13-15)gaC>gaA	p.D5E	SSX3_ENST00000376895.1_5'Flank|SSX3_ENST00000376893.3_Missense_Mutation_p.D5E	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(1)|lung(9)	13						TTGCAAAGGTGTCATCTCCGT	0.517																																					p.D5E	Colon(37;227 826 19399 40970 48007)	.											.	SSX3-130	0			c.C15A						.						256.0	204.0	221.0					X																	48214670		2203	4300	6503	SO:0001583	missense	10214	exon2			AAAGGTGTCATCT	U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.15C>A	X.37:g.48214670G>T	ENSP00000298396:p.Asp5Glu	1372	4		3238	460	NM_021014	0	0	0	0	0	O60223|Q5JQZ3|Q9BRW7	Missense_Mutation	SNP	ENST00000298396.2	37	CCDS14291.1	.	.	.	.	.	.	.	.	.	.	g	6.369	0.436158	0.12104	.	.	ENSG00000165584	ENST00000298396;ENST00000376893	T;T	0.10005	3.01;2.92	1.73	-1.81	0.07882	.	1.122620	0.06826	N	0.793117	T	0.08268	0.0206	L	0.41824	1.3	0.09310	N	1	B;B	0.16166	0.016;0.002	B;B	0.17979	0.02;0.005	T	0.41215	-0.9521	10	0.45353	T	0.12	.	2.024	0.03515	0.3859:0.0:0.3565:0.2576	.	5;5	Q9BRW7;Q99909	.;SSX3_HUMAN	E	5	ENSP00000298396:D5E;ENSP00000366090:D5E	ENSP00000298396:D5E	D	-	3	2	SSX3	48099614	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.853000	0.04303	-0.686000	0.05170	0.181000	0.17075	GAC	.		0.517	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056486.1	NM_021014	
CACNA1F	778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49067892	49067892	+	Missense_Mutation	SNP	C	C	T	rs370863603		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chrX:49067892C>T	ENST00000376265.2	-	36	4244	c.4183G>A	c.(4183-4185)Gga>Aga	p.G1395R	CACNA1F_ENST00000323022.5_Missense_Mutation_p.G1384R|CACNA1F_ENST00000376251.1_Missense_Mutation_p.G1330R	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1395					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CACCGATTTCCGGGAAGGCTG	0.532																																					p.G1395R		.											.	CACNA1F-176	0			c.G4183A						.	C	ARG/GLY	0,3835		0,0,1632,571	101.0	79.0	86.0		4183	5.4	0.6	X		86	1,6727		0,1,2427,1872	no	missense	CACNA1F	NM_005183.2	125	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	1395/1978	49067892	1,10562	2203	4300	6503	SO:0001583	missense	778	exon36			GATTTCCGGGAAG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4183G>A	X.37:g.49067892C>T	ENSP00000365441:p.Gly1395Arg	504	0		1381	184	NM_005183	0	0	0	0	0	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.958794	0.74016	0.0	1.49E-4	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.98264	-4.83;-4.83;-4.83	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98492	0.9497	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.99675	1.0997	10	0.51188	T	0.08	.	16.9052	0.86124	0.0:1.0:0.0:0.0	.	1384;1395	F5CIQ9;O60840	.;CAC1F_HUMAN	R	1330;1384;1395	ENSP00000365427:G1330R;ENSP00000321618:G1384R;ENSP00000365441:G1395R	ENSP00000321618:G1384R	G	-	1	0	CACNA1F	48954836	1.000000	0.71417	0.559000	0.28332	0.852000	0.48524	7.676000	0.84012	2.254000	0.74563	0.523000	0.50628	GGA	.		0.532	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
SHROOM4	57477	broad.mit.edu	37	X	50376327	50376327	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chrX:50376327T>C	ENST00000289292.7	-	4	3029	c.2746A>G	c.(2746-2748)Aat>Gat	p.N916D	SHROOM4_ENST00000376020.2_Missense_Mutation_p.N916D|SHROOM4_ENST00000460112.3_Missense_Mutation_p.N800D			Q9ULL8	SHRM4_HUMAN	shroom family member 4	916	Cys-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGCATCATATTTCTCTTTAGC	0.493																																					p.N916D		.											.	SHROOM4-131	0			c.A2746G						.						78.0	62.0	67.0					X																	50376327		2203	4300	6503	SO:0001583	missense	57477	exon4			TCATATTTCTCTT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.2746A>G	X.37:g.50376327T>C	ENSP00000289292:p.Asn916Asp	431	1		1209	21	NM_020717	0	0	1	1	0	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.105901	0.56291	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	D;D;D	0.94046	-3.34;-3.34;-3.34	5.67	5.67	0.87782	.	0.425932	0.23937	N	0.043084	D	0.89866	0.6839	L	0.29908	0.895	0.34746	D	0.731269	P	0.45044	0.849	B	0.42798	0.398	D	0.93561	0.6895	10	0.66056	D	0.02	.	13.7694	0.63015	0.0:0.0:0.0:1.0	.	916	Q9ULL8	SHRM4_HUMAN	D	916;916;800	ENSP00000289292:N916D;ENSP00000365188:N916D;ENSP00000421450:N800D	ENSP00000289292:N916D	N	-	1	0	SHROOM4	50393067	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	4.590000	0.61013	1.896000	0.54893	0.345000	0.21793	AAT	.		0.493	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
GPR112	139378	broad.mit.edu	37	X	135427636	135427636	+	Missense_Mutation	SNP	G	G	T	rs373273371		TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chrX:135427636G>T	ENST00000394143.1	+	6	2062	c.1771G>T	c.(1771-1773)Gca>Tca	p.A591S	GPR112_ENST00000287534.4_Missense_Mutation_p.A528S|GPR112_ENST00000370652.1_Missense_Mutation_p.A591S|GPR112_ENST00000394141.1_Missense_Mutation_p.A386S|GPR112_ENST00000412101.1_Missense_Mutation_p.A386S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	591					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AATCACACTTGCATCTACAGT	0.423																																					p.A591S		.											.	GPR112-183	0			c.G1771T						.						112.0	83.0	93.0					X																	135427636		2203	4300	6503	SO:0001583	missense	139378	exon6			ACACTTGCATCTA	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1771G>T	X.37:g.135427636G>T	ENSP00000377699:p.Ala591Ser	176	0		80	3	NM_153834	0	0	0	0	0	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	8.649	0.897692	0.17686	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29917	1.59;1.59;1.55;1.69;1.55	3.41	1.51	0.23008	.	.	.	.	.	T	0.17066	0.0410	N	0.19112	0.55	0.09310	N	1	B;B;B	0.27732	0.187;0.015;0.039	B;B;B	0.26770	0.073;0.01;0.017	T	0.21690	-1.0238	9	0.48119	T	0.1	.	3.9732	0.09462	0.14:0.0:0.6268:0.2332	.	528;386;591	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	591;591;386;528;386	ENSP00000377699:A591S;ENSP00000359686:A591S;ENSP00000416526:A386S;ENSP00000287534:A528S;ENSP00000377697:A386S	ENSP00000287534:A528S	A	+	1	0	GPR112	135255302	0.033000	0.19621	0.001000	0.08648	0.008000	0.06430	0.398000	0.20899	0.107000	0.17824	0.411000	0.27672	GCA	.		0.423	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	25	0		75	8	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
SHOX2	6474	hgsc.bcm.edu	37	3	157823581	157823582	+	In_Frame_Ins	INS	-	-	CACCTCCTC			TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr3:157823581_157823582insCACCTCCTC	ENST00000425436.3	-	1	257_258	c.232_233insGAGGAGGTG	c.(232-234)gta>gGAGGAGGTGta	p.77_78insGGG	SHOX2_ENST00000483851.2_In_Frame_Ins_p.77_78insGGG|RSRC1_ENST00000480820.1_5'Flank|SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000441443.2_5'UTR|SHOX2_ENST00000389589.4_In_Frame_Ins_p.77_78insGGG|SHOX2_ENST00000490689.2_5'Flank	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	77	Poly-Gly.				cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			tcctcctcctacacctcctccg	0.787																																					p.V78delinsGGGV		.											.	SHOX2-90	0			c.233_234insGAGGAGGTG						.		,,	21,2419		6,9,1205					,,	-1.0	0.6			7	162,5396		41,80,2658	no	coding,coding,coding	SHOX2	NM_006884.3,NM_003030.4,NM_001163678.1	,,	47,89,3863	A1A1,A1R,RR		2.9147,0.8607,2.2881	,,	,,		183,7815				SO:0001652	inframe_insertion	6474	exon1			CCTCCTACACCTC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.224_232dupGAGGAGGTG	3.37:g.157823582_157823590dupCACCTCCTC	ENSP00000398704:p.Gly80_Gly81dup	19	0		39	12	NM_001163678	0	0	0	0	0	O60465|O60467|O60903	In_Frame_Ins	INS	ENST00000425436.3	37	CCDS43164.1																																																																																			.		0.787	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970771	45970772	+	Missense_Mutation	DNP	CA	CA	TG	rs76021731|rs200215960|rs67692969|rs71199610	byFrequency	TCGA-OR-A5KV-01A-11D-A29I-10	TCGA-OR-A5KV-10A-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d8ea55c4-f064-4756-9e70-680a224f3c28	49134116-41eb-416d-a052-81c9fa07055b	g.chr21:45970771_45970772CA>TG	ENST00000391621.1	-	1	616_617	c.570_571TG>CA	c.(568-573)ccTGtc>ccCAtc	p.V191I	KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	191	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						TTGCAGCAGACAGGCTTGCAGC	0.609																																					p.V191I		.											.	KRTAP10-2-135	0			c.T570C						.																																			SO:0001583	missense	386679	exon1			GCAGACAGGCTTG	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.570_571delinsTG	21.37:g.45970771_45970772delinsTG	ENSP00000375479:p.Val191Ile	217	0		216	0	NM_198693	0	0	0	0	0	Q70LJ5	Missense_Mutation	DNP	ENST00000391621.1	37	CCDS42955.1																																																																																			A|0.908;G|0.092		0.609	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
