#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	bcgsc.ca	37	1	19447843	19447843	+	Silent	SNP	C	C	G	rs1044010	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:19447843C>G	ENST00000375254.3	-	68	10008	c.9981G>C	c.(9979-9981)ctG>ctC	p.L3327L	UBR4_ENST00000375226.2_Silent_p.L3303L|UBR4_ENST00000375267.2_Silent_p.L3327L|UBR4_ENST00000375218.3_5'Flank|UBR4_ENST00000375217.2_Silent_p.L3320L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3327					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGCTGCCGCACAGAGCACAGG	0.602													C|||	3007	0.600439	0.5424	0.6844	5008	,	,		8659	0.7589		0.5775	False		,,,				2504	0.4796				p.L3327L		.											.	UBR4-612	0			c.G9981C						.	C		2419,1987	616.9+/-392.9	670,1079,454	66.0	64.0	65.0		9981	1.8	1.0	1	dbSNP_86	65	4866,3734	618.0+/-396.7	1392,2082,826	no	coding-synonymous	UBR4	NM_020765.2		2062,3161,1280	GG,GC,CC		43.4186,45.0976,43.9874		3327/5184	19447843	7285,5721	2203	4300	6503	SO:0001819	synonymous_variant	23352	exon68			GCCGCACAGAGCA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.9981G>C	1.37:g.19447843C>G		437	4		348	11	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			C|0.488;G|0.512		0.602	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
RSPO1	284654	bcgsc.ca	37	1	38079517	38079517	+	Missense_Mutation	SNP	T	T	G	rs36043533	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:38079517T>G	ENST00000401069.1	-	6	1196	c.484A>C	c.(484-486)Aag>Cag	p.K162Q	RSPO1_ENST00000401068.1_Missense_Mutation_p.K162Q|RSPO1_ENST00000401070.1_Intron|RSPO1_ENST00000373059.1_Missense_Mutation_p.K135Q|RSPO1_ENST00000401071.2_Intron|RSPO1_ENST00000356545.2_Missense_Mutation_p.K162Q	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	162	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGCTGCTGCTTCTTGGAGCAG	0.617													T|||	242	0.0483227	0.0045	0.0418	5008	,	,		19712	0.0476		0.0427	False		,,,				2504	0.1186				p.K162Q	GBM(122;680 2230 27822 42821)	.											.	RSPO1-22	0			c.A484C						.	T	GLN/LYS,GLN/LYS,GLN/LYS,	45,3859		0,45,1907	56.0	60.0	59.0		484,484,403,	5.4	1.0	1	dbSNP_126	59	470,7816		13,444,3686	no	missense,missense,missense,intron	RSPO1	NM_001038633.3,NM_001242908.1,NM_001242909.1,NM_001242910.1	53,53,53,	13,489,5593	GG,GT,TT		5.6722,1.1527,4.2248	probably-damaging,probably-damaging,probably-damaging,	162/264,162/264,135/237,	38079517	515,11675	1952	4143	6095	SO:0001583	missense	284654	exon6			GCTGCTTCTTGGA	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.484A>C	1.37:g.38079517T>G	ENSP00000383847:p.Lys162Gln	320	2		219	14	NM_001242908	0	0	0	0	0	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	ENST00000401069.1	37	CCDS41304.1	84	0.038461538461538464	3	0.006097560975609756	13	0.03591160220994475	35	0.06118881118881119	33	0.04353562005277045	T	21.6	4.171296	0.78452	0.011527	0.056722	ENSG00000169218	ENST00000373059;ENST00000356545;ENST00000401069;ENST00000401068	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.42	5.42	0.78866	.	0.100628	0.64402	D	0.000002	T	0.35624	0.0938	L	0.57536	1.79	0.09310	P	1.0	P;P	0.38677	0.589;0.642	B;B	0.39503	0.295;0.301	T	0.73418	-0.3989	9	0.56958	D	0.05	.	15.7743	0.78198	0.0:0.0:0.0:1.0	rs36043533	135;162	Q2MKA7-2;Q2MKA7	.;RSPO1_HUMAN	Q	135;162;162;162	ENSP00000362150:K135Q;ENSP00000348944:K162Q;ENSP00000383847:K162Q;ENSP00000383846:K162Q	ENSP00000348944:K162Q	K	-	1	0	RSPO1	37852104	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.283000	0.78640	2.189000	0.69895	0.533000	0.62120	AAG	T|0.954;G|0.046		0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640	
ZFYVE9	9372	bcgsc.ca	37	1	52761610	52761610	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:52761610G>T	ENST00000371591.1	+	11	3425	c.3294G>T	c.(3292-3294)ttG>ttT	p.L1098F	ZFYVE9_ENST00000357206.2_Missense_Mutation_p.L1039F|ZFYVE9_ENST00000469134.1_3'UTR|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.L1098F	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1098					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GGAAGCCATTGTTTGGAGAGA	0.373																																					p.L1098F		.											.	ZFYVE9-230	0			c.G3294T						.						189.0	174.0	179.0					1																	52761610		2203	4300	6503	SO:0001583	missense	9372	exon12			GCCATTGTTTGGA	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.3294G>T	1.37:g.52761610G>T	ENSP00000360647:p.Leu1098Phe	71	0		50	4	NM_004799	0	0	0	0	0	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293039	0.60086	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.49139	0.87;0.79;0.79	4.68	-0.288	0.12855	Domain of unknown function DUF3480 (1);	0.000000	0.56097	D	0.000024	T	0.58481	0.2125	L	0.56769	1.78	0.46678	D	0.999155	D;D	0.89917	0.999;1.0	D;D	0.87578	0.982;0.998	T	0.56866	-0.7908	10	0.66056	D	0.02	.	9.1488	0.36951	0.424:0.0:0.576:0.0	.	1039;1098	O95405-2;O95405	.;ZFYV9_HUMAN	F	1039;1098;1098	ENSP00000349737:L1039F;ENSP00000287727:L1098F;ENSP00000360647:L1098F	ENSP00000287727:L1098F	L	+	3	2	ZFYVE9	52534198	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.200000	0.32247	-0.010000	0.14271	0.579000	0.79373	TTG	.		0.373	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
DHCR24	1718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	55337052	55337052	+	Missense_Mutation	SNP	C	C	G	rs181555625		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:55337052C>G	ENST00000371269.3	-	5	945	c.847G>C	c.(847-849)Gtc>Ctc	p.V283L	DHCR24_ENST00000535035.1_Missense_Mutation_p.V242L|DHCR24_ENST00000537443.1_Missense_Mutation_p.V115L	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	283					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						TCTGTCATGACCCCTGTCATA	0.587																																					p.V283L	Pancreas(39;516 1021 24601 30715 32780)	.											.	DHCR24-91	0			c.G847C						.						53.0	46.0	49.0					1																	55337052		2203	4300	6503	SO:0001583	missense	1718	exon5			TCATGACCCCTGT	AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.847G>C	1.37:g.55337052C>G	ENSP00000360316:p.Val283Leu	80	0		60	6	NM_014762	0	0	8	8	0	B7Z817|D3DQ51|Q9HBA8	Missense_Mutation	SNP	ENST00000371269.3	37	CCDS600.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273555	0.23221	.	.	ENSG00000116133	ENST00000371269;ENST00000537443;ENST00000535035	D;D;D	0.92397	-3.03;-2.03;-3.03	5.31	4.39	0.52855	.	0.326793	0.33235	N	0.005122	D	0.89615	0.6766	L	0.56769	1.78	0.52501	D	0.999952	B;B;B	0.25850	0.064;0.109;0.136	B;B;B	0.20577	0.019;0.019;0.03	D	0.86513	0.1811	10	0.30078	T	0.28	-29.8624	15.6657	0.77227	0.1384:0.8616:0.0:0.0	.	242;242;283	B7Z817;B7ZAV4;Q15392	.;.;DHC24_HUMAN	L	283;115;242	ENSP00000360316:V283L;ENSP00000439852:V115L;ENSP00000440191:V242L	ENSP00000360316:V283L	V	-	1	0	DHCR24	55109640	0.995000	0.38212	0.889000	0.34880	0.265000	0.26407	2.942000	0.49018	1.372000	0.46190	0.655000	0.94253	GTC	C|0.999;A|0.000		0.587	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	
SPRR3	6707	ucsc.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		87	0		117	30	NM_001097589	0	0	1	1	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR3	6707	ucsc.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000331860.3_Silent_p.G81G|SPRR3_ENST00000542696.1_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		.											.	SPRR3-45	1	Substitution - coding silent(1)	prostate(1)	c.T243A						.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		93	1		115	14	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
FCRL2	79368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	157740445	157740445	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:157740445delG	ENST00000361516.3	-	3	112	c.64delC	c.(64-66)cttfs	p.L22fs	FCRL2_ENST00000368181.4_Frame_Shift_Del_p.L22fs|FCRL2_ENST00000392274.3_Frame_Shift_Del_p.L22fs|FCRL2_ENST00000469986.1_5'Flank	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	22	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGCGCCACAAGGGTCAGCGAA	0.502																																					p.L22fs		.											.	FCRL2-92	0			c.64delC						.						36.0	36.0	36.0					1																	157740445		2203	4300	6503	SO:0001589	frameshift_variant	79368	exon3			CCACAAGGGTCAG	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.64delC	1.37:g.157740445delG	ENSP00000355157:p.Leu22fs	36	0		56	16	NM_030764	0	0	0	0	0	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Frame_Shift_Del	DEL	ENST00000361516.3	37	CCDS1168.1																																																																																			.		0.502	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764	
GJC2	57165	hgsc.bcm.edu	37	1	228346053	228346053	+	Silent	SNP	C	C	T	rs116557768	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr1:228346053C>T	ENST00000366714.2	+	2	769	c.594C>T	c.(592-594)caC>caT	p.H198H		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	198					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				CCGGGCAACACGATGGGCGGA	0.731													.|||	80	0.0159744	0.0015	0.013	5008	,	,		5629	0.0		0.0328	False		,,,				2504	0.0368				p.H198H		.											.	GJC2-68	0			c.C594T						.	C		46,4328		2,42,2143	13.0	16.0	15.0		594	-2.0	0.6	1	dbSNP_132	15	341,8201		6,329,3936	no	coding-synonymous	GJC2	NM_020435.3		8,371,6079	TT,TC,CC		3.992,1.0517,2.9963		198/440	228346053	387,12529	2187	4271	6458	SO:0001819	synonymous_variant	57165	exon2			GCAACACGATGGG	AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.594C>T	1.37:g.228346053C>T		0	0		21	14	NM_020435	0	0	0	0	0	O43440|Q7Z7J2|Q8IWJ9	Silent	SNP	ENST00000366714.2	37	CCDS1569.1																																																																																			C|0.986;T|0.014		0.731	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095985.1	NM_020435	
ECHDC3	79746	hgsc.bcm.edu	37	10	11784633	11784633	+	Missense_Mutation	SNP	C	C	T	rs11558855	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:11784633C>T	ENST00000379215.4	+	1	269	c.58C>T	c.(58-60)Cgc>Tgc	p.R20C	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	20						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GTGTCTCCGGCGCGGCCCCTG	0.781													C|||	460	0.091853	0.0424	0.1254	5008	,	,		5907	0.0169		0.17	False		,,,				2504	0.1319				p.R20C		.											.	ECHDC3-90	0			c.C58T						.	C	CYS/ARG	141,2883		1,139,1372	2.0	2.0	2.0		58	2.0	0.0	10	dbSNP_120	2	838,5418		38,762,2328	no	missense	ECHDC3	NM_024693.4	180	39,901,3700	TT,TC,CC		13.3951,4.6627,10.5496	probably-damaging	20/304	11784633	979,8301	1512	3128	4640	SO:0001583	missense	79746	exon1			CTCCGGCGCGGCC	AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.58C>T	10.37:g.11784633C>T	ENSP00000368517:p.Arg20Cys	0	0		6	6	NM_024693	0	0	0	0	0	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Missense_Mutation	SNP	ENST00000379215.4	37	CCDS7084.1	266	0.12179487179487179	44	0.08943089430894309	44	0.12154696132596685	31	0.05419580419580419	147	0.19393139841688653	C	16.93	3.258520	0.59321	0.046627	0.133951	ENSG00000134463	ENST00000379215;ENST00000420401	T;T	0.73258	-0.14;-0.73	4.08	2.03	0.26663	.	0.616622	0.16841	N	0.197355	T	0.00144	0.0004	L	0.29908	0.895	0.80722	P	0.0	D	0.69078	0.997	B	0.44315	0.446	T	0.04307	-1.0961	9	0.62326	D	0.03	.	7.364	0.26762	0.1877:0.6294:0.1829:0.0	rs11558855	20	Q96DC8	ECHD3_HUMAN	C	20	ENSP00000368517:R20C;ENSP00000405584:R20C	ENSP00000368517:R20C	R	+	1	0	ECHDC3	11824639	0.021000	0.18746	0.013000	0.15412	0.002000	0.02628	0.149000	0.16243	0.834000	0.34852	-0.326000	0.08463	CGC	C|0.878;T|0.122		0.781	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046771.1	NM_024693	
PTPLA	9200	hgsc.bcm.edu	37	10	17659149	17659149	+	Missense_Mutation	SNP	C	C	G	rs7895850	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:17659149C>G	ENST00000361271.3	-	1	227	c.190G>C	c.(190-192)Gag>Cag	p.E64Q	PTPLA_ENST00000326961.6_Missense_Mutation_p.E64Q	NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	64			E -> K (in dbSNP:rs7895850). {ECO:0000269|PubMed:10644438, ECO:0000269|PubMed:11054553, ECO:0000269|PubMed:15489334}.|E -> Q (in dbSNP:rs7895850). {ECO:0000269|PubMed:11054553}.		fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						CGCCTCCGCTCGCCGGGAGCC	0.766													T|||	543	0.108427	0.0401	0.121	5008	,	,		6575	0.2321		0.1103	False		,,,				2504	0.0624				p.E64Q		.											.	PTPLA-226	0			c.G190C						.	T	LYS/GLN/GLU	2648,64,0		1292,64,0,0,0,0	2.0	4.0	4.0		190	2.0	0.1	10	dbSNP_116	4	4685,237,0		2230,225,0,6,0,0	no	missense	PTPLA	NM_014241.3	29,56	3522,289,0,6,0,0	TT,TG,TC,GG,GC,CC		4.8151,2.3599,3.9429	benign	64/289	17659149	7333,301,0	1356	2461	3817	SO:0001583	missense	9200	exon1			TCCGCTCGCCGGG	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.190G>C	10.37:g.17659149C>G	ENSP00000355308:p.Glu64Gln	0	0		11	7	NM_014241	0	0	0	0	0	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	T	6.487	0.458102	0.12342	0.023599	0.0481510000000001	ENSG00000165996	ENST00000361271;ENST00000326961	T;T	0.19105	2.75;2.17	3.35	2.04	0.26737	.	0.660756	0.13666	N	0.371221	T	0.01156	0.0038	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.23854	0.092;0.009;0.007	B;B;B	0.12837	0.008;0.001;0.002	T	0.33137	-0.9880	10	0.24483	T	0.36	-20.0823	3.214	0.06692	0.0:0.1393:0.2442:0.6165	.	64;64;64	A6NP58;B0YJ81-2;B0YJ81	.;.;HACD1_HUMAN	Q	64	ENSP00000355308:E64Q;ENSP00000322923:E64Q	ENSP00000322923:E64Q	E	-	1	0	PTPLA	17699155	1.000000	0.71417	0.050000	0.19076	0.003000	0.03518	1.138000	0.31491	0.439000	0.26476	-0.381000	0.06696	GAG	C|0.007;G|0.002;T|0.991		0.766	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
SLC25A16	8034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70243288	70243288	+	Silent	SNP	G	G	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:70243288G>C	ENST00000609923.1	-	9	998	c.900C>G	c.(898-900)ctC>ctG	p.L300L	SLC25A16_ENST00000539557.1_Silent_p.L202L|SLC25A16_ENST00000265870.3_5'UTR	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	300					coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						AACCACGATAGAGTCCTTTTC	0.388																																					p.L300L		.											.	SLC25A16-90	0			c.C900G						.						155.0	152.0	153.0					10																	70243288		2203	4300	6503	SO:0001819	synonymous_variant	8034	exon9			ACGATAGAGTCCT	M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.900C>G	10.37:g.70243288G>C		38	0		51	12	NM_152707	0	0	0	1	1	Q8N2U1	Silent	SNP	ENST00000609923.1	37	CCDS7280.1																																																																																			.		0.388	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048347.2		
ACADSB	36	bcgsc.ca	37	10	124800853	124800853	+	Silent	SNP	C	C	T	rs1140591	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:124800853C>T	ENST00000358776.4	+	5	653	c.639C>T	c.(637-639)caC>caT	p.H213H	ACADSB_ENST00000368869.4_Silent_p.H111H|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	213					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	GTGCTGAGCACGCAGGGCTCT	0.413													C|||	1141	0.227835	0.2163	0.2176	5008	,	,		17755	0.1419		0.2296	False		,,,				2504	0.3374				p.H213H		.											.	ACADSB-92	0			c.C639T						.	C		950,3456	362.1+/-316.0	103,744,1356	143.0	138.0	139.0		639	-9.7	0.0	10	dbSNP_86	139	2017,6583	353.4+/-329.1	222,1573,2505	no	coding-synonymous	ACADSB	NM_001609.3		325,2317,3861	TT,TC,CC		23.4535,21.5615,22.8125		213/433	124800853	2967,10039	2203	4300	6503	SO:0001819	synonymous_variant	36	exon5			TGAGCACGCAGGG	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.639C>T	10.37:g.124800853C>T		75	0		83	4	NM_001609	0	0	0	0	0	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	37	CCDS7634.1																																																																																			A|0.000;C|0.783;G|0.000;T|0.217		0.413	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219036	134219036	+	Silent	SNP	G	G	A	rs11817589	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:134219036G>A	ENST00000305233.5	+	2	1091	c.1032G>A	c.(1030-1032)gaG>gaA	p.E344E	PWWP2B_ENST00000368609.4_Silent_p.E344E	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	344										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GGGACAGCGAGCACGAGCCCG	0.726													G|||	516	0.103035	0.1241	0.0908	5008	,	,		12864	0.0813		0.0875	False		,,,				2504	0.1217				p.E344E		.											.	PWWP2B-90	0			c.G1032A						.	G	,	353,3895		15,323,1786	15.0	19.0	18.0		1032,1032	4.5	0.0	10	dbSNP_120	18	549,7817		13,523,3647	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	28,846,5433	AA,AG,GG		6.5623,8.3098,7.1508	,	344/500,344/591	134219036	902,11712	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CAGCGAGCACGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1032G>A	10.37:g.134219036G>A		0	0		14	7	NM_001098637	0	0	2	2	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.909;A|0.091		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		0	0		16	8	NM_001098637	0	0	2	2	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
PHLDA2	7262	broad.mit.edu	37	11	2950513	2950513	+	Missense_Mutation	SNP	G	G	T	rs554708054		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr11:2950513G>T	ENST00000314222.4	-	1	172	c.82C>A	c.(82-84)Cgc>Agc	p.R28S		NM_003311.3	NP_003302.1	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain, family A, member 2	28	PH.				apoptotic process (GO:0006915)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|regulation of gene expression (GO:0010468)|regulation of glycogen metabolic process (GO:0070873)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R28S(1)		central_nervous_system(1)	1		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCACCCCGCGCTTCTTCTTC	0.672																																					p.R28S		.											.	PHLDA2-514	1	Substitution - Missense(1)	central_nervous_system(1)	c.C82A						.						18.0	20.0	19.0					11																	2950513		2199	4297	6496	SO:0001583	missense	7262	exon1			CCCCGCGCTTCTT	AF035444	CCDS7741.1	11p15.4	2013-01-10	2003-09-26	2003-10-01	ENSG00000181649	ENSG00000181649		"""Pleckstrin homology (PH) domain containing"""	12385	protein-coding gene	gene with protein product		602131	"""tumor suppressing subtransferable candidate 3"""	TSSC3		9328465, 9403053	Standard	NM_003311		Approved	IPL, BWR1C, HLDA2	uc001lxa.1	Q53GA4	OTTHUMG00000010926	ENST00000314222.4:c.82C>A	11.37:g.2950513G>T	ENSP00000319231:p.Arg28Ser	19	1		83	7	NM_003311	0	0	0	0	0	O00496	Missense_Mutation	SNP	ENST00000314222.4	37	CCDS7741.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727508	0.69074	.	.	ENSG00000181649	ENST00000314222	T	0.45668	0.89	3.51	3.51	0.40186	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.303419	0.25124	U	0.032956	T	0.43055	0.1230	M	0.66939	2.045	0.40575	D	0.98133	P	0.43578	0.811	B	0.39771	0.309	T	0.53507	-0.8429	10	0.44086	T	0.13	-19.9369	15.3955	0.74790	0.0:0.0:1.0:0.0	.	28	Q53GA4	PHLA2_HUMAN	S	28	ENSP00000319231:R28S	ENSP00000319231:R28S	R	-	1	0	PHLDA2	2907089	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.678000	0.46900	1.660000	0.50760	0.313000	0.20887	CGC	.		0.672	PHLDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030116.1	NM_003311	
NTF3	4908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5604093	5604093	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr12:5604093G>A	ENST00000331010.6	+	1	796	c.713G>A	c.(712-714)cGg>cAg	p.R238Q	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Missense_Mutation_p.R251Q	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	238					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						GTGGGCTGGCGGTGGATACGG	0.438																																					p.R251Q	GBM(194;1104 2182 8339 9578 18493)	.											.	NTF3-205	0			c.G752A						.						62.0	51.0	55.0					12																	5604093		2203	4300	6503	SO:0001583	missense	4908	exon2			GCTGGCGGTGGAT		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.713G>A	12.37:g.5604093G>A	ENSP00000328738:p.Arg238Gln	59	0		79	24	NM_001102654	0	0	0	0	0	B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	37	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262794	0.80358	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.74947	-0.89;-0.89	5.45	5.45	0.79879	Nerve growth factor-related (5);	0.107611	0.64402	D	0.000016	D	0.83686	0.5308	M	0.63428	1.95	0.47949	D	0.999556	D;D	0.89917	1.0;1.0	P;P	0.62298	0.9;0.9	D	0.85236	0.1035	10	0.87932	D	0	-36.6442	18.2818	0.90101	0.0:0.0:1.0:0.0	.	238;251	P20783;B7Z1T5	NTF3_HUMAN;.	Q	251;238	ENSP00000397297:R251Q;ENSP00000328738:R238Q	ENSP00000328738:R238Q	R	+	2	0	NTF3	5474354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.672000	0.74477	2.583000	0.87209	0.650000	0.86243	CGG	.		0.438	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1		
VWF	7450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6174404	6174404	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr12:6174404T>A	ENST00000261405.5	-	11	1446	c.1192A>T	c.(1192-1194)Agc>Tgc	p.S398C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	398	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TTGTCAAAGCTCTTGAAGTGT	0.552																																					p.S398C		.											.	VWF-163	0			c.A1192T						.						98.0	91.0	93.0					12																	6174404		2203	4300	6503	SO:0001583	missense	7450	exon11			CAAAGCTCTTGAA		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.1192A>T	12.37:g.6174404T>A	ENSP00000261405:p.Ser398Cys	111	0		170	57	NM_000552	0	0	3	3	0	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357325	0.82243	.	.	ENSG00000110799	ENST00000261405	T	0.60040	0.22	4.98	4.98	0.66077	von Willebrand factor, type C (1);von Willebrand factor, type D domain (3);	0.000000	0.47852	D	0.000217	T	0.79155	0.4398	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.83631	0.0145	10	0.87932	D	0	.	14.0025	0.64442	0.0:0.0:0.0:1.0	.	398;398	B4DNX0;P04275	.;VWF_HUMAN	C	398	ENSP00000261405:S398C	ENSP00000261405:S398C	S	-	1	0	VWF	6044665	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.738000	0.68613	2.093000	0.63338	0.459000	0.35465	AGC	.		0.552	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
KRT72	140807	hgsc.bcm.edu	37	12	52995020	52995020	+	Missense_Mutation	SNP	C	C	T	rs57242225	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr12:52995020C>T	ENST00000537672.2	-	1	227	c.217G>A	c.(217-219)Ggc>Agc	p.G73S	KRT72_ENST00000354310.4_Missense_Mutation_p.G73S|KRT72_ENST00000293745.2_Missense_Mutation_p.G73S|RP11-641A6.2_ENST00000551089.1_RNA|KRT72_ENST00000398066.3_5'UTR	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	73	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CCCACGAAGCCGCCCAGGCGG	0.736													C|||	403	0.0804712	0.1982	0.0591	5008	,	,		11657	0.0218		0.0477	False		,,,				2504	0.0307				p.G73S		.											.	KRT72-96	0			c.G217A						.	C	SER/GLY,SER/GLY,SER/GLY	641,3687		54,533,1577	7.0	8.0	8.0		217,217,217	3.1	0.9	12	dbSNP_129	8	378,8070		10,358,3856	no	missense,missense,missense	KRT72	NM_001146225.1,NM_001146226.1,NM_080747.2	56,56,56	64,891,5433	TT,TC,CC		4.4744,14.8105,7.9759	benign,benign,benign	73/512,73/470,73/512	52995020	1019,11757	2164	4224	6388	SO:0001583	missense	140807	exon1			CGAAGCCGCCCAG	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.217G>A	12.37:g.52995020C>T	ENSP00000441160:p.Gly73Ser	1	0		13	8	NM_001146225	0	0	0	0	0	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	164	0.07509157509157509	90	0.18292682926829268	26	0.0718232044198895	14	0.024475524475524476	34	0.044854881266490766	C	15.85	2.954785	0.53293	0.148105	0.044744	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310	D;D;D	0.83992	-1.79;-1.79;-1.79	3.98	3.09	0.35607	.	0.434068	0.19516	N	0.112389	T	0.00412	0.0013	M	0.70108	2.13	0.09310	P	0.9999999999977768	P;P	0.38110	0.618;0.618	B;B	0.34180	0.177;0.115	T	0.34650	-0.9820	9	0.37606	T	0.19	.	2.8374	0.05519	0.1474:0.5413:0.1432:0.1681	rs57242225;rs61747193	73;73	B4DEI8;Q14CN4	.;K2C72_HUMAN	S	73	ENSP00000441160:G73S;ENSP00000293745:G73S;ENSP00000346269:G73S	ENSP00000293745:G73S	G	-	1	0	KRT72	51281287	0.388000	0.25197	0.851000	0.33527	0.989000	0.77384	0.532000	0.23067	1.269000	0.44280	0.561000	0.74099	GGC	C|0.921;T|0.079		0.736	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	46	1		105	4	NM_001256282	0	0	0	0	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
RNFT2	84900	hgsc.bcm.edu	37	12	117187919	117187919	+	Silent	SNP	C	C	T	rs116754010	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr12:117187919C>T	ENST00000257575.4	+	4	590	c.357C>T	c.(355-357)ggC>ggT	p.G119G	RNFT2_ENST00000319176.7_Silent_p.G119G|RNFT2_ENST00000407967.3_Silent_p.G119G|RNFT2_ENST00000392549.2_Silent_p.G119G			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	119	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TCCACCATGGCGGCCACCGCG	0.751													C|||	314	0.0626997	0.1452	0.0144	5008	,	,		11841	0.0208		0.0159	False		,,,				2504	0.0767				p.G119G		.											.	.	0			c.C357T						.	C	,	436,3370		21,394,1488	4.0	4.0	4.0		357,357	-7.2	0.0	12	dbSNP_132	4	155,7571		1,153,3709	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	22,547,5197	TT,TC,CC		2.0062,11.4556,5.1249	,	119/445,119/421	117187919	591,10941	1903	3863	5766	SO:0001819	synonymous_variant	84900	exon4			CCATGGCGGCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.357C>T	12.37:g.117187919C>T		0	0		7	4	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			C|0.954;T|0.046		0.751	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
OR4K5	79317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20389141	20389141	+	Missense_Mutation	SNP	A	A	C	rs200386813		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:20389141A>C	ENST00000315915.4	+	1	401	c.376A>C	c.(376-378)Ata>Cta	p.I126L		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTATGTAGCCATATGCAAACC	0.453																																					p.I126L		.											.	OR4K5-70	0			c.A376C						.						227.0	226.0	226.0					14																	20389141		2203	4300	6503	SO:0001583	missense	79317	exon1			GTAGCCATATGCA	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.376A>C	14.37:g.20389141A>C	ENSP00000319511:p.Ile126Leu	163	0		259	42	NM_001005483	0	0	0	0	0	Q6IFA7	Missense_Mutation	SNP	ENST00000315915.4	37	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	18.94	3.728926	0.69074	.	.	ENSG00000176281	ENST00000315915	T	0.57595	0.39	4.41	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000043	T	0.82153	0.4975	H	0.99590	4.645	0.35418	D	0.793038	D	0.71674	0.998	D	0.64595	0.927	D	0.91203	0.4993	10	0.72032	D	0.01	.	11.614	0.51078	1.0:0.0:0.0:0.0	.	126	Q8NGD3	OR4K5_HUMAN	L	126	ENSP00000319511:I126L	ENSP00000319511:I126L	I	+	1	0	OR4K5	19458981	0.988000	0.35896	0.999000	0.59377	0.733000	0.41908	3.025000	0.49681	1.838000	0.53458	0.533000	0.62120	ATA	A|0.999;G|0.001		0.453	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	31647449	31647449	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:31647449C>T	ENST00000399332.1	-	3	640	c.152G>A	c.(151-153)cGc>cAc	p.R51H	HECTD1_ENST00000553700.1_Missense_Mutation_p.R51H	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	51					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TAAGAAAGTGCGAGGAGGACA	0.333																																					p.R51H		.											.	HECTD1-570	0			c.G152A						.						60.0	55.0	57.0					14																	31647449		1848	4083	5931	SO:0001583	missense	25831	exon3			AAAGTGCGAGGAG	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.152G>A	14.37:g.31647449C>T	ENSP00000382269:p.Arg51His	33	0		40	13	NM_015382	0	0	0	0	0	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	C	35	5.499125	0.96355	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.33654	1.4;1.4;1.4	5.11	5.11	0.69529	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	M	0.82923	2.615	0.80722	D	1	D	0.54047	0.964	B	0.35240	0.198	T	0.60515	-0.7248	10	0.72032	D	0.01	-6.3741	18.8815	0.92357	0.0:1.0:0.0:0.0	.	51	Q9ULT8	HECD1_HUMAN	H	51	ENSP00000450697:R51H;ENSP00000382269:R51H;ENSP00000452015:R51H	ENSP00000261312:R51H	R	-	2	0	HECTD1	30717200	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	5.743000	0.68655	2.532000	0.85374	0.484000	0.47621	CGC	.		0.333	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
TTLL5	23093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76219245	76219245	+	Silent	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:76219245C>T	ENST00000298832.9	+	18	1702	c.1497C>T	c.(1495-1497)ctC>ctT	p.L499L	TTLL5_ENST00000556893.1_Silent_p.L37L|TTLL5_ENST00000557636.1_Silent_p.L513L|TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000554510.1_5'UTR	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	499					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)	p.L499L(1)		NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GGTCCTACCTCGAGCATAAGA	0.368																																					p.L499L		.											.	TTLL5-92	1	Substitution - coding silent(1)	lung(1)	c.C1497T						.						114.0	106.0	109.0					14																	76219245		2203	4300	6503	SO:0001819	synonymous_variant	23093	exon18			CTACCTCGAGCAT	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.1497C>T	14.37:g.76219245C>T		32	0		35	12	NM_015072	0	0	0	0	0	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Silent	SNP	ENST00000298832.9	37	CCDS32124.1																																																																																			.		0.368	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		0	0		10	6	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
OR4N4	283694	bcgsc.ca	37	15	22382897	22382897	+	Missense_Mutation	SNP	A	A	G	rs62006710	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr15:22382897A>G	ENST00000328795.4	+	1	516	c.425A>G	c.(424-426)tAt>tGt	p.Y142C	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGAGCCTGCTATGCAATGATG	0.547																																					p.Y142C		.											.	OR4N4-73	0			c.A425G						.	A	CYS/TYR	268,4114		12,244,1935	171.0	148.0	156.0		425	3.4	0.3	15	dbSNP_129	156	2142,6382		180,1782,2300	yes	missense	OR4N4	NM_001005241.2	194	192,2026,4235	GG,GA,AA		25.129,6.1159,18.6735	benign	142/317	22382897	2410,10496	2191	4262	6453	SO:0001583	missense	283694	exon1			CCTGCTATGCAAT	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.425A>G	15.37:g.22382897A>G	ENSP00000332500:p.Tyr142Cys	131	1		184	7	NM_001005241	0	0	0	0	0	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	CCDS32173.1	381	0.17445054945054944	11	0.022357723577235773	47	0.1298342541436464	112	0.1958041958041958	211	0.2783641160949868	.	0.058	-1.230687	0.01518	0.061159	0.25129	ENSG00000183706	ENST00000328795	T	0.37752	1.18	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.318652	0.22853	N	0.054825	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.12837	0.008	T	0.30416	-0.9979	9	0.38643	T	0.18	-2.5262	5.3395	0.15976	0.8666:0.0:0.1334:0.0	rs62006710	142	Q8N0Y3	OR4N4_HUMAN	C	142	ENSP00000332500:Y142C	ENSP00000332500:Y142C	Y	+	2	0	OR4N4	19884261	0.000000	0.05858	0.343000	0.25615	0.236000	0.25371	-0.730000	0.04915	1.522000	0.49001	0.332000	0.21555	TAT	A|0.815;G|0.185		0.547	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
DISP2	85455	hgsc.bcm.edu	37	15	40660192	40660192	+	Silent	SNP	C	C	T	rs8040755	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr15:40660192C>T	ENST00000267889.3	+	8	1966	c.1879C>T	c.(1879-1881)Ctg>Ttg	p.L627L	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	627	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CACGGCTGTGCTGGTGCACCT	0.746													C|||	218	0.0435304	0.0038	0.1066	5008	,	,		10666	0.0179		0.0984	False		,,,				2504	0.0225				p.L627L		.											.	DISP2-92	0			c.C1879T						.	C		81,4189		0,81,2054	5.0	5.0	5.0		1879	5.6	1.0	15	dbSNP_116	5	887,7489		41,805,3342	no	coding-synonymous	DISP2	NM_033510.1		41,886,5396	TT,TC,CC		10.5898,1.897,7.6546		627/1402	40660192	968,11678	2135	4188	6323	SO:0001819	synonymous_variant	85455	exon8			GCTGTGCTGGTGC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1879C>T	15.37:g.40660192C>T		2	0		9	4	NM_033510	0	0	0	0	0	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1																																																																																			C|0.941;T|0.059		0.746	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		5	5	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93521561	93521561	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr15:93521561A>G	ENST00000394196.4	+	21	3743	c.2675A>G	c.(2674-2676)cAg>cGg	p.Q892R	CHD2_ENST00000557381.1_Missense_Mutation_p.Q892R	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	892	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TGGAACCCCCAGAATGACTTG	0.532																																					p.Q892R		.											.	CHD2-229	0			c.A2675G						.						96.0	88.0	91.0					15																	93521561		2197	4298	6495	SO:0001583	missense	1106	exon21			ACCCCCAGAATGA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2675A>G	15.37:g.93521561A>G	ENSP00000377747:p.Gln892Arg	37	0		45	11	NM_001271	0	0	0	0	0	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	27.0	4.793290	0.90453	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.95447	-3.71;-3.71	5.82	5.82	0.92795	Helicase, C-terminal (3);	0.000000	0.32769	U	0.005678	D	0.98523	0.9507	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	1.0;0.99;1.0	D;D;D	0.87578	0.998;0.952;0.996	D	0.99737	1.1014	10	0.87932	D	0	-27.3567	16.1832	0.81925	1.0:0.0:0.0:0.0	.	892;892;892	A8K9Y5;O14647;O14647-2	.;CHD2_HUMAN;.	R	892	ENSP00000377747:Q892R;ENSP00000451366:Q892R	ENSP00000377747:Q892R	Q	+	2	0	CHD2	91322565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.307000	0.96226	2.228000	0.72767	0.533000	0.62120	CAG	.		0.532	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CLEC16A	23274	bcgsc.ca	37	16	11114170	11114170	+	Missense_Mutation	SNP	C	C	T	rs74163614		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:11114170C>T	ENST00000409790.1	+	12	1654	c.1424C>T	c.(1423-1425)aCg>aTg	p.T475M	CLEC16A_ENST00000409552.3_Missense_Mutation_p.T457M	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCTGAGAGCACGCAATGGAGC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		21022	0.0		0.001	False		,,,				2504	0.0				p.T475M		.											.	CLEC16A-92	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1424T						.	C	MET/THR	0,3976		0,0,1988	17.0	21.0	20.0		1424	-0.0	0.1	16	dbSNP_130	20	9,8343		0,9,4167	yes	missense	CLEC16A	NM_015226.2	81	0,9,6155	TT,TC,CC		0.1078,0.0,0.073	benign	475/1054	11114170	9,12319	1988	4176	6164	SO:0001583	missense	23274	exon11			AGAGCACGCAATG	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1424C>T	16.37:g.11114170C>T	ENSP00000387122:p.Thr475Met	101	0		121	5	NM_015226	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409790.1	37	CCDS45409.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	7.342	0.621111	0.14193	0.0	0.001078	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.44881	0.91	5.38	-0.0299	0.13916	.	1.392810	0.04271	N	0.342130	T	0.38639	0.1048	L	0.36672	1.1	0.09310	N	1	B;D	0.55800	0.406;0.973	B;P	0.45449	0.128;0.481	T	0.41787	-0.9489	10	0.48119	T	0.1	-1.5357	9.2197	0.37368	0.0:0.6909:0.0:0.3091	.	475;457	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	M	475;475;457	ENSP00000387122:T475M	ENSP00000386495:T457M	T	+	2	0	CLEC16A	11021671	0.000000	0.05858	0.083000	0.20561	0.069000	0.16628	-0.090000	0.11163	0.029000	0.15352	0.555000	0.69702	ACG	C|0.999;T|0.001		0.642	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
NOMO1	23420	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	14988885	14988885	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:14988885G>T	ENST00000287667.7	+	30	3646	c.3475G>T	c.(3475-3477)Gga>Tga	p.G1159*		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1159						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						CATCGCACAAGGATCCTACAT	0.557																																					p.G1159X		.											.	NOMO1-45	0			c.G3475T						.						122.0	116.0	118.0					16																	14988885		2196	4296	6492	SO:0001587	stop_gained	23420	exon30			GCACAAGGATCCT	X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3475G>T	16.37:g.14988885G>T	ENSP00000287667:p.Gly1159*	2184	4		2445	348	NM_014287	0	0	181	182	1	P78421|Q8IW21|Q96DG0	Nonsense_Mutation	SNP	ENST00000287667.7	37	CCDS10556.1	.	.	.	.	.	.	.	.	.	.	G	42	9.284943	0.99125	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	.	.	.	2.96	2.96	0.34315	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-11.9333	11.776	0.51985	0.0:0.0:1.0:0.0	.	.	.	.	X	1159;1159;992	.	ENSP00000287667:G1159X	G	+	1	0	NOMO1	14896386	1.000000	0.71417	0.943000	0.38184	0.903000	0.53119	8.562000	0.90719	1.649000	0.50652	0.384000	0.25694	GGA	.		0.557	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1		
MYH11	4629	hgsc.bcm.edu;ucsc.edu	37	16	15809040	15809040	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:15809040G>T	ENST00000300036.5	-	39	5703	c.5594C>A	c.(5593-5595)gCc>gAc	p.A1865D	MYH11_ENST00000576790.2_Missense_Mutation_p.A1865D|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.A1872D|MYH11_ENST00000452625.2_Missense_Mutation_p.A1872D|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1865					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GTACTGCTCGGCCATCTTGCG	0.622			T	CBFB	AML																																p.A1872D		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11-666	0			c.C5615A						.						91.0	86.0	88.0					16																	15809040		2197	4300	6497	SO:0001583	missense	4629	exon40			TGCTCGGCCATCT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5594C>A	16.37:g.15809040G>T	ENSP00000300036:p.Ala1865Asp	39	0		40	4	NM_001040114	0	0	0	0	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299689	0.60195	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.75	3.78	0.43462	Myosin tail (1);	0.062950	0.64402	D	0.000006	D	0.87755	0.6257	M	0.86420	2.815	0.58432	D	0.999995	P;B;B;B;B	0.37015	0.578;0.403;0.403;0.403;0.275	P;P;P;P;P	0.55455	0.673;0.776;0.776;0.776;0.551	D	0.88385	0.3004	10	0.72032	D	0.01	.	12.3742	0.55271	0.084:0.0:0.916:0.0	.	1872;1865;1872;1865;1872	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	D	1865;1865;1872;1872;1872	ENSP00000300036:A1865D;ENSP00000345136:A1865D;ENSP00000379616:A1872D;ENSP00000407821:A1872D	ENSP00000300036:A1865D	A	-	2	0	MYH11	15716541	1.000000	0.71417	0.760000	0.31359	0.983000	0.72400	5.466000	0.66731	0.956000	0.37904	0.455000	0.32223	GCC	.		0.622	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		4	4	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CDT1	81620	bcgsc.ca	37	16	88872511	88872511	+	Silent	SNP	T	T	C	rs510862	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:88872511T>C	ENST00000301019.4	+	6	1534	c.915T>C	c.(913-915)caT>caC	p.H305H		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1											central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		TGGTGGAGCATGTCAAGGAGC	0.657													C|||	4358	0.870208	0.9864	0.7767	5008	,	,		18252	0.8819		0.7753	False		,,,				2504	0.865				p.H305H	Melanoma(159;511 3380 30971)	.											.	CDT1-227	0			c.T915C						.	C		4184,200		2001,182,9	23.0	23.0	23.0		915	-10.2	0.0	16	dbSNP_83	23	6810,1776		2692,1426,175	no	coding-synonymous	CDT1	NM_030928.3		4693,1608,184	CC,CT,TT		20.6848,4.562,15.2352		305/547	88872511	10994,1976	2192	4293	6485	SO:0001819	synonymous_variant	81620	exon6			GGAGCATGTCAAG	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.915T>C	16.37:g.88872511T>C		76	0		88	6	NM_030928	0	0	0	0	0		Silent	SNP	ENST00000301019.4	37	CCDS32510.1																																																																																			T|0.145;C|0.855		0.657	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	NM_030928	
FLCN	201163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	17131266	17131266	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr17:17131266G>T	ENST00000285071.4	-	4	640	c.186C>A	c.(184-186)agC>agA	p.S62R	RP11-45M22.4_ENST00000427497.3_Intron|FLCN_ENST00000389169.5_Missense_Mutation_p.S62R	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	62					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CCTCTGCGGGGCTGTGCGCAC	0.607									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																												p.S62R		.											.	FLCN-1292	0			c.C186A						.						93.0	79.0	84.0					17																	17131266		2203	4300	6503	SO:0001583	missense	201163	exon4	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	TGCGGGGCTGTGC	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.186C>A	17.37:g.17131266G>T	ENSP00000285071:p.Ser62Arg	123	0		196	69	NM_144997	0	0	0	0	0	A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Missense_Mutation	SNP	ENST00000285071.4	37	CCDS32579.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635260	0.47049	.	.	ENSG00000154803	ENST00000285071;ENST00000389169;ENST00000417064;ENST00000389168;ENST00000389171	D;D;D	0.92699	-3.09;-2.93;-1.84	5.54	3.56	0.40772	.	0.041112	0.85682	D	0.000000	D	0.91875	0.7428	L	0.40543	1.245	0.45791	D	0.998672	P;D;B	0.63880	0.893;0.993;0.232	P;P;B	0.59424	0.578;0.857;0.102	D	0.89384	0.3684	10	0.34782	T	0.22	-8.3086	11.3389	0.49520	0.1467:0.0:0.8533:0.0	.	62;62;62	Q8NFG4-3;Q8NFG4-2;Q8NFG4	.;.;FLCN_HUMAN	R	62;62;9;62;62	ENSP00000285071:S62R;ENSP00000373821:S62R;ENSP00000410410:S9R	ENSP00000285071:S62R	S	-	3	2	FLCN	17071991	1.000000	0.71417	0.999000	0.59377	0.223000	0.24884	2.560000	0.45896	0.715000	0.32103	-0.136000	0.14681	AGC	.		0.607	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606	
EIF1	10209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39847059	39847059	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr17:39847059T>C	ENST00000469257.1	+	4	469	c.323T>C	c.(322-324)cTg>cCg	p.L108P	EIF1_ENST00000591776.1_Missense_Mutation_p.L108P|JUP_ENST00000540235.1_Intron|EIF1_ENST00000310837.4_3'UTR			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1	108					dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GACGATCAGCTGAAGGTTCAT	0.438																																					p.L108P	Pancreas(176;1692 2837 16734 17588)	.											.	EIF1-90	0			c.T323C						.						155.0	141.0	145.0					17																	39847059		2203	4300	6503	SO:0001583	missense	10209	exon4			ATCAGCTGAAGGT	AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.323T>C	17.37:g.39847059T>C	ENSP00000419449:p.Leu108Pro	120	0		126	48	NM_005801	0	0	734	1395	661	Q9UNQ9	Missense_Mutation	SNP	ENST00000469257.1	37	CCDS11403.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.310226	0.81358	.	.	ENSG00000173812	ENST00000469257	T	0.32753	1.44	5.37	5.37	0.77165	Translation initiation factor SUI1 (1);	0.000000	0.64402	D	0.000001	T	0.62684	0.2448	M	0.91510	3.215	0.80722	D	1	D	0.67145	0.996	D	0.71414	0.973	T	0.71751	-0.4498	10	0.72032	D	0.01	-4.6509	14.1017	0.65059	0.0:0.0:0.0:1.0	.	108	P41567	EIF1_HUMAN	P	108	ENSP00000419449:L108P	ENSP00000419449:L108P	L	+	2	0	EIF1	37100585	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.961000	0.76042	2.254000	0.74563	0.482000	0.46254	CTG	.		0.438	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257390.1	NM_005801	
SERPINB12	89777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61223496	61223496	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr18:61223496T>C	ENST00000269491.1	+	1	104	c.104T>C	c.(103-105)cTc>cCc	p.L35P	SERPINB12_ENST00000382768.1_Missense_Mutation_p.L35P	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	35					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						CCCCTGAGCCTCTCAGCTGCC	0.443																																					p.L35P		.											.	SERPINB12-227	0			c.T104C						.						220.0	208.0	212.0					18																	61223496		2203	4300	6503	SO:0001583	missense	89777	exon1			TGAGCCTCTCAGC	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.104T>C	18.37:g.61223496T>C	ENSP00000269491:p.Leu35Pro	112	0		136	51	NM_080474	0	0	0	0	0	Q3SYB4	Missense_Mutation	SNP	ENST00000269491.1	37	CCDS11984.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.437444	0.62955	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.84516	-1.86;-1.86	5.4	5.4	0.78164	Serpin domain (3);	0.335067	0.25636	N	0.029303	D	0.92770	0.7701	M	0.84511	2.7	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.72338	0.964;0.977	D	0.93895	0.7183	10	0.87932	D	0	.	15.4163	0.74970	0.0:0.0:0.0:1.0	.	35;35	Q3SYB4;Q96P63	.;SPB12_HUMAN	P	35	ENSP00000269491:L35P;ENSP00000372218:L35P	ENSP00000269491:L35P	L	+	2	0	SERPINB12	59374476	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	5.920000	0.70017	2.059000	0.61396	0.533000	0.62120	CTC	.		0.443	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474	
CELF5	60680	bcgsc.ca	37	19	3224896	3224896	+	Silent	SNP	G	G	C	rs17852497	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:3224896G>C	ENST00000292672.2	+	1	196	c.159G>C	c.(157-159)ccG>ccC	p.P53P	CELF5_ENST00000541430.2_Silent_p.P53P	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	53	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						GCCAGATCCCGCGGCACCTGG	0.677													G|||	873	0.174321	0.1104	0.1671	5008	,	,		3684	0.1984		0.2256	False		,,,				2504	0.1881				p.P53P		.											.	CELF5-92	0			c.G159C						.	G	,	632,3772		46,540,1616	21.0	20.0	20.0		159,159	-0.6	0.9	19	dbSNP_123	20	1751,6843		186,1379,2732	no	coding-synonymous,coding-synonymous	CELF5	NM_001172673.1,NM_021938.3	,	232,1919,4348	CC,CG,GG		20.3747,14.3506,18.3336	,	53/410,53/486	3224896	2383,10615	2202	4297	6499	SO:0001819	synonymous_variant	60680	exon1			GATCCCGCGGCAC	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.159G>C	19.37:g.3224896G>C		159	2		306	11	NM_021938	0	0	0	0	0	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Silent	SNP	ENST00000292672.2	37	CCDS12106.1																																																																																			G|0.815;C|0.185		0.677	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
C3	718	bcgsc.ca	37	19	6677989	6677989	+	Silent	SNP	G	G	A	rs17030	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:6677989G>A	ENST00000245907.6	-	41	4988	c.4896C>T	c.(4894-4896)ccC>ccT	p.P1632P	C3_ENST00000599668.1_5'UTR	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1632	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CGTCCTCCTCGGGCCAGTGCT	0.612													G|||	2669	0.532947	0.497	0.5043	5008	,	,		17315	0.5476		0.5109	False		,,,				2504	0.6094				p.P1632P		.											.	C3-95	0			c.C4896T						.			2193,2213	587.0+/-386.6	542,1109,552	150.0	118.0	129.0		4896	-9.9	0.0	19	dbSNP_60	129	4445,4155	588.6+/-392.4	1147,2151,1002	no	coding-synonymous	C3	NM_000064.2		1689,3260,1554	AA,AG,GG		48.314,49.773,48.962		1632/1664	6677989	6638,6368	2203	4300	6503	SO:0001819	synonymous_variant	718	exon41			CTCCTCGGGCCAG	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4896C>T	19.37:g.6677989G>A		104	1		117	5	NM_000064	0	0	504	504	0	A7E236	Silent	SNP	ENST00000245907.6	37	CCDS32883.1																																																																																			G|0.494;A|0.506		0.612	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
UNC13A	23025	bcgsc.ca	37	19	17741047	17741047	+	Silent	SNP	A	A	G	rs10413821	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:17741047A>G	ENST00000519716.2	-	30	3575	c.3576T>C	c.(3574-3576)gtT>gtC	p.V1192V	UNC13A_ENST00000550896.1_Silent_p.V1190V|UNC13A_ENST00000552293.1_Silent_p.V1192V|UNC13A_ENST00000551649.1_Silent_p.V1192V|UNC13A_ENST00000252773.7_Silent_p.V1192V|UNC13A_ENST00000428389.2_Silent_p.V1280V	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1192	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GTTGGGAGAAAACATCCACCA	0.547													G|||	2404	0.480032	0.8517	0.451	5008	,	,		19359	0.2966		0.3459	False		,,,				2504	0.3252				p.V1192V		.											.	UNC13A-25	0			c.T3576C						.			3221,985		1248,725,130	42.0	45.0	44.0		3576	3.5	1.0	19	dbSNP_119	44	2927,5509		560,1807,1851	no	coding-synonymous	UNC13A	NM_001080421.2		1808,2532,1981	GG,GA,AA		34.6965,23.4189,48.6315		1192/1704	17741047	6148,6494	2103	4218	6321	SO:0001819	synonymous_variant	23025	exon29			GGAGAAAACATCC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3576T>C	19.37:g.17741047A>G		135	0		105	5	NM_001080421	0	0	0	0	0	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																			A|0.571;G|0.429		0.547	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
DMKN	93099	hgsc.bcm.edu	37	19	36002386	36002386	+	Missense_Mutation	SNP	C	C	T	rs56743379|rs117522133		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:36002386C>T	ENST00000339686.3	-	5	1021	c.845G>A	c.(844-846)aGt>aAt	p.S282N	DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.S282N|DMKN_ENST00000451297.2_Missense_Mutation_p.S282N|DMKN_ENST00000424570.2_Missense_Mutation_p.S282N|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.S282N|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S282N|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000467637.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	282	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gctgccgccactgctgccgcc	0.632																																					p.S282N		.											.	DMKN-155	1	Deletion - In frame(1)	ovary(1)	c.G845A						.						26.0	20.0	22.0					19																	36002386		2190	4261	6451	SO:0001583	missense	93099	exon5			CCGCCACTGCTGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.845G>A	19.37:g.36002386C>T	ENSP00000342012:p.Ser282Asn	72	0		66	21	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007164	0.19199	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	3.03	0.883	0.19177	.	1.984400	0.02204	N	0.062511	T	0.35098	0.0920	L	0.32530	0.975	0.09310	N	1	B;B;B;B;B	0.09022	0.002;0.002;0.002;0.002;0.001	B;B;B;B;B	0.10450	0.005;0.005;0.005;0.005;0.005	T	0.09862	-1.0655	10	0.12766	T	0.61	.	5.3636	0.16101	0.0:0.731:0.0:0.2689	.	282;282;282;282;282	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	N	282	ENSP00000342012:S282N;ENSP00000394908:S282N;ENSP00000415277:S282N;ENSP00000414743:S282N;ENSP00000388404:S282N;ENSP00000409513:S282N	ENSP00000342012:S282N	S	-	2	0	DMKN	40694226	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.157000	0.16402	0.352000	0.24053	-0.221000	0.12465	AGT	C|0.945;T|0.055		0.632	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DMKN	93099	hgsc.bcm.edu	37	19	36002389	36002389	+	Missense_Mutation	SNP	C	C	T	rs56743379|rs142519211		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:36002389C>T	ENST00000339686.3	-	5	1018	c.842G>A	c.(841-843)aGc>aAc	p.S281N	DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.S281N|DMKN_ENST00000451297.2_Missense_Mutation_p.S281N|DMKN_ENST00000424570.2_Missense_Mutation_p.S281N|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.S281N|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S281N|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000467637.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	281	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			gccgccactgctgccgccact	0.632																																					p.S281N		.											.	DMKN-155	1	Deletion - In frame(1)	ovary(1)	c.G842A						.						26.0	20.0	22.0					19																	36002389		2188	4250	6438	SO:0001583	missense	93099	exon5			CCACTGCTGCCGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.842G>A	19.37:g.36002389C>T	ENSP00000342012:p.Ser281Asn	72	0		63	18	NM_001126058	0	0	0	0	0	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	37	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	3.259	-0.151610	0.06585	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	3.03	1.94	0.25998	.	0.972189	0.08437	N	0.945978	T	0.22742	0.0549	N	0.12746	0.255	0.09310	N	1	B;B;B;B;B	0.20550	0.046;0.046;0.046;0.046;0.017	B;B;B;B;B	0.12837	0.008;0.008;0.008;0.008;0.005	T	0.22173	-1.0224	10	0.23302	T	0.38	.	6.4474	0.21883	0.0:0.86:0.0:0.14	.	281;281;281;281;281	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;Q6E0U4	.;.;.;.;DMKN_HUMAN	N	281	ENSP00000342012:S281N;ENSP00000394908:S281N;ENSP00000415277:S281N;ENSP00000414743:S281N;ENSP00000388404:S281N;ENSP00000409513:S281N	ENSP00000342012:S281N	S	-	2	0	DMKN	40694229	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.000000	0.12993	0.834000	0.34852	0.561000	0.74099	AGC	C|0.957;T|0.043		0.632	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
SPTBN4	57731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41063159	41063159	+	Silent	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:41063159C>T	ENST00000352632.3	+	26	5606	c.5520C>T	c.(5518-5520)ttC>ttT	p.F1840F	SPTBN4_ENST00000598249.1_Silent_p.F1840F|SPTBN4_ENST00000338932.3_Silent_p.F1840F|SPTBN4_ENST00000595535.1_Silent_p.F1840F|SPTBN4_ENST00000392025.1_Silent_p.F583F|SPTBN4_ENST00000392023.1_Silent_p.F516F			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1840					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.F516L(1)|p.F1840L(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ATAAGTTCTTCAGTGACGCCC	0.652																																					p.F1840F		.											.	SPTBN4-94	2	Substitution - Missense(2)	lung(2)	c.C5520T						.						26.0	30.0	28.0					19																	41063159		2203	4300	6503	SO:0001819	synonymous_variant	57731	exon26			GTTCTTCAGTGAC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5520C>T	19.37:g.41063159C>T		105	0		135	41	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			.		0.652	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
TPRX1	284355	ucsc.edu	37	19	48305646	48305646	+	Missense_Mutation	SNP	G	G	A	rs112842028		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr19:48305646G>A	ENST00000322175.3	-	2	777	c.622C>T	c.(622-624)Cca>Tca	p.P208S	TPRX1_ENST00000543508.1_Missense_Mutation_p.P198S|TPRX1_ENST00000535759.1_Missense_Mutation_p.P305S	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	208	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		attgggcctgggatcgggcct	0.672																																					p.P208S	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.C622T						.						13.0	9.0	11.0					19																	48305646		1817	3498	5315	SO:0001583	missense	284355	exon2			GGCCTGGGATCGG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.622C>T	19.37:g.48305646G>A	ENSP00000323455:p.Pro208Ser	45	0		38	6	NM_198479	0	0	0	0	0	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	-	0.005	-2.195800	0.00299	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.65549	-0.16;-0.16;-0.16	0.401	-0.802	0.10889	.	.	.	.	.	T	0.31104	0.0786	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08617	-1.0713	8	0.16896	T	0.51	.	.	.	.	.	208	Q8N7U7	TPRX1_HUMAN	S	208;305;198	ENSP00000323455:P208S;ENSP00000438832:P305S;ENSP00000438712:P198S	ENSP00000323455:P208S	P	-	1	0	TPRX1	52997458	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.103000	0.10940	-2.971000	0.00286	-2.992000	0.00078	CCA	G|0.500;A|0.500		0.672	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	29295883	29295883	+	Silent	SNP	T	T	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:29295883T>A	ENST00000331664.5	-	1	1244	c.1245A>T	c.(1243-1245)tcA>tcT	p.S415S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	415					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TAGGAGCCCCTGAGAGCAGGC	0.582																																					p.S415S		.											.	C2orf71-91	0			c.A1245T						.						83.0	85.0	84.0					2																	29295883		1977	4159	6136	SO:0001819	synonymous_variant	388939	exon1			AGCCCCTGAGAGC		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1245A>T	2.37:g.29295883T>A		118	0		159	58	NM_001029883	0	0	0	0	0		Silent	SNP	ENST00000331664.5	37	CCDS42669.1																																																																																			.		0.582	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
GALNT14	79623	broad.mit.edu;bcgsc.ca	37	2	31147655	31147655	+	Missense_Mutation	SNP	G	G	A	rs377585928		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:31147655G>A	ENST00000349752.5	-	12	1825	c.1186C>T	c.(1186-1188)Cgc>Tgc	p.R396C	GALNT14_ENST00000420311.2_Missense_Mutation_p.R361C|GALNT14_ENST00000324589.5_Missense_Mutation_p.R401C|GALNT14_ENST00000406653.1_Missense_Mutation_p.R376C|GALNT14_ENST00000356174.3_Missense_Mutation_p.R363C|GALNT14_ENST00000486564.1_Intron	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	396					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CTCTGGCAGCGCAGATTCTTC	0.547																																					p.R401C		.											.	GALNT14-93	0			c.C1201T						.		CYS/ARG	0,4406		0,0,2203	85.0	72.0	76.0		1186	2.8	0.0	2		76	1,8599	1.2+/-3.3	0,1,4299	no	missense	GALNT14	NM_024572.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	396/553	31147655	1,13005	2203	4300	6503	SO:0001583	missense	79623	exon13			GGCAGCGCAGATT	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1186C>T	2.37:g.31147655G>A	ENSP00000288988:p.Arg396Cys	85	0		76	4	NM_001253826	0	0	0	0	0	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	g	20.0	3.929754	0.73327	0.0	1.16E-4	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	4.83	2.76	0.32466	.	1.073180	0.07244	N	0.864697	T	0.35799	0.0944	L	0.48362	1.52	0.35068	D	0.762232	B;P;P;B;P	0.51791	0.001;0.85;0.948;0.001;0.767	B;B;P;B;B	0.47206	0.005;0.235;0.541;0.001;0.183	T	0.43861	-0.9365	10	0.62326	D	0.03	.	10.6039	0.45384	0.0:0.0:0.3884:0.6116	.	361;363;401;396;376	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	C	396;401;376;363;361;363	ENSP00000288988:R396C;ENSP00000314500:R401C;ENSP00000385435:R376C;ENSP00000348497:R363C;ENSP00000415514:R361C;ENSP00000406399:R363C	ENSP00000314500:R401C	R	-	1	0	GALNT14	31001159	0.995000	0.38212	0.009000	0.14445	0.977000	0.68977	5.345000	0.65987	1.000000	0.39049	0.306000	0.20318	CGC	.		0.547	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
TMEM247	388946	ucsc.edu;bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	117	1		250	35	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
SLC5A7	60482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	108627278	108627278	+	Silent	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:108627278C>T	ENST00000264047.2	+	9	1980	c.1704C>T	c.(1702-1704)tcC>tcT	p.S568S	SLC5A7_ENST00000540517.1_Silent_p.S463S|SLC5A7_ENST00000409059.1_Silent_p.S568S	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	568					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	ATGTTGATTCCAGTCCAGAAG	0.403																																					p.S568S		.											.	SLC5A7-93	0			c.C1704T						.						35.0	37.0	36.0					2																	108627278		2200	4297	6497	SO:0001819	synonymous_variant	60482	exon9			TGATTCCAGTCCA	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1704C>T	2.37:g.108627278C>T		18	0		21	10	NM_021815	0	0	0	0	0	Q53TF2	Silent	SNP	ENST00000264047.2	37	CCDS2074.1																																																																																			.		0.403	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
IWS1	55677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128281317	128281317	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:128281317C>G	ENST00000295321.4	-	2	344	c.85G>C	c.(85-87)Ggt>Cgt	p.G29R	IWS1_ENST00000455721.2_Missense_Mutation_p.G36R|IWS1_ENST00000486662.1_Intron	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	29					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCATCCTCACCGTCTGACCCT	0.438																																					p.G29R		.											.	IWS1-91	0			c.G85C						.						276.0	231.0	246.0					2																	128281317		2203	4300	6503	SO:0001583	missense	55677	exon2			CCTCACCGTCTGA	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.85G>C	2.37:g.128281317C>G	ENSP00000295321:p.Gly29Arg	47	0		101	33	NM_017969	0	0	0	0	0	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	37	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111163	0.56398	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721;ENST00000409725	T;T	0.30182	1.55;1.54	5.65	3.86	0.44501	.	0.293408	0.29348	N	0.012406	T	0.16981	0.0408	N	0.22421	0.69	0.25739	N	0.985181	P	0.38617	0.64	B	0.35510	0.204	T	0.11941	-1.0567	10	0.17369	T	0.5	-2.6949	8.634	0.33936	0.0:0.7852:0.0:0.2148	.	29	Q96ST2	IWS1_HUMAN	R	29;29;36;34	ENSP00000295321:G29R;ENSP00000399245:G36R	ENSP00000295321:G29R	G	-	1	0	IWS1	127997787	0.644000	0.27277	0.998000	0.56505	0.997000	0.91878	0.905000	0.28504	0.746000	0.32786	0.650000	0.86243	GGT	.		0.438	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
HJURP	55355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234750050	234750050	+	Missense_Mutation	SNP	G	G	A	rs148843421	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:234750050G>A	ENST00000411486.2	-	8	1441	c.1376C>T	c.(1375-1377)cCg>cTg	p.P459L	HJURP_ENST00000432087.1_Missense_Mutation_p.P405L|HJURP_ENST00000441687.1_Missense_Mutation_p.P374L|HJURP_ENST00000434039.1_5'Flank	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	459					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)	p.P459Q(1)		NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		CCAGGAGTCCGGGAGGCACAT	0.562																																					p.P459L		.											.	HJURP-69	1	Substitution - Missense(1)	lung(1)	c.C1376T						.	G	LEU/PRO	5,4401	11.4+/-27.6	0,5,2198	72.0	75.0	74.0		1376	2.2	0.0	2	dbSNP_134	74	0,8600		0,0,4300	yes	missense	HJURP	NM_018410.3	98	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	benign	459/749	234750050	5,13001	2203	4300	6503	SO:0001583	missense	55355	exon8			GAGTCCGGGAGGC		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1376C>T	2.37:g.234750050G>A	ENSP00000414109:p.Pro459Leu	77	0		82	17	NM_018410	0	0	0	0	0	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	37	CCDS33406.1	.	.	.	.	.	.	.	.	.	.	G	7.235	0.600191	0.13939	0.001135	0.0	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	3.98	2.2	0.27929	Holliday junction regulator protein family C-terminal repeat (1);	0.361995	0.23704	N	0.045388	T	0.49626	0.1568	L	0.31065	0.9	0.09310	N	1	B;B;B	0.21905	0.05;0.05;0.062	B;B;B	0.23852	0.017;0.017;0.049	T	0.38023	-0.9680	10	0.39692	T	0.17	-10.5301	6.678	0.23106	0.2138:0.0:0.7862:0.0	.	374;405;459	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	L	459;405;374;374	ENSP00000414109:P459L;ENSP00000407208:P405L;ENSP00000401944:P374L;ENSP00000393253:P374L	ENSP00000414109:P459L	P	-	2	0	HJURP	234414789	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.565000	0.23578	0.664000	0.31047	-0.736000	0.03550	CCG	G|1.000;A|0.000		0.562	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410	
ANKMY1	51281	bcgsc.ca	37	2	241465261	241465261	+	Silent	SNP	G	G	A	rs35186665	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:241465261G>A	ENST00000272972.3	-	6	1123	c.909C>T	c.(907-909)caC>caT	p.H303H	ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000536462.1_Silent_p.H115H|ANKMY1_ENST00000405523.3_Silent_p.H162H|ANKMY1_ENST00000405002.1_Silent_p.H73H|ANKMY1_ENST00000373320.4_Silent_p.H73H|ANKMY1_ENST00000361678.4_Silent_p.H162H|ANKMY1_ENST00000391987.1_Silent_p.H303H|ANKMY1_ENST00000373318.2_Silent_p.H162H|ANKMY1_ENST00000406958.1_Silent_p.H162H|ANKMY1_ENST00000401804.1_Silent_p.H392H|ANKMY1_ENST00000403283.1_Silent_p.H241H	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	303							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CGTTGTGGCAGTGAGTCTGGA	0.592													G|||	253	0.0505192	0.0038	0.0461	5008	,	,		22147	0.0119		0.0915	False		,,,				2504	0.1145				p.H303H		.											.	ANKMY1-90	0			c.C909T						.	G	,	98,4308	78.3+/-116.7	2,94,2107	171.0	130.0	144.0		909,486	-2.2	0.1	2	dbSNP_126	144	898,7702	202.1+/-245.5	53,792,3455	no	coding-synonymous,coding-synonymous	ANKMY1	NM_016552.2,NM_017844.2	,	55,886,5562	AA,AG,GG		10.4419,2.2242,7.658	,	303/942,162/718	241465261	996,12010	2203	4300	6503	SO:0001819	synonymous_variant	51281	exon6			GTGGCAGTGAGTC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.909C>T	2.37:g.241465261G>A		50	0		72	4	NM_016552	0	0	0	0	0	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1	94	0.04304029304029304	4	0.008130081300813009	19	0.052486187845303865	6	0.01048951048951049	65	0.08575197889182058	G	13.84	2.357071	0.41801	0.022242	0.104419	ENSG00000144504	ENST00000539830	.	.	.	3.63	-2.19	0.07015	.	.	.	.	.	T	0.03220	0.0094	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39742	-0.9599	5	0.66056	D	0.02	-13.4375	8.5052	0.33184	0.5436:0.0:0.4564:0.0	rs35186665	.	.	.	I	231	.	ENSP00000444166:T231I	T	-	2	0	ANKMY1	241113934	0.990000	0.36364	0.078000	0.20375	0.008000	0.06430	0.172000	0.16704	-0.270000	0.09285	-0.670000	0.03821	ACT	G|0.934;A|0.066		0.592	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
SNED1	25992	hgsc.bcm.edu	37	2	242011084	242011084	+	Missense_Mutation	SNP	T	T	C	rs17440466	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr2:242011084T>C	ENST00000310397.8	+	25	3683	c.3683T>C	c.(3682-3684)cTg>cCg	p.L1228P	SNED1_ENST00000401884.1_Missense_Mutation_p.L1228P|SNED1_ENST00000405547.3_Missense_Mutation_p.L1228P|SNED1_ENST00000342631.6_Missense_Mutation_p.L1228P|MTERFD2_ENST00000464344.2_5'Flank	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1228			L -> P (in dbSNP:rs17440466).		cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGCCGGAGCTGCGCCTGCTC	0.726													T|||	550	0.109824	0.0227	0.0821	5008	,	,		7723	0.1885		0.171	False		,,,				2504	0.1033				p.L1228P		.											.	SNED1-72	0			c.T3683C						.	T	PRO/LEU	148,3636		7,134,1751	5.0	6.0	6.0		3683	4.4	1.0	2	dbSNP_123	6	1058,6892		57,944,2974	no	missense	SNED1	NM_001080437.1	98	64,1078,4725	CC,CT,TT		13.3082,3.9112,10.2778	probably-damaging	1228/1414	242011084	1206,10528	1892	3975	5867	SO:0001583	missense	25992	exon25			CGGAGCTGCGCCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3683T>C	2.37:g.242011084T>C	ENSP00000308893:p.Leu1228Pro	1	0		18	18	NM_001080437	0	0	0	0	0	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	255	0.11675824175824176	17	0.034552845528455285	27	0.07458563535911603	105	0.18356643356643357	106	0.13984168865435356	T	13.43	2.236189	0.39498	0.039112	0.133082	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.83992	-1.72;-1.79;-1.76;-1.72	4.36	4.36	0.52297	.	0.000000	0.34025	N	0.004340	T	0.01156	0.0038	M	0.67953	2.075	0.09310	P	0.99999566469	D;D;D;D	0.76494	0.992;0.996;0.999;0.96	P;D;D;P	0.83275	0.857;0.918;0.996;0.613	T	0.33904	-0.9850	9	0.37606	T	0.19	.	11.3537	0.49602	0.0:0.0:0.0:1.0	rs17440466;rs17440466	1228;1228;1228;1228	Q8TER0-3;Q8TER0-5;B5MEF5;Q8TER0	.;.;.;SNED1_HUMAN	P	1228	ENSP00000384871:L1228P;ENSP00000386007:L1228P;ENSP00000308893:L1228P;ENSP00000342992:L1228P	ENSP00000308893:L1228P	L	+	2	0	SNED1	241659757	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	1.160000	0.31761	1.727000	0.51537	0.383000	0.25322	CTG	T|0.877;C|0.123		0.726	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		0	0		5	5	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
TRIB3	57761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	368653	368653	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:368653A>G	ENST00000217233.3	+	2	553		c.e2-1		TRIB3_ENST00000485293.1_Splice_Site|TRIB3_ENST00000422053.2_Splice_Site	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3						cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		CCTTTTTACCAGATGCGAGCC	0.547																																					.	Melanoma(101;421 2374 19538)	.											.	TRIB3-359	0			.						.						44.0	48.0	47.0					20																	368653		2202	4300	6502	SO:0001630	splice_region_variant	57761	.			TTTACCAGATGCG	AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.0-1A>G	20.37:g.368653A>G		40	0		46	17	.	0	0	0	4	4	Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Splice_Site	SNP	ENST00000217233.3	37	CCDS12997.1	.	.	.	.	.	.	.	.	.	.	A	8.094	0.775223	0.16051	.	.	ENSG00000101255	ENST00000422053	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2688	0.43470	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIB3	316653	1.000000	0.71417	0.982000	0.44146	0.150000	0.21749	5.041000	0.64196	1.927000	0.55829	0.459000	0.35465	.	.		0.547	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2	NM_021158	Intron
CPXM1	56265	bcgsc.ca	37	20	2776975	2776975	+	Missense_Mutation	SNP	C	C	T	rs41310169	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:2776975C>T	ENST00000380605.2	-	9	1224	c.1160G>A	c.(1159-1161)cGg>cAg	p.R387Q		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	387					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCGGGTCACCCGTGGGTTCCC	0.622													C|||	19	0.00379393	0.0008	0.0043	5008	,	,		19754	0.0		0.0149	False		,,,				2504	0.0				p.R387Q		.											.	CPXM1-94	0			c.G1160A						.	C	GLN/ARG,GLN/ARG	6,4400	11.4+/-27.6	0,6,2197	79.0	74.0	76.0		1160,1160	5.4	0.7	20	dbSNP_127	76	114,8486	61.3+/-123.2	1,112,4187	yes	missense,missense	CPXM1	NM_001184699.1,NM_019609.4	43,43	1,118,6384	TT,TC,CC		1.3256,0.1362,0.9227	probably-damaging,probably-damaging	387/661,387/735	2776975	120,12886	2203	4300	6503	SO:0001583	missense	56265	exon9			GTCACCCGTGGGT	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1160G>A	20.37:g.2776975C>T	ENSP00000369979:p.Arg387Gln	68	0		63	4	NM_001184699	0	0	0	0	0	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	13	0.005952380952380952	0	0.0	1	0.0027624309392265192	0	0.0	12	0.0158311345646438	C	31	5.088769	0.94100	0.001362	0.013256	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.10288	2.89	5.43	5.43	0.79202	Peptidase M14, carboxypeptidase A (1);	0.055425	0.64402	D	0.000001	T	0.22244	0.0536	M	0.85710	2.77	0.51482	D	0.999927	D;D	0.89917	0.99;1.0	P;D	0.69142	0.672;0.962	T	0.04811	-1.0925	10	0.87932	D	0	-22.8022	16.7686	0.85531	0.0:1.0:0.0:0.0	rs41310169;rs61729446	387;387	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	Q	387;83	ENSP00000369979:R387Q	ENSP00000369979:R387Q	R	-	2	0	CPXM1	2724975	1.000000	0.71417	0.662000	0.29724	0.991000	0.79684	7.651000	0.83577	2.825000	0.97269	0.655000	0.94253	CGG	C|0.993;T|0.007		0.622	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.		.											.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		41	1		64	4	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
R3HDML	140902	bcgsc.ca	37	20	42966025	42966025	+	Silent	SNP	T	T	C	rs1884612	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:42966025T>C	ENST00000217043.2	+	1	400	c.228T>C	c.(226-228)agT>agC	p.S76S		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	76	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			TCCGGGCCAGTGTGTACCCAC	0.607													C|||	1236	0.246805	0.2519	0.3516	5008	,	,		17546	0.0982		0.2962	False		,,,				2504	0.2679				p.S76S		.											.	R3HDML-90	0			c.T228C						.	C		1187,3219	708.5+/-407.6	176,835,1192	57.0	54.0	55.0		228	0.6	1.0	20	dbSNP_92	55	2476,6124	694.4+/-404.7	346,1784,2170	no	coding-synonymous	R3HDML	NM_178491.2		522,2619,3362	CC,CT,TT		28.7907,26.9405,28.1639		76/254	42966025	3663,9343	2203	4300	6503	SO:0001819	synonymous_variant	140902	exon1			GGCCAGTGTGTAC	BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.228T>C	20.37:g.42966025T>C		129	0		195	8	NM_178491	0	0	0	0	0		Silent	SNP	ENST00000217043.2	37	CCDS13329.1																																																																																			T|0.730;C|0.270		0.607	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
OCSTAMP	128506	broad.mit.edu	37	20	45174026	45174026	+	Silent	SNP	A	A	C	rs202396	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr20:45174026A>C	ENST00000279028.2	-	2	1000	c.987T>G	c.(985-987)gcT>gcG	p.A329A		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	329					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						AGTCCACAGTAGCCTGTGCCA	0.557													C|||	1266	0.252796	0.5242	0.1052	5008	,	,		19898	0.1577		0.1392	False		,,,				2504	0.2055				p.A329A		.											.	.	0			c.T987G						.	C		615,769		142,331,219	17.0	17.0	17.0		987	-7.0	0.1	20	dbSNP_79	17	358,2824		21,316,1254	no	coding-synonymous	C20orf123	NM_080721.1		163,647,1473	CC,CA,AA		11.2508,44.4364,21.3097		329/567	45174026	973,3593	692	1591	2283	SO:0001819	synonymous_variant	128506	exon2			CACAGTAGCCTGT	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.987T>G	20.37:g.45174026A>C		54	0		62	3	NM_080721	0	0	0	0	0		Silent	SNP	ENST00000279028.2	37	CCDS54468.1																																																																																			A|0.805;C|0.195		0.557	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079573.2	XM_496476	
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	0	0		9	8	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		0	0		9	8	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-7	386675	broad.mit.edu	37	21	46020669	46020670	+	Frame_Shift_Del	DEL	AG	AG	-	rs36208679|rs60739860		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr21:46020669_46020670delAG	ENST00000380102.2	+	1	173_174	c.148_149delAG	c.(148-150)agcfs	p.S50fs	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	50	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CTGCGCCCCCAGCTGCTGCGCC	0.703																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.																																			SO:0001589	frameshift_variant	386675	.			GCCCCCAGCTGCT	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.148_149delAG	21.37:g.46020669_46020670delAG	ENSP00000369445:p.Ser50fs	17	0		90	8	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.703	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
LSS	4047	bcgsc.ca	37	21	47614443	47614443	+	Silent	SNP	A	A	G	rs2254522	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr21:47614443A>G	ENST00000397728.3	-	20	2028	c.1950T>C	c.(1948-1950)caT>caC	p.H650H	AP001468.1_ENST00000594486.1_5'Flank|LSS_ENST00000522411.1_Silent_p.H639H|LSS_ENST00000457828.2_Silent_p.H570H|LSS_ENST00000356396.4_Silent_p.H650H	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	650					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					AGCATGTGTTATGGATCTGGG	0.622													G|||	1695	0.338458	0.3253	0.2637	5008	,	,		20984	0.5655		0.1958	False		,,,				2504	0.3221				p.H650H	Pancreas(114;955 2313 34923 50507)	.											.	LSS-90	0			c.T1950C						.	G	,,,	1379,3027	687.5+/-404.9	223,933,1047	98.0	78.0	85.0		1950,1917,1710,1950	1.2	1.0	21	dbSNP_100	85	1740,6860	735.0+/-406.9	167,1406,2727	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LSS	NM_001001438.2,NM_001145436.1,NM_001145437.1,NM_002340.5	,,,	390,2339,3774	GG,GA,AA		20.2326,31.2982,23.9812	,,,	650/733,639/722,570/653,650/733	47614443	3119,9887	2203	4300	6503	SO:0001819	synonymous_variant	4047	exon20			TGTGTTATGGATC	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1950T>C	21.37:g.47614443A>G		106	0		106	5	NM_001001438	0	0	18	18	0	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Silent	SNP	ENST00000397728.3	37	CCDS13733.1	703	0.3218864468864469	126	0.25609756097560976	76	0.20994475138121546	347	0.6066433566433567	154	0.20316622691292877	G	5.699	0.313580	0.10789	0.312982	0.202326	ENSG00000160285	ENST00000419093	.	.	.	5.07	1.21	0.21127	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999999816	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0859	0.36581	0.3764:0.0:0.6236:0.0	rs2254522;rs2254522	.	.	.	Q	18	.	.	X	-	1	0	LSS	46438871	1.000000	0.71417	0.967000	0.41034	0.432000	0.31715	2.487000	0.45268	-0.190000	0.10465	-0.726000	0.03593	TAA	A|0.712;C|0.002		0.622	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
CLDN5	7122	hgsc.bcm.edu	37	22	19511953	19511953	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr22:19511953C>A	ENST00000406028.1	-	2	1141	c.81G>T	c.(79-81)agG>agT	p.R27S	CLDN5_ENST00000413119.2_Missense_Mutation_p.R27S|CLDN5_ENST00000403084.1_Missense_Mutation_p.R27S			O00501	CLD5_HUMAN	claudin 5	0					calcium-independent cell-cell adhesion (GO:0016338)|myelination (GO:0042552)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			liver(1)|lung(2)|prostate(1)	4	Colorectal(54;0.0993)					CGGGGGGTACCCTCTTTGAAG	0.716																																					p.R27S		.											.	CLDN5-492	0			c.G81T						.						3.0	5.0	4.0					22																	19511953		622	1460	2082	SO:0001583	missense	7122	exon1			GGGTACCCTCTTT	AF000959	CCDS13763.2	22q11.21	2008-08-01	2008-08-01		ENSG00000184113	ENSG00000184113		"""Claudins"""	2047	protein-coding gene	gene with protein product		602101	"""transmembrane protein deleted in velocardiofacial syndrome"""	AWAL, TMVCF		9441748, 9192844	Standard	NM_003277		Approved	CPETRL1, BEC1	uc002zpu.2	O00501	OTTHUMG00000150441	ENST00000406028.1:c.81G>T	22.37:g.19511953C>A	ENSP00000385477:p.Arg27Ser	0	0		24	11	NM_001130861	0	0	0	0	0	B3KS11|Q53XW2|Q8WUW3	Missense_Mutation	SNP	ENST00000406028.1	37	CCDS13763.2	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947229	0.34377	.	.	ENSG00000184113	ENST00000406028;ENST00000403084;ENST00000413119	D;D;D	0.88741	-2.42;-2.42;-2.42	5.24	-6.06	0.02165	.	.	.	.	.	T	0.70544	0.3236	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.57418	-0.7815	9	0.87932	D	0	.	1.7987	0.03067	0.2908:0.3902:0.1059:0.2131	.	27	D3DX19	.	S	27	ENSP00000385477:R27S;ENSP00000384554:R27S;ENSP00000400612:R27S	ENSP00000384554:R27S	R	-	3	2	CLDN5	17891953	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.372000	0.07504	-0.620000	0.05641	-1.119000	0.02030	AGG	.		0.716	CLDN5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318122.3	NM_003277	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		0	0		4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24709364	24709364	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr22:24709364C>G	ENST00000314328.9	+	4	522	c.237C>G	c.(235-237)tgC>tgG	p.C79W	SPECC1L_ENST00000437398.1_Missense_Mutation_p.C79W|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.C79W|SPECC1L_ENST00000416735.1_3'UTR|SPECC1L_ENST00000541492.1_Missense_Mutation_p.C79W	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	79					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AAAGCACCTGCCCATCTGCAG	0.488																																					p.C79W		.											.	SPECC1L-92	0			c.C237G						.						106.0	88.0	94.0					22																	24709364		2203	4300	6503	SO:0001583	missense	23384	exon3			CACCTGCCCATCT	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.237C>G	22.37:g.24709364C>G	ENSP00000325785:p.Cys79Trp	164	0		233	84	NM_001145468	0	0	0	0	0	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360951	0.41801	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	T;T;T;T;T	0.60920	0.15;2.62;0.15;3.15;0.72	5.09	1.74	0.24563	.	0.241950	0.41712	D	0.000834	T	0.46210	0.1381	N	0.14661	0.345	0.51767	D	0.999933	D;D	0.63046	0.992;0.964	P;P	0.53035	0.716;0.524	T	0.43734	-0.9373	10	0.72032	D	0.01	-18.3326	6.8014	0.23754	0.0:0.552:0.0:0.448	.	79;79	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	W	107;79;79;79;79;18	ENSP00000393363:C79W;ENSP00000405671:C79W;ENSP00000325785:C79W;ENSP00000439633:C79W;ENSP00000414354:C18W	ENSP00000325785:C79W	C	+	3	2	SPECC1L	23039364	0.021000	0.18746	0.466000	0.27168	0.993000	0.82548	0.199000	0.17237	0.210000	0.20664	-0.136000	0.14681	TGC	.		0.488	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
PDCD6IP	10015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33877676	33877676	+	Silent	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:33877676C>T	ENST00000307296.3	+	8	1352	c.975C>T	c.(973-975)gaC>gaT	p.D325D	PDCD6IP_ENST00000457054.2_Silent_p.D330D			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	325	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						GAGTTCCAGACCTTAAAGATC	0.383																																					p.D330D		.											.	PDCD6IP-228	0			c.C990T						.						148.0	151.0	150.0					3																	33877676		2203	4300	6503	SO:0001819	synonymous_variant	10015	exon8			TCCAGACCTTAAA	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.975C>T	3.37:g.33877676C>T		110	0		153	53	NM_001162429	0	0	2	2	0	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	ENST00000307296.3	37	CCDS2660.1																																																																																			.		0.383	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	116	0		134	57	NM_001098209	0	0	10	16	6	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		4	0		37	14	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
CNBP	7555	hgsc.bcm.edu	37	3	128889366	128889366	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:128889366T>C	ENST00000422453.2	-	5	624	c.464A>G	c.(463-465)gAa>gGa	p.E155G	CNBP_ENST00000441626.2_Missense_Mutation_p.E157G|CNBP_ENST00000502976.1_Missense_Mutation_p.E148G|CNBP_ENST00000500450.2_Missense_Mutation_p.E138G|CNBP_ENST00000451728.2_Missense_Mutation_p.E156G|CNBP_ENST00000446936.2_Missense_Mutation_p.E150G|CNBP_ENST00000504813.1_Missense_Mutation_p.E145G	NM_001127192.1|NM_001127193.1|NM_003418.4	NP_001120664.1|NP_001120665.1|NP_003409.1	P62633	CNBP_HUMAN	CCHC-type zinc finger, nucleic acid binding protein	155					cholesterol biosynthetic process (GO:0006695)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			biliary_tract(1)|endometrium(1)|kidney(1)|lung(2)	5						ACAGTTGACTTCACTTGTCTT	0.443																																					p.E157G		.											.	CNBP-226	0			c.A470G						.						194.0	179.0	184.0					3																	128889366		2203	4300	6503	SO:0001583	missense	7555	exon5			TTGACTTCACTTG	U19765	CCDS3056.1, CCDS46906.1, CCDS46907.1, CCDS46908.1, CCDS54637.1	3q21	2013-01-09	2006-06-29	2006-06-29				"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCHC domain containing"""	13164	protein-coding gene	gene with protein product		116955	"""zinc finger protein 9 (a cellular retroviral nucleic acid binding protein)"", ""zinc finger protein 9"""	DM2, ZNF9		2249857, 11486088	Standard	NM_003418		Approved	RNF163, ZCCHC22, CNBP1	uc021xdw.1	P62633		ENST00000422453.2:c.464A>G	3.37:g.128889366T>C	ENSP00000410619:p.Glu155Gly	57	0		77	4	NM_001127192	0	0	50	50	0	A8K7V4|B2RAV9|B4DP17|D3DNB9|D3DNC0|D3DNC1|E9PDR7|P20694|Q4JGY0|Q4JGY1|Q5QJR0|Q5U0E9|Q6PJI7|Q96NV3	Missense_Mutation	SNP	ENST00000422453.2	37	CCDS3056.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778031	0.49786	.	.	ENSG00000169714	ENST00000502976;ENST00000422453;ENST00000451728;ENST00000446936;ENST00000500450;ENST00000504813;ENST00000441626	.	.	.	6.08	6.08	0.98989	Zinc finger, CCHC retroviral-type (1);	0.000000	0.85682	D	0.000000	T	0.42471	0.1204	N	0.17723	0.515	0.80722	D	1	B;B;P	0.37914	0.22;0.328;0.611	B;B;B	0.38985	0.179;0.157;0.287	T	0.47368	-0.9123	9	0.72032	D	0.01	-4.7896	14.6032	0.68456	0.0:0.0:0.0:1.0	.	138;148;155	B4DP17;P62633-2;P62633	.;.;CNBP_HUMAN	G	148;155;156;150;138;145;157	.	ENSP00000410619:E155G	E	-	2	0	CNBP	130372056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.333000	0.79357	0.482000	0.46254	GAA	.		0.443	CNBP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358419.1	NM_003418	
CPNE4	131034	bcgsc.ca	37	3	131268824	131268824	+	Silent	SNP	T	T	C	rs11915192	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:131268824T>C	ENST00000512055.1	-	18	3395	c.1269A>G	c.(1267-1269)tcA>tcG	p.S423S	CPNE4_ENST00000511604.1_Silent_p.S423S|CPNE4_ENST00000512332.1_Silent_p.S441S|CPNE4_ENST00000429747.1_Silent_p.S423S|CPNE4_ENST00000502818.1_Silent_p.S441S			Q96A23	CPNE4_HUMAN	copine IV	423	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CCTCTGACGCTGACTTGGCAA	0.517													T|||	878	0.175319	0.2443	0.1268	5008	,	,		20206	0.1141		0.1352	False		,,,				2504	0.2209				p.S423S		.											.	CPNE4-92	0			c.A1269G						.	T		952,3454	360.9+/-315.4	98,756,1349	157.0	135.0	142.0		1269	1.2	1.0	3	dbSNP_120	142	1191,7409	242.9+/-272.7	67,1057,3176	no	coding-synonymous	CPNE4	NM_130808.1		165,1813,4525	CC,CT,TT		13.8488,21.6069,16.477		423/558	131268824	2143,10863	2203	4300	6503	SO:0001819	synonymous_variant	131034	exon14			TGACGCTGACTTG	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1269A>G	3.37:g.131268824T>C		149	0		172	6	NM_130808	0	0	0	0	0	D3DNC5|Q8TEX1	Silent	SNP	ENST00000512055.1	37	CCDS3072.1																																																																																			T|0.840;C|0.160		0.517	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	
ALG3	10195	hgsc.bcm.edu	37	3	183959508	183959508	+	IGR	SNP	A	A	C	rs28606531	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:183959508A>C	ENST00000397676.3	-	0	1528				MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Silent_p.P1137P|VWA5B2_ENST00000273794.5_Silent_p.P919P|EIF2B5_ENST00000444495.1_Intron|ALG3_ENST00000463495.1_5'Flank	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGAGGGGCCAGGCCAGGTGG	0.746													A|||	346	0.0690895	0.0204	0.0735	5008	,	,		13734	0.0079		0.1451	False		,,,				2504	0.1166				p.P1137P		.											.	.	0			c.A3411C						.						3.0	4.0	4.0					3																	183959508		597	1420	2017	SO:0001628	intergenic_variant	90113	exon19			GGGGCCAGGCCAG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959508A>C		0	0		10	5	NM_138345	0	0	0	0	0	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1																																																																																			A|0.927;C|0.073		0.746	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	60	11		183	65	NM_000203	0	0	5	8	3	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		2	0		24	13	NM_175918	0	0	3	11	8	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389070	1389070	+	Silent	SNP	A	A	G	rs151096093	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:1389070A>G	ENST00000324803.4	+	1	3731	c.771A>G	c.(769-771)ggA>ggG	p.G257G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	257					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCGATGTGGAGTGCCCGCCT	0.697																																					p.G257G		.											.	CRIPAK-90	0			c.A771G						.						159.0	142.0	148.0					4																	1389070		2202	4299	6501	SO:0001819	synonymous_variant	285464	exon1			ATGTGGAGTGCCC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.771A>G	4.37:g.1389070A>G		6	0		43	14	NM_175918	0	0	2	8	6	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			A|0.981;G|0.019		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
GABRB1	2560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47408836	47408836	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:47408836G>A	ENST00000295454.3	+	8	1265	c.973G>A	c.(973-975)Gcc>Acc	p.A325T	GABRB1_ENST00000538619.1_Missense_Mutation_p.A255T	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	325					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTGGAGTATGCCTTTGTAAA	0.438																																					p.A325T		.											.	GABRB1-92	0			c.G973A						.						192.0	183.0	186.0					4																	47408836		2203	4300	6503	SO:0001583	missense	2560	exon8			GAGTATGCCTTTG		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.973G>A	4.37:g.47408836G>A	ENSP00000295454:p.Ala325Thr	80	0		98	39	NM_000812	0	0	0	0	0	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	ENST00000295454.3	37	CCDS3474.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995360	0.93167	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.86562	-2.14;-2.14	4.74	4.74	0.60224	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.64402	D	0.000003	D	0.93615	0.7961	M	0.80847	2.515	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.967;0.996	D	0.94473	0.7686	10	0.87932	D	0	-18.6479	17.5289	0.87808	0.0:0.0:1.0:0.0	.	255;325	F5GXV5;P18505	.;GBRB1_HUMAN	T	325;255	ENSP00000295454:A325T;ENSP00000440330:A255T	ENSP00000295454:A325T	A	+	1	0	GABRB1	47103593	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	9.657000	0.98554	2.464000	0.83262	0.467000	0.42956	GCC	.		0.438	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216896.1		
PF4	5196	broad.mit.edu	37	4	74846972	74846972	+	Silent	SNP	G	G	A	rs62313967		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:74846972G>A	ENST00000296029.3	-	3	425	c.255C>T	c.(253-255)gaC>gaT	p.D85D		NM_002619.3	NP_002610.1	P02776	PLF4_HUMAN	platelet factor 4	85					blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|leukocyte chemotaxis (GO:0030595)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cytolysis (GO:0045918)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of MHC class II biosynthetic process (GO:0045347)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)			kidney(1)|lung(1)	2	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	GGGCTTGCAGGTCCAAGCAAA	0.428																																					p.D85D		.											.	PF4-90	0			c.C255T						.						84.0	89.0	88.0					4																	74846972		2203	4300	6503	SO:0001819	synonymous_variant	5196	exon3			TTGCAGGTCCAAG	M25897	CCDS3562.1	4q12-q21	2012-10-02	2008-08-29		ENSG00000163737	ENSG00000163737			8861	protein-coding gene	gene with protein product	"""chemokine (C-X-C motif) ligand 4"""	173460	"""platelet factor 4"""			3622011	Standard	NM_002619		Approved	SCYB4, CXCL4	uc003hhi.3	P02776	OTTHUMG00000130009	ENST00000296029.3:c.255C>T	4.37:g.74846972G>A		106	1		111	9	NM_002619	0	0	0	0	0	Q53X61|Q9UC64|Q9UC65	Silent	SNP	ENST00000296029.3	37	CCDS3562.1																																																																																			.		0.428	PF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252282.1		
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071E		.											.	DSPP-90	0			c.C3213A						.						56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu	417	2		669	23	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC	.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	mdanderson.org	37	4	88537087	88537087	+	Silent	SNP	C	C	T	rs553101049	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:88537087C>T	ENST00000282478.7	+	4	3306	c.3273C>T	c.(3271-3273)agC>agT	p.S1091S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1091S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1091	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaatagcagtg	0.547													C|||	744	0.148562	0.1498	0.1052	5008	,	,		12505	0.1944		0.1312	False		,,,				2504	0.1483				p.S1091S		.											.	DSPP-90	0			c.C3273T						.																																			SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3273C>T	4.37:g.88537087C>T		192	3		187	31	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DCHS2	54798	broad.mit.edu;bcgsc.ca	37	4	155410822	155410822	+	Silent	SNP	G	G	A	rs4696593	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr4:155410822G>A	ENST00000339452.1	-	1	2046	c.1686C>T	c.(1684-1686)agC>agT	p.S562S	DCHS2_ENST00000443500.1_Silent_p.S562S|DCHS2_ENST00000456341.2_Silent_p.S555S	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1707	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CATCGGAGGCGCTGACCCACA	0.602													G|||	2909	0.580871	0.4849	0.4971	5008	,	,		17880	0.8333		0.5358	False		,,,				2504	0.5562				p.S562S		.											.	DCHS2-94	0			c.C1686T						.	G	,	636,748		143,350,199	58.0	67.0	64.0		1686,1686	2.6	1.0	4	dbSNP_111	64	1760,1422		498,764,329	no	coding-synonymous,coding-synonymous	DCHS2	NM_001142552.1,NM_001142553.1	,	641,1114,528	AA,AG,GG		44.6889,45.9538,47.5252	,	562/1370,562/710	155410822	2396,2170	692	1591	2283	SO:0001819	synonymous_variant	54798	exon1			GGAGGCGCTGACC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1686C>T	4.37:g.155410822G>A		47	0		84	4	NM_001142552	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000339452.1	37	CCDS47150.1																																																																																			G|0.377;A|0.623		0.602	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
HSD17B4	3295	ucsc.edu;bcgsc.ca	37	5	118861713	118861713	+	Missense_Mutation	SNP	A	A	G	rs11205	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr5:118861713A>G	ENST00000256216.6	+	19	1808	c.1675A>G	c.(1675-1677)Att>Gtt	p.I559V	HSD17B4_ENST00000522415.1_3'UTR|HSD17B4_ENST00000510025.1_Missense_Mutation_p.I535V|HSD17B4_ENST00000513628.1_Missense_Mutation_p.I422V|HSD17B4_ENST00000504811.1_Missense_Mutation_p.I584V|HSD17B4_ENST00000414835.2_Missense_Mutation_p.I419V|HSD17B4_ENST00000509514.1_Missense_Mutation_p.I297V|HSD17B4_ENST00000515320.1_Missense_Mutation_p.I541V	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	559	Enoyl-CoA hydratase 2.|MaoC-like.		I -> V (in dbSNP:rs11205). {ECO:0000269|PubMed:14702039}.		alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.I559V(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		ATTCAAGGCAATTAAGGTAAA	0.313													A|||	2004	0.40016	0.4092	0.4683	5008	,	,		15465	0.4177		0.4125	False		,,,				2504	0.3088				p.I584V	Colon(35;490 801 34689 41394 43344)	.											.	HSD17B4-92	1	Substitution - Missense(1)	prostate(1)	c.A1750G						.	A	VAL/ILE,VAL/ILE,VAL/ILE	1741,2663	519.1+/-369.9	341,1059,802	148.0	142.0	144.0		1675,1750,1621	5.4	1.0	5	dbSNP_52	144	3518,5082	512.7+/-378.0	717,2084,1499	yes	missense,missense,missense	HSD17B4	NM_000414.3,NM_001199291.1,NM_001199292.1	29,29,29	1058,3143,2301	GG,GA,AA		40.907,39.5322,40.4414	benign,benign,benign	559/737,584/762,541/719	118861713	5259,7745	2202	4300	6502	SO:0001583	missense	3295	exon20			AAGGCAATTAAGG		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1675A>G	5.37:g.118861713A>G	ENSP00000256216:p.Ile559Val	49	0		46	5	NM_001199291	0	0	0	0	0	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	ENST00000256216.6	37	CCDS4126.1	888	0.4065934065934066	181	0.3678861788617886	164	0.4530386740331492	213	0.3723776223776224	330	0.43535620052770446	A	14.61	2.587740	0.46110	0.395322	0.40907	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	T;T;T;T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4;-1.4;-1.4;-1.4	5.39	5.39	0.77823	MaoC-like dehydratase (1);	0.046452	0.85682	D	0.000000	T	0.00012	0.0000	L	0.28740	0.885	0.09310	P	0.9999982734	P;B;B;B;B	0.42827	0.791;0.223;0.418;0.094;0.118	B;B;B;B;B	0.40534	0.332;0.204;0.088;0.264;0.17	T	0.34527	-0.9825	9	0.39692	T	0.17	-21.7798	14.3833	0.66926	1.0:0.0:0.0:0.0	rs11205;rs1130646;rs3189732;rs11539470;rs11740179;rs16918307;rs17342666;rs60097041;rs11205	584;541;535;297;559	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	V	559;541;535;584;419;422;297	ENSP00000256216:I559V;ENSP00000424613:I541V;ENSP00000424940:I535V;ENSP00000420914:I584V;ENSP00000411960:I419V;ENSP00000425993:I422V;ENSP00000426272:I297V	ENSP00000256216:I559V	I	+	1	0	HSD17B4	118889612	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	3.836000	0.55813	2.050000	0.60909	0.482000	0.46254	ATT	A|0.591;G|0.409		0.313	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250863.3	NM_000414	
RAD50	10111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131927722	131927722	+	Silent	SNP	T	T	C			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr5:131927722T>C	ENST00000265335.6	+	11	2176	c.1789T>C	c.(1789-1791)Ttg>Ctg	p.L597L	RAD50_ENST00000378823.3_Silent_p.L458L			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	597					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTTGCCAAATTGAAGTAAGT	0.318								Homologous recombination																													p.L597L		.											.	RAD50-229	0			c.T1789C						.						80.0	86.0	84.0					5																	131927722		2203	4300	6503	SO:0001819	synonymous_variant	10111	exon11			GCCAAATTGAAGT	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1789T>C	5.37:g.131927722T>C		118	0		144	54	NM_005732	0	0	0	0	0	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	37	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	T	9.236	1.037139	0.19669	.	.	ENSG00000113522	ENST00000434288	.	.	.	6.06	2.45	0.29901	.	.	.	.	.	T	0.57651	0.2068	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49194	-0.8965	4	.	.	.	-6.8943	8.7475	0.34596	0.0:0.3597:0.0:0.6403	.	.	.	.	T	95	.	.	I	+	2	0	RAD50	131955621	0.026000	0.19158	0.992000	0.48379	0.972000	0.66771	0.088000	0.14979	0.201000	0.20466	0.533000	0.62120	ATT	.		0.318	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
PCDHB5	26167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140515569	140515569	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr5:140515569C>T	ENST00000231134.5	+	1	770	c.553C>T	c.(553-555)Cgc>Tgc	p.R185C		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	185	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACGCATAATCGCGGAGATGG	0.507																																					p.R185C		.											.	PCDHB5-95	0			c.C553T						.						82.0	83.0	83.0					5																	140515569		2203	4300	6503	SO:0001583	missense	26167	exon1			CATAATCGCGGAG	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.553C>T	5.37:g.140515569C>T	ENSP00000231134:p.Arg185Cys	136	0		142	57	NM_015669	0	0	0	0	0	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427606	0.25726	.	.	ENSG00000113209	ENST00000231134	T	0.20463	2.07	5.18	3.28	0.37604	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48021	0.1477	M	0.92026	3.265	0.09310	N	1	D	0.71674	0.998	D	0.65140	0.932	T	0.36212	-0.9757	9	0.56958	D	0.05	.	7.3884	0.26895	0.3852:0.3865:0.2284:0.0	.	185	Q9Y5E4	PCDB5_HUMAN	C	185	ENSP00000231134:R185C	ENSP00000231134:R185C	R	+	1	0	PCDHB5	140495753	0.000000	0.05858	0.446000	0.26920	0.256000	0.26092	-1.443000	0.02405	2.581000	0.87130	0.555000	0.69702	CGC	.		0.507	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170648797	170648797	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr5:170648797A>G	ENST00000523189.1	+	22	2539	c.2375A>G	c.(2374-2376)aAt>aGt	p.N792S	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	792					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCATCTCCTAATGGAATTCTT	0.328			T	TRD@	ALL																																p.N792S		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17-524	0			c.A2375G						.						99.0	96.0	97.0					5																	170648797		2202	4297	6499	SO:0001583	missense	64901	exon22			CTCCTAATGGAAT	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2375A>G	5.37:g.170648797A>G	ENSP00000427975:p.Asn792Ser	34	0		29	13	NM_022897	0	0	0	0	0	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.004581	0.54254	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.66099	-0.19	5.85	5.85	0.93711	Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	T	0.65616	0.2708	M	0.80616	2.505	0.40088	D	0.976216	P;P	0.37276	0.589;0.589	B;B	0.38020	0.263;0.263	T	0.67209	-0.5728	10	0.30854	T	0.27	-19.143	14.8066	0.69962	1.0:0.0:0.0:0.0	.	792;792	Q546R4;Q9H2T7	.;RBP17_HUMAN	S	792;222	ENSP00000427975:N792S	ENSP00000427975:N792S	N	+	2	0	RANBP17	170581402	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.951000	0.70273	2.238000	0.73509	0.533000	0.62120	AAT	.		0.328	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		5	5	NM_001145115	0	0	0	1	1		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
ATXN1	6310	hgsc.bcm.edu	37	6	16327900	16327900	+	Missense_Mutation	SNP	C	C	A	rs200111316		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr6:16327900C>A	ENST00000244769.4	-	8	1578	c.642G>T	c.(640-642)caG>caT	p.Q214H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q214H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	214	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgat	0.667																																					p.Q214H		.											.	ATXN1-93	0			c.G642T						.						4.0	8.0	7.0					6																	16327900		1667	3549	5216	SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.642G>T	6.37:g.16327900C>A	ENSP00000244769:p.Gln214His	14	0		52	9	NM_001128164	0	0	1	1	0	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	4.744	0.138290	0.09083	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.51325	0.71;0.71	.	.	.	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.18587	-1.0332	5	0.21014	T	0.42	.	.	.	.	.	214	P54253	ATX1_HUMAN	H	214	ENSP00000244769:Q214H;ENSP00000416360:Q214H	ENSP00000244769:Q214H	Q	-	3	2	ATXN1	16435879	0.001000	0.12720	0.011000	0.14972	0.070000	0.16714	-0.244000	0.08903	-2.096000	0.00852	-2.162000	0.00326	CAG	.		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
HLA-DQB1	3119	bcgsc.ca	37	6	32629129	32629129	+	Missense_Mutation	SNP	T	T	C	rs1130432	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr6:32629129T>C	ENST00000399084.1	-	5	945	c.767A>G	c.(766-768)cAg>cGg	p.Q256R	HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.Q256R|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.Q256R|HLA-DQB1_ENST00000460185.1_5'Flank|HLA-DQB1_ENST00000399082.3_Intron|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000399079.3_Intron|HLA-DQB1-AS1_ENST00000419852.1_RNA			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	256			Q -> R (in allele DQB1*05:01, allele DQB1*05:02 and allele DQB1*05:03; dbSNP:rs1130432).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	CTCACCTTTCTGACTCCTTTG	0.557									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				.|||	1335	0.266573	0.2723	0.1902	5008	,	,		12932	0.3204		0.2445	False		,,,				2504	0.2802				p.Q256R	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.A767G						.	T	ARG/GLN	946,3042		238,470,1286	28.0	25.0	26.0		767	3.6	0.9	6	dbSNP_86	26	1711,6421		446,819,2801	yes	missense	HLA-DQB1	NM_002123.4	43	684,1289,4087	CC,CT,TT		21.0403,23.7212,21.9224	benign	256/262	32629129	2657,9463	1994	4066	6060	SO:0001583	missense	3119	exon4	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	CCTTTCTGACTCC		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.767A>G	6.37:g.32629129T>C	ENSP00000382034:p.Gln256Arg	23	0		34	5	NM_002123	0	0	0	0	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399084.1	37	CCDS43451.1	417	0.19093406593406592	113	0.22967479674796748	63	0.17403314917127072	86	0.15034965034965034	155	0.20448548812664907	.	13.83	2.354500	0.41700	0.237212	0.210403	ENSG00000179344	ENST00000374943;ENST00000434651;ENST00000399084	T;T;T	0.00637	6.13;6.05;6.05	4.75	3.6	0.41247	.	0.567063	0.16716	N	0.202474	T	0.00384	0.0012	L	0.54965	1.715	0.39169	P	0.03744599999999998	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.10450	0.003;0.004;0.005	T	0.39702	-0.9601	9	0.87932	D	0	.	7.8247	0.29307	0.0:0.1:0.0:0.9	rs1130432;rs3189265;rs9273619;rs9273620;rs12722395;rs35107830	221;256;256	A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.	R	256	ENSP00000364080:Q256R;ENSP00000407332:Q256R;ENSP00000382034:Q256R	ENSP00000364080:Q256R	Q	-	2	0	HLA-DQB1	32737107	0.999000	0.42202	0.933000	0.37362	0.910000	0.53928	1.001000	0.29783	1.776000	0.52262	0.528000	0.53228	CAG	T|0.827;C|0.173		0.557	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1	NM_002123	
TMEM151B	441151	hgsc.bcm.edu	37	6	44243154	44243154	+	Silent	SNP	C	C	T	rs12194552	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr6:44243154C>T	ENST00000451188.2	+	3	868	c.591C>T	c.(589-591)cgC>cgT	p.R197R	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	197						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						ACCACGAACGCGTCAACACGC	0.726													C|||	140	0.0279553	0.0023	0.036	5008	,	,		12642	0.001		0.0825	False		,,,				2504	0.0286				p.R197R		.											.	.	0			c.C591T						.	C		17,1325		0,17,654	6.0	9.0	9.0		591	-2.1	1.0	6	dbSNP_120	9	223,2889		9,205,1342	no	coding-synonymous	TMEM151B	NM_001137560.1		9,222,1996	TT,TC,CC		7.1658,1.2668,5.3884		197/567	44243154	240,4214	671	1556	2227	SO:0001819	synonymous_variant	441151	exon3			CGAACGCGTCAAC	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.591C>T	6.37:g.44243154C>T		0	0		20	11	NM_001137560	0	0	0	0	0	Q5T9V7	Silent	SNP	ENST00000451188.2	37	CCDS47437.1																																																																																			C|0.967;T|0.033		0.726	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
UTRN	7402	ucsc.edu	37	6	145051594	145051594	+	Missense_Mutation	SNP	G	G	T	rs4305737	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr6:145051594G>T	ENST00000367545.3	+	53	7911	c.7911G>T	c.(7909-7911)gaG>gaT	p.E2637D	UTRN_ENST00000367526.4_Missense_Mutation_p.E192D	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2637					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CCCCTGAAGAGCCAAGAAGAA	0.443																																					p.E2637D		.											.	UTRN-95	0			c.G7911T						.						67.0	73.0	71.0					6																	145051594		2203	4300	6503	SO:0001583	missense	7402	exon53			TGAAGAGCCAAGA	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.7911G>T	6.37:g.145051594G>T	ENSP00000356515:p.Glu2637Asp	25	0		33	4	NM_007124	0	0	0	0	0	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.305719	0.23736	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.60299	0.2;3.46	5.11	2.72	0.32119	.	0.126886	0.35378	N	0.003255	T	0.20129	0.0484	N	0.25647	0.755	0.33236	P	0.44338599999999995	B	0.22414	0.069	B	0.20955	0.032	T	0.05289	-1.0894	9	0.24483	T	0.36	.	8.115	0.30937	0.6961:0.0:0.3039:0.0	.	2637	P46939	UTRO_HUMAN	D	2637;192	ENSP00000356515:E2637D;ENSP00000356496:E192D	ENSP00000356496:E192D	E	+	3	2	UTRN	145093287	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.168000	0.31859	0.379000	0.24794	-0.269000	0.10298	GAG	G|0.490;A|0.510		0.443	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
NOM1	64434	hgsc.bcm.edu	37	7	156742501	156742501	+	Missense_Mutation	SNP	C	C	G	rs6969990	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr7:156742501C>G	ENST00000275820.3	+	1	85	c.70C>G	c.(70-72)Cgc>Ggc	p.R24G		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	24	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.		R -> G (in dbSNP:rs6969990).			nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CCGCATGAAGCGCAGAggcgg	0.721													.|||	1013	0.202276	0.2042	0.2392	5008	,	,		7202	0.2778		0.1511	False		,,,				2504	0.1483				p.R24G		.											.	NOM1-90	0			c.C70G						.	C	GLY/ARG	460,2914		22,416,1249	3.0	4.0	3.0		70	4.4	0.0	7	dbSNP_116	3	715,6171		26,663,2754	no	missense	NOM1	NM_138400.1	125	48,1079,4003	GG,GC,CC		10.3834,13.6337,11.4522	probably-damaging	24/861	156742501	1175,9085	1687	3443	5130	SO:0001583	missense	64434	exon1			ATGAAGCGCAGAG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.70C>G	7.37:g.156742501C>G	ENSP00000275820:p.Arg24Gly	0	0		10	7	NM_138400	0	0	0	0	0	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	459	0.21016483516483517	100	0.2032520325203252	69	0.19060773480662985	164	0.2867132867132867	126	0.1662269129287599	C	17.33	3.362797	0.61403	0.136337	0.103834	ENSG00000146909	ENST00000275820	T	0.13307	2.6	4.36	4.36	0.52297	.	1.850510	0.03172	N	0.170899	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	9.99999999995449E-6	D	0.64830	0.994	P	0.54924	0.764	T	0.39603	-0.9606	9	0.87932	D	0	-1.3828	15.9395	0.79743	0.0:1.0:0.0:0.0	rs6969990;rs6969990	24	Q5C9Z4	NOM1_HUMAN	G	24	ENSP00000275820:R24G	ENSP00000275820:R24G	R	+	1	0	NOM1	156435262	0.939000	0.31865	0.023000	0.16930	0.179000	0.23085	3.589000	0.53972	1.979000	0.57680	0.306000	0.20318	CGC	C|0.663;G|0.337		0.721	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
SAMD12	401474	bcgsc.ca	37	8	119391791	119391791	+	Silent	SNP	T	T	C	rs5020517	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:119391791T>C	ENST00000314727.4	-	4	607	c.471A>G	c.(469-471)ctA>ctG	p.L157L	AC023590.1_ENST00000430457.1_Intron|SAMD12_ENST00000527515.1_Intron|SAMD12_ENST00000409003.4_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	157										endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CAGGAAGCAATAGGGTACCTT	0.468													C|||	3008	0.600639	0.8654	0.5259	5008	,	,		18611	0.3244		0.6938	False		,,,				2504	0.4847				p.L157L		.											.	SAMD12-227	0			c.A471G						.	C	,	3727,679	287.2+/-279.2	1574,579,50	149.0	135.0	140.0		,471	3.0	0.0	8	dbSNP_113	140	5913,2687	430.6+/-356.6	2006,1901,393	no	intron,coding-synonymous	SAMD12	NM_001101676.1,NM_207506.2	,	3580,2480,443	CC,CT,TT		31.2442,15.4108,25.8804	,	,157/202	119391791	9640,3366	2203	4300	6503	SO:0001819	synonymous_variant	401474	exon4			AAGCAATAGGGTA	AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.471A>G	8.37:g.119391791T>C		96	0		136	6	NM_207506	0	0	0	0	0	Q0P502	Silent	SNP	ENST00000314727.4	37	CCDS6325.1																																																																																			T|0.303;C|0.697		0.468	SAMD12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132989.3	NM_207506	
TSNARE1	203062	bcgsc.ca	37	8	143413136	143413136	+	Missense_Mutation	SNP	C	C	T	rs10435683	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:143413136C>T	ENST00000307180.3	-	5	919	c.802G>A	c.(802-804)Gtc>Atc	p.V268I	TSNARE1_ENST00000520166.1_Missense_Mutation_p.V268I|TSNARE1_ENST00000519651.1_Missense_Mutation_p.V49I|TSNARE1_ENST00000524325.1_Missense_Mutation_p.V268I	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	268			V -> I (in dbSNP:rs10435683).		intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.V268I(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATTCGGAAGACGTTGGCCGAC	0.612													C|||	2160	0.43131	0.5401	0.4424	5008	,	,		19919	0.4742		0.3231	False		,,,				2504	0.3436				p.V268I		.											.	TSNARE1-90	1	Substitution - Missense(1)	stomach(1)	c.G802A						.	C	ILE/VAL	2224,2180		567,1090,545	177.0	123.0	141.0		802	2.4	0.0	8	dbSNP_119	141	2772,5828		443,1886,1971	yes	missense	TSNARE1	NM_145003.3	29	1010,2976,2516	TT,TC,CC		32.2326,49.5005,38.4189	benign	268/514	143413136	4996,8008	2202	4300	6502	SO:0001583	missense	203062	exon5			GGAAGACGTTGGC			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.802G>A	8.37:g.143413136C>T	ENSP00000303437:p.Val268Ile	154	1		159	6	NM_145003	0	0	0	0	0	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	810	0.3708791208791209	194	0.3943089430894309	137	0.3784530386740331	269	0.47027972027972026	210	0.2770448548812665	C	3.809	-0.040197	0.07497	0.504995	0.322326	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	4.23	2.41	0.29592	t-SNARE (1);	0.261153	0.19294	N	0.117812	T	0.00012	0.0000	N	0.17474	0.49	0.52099	P	5.100000000002325E-5	B;B;B;B	0.20671	0.046;0.047;0.046;0.046	B;B;B;B	0.15484	0.013;0.003;0.013;0.013	T	0.46233	-0.9206	9	0.07030	T	0.85	-14.6583	6.5544	0.22452	0.0:0.7704:0.0:0.2296	rs10435683;rs13271812;rs59659999;rs10435683	268;49;268;268	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	I	268;268;268;49	ENSP00000428763:V268I;ENSP00000303437:V268I;ENSP00000427770:V268I;ENSP00000429679:V49I	ENSP00000303437:V268I	V	-	1	0	TSNARE1	143411043	0.273000	0.24181	0.041000	0.18516	0.846000	0.48090	0.430000	0.21428	0.257000	0.21650	0.655000	0.94253	GTC	C|0.606;T|0.394		0.612	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		4	4	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144990528	144990528	+	Silent	SNP	A	A	G	rs7014582	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:144990528A>G	ENST00000322810.4	-	32	14041	c.13872T>C	c.(13870-13872)gcT>gcC	p.A4624A	PLEC_ENST00000398774.2_Silent_p.A4455A|PLEC_ENST00000354589.3_Silent_p.A4487A|PLEC_ENST00000436759.2_Silent_p.A4514A|PLEC_ENST00000357649.2_Silent_p.A4491A|PLEC_ENST00000345136.3_Silent_p.A4487A|PLEC_ENST00000527096.1_Silent_p.A4510A|PLEC_ENST00000354958.2_Silent_p.A4465A|PLEC_ENST00000356346.3_Silent_p.A4473A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4624	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGGGAGCCAGCGGTAGAGC	0.716													G|||	2389	0.477037	0.8979	0.3746	5008	,	,		8857	0.1508		0.4404	False		,,,				2504	0.3548				p.A4624A		.											.	PLEC-141	0			c.T13872C						.	G	,,,,,,,	2833,621		1197,439,91	12.0	16.0	15.0		13542,13419,13395,13872,13365,13461,13473,13461	-8.1	0.0	8	dbSNP_116	15	3324,4610		785,1754,1428	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	1982,2193,1519	GG,GA,AA		41.8956,17.9792,45.9343	,,,,,,,	4514/4575,4473/4534,4465/4526,4624/4685,4455/4516,4487/4548,4491/4552,4487/4548	144990528	6157,5231	1727	3967	5694	SO:0001819	synonymous_variant	5339	exon32			GGAGCCAGCGGTA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13872T>C	8.37:g.144990528A>G		1	0		11	6	NM_201380	0	0	6	7	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.536;G|0.464		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000354589.3_Silent_p.A1560A|PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000356346.3_Silent_p.A1546A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		3	0		7	4	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
OPLAH	26873	hgsc.bcm.edu	37	8	145107390	145107390	+	Missense_Mutation	SNP	C	C	T	rs185836803	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr8:145107390C>T	ENST00000426825.1	-	23	3346	c.3265G>A	c.(3265-3267)Gtc>Atc	p.V1089I	CTD-3065J16.6_ENST00000561181.1_RNA|CTD-3065J16.6_ENST00000528912.1_RNA|OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1089				QRVVDV -> NAWWMF (in Ref. 4; AAB81519). {ECO:0000305}.	glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCAGGATGACATCCACCACG	0.746													C|||	20	0.00399361	0.0008	0.0101	5008	,	,		10202	0.0		0.0109	False		,,,				2504	0.001				p.V1089I		.											.	OPLAH-68	0			c.G3265A						.	C	ILE/VAL	6,3568		0,6,1781	4.0	5.0	5.0		3265	4.4	1.0	8		5	61,7691		0,61,3815	no	missense	OPLAH	NM_017570.3	29	0,67,5596	TT,TC,CC		0.7869,0.1679,0.5916	probably-damaging	1089/1289	145107390	67,11259	1787	3876	5663	SO:0001583	missense	26873	exon23			GGATGACATCCAC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.3265G>A	8.37:g.145107390C>T	ENSP00000475943:p.Val1089Ile	0	0		19	11	NM_017570	0	0	4	13	9	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	0	0.0	2	0.002638522427440633	C	14.93	2.683579	0.47991	0.001679	0.007869	ENSG00000178814	ENST00000426825	.	.	.	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.70675	0.3251	.	.	.	0.35089	D	0.764157	D	0.61697	0.99	D	0.66497	0.944	T	0.80462	-0.1372	7	0.56958	D	0.05	.	14.8924	0.70620	0.0:1.0:0.0:0.0	.	1089	O14841	OPLA_HUMAN	I	1089	.	ENSP00000412071:V1089I	V	-	1	0	OPLAH	145179378	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.973000	0.63763	2.164000	0.68074	0.643000	0.83706	GTC	C|0.998;T|0.002		0.746	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
NACC2	138151	hgsc.bcm.edu	37	9	138903545	138903545	+	Silent	SNP	G	G	A	rs79175912	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr9:138903545G>A	ENST00000371753.1	-	5	1639	c.1581C>T	c.(1579-1581)gaC>gaT	p.D527D	NACC2_ENST00000277554.2_Silent_p.D527D			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	527					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						CCTCGCCGGCGTCGAAGGCGG	0.721													G|||	14	0.00279553	0.0008	0.0014	5008	,	,		9266	0.0		0.008	False		,,,				2504	0.0041				p.D527D		.											.	NACC2-90	0			c.C1581T						.	G		7,4195		0,7,2094	6.0	7.0	6.0		1581	-7.4	0.0	9	dbSNP_131	6	80,8220		0,80,4070	no	coding-synonymous	NACC2	NM_144653.4		0,87,6164	AA,AG,GG		0.9639,0.1666,0.6959		527/588	138903545	87,12415	2101	4150	6251	SO:0001819	synonymous_variant	138151	exon6			GCCGGCGTCGAAG	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1581C>T	9.37:g.138903545G>A		3	0		25	14	NM_144653	0	0	0	0	0		Silent	SNP	ENST00000371753.1	37	CCDS6993.1																																																																																			G|0.999;A|0.001		0.721	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055040.1	NM_144653	
GPSM1	26086	broad.mit.edu;bcgsc.ca	37	9	139235606	139235606	+	Intron	SNP	G	G	C	rs78403475	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr9:139235606G>C	ENST00000440944.1	+	9	1427				GPSM1_ENST00000392945.3_Missense_Mutation_p.A455P	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CTCAGGGACAGCACAGGCCTG	0.657													G|||	467	0.0932508	0.0567	0.1009	5008	,	,		16606	0.1508		0.0805	False		,,,				2504	0.091				p.A455P		.											.	GPSM1-90	0			c.G1363C						.						15.0	19.0	18.0					9																	139235606		691	1590	2281	SO:0001627	intron_variant	26086	exon9			GGGACAGCACAGG	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1207+156G>C	9.37:g.139235606G>C		120	0		180	7	NM_015597	0	0	0	0	0	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	37	CCDS48055.1	217	0.09935897435897435	35	0.07113821138211382	31	0.0856353591160221	86	0.15034965034965034	65	0.08575197889182058	G	4.405	0.074756	0.08485	.	.	ENSG00000160360	ENST00000392945	D	0.91996	-2.95	1.44	0.511	0.16989	.	.	.	.	.	T	0.01940	0.0061	.	.	.	0.80722	P	0.0	P	0.34977	0.478	B	0.21151	0.033	T	0.48364	-0.9042	7	0.87932	D	0	.	3.8124	0.08802	0.2453:0.0:0.7547:0.0	.	455	Q86YR5-3	.	P	455	ENSP00000376674:A455P	ENSP00000376674:A455P	A	+	1	0	GPSM1	138355427	0.000000	0.05858	0.003000	0.11579	0.016000	0.09150	-0.389000	0.07342	0.176000	0.19873	-0.379000	0.06801	GCA	G|0.900;C|0.100		0.657	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
FBXW5	54461	broad.mit.edu	37	9	139837138	139837138	+	Missense_Mutation	SNP	G	G	A	rs148935719	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr9:139837138G>A	ENST00000325285.3	-	5	615	c.536C>T	c.(535-537)gCg>gTg	p.A179V	FBXW5_ENST00000483559.1_5'UTR|C8G_ENST00000224181.3_5'Flank	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	179					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGACAGCAGCGCGAAGGAGTC	0.662													G|||	6	0.00119808	0.003	0.0014	5008	,	,		14684	0.001		0.0	False		,,,				2504	0.0				p.A179V		.											.	FBXW5-226	0			c.C536T						.	G	VAL/ALA	1,4381		0,1,2190	30.0	25.0	27.0		536	0.2	0.2	9	dbSNP_134	27	17,8571		0,17,4277	yes	missense	FBXW5	NM_018998.2	64	0,18,6467	AA,AG,GG		0.198,0.0228,0.1388	benign	179/567	139837138	18,12952	2191	4294	6485	SO:0001583	missense	54461	exon5			AGCAGCGCGAAGG	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.536C>T	9.37:g.139837138G>A	ENSP00000313034:p.Ala179Val	49	3		125	5	NM_018998	0	0	0	0	0	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	ENST00000325285.3	37	CCDS7014.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566123	0.27915	2.28E-4	0.00198	ENSG00000159069	ENST00000325285;ENST00000433269;ENST00000428398	T;T;T	0.65732	-0.17;0.91;1.56	4.14	0.22	0.15279	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);	0.374308	0.30584	N	0.009314	T	0.35566	0.0936	L	0.38531	1.155	0.20489	N	0.999894	P	0.44659	0.84	B	0.28385	0.089	T	0.32134	-0.9918	10	0.29301	T	0.29	-18.614	4.0953	0.09988	0.3496:0.0:0.4982:0.1522	.	179	Q969U6	FBXW5_HUMAN	V	179;14;189	ENSP00000313034:A179V;ENSP00000409102:A14V;ENSP00000404829:A189V	ENSP00000313034:A179V	A	-	2	0	FBXW5	138956959	0.895000	0.30542	0.185000	0.23176	0.814000	0.46013	2.511000	0.45476	-0.147000	0.11254	-0.258000	0.10820	GCG	G|0.998;A|0.002		0.662	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	NM_018998	
PCSK1N	27344	hgsc.bcm.edu	37	X	48690749	48690749	+	Silent	SNP	C	C	T	rs11538178		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chrX:48690749C>T	ENST00000218230.5	-	2	217	c.117G>A	c.(115-117)gaG>gaA	p.E39E	PCSK1N_ENST00000478242.1_5'UTR	NM_013271.2	NP_037403.1	Q9UHG2	PCSK1_HUMAN	proprotein convertase subtilisin/kexin type 1 inhibitor	39	ProSAAS(1-180). {ECO:0000250}.				neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)	endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)										GGCCGCGGGGCTCCTGCGGGA	0.682													c|||	1198	0.317351	0.5234	0.0807	3775	,	,		6872	0.1151		0.0666	False		,,,				2504	0.273				p.E39E		.											.	PCSK1N-130	0			c.G117A						.			1039,1413		118,601,202,343,126	2.0	2.0	2.0		117	0.3	0.9	X	dbSNP_120	2	346,4094		11,224,100,1486,898	yes	coding-synonymous	PCSK1N	NM_013271.2		129,825,302,1829,1024	TT,TC,T,CC,C		7.7928,42.3736,20.0958		39/261	48690749	1385,5507	1390	2719	4109	SO:0001819	synonymous_variant	27344	exon2			GCGGGGCTCCTGC	AF181562	CCDS14307.1	Xp11.23	2008-07-28			ENSG00000102109	ENSG00000102109			17301	protein-coding gene	gene with protein product		300399				10632593	Standard	NM_013271		Approved	SAAS	uc004dkz.4	Q9UHG2	OTTHUMG00000034502	ENST00000218230.5:c.117G>A	X.37:g.48690749C>T		2	0		18	8	NM_013271	0	0	0	0	0	Q4VC04	Silent	SNP	ENST00000218230.5	37	CCDS14307.1																																																																																			C|0.762;T|0.238		0.682	PCSK1N-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083444.1	NM_013271	
SERPINA7	6906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	105277575	105277575	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chrX:105277575A>T	ENST00000327674.4	-	4	1499	c.1164T>A	c.(1162-1164)gaT>gaA	p.D388E	SERPINA7_ENST00000372563.1_Missense_Mutation_p.D388E|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	388					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TGAAAGATCTATCAATTTGGA	0.428																																					p.D388E		.											.	SERPINA7-226	0			c.T1164A						.						215.0	215.0	215.0					X																	105277575		2203	4300	6503	SO:0001583	missense	6906	exon5			AGATCTATCAATT	M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.1164T>A	X.37:g.105277575A>T	ENSP00000329374:p.Asp388Glu	233	0		230	99	NM_000354	0	0	0	0	0	D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	A	14.37	2.514560	0.44763	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.88975	-2.45;-2.45	4.9	2.31	0.28768	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.231301	0.35970	N	0.002866	D	0.88948	0.6576	M	0.88979	2.995	0.22866	N	0.998638	B	0.25850	0.136	B	0.27500	0.08	D	0.83420	0.0032	10	0.87932	D	0	.	7.9161	0.29818	0.6746:0.0:0.0:0.3254	.	388	P05543	THBG_HUMAN	E	388	ENSP00000329374:D388E;ENSP00000361644:D388E	ENSP00000329374:D388E	D	-	3	2	SERPINA7	105164231	0.607000	0.26958	0.174000	0.22961	0.012000	0.07955	1.042000	0.30303	0.777000	0.33496	0.481000	0.45027	GAT	.		0.428	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354	
C14orf23	387978	broad.mit.edu	37	14	29261305	29261306	+	In_Frame_Ins	INS	-	-	AAC	rs202195469|rs200251419|rs565026588	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:29261305_29261306insAAC	ENST00000399387.4	+	3	446_447	c.342_343insAAC	c.(343-345)aaa>AACaaa	p.114_115insN	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAAA	0.376																																					.		.											.	C14orf23-23	0			.						.																																			SO:0001652	inframe_insertion	387978	.			AGCACTAAAAAAA			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	Exception_encountered	14.37:g.29261305_29261306insAAC	ENSP00000382318:p.Leu114_Lys115insAsn	78	0		65	19	.	0	0	0	0	0		RNA	INS	ENST00000399387.4	37																																																																																				-|0.667;AAC|0.333		0.376	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
AMN	81693	hgsc.bcm.edu;broad.mit.edu	37	14	103396993	103396994	+	In_Frame_Ins	INS	-	-	GCCGGG	rs58093397|rs36040113	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr14:103396993_103396994insGCCGGG	ENST00000299155.5	+	12	1371_1372	c.1338_1339insGCCGGG	c.(1339-1341)gcc>GCCGGGgcc	p.447_447A>AGA	RP11-365N19.2_ENST00000560931.1_RNA	NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	447					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCCTCTGTTCGCCGGGGCCGA	0.713														70	0.0139776	0.0408	0.0115	5008	,	,		11705	0.0		0.005	False		,,,				2504	0.0031				p.F446delinsFAG		.											.	AMN-90	0			c.1338_1339insGCCGGG						.			123,4009		8,107,1951						-4.1	0.0		dbSNP_126	12	51,8009		3,45,3982	no	coding	AMN	NM_030943.3		11,152,5933	A1A1,A1R,RR		0.6328,2.9768,1.4272				174,12018				SO:0001652	inframe_insertion	81693	exon12			TCTGTTCGCCGGG	AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.1339_1344dupGCCGGG	14.37:g.103396994_103396999dupGCCGGG	Exception_encountered	10	0		76	14	NM_030943	0	0	0	0	0	Q6UX83	In_Frame_Ins	INS	ENST00000299155.5	37	CCDS9977.1																																																																																			-|1.000;|0.000		0.713	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415704.1		
SPIRE2	84501	broad.mit.edu	37	16	89916879	89916880	+	In_Frame_Ins	INS	-	-	GAG	rs146569219|rs377330880	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:89916879_89916880insGAG	ENST00000378247.3	+	3	499_500	c.456_457insGAG	c.(457-459)gag>GAGgag	p.153_153E>EE	SPIRE2_ENST00000393062.2_In_Frame_Ins_p.153_153E>EE|SPIRE2_ENST00000564878.1_3'UTR	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	153	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		ACGGGGGTCCCGAGGAGGAGGA	0.728														371	0.0740815	0.0038	0.0245	5008	,	,		12494	0.2679		0.0606	False		,,,				2504	0.0184				p.P152delinsPE		.											.	SPIRE2-90	0			c.456_457insGAG						.																																			SO:0001652	inframe_insertion	84501	exon3			GGGTCCCGAGGAG	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.469_471dupGAG	16.37:g.89916886_89916888dupGAG	ENSP00000367494:p.Glu157dup	4	0		52	16	NM_032451	0	0	0	0	0	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	In_Frame_Ins	INS	ENST00000378247.3	37	CCDS32516.1																																																																																			-|0.923;GAG|0.077		0.728	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
ULK2	9706	hgsc.bcm.edu	37	17	19770717	19770718	+	In_Frame_Ins	INS	-	-	CCA			TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr17:19770717_19770718insCCA	ENST00000395544.4	-	1	512_513	c.13_14insTGG	c.(13-15)ggt>gTGGgt	p.4_5insV	ULK2_ENST00000361658.2_In_Frame_Ins_p.4_5insV	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	4					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CTCGAAGTCACCCACCACCTCC	0.767																																					p.G5delinsVG		.											.	ULK2-334	0			c.14_15insTGG						.																																			SO:0001652	inframe_insertion	9706	exon1			AAGTCACCCACCA	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.11_13dupTGG	17.37:g.19770721_19770723dupCCA	ENSP00000378914:p.Val4_Val4dup	8	2		43	13	NM_014683	0	0	0	0	0	A8MY69|O75119	In_Frame_Ins	INS	ENST00000395544.4	37	CCDS11213.1																																																																																			.		0.767	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	In_Frame_Ins	INS	-	-	TGGCAGCAGCTGGGG	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr17:39305774_39305775insTGGCAGCAGCTGGGG	ENST00000343246.4	-	1	279_280	c.245_246insCCCCAGCTGCTGCCA	c.(244-246)cag>caCCCCAGCTGCTGCCAg	p.81_82insHPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82delinsHPSCCQ		.											.	KRTAP4-5-90	1	Substitution - Missense(1)	lung(1)	c.246_247insCCCCAGCTGCTGCCA						.																																			SO:0001652	inframe_insertion	85289	exon1			GGTGGTCTGGCAG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246insCCCCAGCTGCTGCCA	17.37:g.39305774_39305775insTGGCAGCAGCTGGGG	ENSP00000340546:p.Cys81_Gln82insHisProSerCysCys	11	0		75	59	NM_033188	0	0	0	0	0		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
C21orf58	54058	hgsc.bcm.edu;broad.mit.edu	37	21	47721985	47721986	+	In_Frame_Ins	INS	-	-	TGGTGG	rs144178764|rs112899928|rs35902237|rs71318063	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr21:47721985_47721986insTGGTGG	ENST00000291691.7	-	8	2032_2033	c.896_897insCCACCA	c.(895-897)cat>caCCACCAt	p.299_299H>HHH	C21orf58_ENST00000397682.3_In_Frame_Ins_p.193_193H>HHH|C21orf58_ENST00000397680.1_In_Frame_Ins_p.193_193H>HHH|C21orf58_ENST00000397679.1_In_Frame_Ins_p.193_193H>HHH|C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397683.1_In_Frame_Ins_p.193_193H>HHH	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	299	Poly-His.							p.H299_A300insH(3)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		GCCACACAGCAtggtggtggtg	0.708																																					p.H299delinsHHH		.											.	C21orf58-91	3	Insertion - In frame(3)	breast(2)|central_nervous_system(1)	c.897_898insCCACCA						.																																			SO:0001652	inframe_insertion	54058	exon8			CACAGCATGGTGG		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.891_896dupCCACCA	21.37:g.47721986_47721991dupTGGTGG	ENSP00000291691:p.HisHis299dup	6	0		57	8	NM_058180	0	0	0	0	0	B3KPI1	In_Frame_Ins	INS	ENST00000291691.7	37	CCDS13735.1																																																																																			-|0.500;TGG|0.500		0.708	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
ZNF717	100131827	broad.mit.edu	37	3	75790810	75790811	+	Frame_Shift_Ins	INS	-	-	T	rs199577560	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr3:75790810_75790811insT	ENST00000477374.1	-	3	305_306	c.134_135insA	c.(133-135)accfs	p.T45fs	ZNF717_ENST00000400845.3_Frame_Shift_Ins_p.T38fs|ZNF717_ENST00000422325.1_Frame_Shift_Ins_p.T45fs|ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000478296.1_5'UTR			Q9BY31	ZN717_HUMAN	zinc finger protein 717	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						CCCTGTACAGGGTCCTCTGAGC	0.51																																					p.T45fs		.											.	.	0			c.135_136insA						.																																			SO:0001589	frameshift_variant	100131827	exon3			GTACAGGGTCCTC	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000477374.1:c.134_135insA	3.37:g.75790810_75790811insT	ENSP00000417902:p.Thr45fs	116	0		154	14	NM_001128223	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000477374.1	37																																																																																				.		0.510	ZNF717-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000352767.1	NM_001128223	
NOTCH1	4851	broad.mit.edu	37	9	139417461	139417462	+	Frame_Shift_Ins	INS	-	-	G	rs146350322		TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr9:139417461_139417462insG	ENST00000277541.6	-	4	657_658	c.582_583insC	c.(580-585)acctgcfs	p.C195fs	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	195	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGTTGTGGCAGGTGCCTCCGT	0.698			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.C195fs		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.583_584insC						.																																			SO:0001589	frameshift_variant	4851	exon4			TGTGGCAGGTGCC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.583dupC	9.37:g.139417463_139417463dupG	ENSP00000277541:p.Cys195fs	12	0		106	8	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Frame_Shift_Ins	INS	ENST00000277541.6	37	CCDS43905.1																																																																																			.		0.698	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
GAS8	2622	bcgsc.ca	37	16	90095596	90095597	+	Intron	DNP	AT	AT	GC	rs61118444|rs55742939|rs71137702	byFrequency	TCGA-OR-A5L3-01A-11D-A29I-10	TCGA-OR-A5L3-10A-01D-A29L-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	20de8d93-d3ca-4127-a242-4b4883523118	4a788687-ee2a-41b7-809d-410076aa453b	g.chr16:90095596_90095597AT>GC	ENST00000268699.4	+	2	212				GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.I52A|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctatggggcagcct	0.663																																					p.I52A		.											.	C16orf3-90	0			c.A154G						.																																			SO:0001627	intron_variant	750	exon1			AGGCTATGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	Exception_encountered	16.37:g.90095596_90095597delinsGC		27	0		60	0	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	DNP	ENST00000268699.4	37	CCDS10992.1																																																																																			T|0.361;C|0.639		0.663	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
