#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VWA5B1	127731	bcgsc.ca	37	1	20640906	20640906	+	Silent	SNP	C	C	T	rs61741263	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:20640906C>T	ENST00000375079.2	+	4	580	c.384C>T	c.(382-384)ttC>ttT	p.F128F	VWA5B1_ENST00000289815.8_Silent_p.F128F|RP4-745E8.2_ENST00000444923.1_RNA|VWA5B1_ENST00000289825.4_5'UTR|VWA5B1_ENST00000375083.4_Silent_p.F128F	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	128	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						GGATCCTGTTCGTGGCCAACC	0.597													C|||	45	0.00898562	0.0008	0.0245	5008	,	,		19180	0.0		0.0209	False		,,,				2504	0.0061				p.F128F		.											.	.	0			c.C384T						.	C		7,1377		0,7,685	92.0	88.0	89.0		384	-3.0	1.0	1	dbSNP_129	89	56,3126		0,56,1535	no	coding-synonymous	VWA5B1	NM_001039500.2		0,63,2220	TT,TC,CC		1.7599,0.5058,1.3798		128/1216	20640906	63,4503	692	1591	2283	SO:0001819	synonymous_variant	127731	exon4			CCTGTTCGTGGCC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.384C>T	1.37:g.20640906C>T		208	1		127	5	NM_001039500	0	0	0	0	0	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Silent	SNP	ENST00000375079.2	37																																																																																				C|0.987;T|0.013		0.597	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
MATN1	4146	bcgsc.ca	37	1	31188089	31188089	+	Silent	SNP	C	C	T	rs1065755	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:31188089C>T	ENST00000373765.4	-	6	1310	c.1275G>A	c.(1273-1275)gaG>gaA	p.E425E	MATN1_ENST00000477320.1_5'Flank	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	425	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCACAGGCTCTGAGGCTA	0.532													C|||	1440	0.28754	0.2564	0.4121	5008	,	,		22606	0.1835		0.3638	False		,,,				2504	0.2699				p.E425E		.											.	MATN1-90	0			c.G1275A						.	C		1282,3124	436.4+/-344.6	173,936,1094	224.0	184.0	198.0		1275	-0.2	0.9	1	dbSNP_86	198	2922,5678	455.2+/-363.7	504,1914,1882	no	coding-synonymous	MATN1	NM_002379.3		677,2850,2976	TT,TC,CC		33.9767,29.0967,32.3235		425/497	31188089	4204,8802	2203	4300	6503	SO:0001819	synonymous_variant	4146	exon6			CACAGGCTCTGAG	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.1275G>A	1.37:g.31188089C>T		174	0		111	7	NM_002379	0	0	0	0	0	B2R7E3|Q5TBB9	Silent	SNP	ENST00000373765.4	37	CCDS336.1																																																																																			C|0.696;T|0.304		0.532	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010458.1	NM_002379	
HIAT1	64645	broad.mit.edu	37	1	100527445	100527445	+	Silent	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:100527445G>T	ENST00000370152.3	+	5	562	c.426G>T	c.(424-426)gtG>gtT	p.V142V	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	142				V -> M (in Ref. 1; BAB71375). {ECO:0000305}.	transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		CTTTTTCTGTGGTATTTGCAT	0.368																																					p.V142V		.											.	HIAT1-90	0			c.G426T						.						213.0	195.0	201.0					1																	100527445		2203	4300	6503	SO:0001819	synonymous_variant	64645	exon5			TTCTGTGGTATTT	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.426G>T	1.37:g.100527445G>T		115	0		90	4	NM_033055	0	0	30	31	1	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Silent	SNP	ENST00000370152.3	37	CCDS763.1	.	.	.	.	.	.	.	.	.	.	G	9.027	0.986303	0.18889	.	.	ENSG00000156875	ENST00000421661	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.52224	0.1721	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52675	-0.8544	4	.	.	.	-54.1801	11.0277	0.47755	0.1438:0.0:0.8562:0.0	.	.	.	.	C	81	.	.	G	+	1	0	HIAT1	100300033	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.205000	0.42770	2.631000	0.89168	0.650000	0.86243	GGT	.		0.368	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055	
LAMC1	3915	bcgsc.ca	37	1	183072590	183072590	+	Silent	SNP	T	T	C	rs2296288	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:183072590T>C	ENST00000258341.4	+	2	803	c.546T>C	c.(544-546)tgT>tgC	p.C182C		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	182	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GTGGTTCCTGTGAGAACACCT	0.552													C|||	2664	0.531949	0.3321	0.6268	5008	,	,		19406	0.628		0.5646	False		,,,				2504	0.6022				p.C182C		.											.	LAMC1-252	0			c.T546C						.	C		1657,2749	658.8+/-400.5	337,983,883	88.0	81.0	83.0		546	-3.3	1.0	1	dbSNP_100	83	4913,3687	528.5+/-381.4	1352,2209,739	no	coding-synonymous	LAMC1	NM_002293.3		1689,3192,1622	CC,CT,TT		42.8721,37.6078,49.4849		182/1610	183072590	6570,6436	2203	4300	6503	SO:0001819	synonymous_variant	3915	exon2			TTCCTGTGAGAAC	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.546T>C	1.37:g.183072590T>C		362	0		208	7	NM_002293	0	0	11	11	0	Q5VYE7	Silent	SNP	ENST00000258341.4	37	CCDS1351.1																																																																																			T|0.486;C|0.514		0.552	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
CRB1	23418	broad.mit.edu	37	1	197298083	197298083	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:197298083G>T	ENST00000367400.3	+	2	737	c.602G>T	c.(601-603)tGc>tTc	p.C201F	CRB1_ENST00000535699.1_Missense_Mutation_p.C132F|CRB1_ENST00000367399.2_Missense_Mutation_p.C201F|CRB1_ENST00000538660.1_Missense_Mutation_p.C201F	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	201	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GAGGCTACATGCCTCAATGAA	0.433																																					p.C201F		.											.	CRB1-161	0			c.G602T						.						68.0	61.0	63.0					1																	197298083		2203	4300	6503	SO:0001583	missense	23418	exon2			CTACATGCCTCAA		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.602G>T	1.37:g.197298083G>T	ENSP00000356370:p.Cys201Phe	89	1		69	3	NM_201253	0	0	0	0	0	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418763	0.42918	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399	D;D;D;D	0.99992	-12.4;-12.4;-12.4;-12.4	5.53	4.62	0.57501	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99994	0.9999	H	0.98721	4.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.958;0.999;0.999	D	0.99990	1.4100	9	0.87932	D	0	.	14.4173	0.67158	0.071:0.0:0.929:0.0	.	201;132;201;201;226	B7Z5T2;F5H0L2;P82279-3;P82279;Q59H36	.;.;.;CRUM1_HUMAN;.	F	132;201;201;201	ENSP00000438786:C132F;ENSP00000438091:C201F;ENSP00000356370:C201F;ENSP00000356369:C201F	ENSP00000356369:C201F	C	+	2	0	CRB1	195564706	1.000000	0.71417	0.859000	0.33776	0.008000	0.06430	7.485000	0.81204	1.455000	0.47813	0.655000	0.94253	TGC	.		0.433	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
KCTD3	51133	hgsc.bcm.edu	37	1	215741053	215741053	+	Missense_Mutation	SNP	T	T	G	rs2275768	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:215741053T>G	ENST00000259154.4	+	1	319	c.25T>G	c.(25-27)Ttc>Gtc	p.F9V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	9			F -> V (in dbSNP:rs2275768). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTGCGGCAGCTTCCCCGCGGC	0.761													T|||	1459	0.291334	0.0605	0.2291	5008	,	,		8959	0.4276		0.2853	False		,,,				2504	0.5133				p.F9V		.											.	KCTD3-93	0			c.T25G						.	T	VAL/PHE	232,2814		17,198,1308	3.0	5.0	5.0		25	1.6	0.8	1	dbSNP_100	5	1189,4951		136,917,2017	no	missense	KCTD3	NM_016121.3	50	153,1115,3325	GG,GT,TT		19.3648,7.6165,15.4692	benign	9/816	215741053	1421,7765	1523	3070	4593	SO:0001583	missense	51133	exon1			GGCAGCTTCCCCG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.25T>G	1.37:g.215741053T>G	ENSP00000259154:p.Phe9Val	4	0		9	8	NM_016121	0	0	0	17	17	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	595	0.2724358974358974	34	0.06910569105691057	93	0.2569060773480663	249	0.4353146853146853	219	0.28891820580474936	T	10.24	1.294537	0.23564	0.076165	0.193648	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.36520	1.25	2.8	1.63	0.23807	.	0.611401	0.14267	U	0.330439	T	0.00012	0.0000	L	0.27053	0.805	0.50813	P	1.0900000000002574E-4	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.001	T	0.48115	-0.9063	9	0.23891	T	0.37	-7.5445	6.7109	0.23276	0.0:0.2267:0.0:0.7733	rs2275768;rs17845401;rs17858259	9;9	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	9	ENSP00000259154:F9V	ENSP00000259154:F9V	F	+	1	0	KCTD3	213807676	0.045000	0.20229	0.833000	0.33012	0.447000	0.32167	0.628000	0.24522	0.293000	0.22520	0.254000	0.18369	TTC	T|0.721;G|0.279		0.761	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
OR2T34	127068	ucsc.edu	37	1	248737734	248737734	+	Missense_Mutation	SNP	G	G	A	rs139616012		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr1:248737734G>A	ENST00000328782.2	-	1	346	c.325C>T	c.(325-327)Cac>Tac	p.H109Y		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGGTCAGGTGGAAGAACATC	0.542																																					p.H109Y		.											.	OR2T34-69	0			c.C325T						.						120.0	109.0	112.0					1																	248737734		2163	4276	6439	SO:0001583	missense	127068	exon1			TCAGGTGGAAGAA	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.325C>T	1.37:g.248737734G>A	ENSP00000330904:p.His109Tyr	278	2		33	9	NM_001001821	0	0	0	0	0	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	296	0.13553113553113552	69	0.1402439024390244	61	0.1685082872928177	71	0.12412587412587413	95	0.12532981530343007	.	0.011	-1.710055	0.00712	.	.	ENSG00000183310	ENST00000328782	T	0.01304	5.03	2.34	-0.481	0.12082	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.00109	-2.105	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38908	-0.9639	8	0.02654	T	1	.	4.2299	0.10597	0.597:0.1723:0.2307:0.0	.	109	Q8NGX1	O2T34_HUMAN	Y	109	ENSP00000330904:H109Y	ENSP00000330904:H109Y	H	-	1	0	OR2T34	246804357	0.001000	0.12720	0.040000	0.18447	0.392000	0.30506	0.697000	0.25556	-0.366000	0.08064	-1.344000	0.01245	CAC	.		0.542	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
SFMBT2	57713	hgsc.bcm.edu	37	10	7213977	7213977	+	Silent	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr10:7213977G>A	ENST00000361972.4	-	19	2385	c.2295C>T	c.(2293-2295)agC>agT	p.S765S	SFMBT2_ENST00000397167.1_Silent_p.S765S	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	765					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GCTCTGAGCCGCTCCGCAGGG	0.751																																					p.S765S		.											.	SFMBT2-141	0			c.C2295T						.																																			SO:0001819	synonymous_variant	57713	exon19			TGAGCCGCTCCGC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2295C>T	10.37:g.7213977G>A		0	0		19	6	NM_001029880	0	0	2	2	0	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	37	CCDS31138.1																																																																																			.		0.751	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
TECTB	6975	broad.mit.edu	37	10	114053512	114053512	+	Missense_Mutation	SNP	T	T	A	rs41296127	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr10:114053512T>A	ENST00000369422.3	+	5	500	c.500T>A	c.(499-501)aTc>aAc	p.I167N		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	167	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		AAGTTCTCCATCAAGAAAGAA	0.463													T|||	3	0.000599042	0.0	0.0014	5008	,	,		20324	0.0		0.001	False		,,,				2504	0.001				p.I167N		.											.	TECTB-90	0			c.T500A						.	T	ASN/ILE	2,4404	4.2+/-10.8	0,2,2201	146.0	137.0	140.0		500	-1.5	1.0	10	dbSNP_127	140	41,8559	27.4+/-76.7	0,41,4259	yes	missense	TECTB	NM_058222.1	149	0,43,6460	AA,AT,TT		0.4767,0.0454,0.3306	benign	167/330	114053512	43,12963	2203	4300	6503	SO:0001583	missense	6975	exon5			TCTCCATCAAGAA	AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.500T>A	10.37:g.114053512T>A	ENSP00000358430:p.Ile167Asn	131	1		143	7	NM_058222	0	0	0	0	0	Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	CCDS7571.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	10.55	1.382544	0.25031	4.54E-4	0.004767	ENSG00000119913	ENST00000369422	D	0.81579	-1.51	5.87	-1.53	0.08611	Zona pellucida sperm-binding protein (3);	0.601827	0.19541	N	0.111786	T	0.55210	0.1906	N	0.14661	0.345	0.21861	N	0.999504	B	0.02656	0.0	B	0.01281	0.0	T	0.34254	-0.9836	10	0.15952	T	0.53	.	3.4442	0.07474	0.1444:0.4914:0.0905:0.2737	rs41296127	167	Q96PL2	TECTB_HUMAN	N	167	ENSP00000358430:I167N	ENSP00000358430:I167N	I	+	2	0	TECTB	114043502	0.018000	0.18449	0.953000	0.39169	0.972000	0.66771	-0.087000	0.11215	-0.206000	0.10203	-0.854000	0.03029	ATC	T|0.997;A|0.003		0.463	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P2865P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		200	8		66	48	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	237	1		66	33	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651229	1651229	+	Silent	SNP	G	G	A	rs553119014	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr11:1651229G>A	ENST00000399676.2	+	1	197	c.159G>A	c.(157-159)gcG>gcA	p.A53A		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtgggg	0.682													g|||	17	0.00339457	0.0045	0.0014	5008	,	,		5663	0.0		0.005	False		,,,				2504	0.0051				p.A53A		.											.	KRTAP5-5-23	1	Substitution - coding silent(1)	large_intestine(1)	c.G159A						.						35.0	47.0	43.0					11																	1651229		2115	4180	6295	SO:0001819	synonymous_variant	439915	exon1			CTGTGCGGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.159G>A	11.37:g.1651229G>A		51	0		67	15	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
FAM86C1	55199	hgsc.bcm.edu	37	11	71498671	71498671	+	Missense_Mutation	SNP	G	G	C	rs12283346	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr11:71498671G>C	ENST00000359244.4	+	1	112	c.89G>C	c.(88-90)cGc>cCc	p.R30P	FAM86C1_ENST00000346333.6_Missense_Mutation_p.R30P|FAM86C1_ENST00000426628.2_Missense_Mutation_p.R30P	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	30			R -> P (in dbSNP:rs12283346). {ECO:0000269|PubMed:14702039}.							lung(1)	1						CGCTCCTTCCGCTGGCAGGTG	0.741													.|||	2261	0.451478	0.3351	0.3516	5008	,	,		10448	0.3452		0.5666	False		,,,				2504	0.6708				p.R30P		.											.	FAM86C1-90	0			c.G89C						.						3.0	3.0	3.0					11																	71498671		1774	3427	5201	SO:0001583	missense	55199	exon1			CCTTCCGCTGGCA	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.89G>C	11.37:g.71498671G>C	ENSP00000352182:p.Arg30Pro	0	0		7	7	NM_152563	0	0	0	0	0	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	871	0.39880952380952384	166	0.33739837398373984	136	0.3756906077348066	173	0.30244755244755245	396	0.5224274406332454	.	1.506	-0.550640	0.03996	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	2.47	2.47	0.30058	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	4.000000000004E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44483	-0.9325	7	0.02654	T	1	.	7.3824	0.26864	0.0:0.7256:0.2744:0.0	rs12283346	30;30;30	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	P	30	ENSP00000325662:R30P;ENSP00000352182:R30P;ENSP00000391329:R30P;ENSP00000436598:R30P	ENSP00000325662:R30P	R	+	2	0	FAM86C1	71176319	0.633000	0.27181	0.784000	0.31847	0.041000	0.13682	0.888000	0.28268	0.155000	0.19261	-1.123000	0.02005	CGC	G|0.601;C|0.399		0.741	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
COLCA1	399948	bcgsc.ca	37	11	111167557	111167557	+	5'UTR	SNP	A	A	C	rs6589218	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr11:111167557A>C	ENST00000532918.1	-	0	2052				COLCA2_ENST00000526216.1_5'Flank|COLCA1_ENST00000355430.4_5'UTR|COLCA2_ENST00000398035.2_5'Flank|COLCA1_ENST00000540738.1_5'Flank|COLCA1_ENST00000526150.1_5'Flank			Q6ZS62	COLC1_HUMAN	colorectal cancer associated 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)											AGAGGGGGCAAGGCCTAGGCA	0.557													A|||	3521	0.703075	0.646	0.8012	5008	,	,		18479	0.5992		0.7028	False		,,,				2504	0.818				.		.											.	C11orf92-226	0			.						.																																			SO:0001623	5_prime_UTR_variant	399948	.			GGGGCAAGGCCTA	AK127703		11q23.1	2013-08-22	2013-08-22	2013-08-22	ENSG00000196167	ENSG00000196167			33789	other	unknown	"""cancer susceptibility candidate 12"""	615693	"""chromosome 11 open reading frame 92"""	C11orf92			Standard	NR_034154		Approved	FLJ45803, CASC12	uc001pld.3	Q6ZS62	OTTHUMG00000166658	ENST00000532918.1:c.-354T>G	11.37:g.111167557A>C		202	0		174	8	.	0	0	1	1	0		RNA	SNP	ENST00000532918.1	37																																																																																				A|0.335;C|0.665		0.557	COLCA1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390999.1		
KLRK1	22914	bcgsc.ca	37	12	10525740	10525740	+	Silent	SNP	C	C	T	rs1049172	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr12:10525740C>T	ENST00000240618.6	-	8	764	c.624G>A	c.(622-624)acG>acA	p.T208T	KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Silent_p.T208T|RP11-277P12.20_ENST00000500682.1_RNA	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	208	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TGCAGATGTACGTATTTGGAG	0.413													T|||	3578	0.714457	0.4652	0.7723	5008	,	,		17663	0.872		0.7048	False		,,,				2504	0.8579				p.T208T		.											.	.	0			c.G624A						.	T	,	2218,2188	586.5+/-386.5	549,1120,534	193.0	165.0	175.0		624,624	-2.2	0.9	12	dbSNP_86	175	6023,2577	420.0+/-353.3	2144,1735,421	no	coding-synonymous,coding-synonymous	KLRK1,KLRC4-KLRK1	NM_001199805.1,NM_007360.3	,	2693,2855,955	TT,TC,CC		29.9651,49.6596,36.6369	,	208/217,208/217	10525740	8241,4765	2203	4300	6503	SO:0001819	synonymous_variant	0	exon13			GATGTACGTATTT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.624G>A	12.37:g.10525740C>T		92	0		107	6	NM_001199805	0	0	0	0	0	A8K7K5|A8K7P4|Q9NR41	Silent	SNP	ENST00000240618.6	37	CCDS8623.1																																																																																			C|0.332;T|0.668		0.413	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		0	0		27	14	NM_152435	0	0	1	1	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
MICU2	221154	hgsc.bcm.edu	37	13	22178258	22178258	+	Silent	SNP	C	C	T	rs9509812	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr13:22178258C>T	ENST00000382374.4	-	1	95	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	10	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGGCCGCCACCCGCGCGCAGC	0.751													C|||	455	0.0908546	0.0113	0.1441	5008	,	,		12694	0.002		0.2545	False		,,,				2504	0.0838				p.R10R		.											.	EFHA1-90	0			c.G30A						.	C		108,3144		5,98,1523	3.0	3.0	3.0		30	-1.6	0.0	13	dbSNP_119	3	1216,5514		95,1026,2244	no	coding-synonymous	EFHA1	NM_152726.2		100,1124,3767	TT,TC,CC		18.0684,3.321,13.2639		10/435	22178258	1324,8658	1626	3365	4991	SO:0001819	synonymous_variant	221154	exon1			CGCCACCCGCGCG	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.30G>A	13.37:g.22178258C>T		0	0		15	8	NM_152726	0	0	0	3	3	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			C|0.873;T|0.127		0.751	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
DLEU7	220107	hgsc.bcm.edu	37	13	51417535	51417535	+	Missense_Mutation	SNP	G	G	A	rs898861	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr13:51417535G>A	ENST00000504404.1	-	1	297	c.248C>T	c.(247-249)gCg>gTg	p.A83V	DLEU7-AS1_ENST00000413510.2_RNA|DLEU7_ENST00000400393.3_Missense_Mutation_p.A83V			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	83			A -> V (in dbSNP:rs898861). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.										Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		TGGGGAGTTCGCCCGCGCCGC	0.811													G|||	885	0.176717	0.0968	0.1888	5008	,	,		8444	0.2917		0.1988	False		,,,				2504	0.135				p.A83V		.											.	.	0			c.C248T						.	G	VAL/ALA	212,2568		7,198,1185	2.0	3.0	3.0		248	1.8	0.0	13	dbSNP_86	3	970,5336		43,884,2226	yes	missense	DLEU7	NM_198989.2	64	50,1082,3411	AA,AG,GG		15.3822,7.6259,13.009	possibly-damaging	83/161	51417535	1182,7904	1390	3153	4543	SO:0001583	missense	220107	exon1			GAGTTCGCCCGCG	AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.248C>T	13.37:g.51417535G>A	ENSP00000427177:p.Ala83Val	1	0		8	6	NM_198989	0	0	0	0	0	Q2M2E4|Q6ZT82	Missense_Mutation	SNP	ENST00000504404.1	37		458	0.2097069597069597	57	0.11585365853658537	67	0.1850828729281768	188	0.32867132867132864	146	0.19261213720316622	G	11.22	1.574237	0.28092	0.076259	0.153822	ENSG00000186047	ENST00000400393;ENST00000504404;ENST00000335465	T;T	0.49139	0.79;0.82	2.72	1.81	0.25067	.	0.342483	0.19746	U	0.107012	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B;B	0.28026	0.198;0.198	B;B	0.25506	0.061;0.061	T	0.32587	-0.9901	9	0.07175	T	0.84	.	5.0335	0.14423	0.0:0.2383:0.5179:0.2437	rs898861;rs12869977	83;83	Q6UYE1;Q6UYE1-2	LEU7_HUMAN;.	V	83;83;36	ENSP00000420976:A83V;ENSP00000427177:A83V	ENSP00000439677:A36V	A	-	2	0	DLEU7	50315536	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.065000	0.14466	0.650000	0.30769	0.491000	0.48974	GCG	G|0.789;A|0.211		0.811	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		9	8	NM_018139	0	0	0	2	2	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	1	0		44	43	NM_001127258	0	0	0	1	1	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
C14orf180	400258	hgsc.bcm.edu	37	14	105055119	105055127	+	Stop_Codon_Del	DEL	GACGGGCAG	GACGGGCAG	-	rs111285011|rs569942489|rs11278058	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	GACGGGCAG	GACGGGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr14:105055119_105055127delGACGGGCAG	ENST00000557649.1	+	0	818_826				C14orf180_ENST00000410013.1_Stop_Codon_Del|C14orf180_ENST00000331952.2_In_Frame_Del_p.TGR153del|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CTGCGGCTCTgacgggcaggacgggcagg	0.718														3012	0.601438	0.8079	0.6095	5008	,	,		14598	0.6954		0.4235	False		,,,				2504	0.4029				p.161_161del		.											.	C14orf180-492	0			c.482_784del						.			1070,740		494,82,329						3.0	0.1		dbSNP_132	3	1279,3127		502,275,1426	no	coding	C14orf180	NM_001008404.1		996,357,1755	A1A1,A1R,RR		29.0286,40.884,37.7896				2349,3867				SO:0001567	stop_retained_variant	400258	exon5			GGCTCTGACGGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	Exception_encountered	14.37:g.105055128_105055136delGACGGGCAG		1	1		40	18	NM_001008404	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000557649.1	37	CCDS32166.1																																																																																			-|1.000;|0.000		0.718	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
PLCB2	5330	hgsc.bcm.edu	37	15	40583560	40583560	+	Silent	SNP	G	G	T	rs62021888	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:40583560G>T	ENST00000260402.3	-	26	3025	c.2776C>A	c.(2776-2778)Cgg>Agg	p.R926R	PLCB2_ENST00000456256.2_Silent_p.R911R|PLCB2_ENST00000557821.1_Silent_p.R922R	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	926					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		gccgcgccccgctgcagcagc	0.736													G|||	808	0.161342	0.0121	0.2075	5008	,	,		8373	0.1518		0.337	False		,,,				2504	0.1595				p.R926R		.											.	PLCB2-275	0			c.C2776A						.						2.0	3.0	3.0					15																	40583560		1222	3008	4230	SO:0001819	synonymous_variant	5330	exon26			CGCCCCGCTGCAG		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.2776C>A	15.37:g.40583560G>T		0	0		4	4	NM_004573	0	0	0	0	0	A8K6J2|B9EGH5	Silent	SNP	ENST00000260402.3	37	CCDS42020.1																																																																																			G|0.817;T|0.183		0.736	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
DUOX2	50506	bcgsc.ca	37	15	45388196	45388196	+	Missense_Mutation	SNP	G	G	A	rs534696164	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:45388196G>A	ENST00000603300.1	-	30	4112	c.3910C>T	c.(3910-3912)Cgg>Tgg	p.R1304W	DUOX2_ENST00000389039.6_Missense_Mutation_p.R1304W	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1304	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CAGGCGATCCGCACCCACTGT	0.602													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17612	0.0		0.0	False		,,,				2504	0.0				p.R1304W		.											.	DUOX2-95	0			c.C3910T						.						100.0	85.0	90.0					15																	45388196		2198	4298	6496	SO:0001583	missense	50506	exon30			CGATCCGCACCCA	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3910C>T	15.37:g.45388196G>A	ENSP00000475084:p.Arg1304Trp	207	2		111	5	NM_014080	0	0	0	0	0	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874976	0.91664	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.69	5.69	0.88448	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.77974	0.4211	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79550	-0.1757	9	0.66056	D	0.02	-22.551	13.7253	0.62754	0.0:0.0:0.8462:0.1538	.	1304	Q9NRD8	DUOX2_HUMAN	W	1304	.	ENSP00000373691:R1304W	R	-	1	2	DUOX2	43175488	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.530000	0.67141	2.688000	0.91661	0.561000	0.74099	CGG	.		0.602	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
SECISBP2L	9728	broad.mit.edu	37	15	49319661	49319661	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:49319661delG	ENST00000559471.1	-	7	1199	c.936delC	c.(934-936)tccfs	p.S312fs	SECISBP2L_ENST00000261847.3_Frame_Shift_Del_p.S312fs	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	312							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						AAGTTACATTGGACCAATTTA	0.323																																					p.S312fs		.											.	SECISBP2L-136	0			c.936delC						.						87.0	85.0	86.0					15																	49319661		2197	4294	6491	SO:0001589	frameshift_variant	9728	exon7			TACATTGGACCAA	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.936delC	15.37:g.49319661delG	ENSP00000453854:p.Ser312fs	8	0		6	2	NM_001193489	0	0	0	0	0	Q8N767	Frame_Shift_Del	DEL	ENST00000559471.1	37	CCDS53942.1																																																																																			.		0.323	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
DMXL2	23312	broad.mit.edu	37	15	51830641	51830641	+	Missense_Mutation	SNP	T	T	G	rs143811213		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:51830641T>G	ENST00000251076.5	-	10	1401	c.1114A>C	c.(1114-1116)Aat>Cat	p.N372H	DMXL2_ENST00000543779.2_Missense_Mutation_p.N372H|DMXL2_ENST00000449909.3_Missense_Mutation_p.N372H	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	372						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACCAAGACATTTGGAATATCT	0.294																																					p.N372H		.											.	DMXL2-99	0			c.A1114C						.	T	HIS/ASN,HIS/ASN,HIS/ASN	2,4388	4.2+/-10.8	0,2,2193	50.0	48.0	49.0		1114,1114,1114	4.1	1.0	15	dbSNP_134	49	4,8582	2.2+/-6.3	0,4,4289	yes	missense,missense,missense	DMXL2	NM_001174116.1,NM_001174117.1,NM_015263.3	68,68,68	0,6,6482	GG,GT,TT		0.0466,0.0456,0.0462	benign,benign,benign	372/3038,372/2401,372/3037	51830641	6,12970	2195	4293	6488	SO:0001583	missense	23312	exon10			AGACATTTGGAAT	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1114A>C	15.37:g.51830641T>G	ENSP00000251076:p.Asn372His	44	0		36	3	NM_001174117	0	0	0	0	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.196079	0.38806	4.56E-4	4.66E-4	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.44083	0.93;0.93;0.93	5.28	4.11	0.48088	.	0.217451	0.48767	D	0.000165	T	0.31358	0.0794	N	0.22421	0.69	0.20821	N	0.999846	P;B;B	0.35050	0.482;0.412;0.198	B;B;B	0.42995	0.404;0.259;0.241	T	0.20338	-1.0278	10	0.72032	D	0.01	.	4.3591	0.11194	0.3516:0.1002:0.0:0.5482	.	372;372;372	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	H	372	ENSP00000251076:N372H;ENSP00000441858:N372H;ENSP00000400855:N372H	ENSP00000251076:N372H	N	-	1	0	DMXL2	49617933	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.199000	0.51043	1.988000	0.58038	0.528000	0.53228	AAT	T|1.000;G|0.000		0.294	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
POLR2M	81488	hgsc.bcm.edu	37	15	58001174	58001174	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:58001174A>C	ENST00000299638.3	+	2	590	c.376A>C	c.(376-378)Acc>Ccc	p.T126P	POLR2M_ENST00000464308.1_3'UTR|GCOM1_ENST00000484300.1_Intron|GCOM1_ENST00000380568.3_Intron|POLR2M_ENST00000380557.4_Intron|GCOM1_ENST00000380569.2_Intron|POLR2M_ENST00000380563.2_Missense_Mutation_p.T126P|GCOM1_ENST00000587652.1_Missense_Mutation_p.T523P	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	126					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)	p.T126P(1)									GTCATCTCAAACCTCACAAAA	0.453																																					p.T126P		.											.	.	1	Substitution - Missense(1)	skin(1)	c.A376C						.						40.0	35.0	37.0					15																	58001174		2191	4272	6463	SO:0001583	missense	81488	exon2			TCTCAAACCTCAC	AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.376A>C	15.37:g.58001174A>C	ENSP00000299638:p.Thr126Pro	168	0		136	7	NM_015532	0	0	34	34	0	Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Missense_Mutation	SNP	ENST00000299638.3	37	CCDS32252.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.875801	0.51695	.	.	ENSG00000255529	ENST00000380563;ENST00000299638	T;T	0.30448	1.53;1.53	5.25	-0.124	0.13523	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.09310	N	0.999998	B	0.17667	0.023	B	0.20955	0.032	T	0.28267	-1.0049	8	0.66056	D	0.02	.	6.1364	0.20235	0.6318:0.1287:0.2395:0.0	.	126	P0CAP2	GRL1A_HUMAN	P	126	ENSP00000369937:T126P;ENSP00000299638:T126P	ENSP00000299638:T126P	T	+	1	0	GRINL1A	55788466	0.000000	0.05858	0.072000	0.20136	0.048000	0.14542	-0.209000	0.09358	0.095000	0.17434	0.482000	0.46254	ACC	A|0.119;C|0.881		0.453	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2		
C15orf40	123207	broad.mit.edu	37	15	83680329	83680329	+	Missense_Mutation	SNP	G	G	A	rs17361375	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr15:83680329G>A	ENST00000513601.2	-	1	38	c.31C>T	c.(31-33)Ctt>Ttt	p.L11F	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA|C15orf40_ENST00000538348.2_Missense_Mutation_p.L11F|C15orf40_ENST00000565712.1_Missense_Mutation_p.L11F|C15orf40_ENST00000304177.5_5'UTR|C15orf40_ENST00000451195.3_Missense_Mutation_p.L11F			Q8WUR7	CO040_HUMAN	chromosome 15 open reading frame 40	11										large_intestine(3)|lung(2)|skin(1)	6						GTTGCCCGAAGGTGCCTCAGC	0.697											OREG0023391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	651	0.129992	0.1566	0.2291	5008	,	,		13813	0.003		0.1918	False		,,,				2504	0.091				p.L11F		.											.	C15orf40-91	0			c.C31T						.	G	PHE/LEU,PHE/LEU,PHE/LEU,PHE/LEU,PHE/LEU	726,3678		46,634,1522	18.0	20.0	19.0		31,31,31,31,31	-1.2	0.0	15	dbSNP_123	19	1780,6820		176,1428,2696	yes	missense,missense,missense,missense,missense	C15orf40	NM_144597.2,NM_001160116.1,NM_001160115.1,NM_001160114.1,NM_001160113.1	22,22,22,22,22	222,2062,4218	AA,AG,GG		20.6977,16.485,19.271	benign,benign,benign,benign,benign	11/154,11/150,11/168,11/154,11/168	83680329	2506,10498	2202	4300	6502	SO:0001583	missense	123207	exon1			CCCGAAGGTGCCT	BC019820	CCDS32312.1, CCDS32312.2, CCDS53968.1, CCDS53969.1	15q25.2	2012-05-30			ENSG00000169609	ENSG00000169609			28443	protein-coding gene	gene with protein product							Standard	NM_144597		Approved	MGC29937	uc010uoo.1	Q8WUR7	OTTHUMG00000160473	ENST00000513601.2:c.31C>T	15.37:g.83680329G>A	ENSP00000424666:p.Leu11Phe	24	0	1223	15	3	NM_001160116	0	0	17	17	0	A6NIC9|B2R5E7|F5GX92|F8WD31|G5EA00	Missense_Mutation	SNP	ENST00000513601.2	37	CCDS32312.2	290	0.13278388278388278	71	0.1443089430894309	73	0.20165745856353592	1	0.0017482517482517483	145	0.19129287598944592	G	10.89	1.479786	0.26511	0.16485	0.206977	ENSG00000169609	ENST00000538348;ENST00000451195;ENST00000513601	.	.	.	3.61	-1.25	0.09405	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.51482	P	7.900000000005125E-5	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.36939	-0.9727	7	0.11182	T	0.66	.	3.9244	0.09257	0.2978:0.3667:0.3354:0.0	rs17361375;rs17361375	11;11;11	F8WD31;F5GX92;G5EA00	.;.;.	F	11	.	ENSP00000403987:L11F	L	-	1	0	C15orf40	81471333	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.601000	0.05687	-0.228000	0.09869	-1.717000	0.00709	CTT	G|0.855;A|0.145		0.697	C15orf40-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360737.2	NM_144597	
SEPT12	124404	bcgsc.ca	37	16	4837545	4837545	+	Silent	SNP	A	A	G	rs9673735	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:4837545A>G	ENST00000268231.8	-	2	365	c.102T>C	c.(100-102)gcT>gcC	p.A34A	SEPT12_ENST00000396693.5_Silent_p.A34A|SEPT12_ENST00000591861.1_5'UTR|SMIM22_ENST00000589721.1_5'Flank|SMIM22_ENST00000589327.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	34					cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)	p.A34A(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						GGTCCAGCACAGCCTCAATGC	0.627													A|||	1520	0.303514	0.1536	0.3458	5008	,	,		18187	0.3026		0.328	False		,,,				2504	0.4519				p.A34A		.											.	SEPT12-91	1	Substitution - coding silent(1)	stomach(1)	c.T102C						.	A	,	704,3690	293.6+/-282.7	56,592,1549	200.0	146.0	164.0		102,102	-9.9	0.5	16	dbSNP_119	164	2371,6229	394.7+/-344.8	340,1691,2269	no	coding-synonymous,coding-synonymous	SEPT12	NM_001154458.2,NM_144605.4	,	396,2283,3818	GG,GA,AA		27.5698,16.0218,23.6648	,	34/313,34/359	4837545	3075,9919	2197	4300	6497	SO:0001819	synonymous_variant	124404	exon2			CAGCACAGCCTCA	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.102T>C	16.37:g.4837545A>G		94	1		54	4	NM_144605	0	0	0	0	0	Q0P6B0|Q1PBH0|Q96LL0	Silent	SNP	ENST00000268231.8	37	CCDS10522.1																																																																																			A|0.742;G|0.258		0.627	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251645.2	NM_144605	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		8	8	NM_024336	0	0	0	1	1	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
GOT2	2806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	58742148	58742148	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:58742148C>T	ENST00000245206.5	-	10	1348	c.1220G>A	c.(1219-1221)cGc>cAc	p.R407H	GOT2_ENST00000434819.2_Missense_Mutation_p.R364H	NM_002080.2	NP_002071.2	P00505	AATM_HUMAN	glutamic-oxaloacetic transaminase 2, mitochondrial	407					2-oxoglutarate metabolic process (GO:0006103)|4-hydroxyproline catabolic process (GO:0019470)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid transport (GO:0015908)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|oxaloacetate metabolic process (GO:0006107)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|prostate(2)|skin(1)	22					L-Aspartic Acid(DB00128)	CACAGAGATGCGGCCATCTTT	0.552																																					p.R407H		.											.	GOT2-91	0			c.G1220A						.						71.0	66.0	68.0					16																	58742148		2198	4300	6498	SO:0001583	missense	2806	exon10			GAGATGCGGCCAT		CCDS10801.1, CCDS67045.1	16q21	2013-05-29	2013-05-29		ENSG00000125166	ENSG00000125166	2.6.1.1		4433	protein-coding gene	gene with protein product	"""kynurenine aminotransferase IV"", ""aspartate aminotransferase 2"", ""aspartate transaminase 2"""	138150	"""glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)"""			17442055	Standard	NM_002080		Approved	mitAAT, KATIV, KAT4	uc002eof.1	P00505	OTTHUMG00000133769	ENST00000245206.5:c.1220G>A	16.37:g.58742148C>T	ENSP00000245206:p.Arg407His	107	0		94	28	NM_002080	0	0	168	255	87	B4DJA6|E7ERW2|Q53FL3|Q9BWA3	Missense_Mutation	SNP	ENST00000245206.5	37	CCDS10801.1	.	.	.	.	.	.	.	.	.	.	C	32	5.123488	0.94429	.	.	ENSG00000125166	ENST00000245206;ENST00000434819	D;D	0.98264	-4.83;-4.83	5.7	5.7	0.88788	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99318	0.9761	H	0.98370	4.215	0.80722	D	1	P;D	0.71674	0.816;0.998	P;P	0.57620	0.803;0.824	D	0.98768	1.0727	9	.	.	.	0.4895	18.8056	0.92035	0.0:1.0:0.0:0.0	.	364;407	E7ERW2;P00505	.;AATM_HUMAN	H	407;364	ENSP00000245206:R407H;ENSP00000394100:R364H	.	R	-	2	0	GOT2	57299649	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.670000	0.83925	2.682000	0.91365	0.655000	0.94253	CGC	.		0.552	GOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258289.3		
E2F4	1874	bcgsc.ca	37	16	67234134	67234134	+	IGR	SNP	A	A	G	rs8058861	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:67234134A>G	ENST00000379378.3	+	0	2096				ELMO3_ENST00000477898.1_5'UTR|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000571638.1_3'UTR|ELMO3_ENST00000360833.1_Missense_Mutation_p.N131D|ELMO3_ENST00000393997.2_Missense_Mutation_p.N148D	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		GCTGCAGAGTAACAGTCCTGA	0.622													G|||	1010	0.201677	0.5182	0.0735	5008	,	,		13259	0.0238		0.0696	False		,,,				2504	0.184				p.N148D		.											.	ELMO3-90	0			c.A442G						.	G	ASP/ASN	1657,2387		342,973,707	36.0	38.0	37.0		442	0.7	0.0	16	dbSNP_116	37	583,7741		29,525,3608	yes	missense	ELMO3	NM_024712.3	23	371,1498,4315	GG,GA,AA		7.0038,40.9743,18.1113	benign	148/774	67234134	2240,10128	2022	4162	6184	SO:0001628	intergenic_variant	79767	exon5			CAGAGTAACAGTC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67234134A>G		194	3		188	7	NM_024712	0	0	0	0	0	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	333	0.15247252747252749	239	0.48577235772357724	33	0.09116022099447514	12	0.02097902097902098	49	0.06464379947229551	G	10.23	1.291660	0.23564	0.409743	0.070038	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.46819	0.86;0.86	5.16	0.709	0.18150	.	1.206870	0.05741	N	0.601429	T	0.00012	0.0000	N	0.12182	0.205	0.36902	P	0.109541	B;B	0.18166	0.011;0.026	B;B	0.17722	0.019;0.019	T	0.45160	-0.9280	9	0.25106	T	0.35	-1.8862	1.3437	0.02159	0.2925:0.242:0.3415:0.124	rs8058861;rs8058861	131;148	F8W9E7;Q96BJ8-3	.;.	D	131;148	ENSP00000354077:N131D;ENSP00000377566:N148D	ENSP00000354077:N131D	N	+	1	0	ELMO3	65791635	0.001000	0.12720	0.035000	0.18076	0.556000	0.35491	-0.293000	0.08320	-0.315000	0.08703	-0.366000	0.07423	AAC	A|0.847;G|0.153		0.622	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72993517	72993517	+	Silent	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:72993517G>A	ENST00000268489.5	-	2	1200	c.528C>T	c.(526-528)ggC>ggT	p.G176G	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	176					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGCCCCCCGCGCCAGGGAGAG	0.627																																					p.G176G		.											.	ZFHX3-72	0			c.C528T						.						34.0	39.0	38.0					16																	72993517		2198	4300	6498	SO:0001819	synonymous_variant	463	exon2			CCCCGCGCCAGGG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.528C>T	16.37:g.72993517G>A		98	0		86	30	NM_006885	0	0	1	3	2	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.627	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
PKD1L2	114780	bcgsc.ca	37	16	81232564	81232564	+	RNA	SNP	T	T	G	rs7194871	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:81232564T>G	ENST00000525539.1	-	0	1245				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCCATCAGTTTCTGGGTTTCT	0.547													T|||	3946	0.787939	0.7239	0.7896	5008	,	,		17300	0.9544		0.7863	False		,,,				2504	0.7035				p.K416Q		.											.	PKD1L2-92	0			c.A1246C						.	T	GLN/LYS,GLN/LYS	2905,1015		1080,745,135	138.0	140.0	139.0		1246,1246	2.2	0.0	16	dbSNP_116	139	6605,1691		2634,1337,177	yes	missense,missense	PKD1L2	NM_001076780.1,NM_052892.3	53,53	3714,2082,312	GG,GT,TT		20.3833,25.8929,22.1513	benign,benign	416/992,416/2460	81232564	9510,2706	1960	4148	6108			114780	exon7			TCAGTTTCTGGGT	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81232564T>G		162	1		192	7	NM_001076780	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		1799	0.8237179487179487	360	0.7317073170731707	287	0.7928176795580111	548	0.958041958041958	604	0.7968337730870713	T	2.880	-0.231983	0.05983	0.741071	0.796167	ENSG00000166473	ENST00000337114	T	0.01252	5.1	5.25	2.15	0.27550	.	0.803489	0.11271	N	0.581429	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.10296	0.002;0.003	B;B	0.08055	0.002;0.003	T	0.28996	-1.0026	8	0.06099	T	0.92	0.0522	9.2619	0.37616	0.0:0.5227:0.2751:0.2022	rs7194871;rs17594471;rs52835002;rs58986301;rs7194871	416;416	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	Q	416	ENSP00000337397:K416Q	ENSP00000337397:K416Q	K	-	1	0	PKD1L2	79790065	0.051000	0.20477	0.049000	0.19019	0.032000	0.12392	0.483000	0.22292	0.198000	0.20407	-0.384000	0.06662	AAA	T|0.190;G|0.810		0.547	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		16	16	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	1	0		19	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		18	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		15	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		15	13	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
CDH15	1013	hgsc.bcm.edu	37	16	89258747	89258747	+	Missense_Mutation	SNP	A	A	C	rs75791347	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr16:89258747A>C	ENST00000289746.2	+	11	1815	c.1750A>C	c.(1750-1752)Aag>Cag	p.K584Q		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	584	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCTGCGGCAAGGACGGCGT	0.751													c|||	2269	0.453075	0.3616	0.3804	5008	,	,		8209	0.6528		0.4304	False		,,,				2504	0.4458				p.K584Q		.											.	CDH15-523	0			c.A1750C						.		GLN/LYS	719,2255		126,467,894	2.0	3.0	2.0		1750	-4.4	0.0	16	dbSNP_131	2	1977,4371		402,1173,1599	no	missense	CDH15	NM_004933.2	53	528,1640,2493	CC,CA,AA		31.1437,24.1762,28.9208	benign	584/815	89258747	2696,6626	1487	3174	4661	SO:0001583	missense	1013	exon11			TGCGGCAAGGACG	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1750A>C	16.37:g.89258747A>C	ENSP00000289746:p.Lys584Gln	0	0		8	5	NM_004933	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	1014	0.4642857142857143	172	0.34959349593495936	127	0.35082872928176795	372	0.6503496503496503	343	0.4525065963060686	c	3.132	-0.178252	0.06380	0.241762	0.311437	ENSG00000129910	ENST00000289746	T	0.56941	0.43	4.6	-4.43	0.03568	Cadherin (1);	1.872270	0.03679	N	0.245167	T	0.00012	0.0000	N	0.05383	-0.06	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.38802	-0.9644	9	0.18276	T	0.48	.	3.3286	0.07076	0.1871:0.1478:0.4907:0.1744	.	584	P55291	CAD15_HUMAN	Q	584	ENSP00000289746:K584Q	ENSP00000289746:K584Q	K	+	1	0	CDH15	87786248	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.609000	0.05635	-0.999000	0.03442	-0.675000	0.03792	AAG	A|0.532;C|0.468		0.751	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
NLGN2	57555	hgsc.bcm.edu	37	17	7320874	7320874	+	Missense_Mutation	SNP	C	C	T	rs62061174	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:7320874C>T	ENST00000302926.2	+	7	2337	c.2264C>T	c.(2263-2265)gCg>gTg	p.A755V	NLGN2_ENST00000575301.1_Missense_Mutation_p.A755V|SPEM1_ENST00000323675.3_5'Flank|RP11-104H15.7_ENST00000575310.1_RNA	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	755					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GGCGTCGGGGCGGACCCTGCC	0.761													C|||	53	0.0105831	0.0008	0.0187	5008	,	,		6326	0.0		0.0338	False		,,,				2504	0.0051				p.A755V		.											.	NLGN2-90	0			c.C2264T						.	C	VAL/ALA	15,3913		0,15,1949	5.0	5.0	5.0		2264	2.3	1.0	17	dbSNP_129	5	206,7598		3,200,3699	yes	missense	NLGN2	NM_020795.2	64	3,215,5648	TT,TC,CC		2.6397,0.3819,1.8837	benign	755/836	7320874	221,11511	1964	3902	5866	SO:0001583	missense	57555	exon7			TCGGGGCGGACCC	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.2264C>T	17.37:g.7320874C>T	ENSP00000305288:p.Ala755Val	0	0		21	10	NM_020795	0	0	0	1	1	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	30	0.013736263736263736	0	0.0	6	0.016574585635359115	2	0.0034965034965034965	22	0.029023746701846966	C	9.067	0.995877	0.19043	0.003819	0.026397	ENSG00000169992	ENST00000302926	T	0.64803	-0.12	3.42	2.33	0.28932	.	0.633271	0.13495	N	0.383697	T	0.15739	0.0379	N	0.08118	0	0.28833	N	0.897033	B	0.09022	0.002	B	0.01281	0.0	T	0.07028	-1.0794	10	0.14656	T	0.56	.	10.3885	0.44154	0.0:0.798:0.202:0.0	rs62061174	755	Q8NFZ4	NLGN2_HUMAN	V	755	ENSP00000305288:A755V	ENSP00000305288:A755V	A	+	2	0	NLGN2	7261598	0.090000	0.21635	0.981000	0.43875	0.746000	0.42486	2.934000	0.48956	1.904000	0.55121	0.448000	0.29417	GCG	C|0.986;T|0.014		0.761	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
TMEM132E	124842	bcgsc.ca	37	17	32957114	32957114	+	Missense_Mutation	SNP	G	G	A	rs56879769	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:32957114G>A	ENST00000321639.5	+	6	1484	c.1156G>A	c.(1156-1158)Gtc>Atc	p.V386I		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	386						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GAATGGCCTCGTCCTGGACAT	0.587													G|||	194	0.038738	0.1021	0.0245	5008	,	,		19643	0.0		0.0358	False		,,,				2504	0.0061				p.V386I		.											.	TMEM132E-68	0			c.G1156A						.	G	ILE/VAL	404,4002	200.4+/-223.7	20,364,1819	116.0	80.0	92.0		1156	5.0	1.0	17	dbSNP_129	92	273,8327	104.4+/-165.4	2,269,4029	yes	missense	TMEM132E	NM_207313.1	29	22,633,5848	AA,AG,GG		3.1744,9.1693,5.2053	benign	386/985	32957114	677,12329	2203	4300	6503	SO:0001583	missense	124842	exon6			GGCCTCGTCCTGG	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1156G>A	17.37:g.32957114G>A	ENSP00000316532:p.Val386Ile	170	0		89	5	NM_207313	0	0	5	5	0	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	87	0.03983516483516483	52	0.10569105691056911	9	0.024861878453038673	0	0.0	26	0.03430079155672823	G	13.73	2.323321	0.41096	0.091693	0.031744	ENSG00000181291	ENST00000321639	T	0.32988	1.43	4.99	4.99	0.66335	.	0.231610	0.43747	D	0.000540	T	0.00356	0.0011	N	0.25647	0.755	0.51233	D	0.999914	B	0.27416	0.178	B	0.19391	0.025	T	0.05484	-1.0882	10	0.48119	T	0.1	-46.4222	7.1501	0.25606	0.1805:0.0:0.8195:0.0	rs56879769	386	Q6IEE7	T132E_HUMAN	I	386	ENSP00000316532:V386I	ENSP00000316532:V386I	V	+	1	0	TMEM132E	29981227	0.991000	0.36638	0.990000	0.47175	0.552000	0.35366	2.169000	0.42434	2.757000	0.94681	0.643000	0.83706	GTC	G|0.952;A|0.048		0.587	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
STARD3	10948	bcgsc.ca	37	17	37815749	37815749	+	Silent	SNP	G	G	A	rs73296109	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:37815749G>A	ENST00000336308.5	+	9	956	c.738G>A	c.(736-738)acG>acA	p.T246T	STARD3_ENST00000394250.4_Silent_p.T228T|STARD3_ENST00000580611.1_Silent_p.T220T|STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000544210.2_Silent_p.T246T	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	246	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGGAGGCCACGGCAGTGGTGG	0.597													A|||	144	0.028754	0.059	0.0274	5008	,	,		14528	0.0		0.0437	False		,,,				2504	0.0031				p.T246T		.											.	STARD3-90	0			c.G738A						.	A	,,	248,4158	803.1+/-415.7	12,224,1967	77.0	78.0	78.0		738,684,738	-0.1	0.2	17	dbSNP_130	78	487,8113	797.7+/-407.4	18,451,3831	no	coding-synonymous,coding-synonymous,coding-synonymous	STARD3	NM_001165937.1,NM_001165938.1,NM_006804.3	,,	30,675,5798	AA,AG,GG		5.6628,5.6287,5.6512	,,	246/446,228/428,246/446	37815749	735,12271	2203	4300	6503	SO:0001819	synonymous_variant	10948	exon9			GGCCACGGCAGTG		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.738G>A	17.37:g.37815749G>A		177	1		94	4	NM_006804	0	0	47	47	0	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Silent	SNP	ENST00000336308.5	37	CCDS11341.1																																																																																			A|0.046;C|0.000;G|0.954;T|0.000		0.597	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
IKZF3	22806	broad.mit.edu	37	17	37922670	37922670	+	Silent	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:37922670G>T	ENST00000346872.3	-	8	964	c.903C>A	c.(901-903)acC>acA	p.T301T	IKZF3_ENST00000394189.2_Silent_p.T119T|IKZF3_ENST00000439167.2_Silent_p.T228T|IKZF3_ENST00000346243.3_Silent_p.T223T|IKZF3_ENST00000535189.1_Silent_p.T267T|IKZF3_ENST00000583368.1_Silent_p.T54T|IKZF3_ENST00000351680.3_Silent_p.T262T|IKZF3_ENST00000377952.2_Silent_p.T80T|IKZF3_ENST00000439016.2_Silent_p.T206T|IKZF3_ENST00000350532.3_Silent_p.T262T|IKZF3_ENST00000377958.2_Silent_p.T214T|RP11-94L15.2_ENST00000488188.2_lincRNA|IKZF3_ENST00000377945.3_Silent_p.T167T|IKZF3_ENST00000377944.3_Silent_p.T158T|IKZF3_ENST00000467757.1_Silent_p.T245T	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	301					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCATCATGCGGGTCTGTATGA	0.522																																					p.T301T		.											.	IKZF3-971	0			c.C903A						.						107.0	104.0	105.0					17																	37922670		2203	4300	6503	SO:0001819	synonymous_variant	22806	exon8			CATGCGGGTCTGT	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.903C>A	17.37:g.37922670G>T		79	0		55	3	NM_012481	0	0	0	0	0	B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Silent	SNP	ENST00000346872.3	37	CCDS11346.1	.	.	.	.	.	.	.	.	.	.	G	7.633	0.679219	0.14907	.	.	ENSG00000161405	ENST00000439167;ENST00000439016	.	.	.	5.82	-0.382	0.12481	.	.	.	.	.	T	0.51517	0.1679	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.43442	-0.9391	4	.	.	.	-9.1466	6.3796	0.21527	0.067:0.3602:0.3854:0.1874	.	.	.	.	H	216;255	.	.	P	-	2	0	IKZF3	35176196	0.788000	0.28762	0.979000	0.43373	0.995000	0.86356	-0.294000	0.08309	0.331000	0.23511	0.655000	0.94253	CCC	.		0.522	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257004.2	NM_012481	
THRA	7067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38240130	38240130	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:38240130T>C	ENST00000264637.4	+	5	845	c.265T>C	c.(265-267)Tat>Cat	p.Y89H	THRA_ENST00000394121.4_Missense_Mutation_p.Y89H|THRA_ENST00000450525.2_Missense_Mutation_p.Y89H|THRA_ENST00000584985.1_Missense_Mutation_p.Y89H|THRA_ENST00000546243.1_Missense_Mutation_p.Y89H	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	89					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCATCCCACCTATTCCTGCAA	0.557																																					p.Y89H		.											.	THRA-186	0			c.T265C						.						154.0	133.0	140.0					17																	38240130		2203	4300	6503	SO:0001583	missense	7067	exon5			CCCACCTATTCCT	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.265T>C	17.37:g.38240130T>C	ENSP00000264637:p.Tyr89His	145	0		85	24	NM_001190918	0	0	30	60	30	A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	37	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.955698	0.92726	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44	5.31	5.31	0.75309	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.998	D	0.99774	1.1025	10	0.87932	D	0	.	14.9322	0.70923	0.0:0.0:0.0:1.0	.	89;89;89	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	H	89	ENSP00000377679:Y89H;ENSP00000264637:Y89H;ENSP00000395641:Y89H;ENSP00000443972:Y89H	ENSP00000264637:Y89H	Y	+	1	0	THRA	35493656	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.976000	0.88070	2.005000	0.58758	0.352000	0.21897	TAT	.		0.557	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2		
MAP3K14-AS1	100133991	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43347828	43347828	+	RNA	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:43347828C>T	ENST00000585780.1	+	0	4950				MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000586450.1_RNA|MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000585351.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA					MAP3K14 antisense RNA 1																		GCTGCAGACACGCGGTGGATG	0.667																																					.		.											.	MAP3K14-1453	0			.						.						38.0	44.0	42.0					17																	43347828		2020	4161	6181			9020	.			CAGACACGCGGTG	AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43347828C>T		73	0		30	11	.	0	0	10	14	4		RNA	SNP	ENST00000585780.1	37		.	.	.	.	.	.	.	.	.	.	C	16.61	3.170766	0.57584	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.291406	0.37393	N	0.002105	T	0.36663	0.0975	N	0.04508	-0.205	0.18873	N	0.99999	P;D	0.57571	0.864;0.98	B;P	0.48368	0.357;0.575	T	0.53634	-0.8411	8	0.56958	D	0.05	.	18.4439	0.90677	0.0:1.0:0.0:0.0	.	642;172	Q99558;Q6ZMZ1	M3K14_HUMAN;.	M	641	.	ENSP00000342059:V641M	V	-	1	0	MAP3K14	40703611	0.880000	0.30214	0.559000	0.28332	0.002000	0.02628	2.195000	0.42677	2.587000	0.87381	0.561000	0.74099	GTG	.		0.667	MAP3K14-AS1-008	KNOWN	basic	antisense	antisense	OTTHUMT00000450941.1	NR_024434	
RNFT1	51136	bcgsc.ca	37	17	58031412	58031412	+	Silent	SNP	A	A	G	rs11368	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:58031412A>G	ENST00000305783.8	-	8	1222	c.1167T>C	c.(1165-1167)atT>atC	p.I389I	RP11-178C3.1_ENST00000591035.1_Intron|RNFT1_ENST00000442346.2_3'UTR	NM_016125.3	NP_057209.3	Q5M7Z0	RNFT1_HUMAN	ring finger protein, transmembrane 1	389						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			TTACCTGACAAATGAGAAGAA	0.328													G|||	2901	0.579273	0.8797	0.5	5008	,	,		19138	0.5764		0.4195	False		,,,				2504	0.3967				p.I389I		.											.	RNFT1-226	0			c.T1167C						.	G		2953,719		1192,569,75	51.0	50.0	50.0		1167	0.9	1.0	17	dbSNP_52	50	3587,4589		816,1955,1317	no	coding-synonymous	RNFT1	NM_016125.3		2008,2524,1392	GG,GA,AA		43.8723,19.5806,44.8008		389/436	58031412	6540,5308	1836	4088	5924	SO:0001819	synonymous_variant	51136	exon8			CTGACAAATGAGA	BC006971	CCDS11622.2	17q23.2	2013-01-09			ENSG00000189050	ENSG00000189050		"""RING-type (C3HC4) zinc fingers"""	30206	protein-coding gene	gene with protein product		615172				12477932	Standard	NM_016125		Approved	PTD016	uc002iya.3	Q5M7Z0	OTTHUMG00000148658	ENST00000305783.8:c.1167T>C	17.37:g.58031412A>G		233	2		142	5	NM_016125	0	0	0	0	0	Q8N7D0|Q96IZ9|Q9Y686	Silent	SNP	ENST00000305783.8	37	CCDS11622.2																																																																																			A|0.499;G|0.501		0.328	RNFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308958.1	NM_016125	
PGS1	9489	hgsc.bcm.edu	37	17	76374760	76374760	+	Missense_Mutation	SNP	C	C	G	rs553284568	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr17:76374760C>G	ENST00000262764.6	+	1	40	c.14C>G	c.(13-15)gCg>gGg	p.A5G	PGS1_ENST00000329897.7_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	5					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GCGGTGGCGGCGGCAGCTGCG	0.741													C|||	6	0.00119808	0.0008	0.0014	5008	,	,		11759	0.0		0.004	False		,,,				2504	0.0				p.A5G	Esophageal Squamous(45;182 1126 10685 43198)	.											.	PGS1-90	0			c.C14G						.																																			SO:0001583	missense	9489	exon1			TGGCGGCGGCAGC		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.14C>G	17.37:g.76374760C>G	ENSP00000262764:p.Ala5Gly	1	0		24	8	NM_024419	0	0	0	0	0	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	37	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524638	0.27299	.	.	ENSG00000087157	ENST00000262764	.	.	.	3.8	2.82	0.32997	.	0.399315	0.22408	N	0.060441	T	0.35480	0.0933	N	0.22421	0.69	0.80722	D	1	B	0.29627	0.252	B	0.26310	0.068	T	0.27739	-1.0065	9	0.87932	D	0	-1.3025	8.8569	0.35234	0.0:0.8902:0.0:0.1098	.	5	Q32NB8	PGPS1_HUMAN	G	5	.	ENSP00000262764:A5G	A	+	2	0	PGS1	73886355	1.000000	0.71417	1.000000	0.80357	0.005000	0.04900	2.838000	0.48199	0.917000	0.36895	-0.140000	0.14226	GCG	.		0.741	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		2	0		18	17	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	0	0		7	7	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
CACTIN	58509	hgsc.bcm.edu	37	19	3613346	3613346	+	Missense_Mutation	SNP	G	G	A	rs2074789	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:3613346G>A	ENST00000429344.2	-	9	1548	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000248420.5_Missense_Mutation_p.A499V|CACTIN_ENST00000221899.3_Missense_Mutation_p.A431V	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	499				A -> V (in Ref. 4; AAH19848). {ECO:0000305}.	cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGTGGGCGCCGCGTCCTCAGG	0.781													G|||	2156	0.430511	0.3018	0.6037	5008	,	,		8769	0.3294		0.5795	False		,,,				2504	0.4325				p.A499V		.											.	.	0			c.C1496T						.	G	VAL/ALA,VAL/ALA	1466,1576		408,650,463	4.0	5.0	5.0		1496,1496	-5.6	0.0	19	dbSNP_96	5	4326,2414		1492,1342,536	yes	missense,missense	C19orf29	NM_001080543.1,NM_021231.1	64,64	1900,1992,999	AA,AG,GG		35.816,48.192,40.7892	benign,benign	499/759,499/759	3613346	5792,3990	1521	3370	4891	SO:0001583	missense	58509	exon9			GGCGCCGCGTCCT	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1496C>T	19.37:g.3613346G>A	ENSP00000415078:p.Ala499Val	0	0		12	7	NM_021231	0	0	0	2	2	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	1016|1016	0.4652014652014652|0.4652014652014652	166|166	0.33739837398373984|0.33739837398373984	219|219	0.6049723756906077|0.6049723756906077	189|189	0.3304195804195804|0.3304195804195804	442|442	0.58311345646438|0.58311345646438	G|G	10.30|10.30	1.311266|1.311266	0.23821|0.23821	0.48192|0.48192	0.64184|0.64184	ENSG00000105298|ENSG00000226800	ENST00000429344;ENST00000248420;ENST00000221899|ENST00000447295	.|.	.|.	.|.	3.38|3.38	-5.6|-5.6	0.02497|0.02497	.|.	2.059910|.	0.01925|.	N|.	0.040837|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.26602|.	0.116;0.154|.	B;B|.	0.18561|.	0.022;0.004|.	T|T	0.46952|0.46952	-0.9154|-0.9154	8|4	0.30078|.	T|.	0.28|.	.|.	0.7428|0.7428	0.00977|0.00977	0.2199:0.145:0.1962:0.4388|0.2199:0.145:0.1962:0.4388	rs2074789;rs11557007|rs2074789;rs11557007	499;499|.	Q8WUQ7-2;Q8WUQ7|.	.;CS029_HUMAN|.	V|H	499;499;431|325	.|.	ENSP00000221899:A431V|.	A|R	-|+	2|2	0|0	C19orf29|C19orf29OS	3564346|3564346	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	-1.122000|-1.122000	0.03267|0.03267	-0.535000|-0.535000	0.06307|0.06307	-0.258000|-0.258000	0.10820|0.10820	GCG|CGC	G|0.535;A|0.465		0.781	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
ANKRD24	170961	hgsc.bcm.edu	37	19	4217510	4217510	+	Missense_Mutation	SNP	A	A	T	rs12980998	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:4217510A>T	ENST00000600132.1	+	18	2629	c.2353A>T	c.(2353-2355)Aca>Tca	p.T785S	ANKRD24_ENST00000262970.5_Missense_Mutation_p.T875S|ANKRD24_ENST00000318934.4_Missense_Mutation_p.T785S	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	785										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		cggTGACACCACACAGCTGCG	0.781													A|||	1351	0.269768	0.2753	0.3199	5008	,	,		7134	0.3373		0.1471	False		,,,				2504	0.2832				p.T785S		.											.	ANKRD24-68	0			c.A2353T						.						1.0	2.0	2.0					19																	4217510		742	1718	2460	SO:0001583	missense	170961	exon18			GACACCACACAGC	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2353A>T	19.37:g.4217510A>T	ENSP00000471252:p.Thr785Ser	0	0		11	4	NM_133475	0	0	0	0	0	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	586	0.2683150183150183	155	0.3150406504065041	121	0.3342541436464088	191	0.3339160839160839	119	0.15699208443271767	a	3.203	-0.163321	0.06502	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.30182	1.55;1.54	4.0	0.266	0.15617	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.10296	0.001;0.003	B;B	0.08055	0.001;0.003	T	0.47005	-0.9150	8	0.10636	T	0.68	-10.5094	5.6286	0.17497	0.1632:0.1671:0.6697:0.0	rs12980998;rs60680356	785;875	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	S	785;875	ENSP00000321731:T785S;ENSP00000262970:T875S	ENSP00000262970:T875S	T	+	1	0	ANKRD24	4168510	0.000000	0.05858	0.030000	0.17652	0.004000	0.04260	0.197000	0.17197	0.307000	0.22880	-1.492000	0.00969	ACA	A|0.731;T|0.269		0.781	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
EMR1	2015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6937659	6937659	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:6937659G>A	ENST00000312053.4	+	20	2692	c.2655G>A	c.(2653-2655)acG>acA	p.T885T	EMR1_ENST00000450315.3_Splice_Site_p.T708T|EMR1_ENST00000381407.5_Splice_Site_p.T744T|EMR1_ENST00000381404.4_Splice_Site_p.T866T|EMR1_ENST00000250572.8_Splice_Site_p.T820T	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	885					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					CTTCCAAGACGGTGAGAGACT	0.582																																					p.T885T		.											.	EMR1-526	0			c.G2655A						.						123.0	100.0	108.0					19																	6937659		2203	4300	6503	SO:0001630	splice_region_variant	2015	exon20			CAAGACGGTGAGA	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2655+1G>A	19.37:g.6937659G>A		100	0		104	29	NM_001974	0	0	0	0	0	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	ENST00000312053.4	37	CCDS12175.1																																																																																			.		0.582	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		Silent
KANK3	256949	hgsc.bcm.edu	37	19	8399635	8399635	+	Missense_Mutation	SNP	C	C	T	rs890853	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:8399635C>T	ENST00000593649.1	-	3	1141	c.1076G>A	c.(1075-1077)cGc>cAc	p.R359H	KANK3_ENST00000330915.3_Missense_Mutation_p.R359H			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	359			R -> H (in dbSNP:rs890853).							breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGACTGGCGCGCAGCAGCTC	0.761													C|||	962	0.192093	0.093	0.3847	5008	,	,		10548	0.2113		0.2545	False		,,,				2504	0.1053				p.R359H		.											.	KANK3-90	0			c.G1076A						.						1.0	1.0	1.0					19																	8399635		1163	2476	3639	SO:0001583	missense	256949	exon3			CTGGCGCGCAGCA	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1076G>A	19.37:g.8399635C>T	ENSP00000470728:p.Arg359His	3	0		13	10	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	37		505	0.23122710622710624	63	0.12804878048780488	131	0.36187845303867405	117	0.20454545454545456	194	0.2559366754617414	C	13.09	2.134512	0.37630	.	.	ENSG00000186994	ENST00000330915	T	0.54071	0.59	4.52	0.959	0.19624	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.53688	P	2.8999999999945736E-5	B	0.16396	0.017	B	0.09377	0.004	T	0.33394	-0.9870	8	0.54805	T	0.06	-23.4019	6.9118	0.24338	0.0:0.5682:0.0:0.4318	rs890853	359	Q6NY19-2	.	H	359	ENSP00000328923:R359H	ENSP00000328923:R359H	R	-	2	0	KANK3	8305635	0.014000	0.17966	0.688000	0.30117	0.060000	0.15804	0.173000	0.16724	0.468000	0.27243	0.297000	0.19635	CGC	C|0.769;T|0.231		0.761	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
PLPPR2	64748	broad.mit.edu	37	19	11472132	11472132	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:11472132G>T	ENST00000251473.5	+	6	1007	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	DKFZP761J1410_ENST00000591608.1_Missense_Mutation_p.A186S	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CAAGGATGCGGCCCTCTGCGC	0.692																																					p.A211S		.											.	LPPR2-153	0			c.G631T						.						26.0	29.0	28.0					19																	11472132		2199	4277	6476	SO:0001583	missense	0	exon6			GATGCGGCCCTCT																												ENST00000251473.5:c.631G>T	19.37:g.11472132G>T	ENSP00000251473:p.Ala211Ser	13	0		150	14	NM_022737	0	0	18	20	2		Missense_Mutation	SNP	ENST00000251473.5	37	CCDS12258.1	.	.	.	.	.	.	.	.	.	.	g	33	5.243323	0.95272	.	.	ENSG00000105520	ENST00000251473	T	0.75477	-0.94	5.36	5.36	0.76844	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	N	0.16166	0.38	0.80722	D	1	P;P	0.45902	0.851;0.868	P;P	0.59012	0.58;0.85	T	0.64415	-0.6413	10	0.02654	T	1	-25.3512	17.8761	0.88825	0.0:0.0:1.0:0.0	.	186;211	Q96GM1-2;Q96GM1	.;LPPR2_HUMAN	S	211	ENSP00000251473:A211S	ENSP00000251473:A211S	A	+	1	0	AC024575.1	11333132	1.000000	0.71417	0.969000	0.41365	0.979000	0.70002	7.161000	0.77505	2.524000	0.85096	0.550000	0.68814	GCC	.		0.692	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458779.1		
CACNA1A	773	hgsc.bcm.edu	37	19	13409706	13409706	+	Missense_Mutation	SNP	C	C	T	rs373189944		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:13409706C>T	ENST00000360228.5	-	19	2740	c.2741G>A	c.(2740-2742)gGg>gAg	p.G914E	CACNA1A_ENST00000573710.2_Missense_Mutation_p.G915E	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	915			P -> S (in dbSNP:rs16020).		adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCAGAACCCGGGTTGCTC	0.771																																					p.G915E		.											.	CACNA1A-67	0			c.G2744A						.						8.0	9.0	9.0					19																	13409706		1770	3822	5592	SO:0001583	missense	773	exon19			CAGAACCCGGGTT	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2741G>A	19.37:g.13409706C>T	ENSP00000353362:p.Gly914Glu	0	0		9	6	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	2.297	-0.360998	0.05103	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.95554	-3.74	4.22	3.18	0.36537	.	1.793560	0.03909	N	0.281670	D	0.90253	0.6952	N	0.14661	0.345	0.18873	N	0.999981	B;B;B	0.32245	0.089;0.006;0.361	B;B;B	0.35470	0.023;0.005;0.203	T	0.83115	-0.0121	10	0.19590	T	0.45	.	6.3597	0.21420	0.1805:0.7212:0.0:0.0983	.	915;918;914	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	E	914;918;915;915	ENSP00000353362:G914E	ENSP00000317661:G915E	G	-	2	0	CACNA1A	13270706	0.019000	0.18553	0.331000	0.25455	0.054000	0.15201	-0.477000	0.06583	0.768000	0.33290	-0.481000	0.04817	GGG	.		0.771	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
MYO9B	4650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17296757	17296757	+	Silent	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:17296757C>T	ENST00000594824.1	+	18	2671	c.2524C>T	c.(2524-2526)Ctg>Ttg	p.L842L	MYO9B_ENST00000397274.2_Silent_p.L842L|MYO9B_ENST00000595618.1_Silent_p.L842L			Q13459	MYO9B_HUMAN	myosin IXB	842	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CTTGGAGGCACTGGGGAAGGC	0.532																																					p.L842L		.											.	MYO9B-67	0			c.C2524T						.						94.0	95.0	95.0					19																	17296757		1929	4125	6054	SO:0001819	synonymous_variant	4650	exon18			GAGGCACTGGGGA		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2524C>T	19.37:g.17296757C>T		116	0		132	25	NM_001130065	0	0	41	60	19	O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	37																																																																																				.		0.532	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
ADCK4	79934	broad.mit.edu	37	19	41209717	41209717	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:41209717A>C	ENST00000324464.3	-	8	921	c.620T>G	c.(619-621)gTg>gGg	p.V207G	ADCK4_ENST00000450541.1_Missense_Mutation_p.V166G|ADCK4_ENST00000243583.6_Missense_Mutation_p.V166G	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	207	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			caaggaggccaccttggcctg	0.627																																					p.V207G		.											.	ADCK4-319	0			c.T620G						.						31.0	32.0	31.0					19																	41209717		2203	4300	6503	SO:0001583	missense	79934	exon8			GAGGCCACCTTGG	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.620T>G	19.37:g.41209717A>C	ENSP00000315118:p.Val207Gly	99	17		104	23	NM_024876	0	0	20	22	2	Q8TAJ1|Q9HA52	Missense_Mutation	SNP	ENST00000324464.3	37	CCDS12562.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672352	0.67928	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.54479	0.57;0.57;0.57	5.4	5.4	0.78164	ABC-1 (1);Protein kinase-like domain (1);	0.202272	0.43110	D	0.000618	T	0.58148	0.2102	M	0.65975	2.015	0.80722	D	1	P;B	0.36222	0.544;0.115	B;B	0.41813	0.367;0.119	T	0.63519	-0.6619	10	0.87932	D	0	-8.5582	14.4234	0.67200	1.0:0.0:0.0:0.0	.	207;166	Q96D53;Q96D53-2	ADCK4_HUMAN;.	G	207;166;166	ENSP00000315118:V207G;ENSP00000412839:V166G;ENSP00000243583:V166G	ENSP00000243583:V166G	V	-	2	0	ADCK4	45901557	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.001000	0.93568	2.054000	0.61138	0.533000	0.62120	GTG	.		0.627	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462731.1	NM_024876	
CIC	23152	hgsc.bcm.edu	37	19	42799208	42799208	+	Silent	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:42799208G>A	ENST00000575354.2	+	20	4732	c.4692G>A	c.(4690-4692)tcG>tcA	p.S1564S	CIC_ENST00000572681.2_Silent_p.S2470S|CIC_ENST00000160740.3_Silent_p.S1562S	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1564	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				cacccagctcggactctggca	0.761			"""Mis, F, S"""		oligodendroglioma																																p.S1564S		.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC-591	0			c.G4692A						.						2.0	3.0	3.0					19																	42799208		1772	3621	5393	SO:0001819	synonymous_variant	23152	exon20			CAGCTCGGACTCT	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.4692G>A	19.37:g.42799208G>A		0	0		14	8	NM_015125	0	0	11	22	11	Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	ENST00000575354.2	37	CCDS12601.1																																																																																			.		0.761	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	1	0		44	18	NM_000400	0	0	17	32	15	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		0	0		38	15	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
SLC1A5	6510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47280654	47280654	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:47280654G>A	ENST00000542575.2	-	6	1695	c.1067C>T	c.(1066-1068)aCg>aTg	p.T356M	SLC1A5_ENST00000434726.2_Missense_Mutation_p.T154M|SLC1A5_ENST00000594991.1_Missense_Mutation_p.T180M|SLC1A5_ENST00000412532.2_Missense_Mutation_p.T128M	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	356					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	CAGCGGCAGCGTGGCGGAACT	0.632																																					p.T356M		.											.	SLC1A5-90	0			c.C1067T						.						44.0	35.0	38.0					19																	47280654		2203	4300	6503	SO:0001583	missense	6510	exon6			GGCAGCGTGGCGG	U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1067C>T	19.37:g.47280654G>A	ENSP00000444408:p.Thr356Met	111	0		121	25	NM_005628	0	0	0	0	0	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	ENST00000542575.2	37	CCDS12692.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715346	0.89112	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.69685	-0.42;-0.42;-0.42	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.89047	0.6604	H	0.98487	4.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.99;0.99	D	0.93169	0.6564	10	0.87932	D	0	-36.2035	17.2957	0.87170	0.0:0.0:1.0:0.0	.	154;356;356	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	M	356;154;128;363	ENSP00000444408:T356M;ENSP00000406532:T154M;ENSP00000397924:T128M	ENSP00000303623:T363M	T	-	2	0	SLC1A5	51972494	1.000000	0.71417	0.981000	0.43875	0.850000	0.48378	9.588000	0.98232	2.619000	0.88677	0.462000	0.41574	ACG	.		0.632	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
SLC8A2	6543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47935685	47935685	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:47935685C>T	ENST00000236877.6	-	9	2523	c.2128G>A	c.(2128-2130)Gag>Aag	p.E710K	SLC8A2_ENST00000542837.1_Missense_Mutation_p.E466K|SLC8A2_ENST00000601757.1_5'UTR|SLC8A2_ENST00000539381.1_Missense_Mutation_p.E173K	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	710					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GACCCGTCCTCCTCCTCCTCC	0.612																																					p.E710K		.											.	SLC8A2-94	0			c.G2128A						.						66.0	69.0	68.0					19																	47935685		2203	4300	6503	SO:0001583	missense	6543	exon9			CGTCCTCCTCCTC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2128G>A	19.37:g.47935685C>T	ENSP00000236877:p.Glu710Lys	87	0		95	14	NM_015063	0	0	5	9	4	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	37	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810771	0.70797	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000539381;ENST00000542837	T;T;T	0.66099	1.3;-0.19;1.16	4.23	4.23	0.50019	.	0.071055	0.53938	D	0.000046	T	0.54303	0.1850	N	0.17631	0.505	0.58432	D	0.999993	P;P	0.52463	0.953;0.651	P;B	0.47603	0.551;0.165	T	0.61287	-0.7093	10	0.54805	T	0.06	.	15.9664	0.79974	0.0:1.0:0.0:0.0	.	538;710	E9PGS7;Q9UPR5	.;NAC2_HUMAN	K	538;710;173;466	ENSP00000236877:E710K;ENSP00000440588:E173K;ENSP00000437536:E466K	ENSP00000236877:E710K	E	-	1	0	SLC8A2	52627497	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.623000	0.83113	2.377000	0.81083	0.558000	0.71614	GAG	.		0.612	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205288	48205288	+	Silent	SNP	G	G	A	rs8100472	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:48205288G>A	ENST00000396720.3	+	15	4493	c.4299G>A	c.(4297-4299)gcG>gcA	p.A1433A	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1433										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCGAGCTGGCGGCCGTGGAGG	0.771													G|||	514	0.102636	0.2519	0.0548	5008	,	,		5835	0.001		0.0577	False		,,,				2504	0.0859				p.A1433A		.											.	GLTSCR1-48	0			c.G4299A						.	G		266,1774		1,264,755	1.0	2.0	2.0		4299	-3.5	1.0	19	dbSNP_116	2	222,4724		0,222,2251	no	coding-synonymous	GLTSCR1	NM_015711.3		1,486,3006	AA,AG,GG		4.4885,13.0392,6.9854		1433/1561	48205288	488,6498	1020	2473	3493	SO:0001819	synonymous_variant	29998	exon15			GCTGGCGGCCGTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4299G>A	19.37:g.48205288G>A		0	0		15	8	NM_015711	0	0	0	0	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			G|0.917;A|0.083		0.771	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
MYH14	79784	hgsc.bcm.edu	37	19	50713713	50713713	+	Missense_Mutation	SNP	C	C	A	rs590722	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:50713713C>A	ENST00000596571.1	+	1	91	c.91C>A	c.(91-93)Ccc>Acc	p.P31T	MYH14_ENST00000262269.8_Missense_Mutation_p.P31T|MYH14_ENST00000598205.1_Missense_Mutation_p.P31T|MYH14_ENST00000601313.1_Missense_Mutation_p.P31T|MYH14_ENST00000440075.2_Missense_Mutation_p.P31T|MYH14_ENST00000425460.1_Missense_Mutation_p.P31T|MYH14_ENST00000376970.2_Missense_Mutation_p.P31T			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	31					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCTGTTCACGCCCCGCGGGCC	0.766													C|||	941	0.187899	0.1581	0.1527	5008	,	,		8614	0.2579		0.1372	False		,,,				2504	0.2331				p.P31T		.											.	MYH14-23	0			c.C91A						.	C	THR/PRO,THR/PRO,THR/PRO	319,2625		14,291,1167	3.0	4.0	4.0		91,91,91	2.2	0.0	19	dbSNP_83	4	784,5950		48,688,2631	no	missense,missense,missense	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	38,38,38	62,979,3798	AA,AC,CC		11.6424,10.8356,11.397	possibly-damaging,possibly-damaging,possibly-damaging	31/2004,31/2037,31/1996	50713713	1103,8575	1472	3367	4839	SO:0001583	missense	79784	exon2			TTCACGCCCCGCG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.91C>A	19.37:g.50713713C>A	ENSP00000472819:p.Pro31Thr	0	0		10	6	NM_001077186	0	0	0	0	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	373	0.1707875457875458	76	0.15447154471544716	47	0.1298342541436464	140	0.24475524475524477	110	0.14511873350923482	C	14.02	2.410075	0.42715	0.108356	0.116424	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.86097	-2.07;-2.04;-2.02;-2.06	4.46	2.2	0.27929	.	.	.	.	.	T	0.00073	0.0002	N	0.19112	0.55	0.80722	P	0.0	B;B;B	0.26876	0.162;0.038;0.063	B;B;B	0.21917	0.037;0.016;0.037	T	0.09487	-1.0672	8	0.72032	D	0.01	.	12.3488	0.55136	0.0:0.4912:0.5088:0.0	rs590722	31;31;31	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	T	31	ENSP00000406273:P31T;ENSP00000366169:P31T;ENSP00000407879:P31T;ENSP00000262269:P31T	ENSP00000262269:P31T	P	+	1	0	MYH14	55405525	0.000000	0.05858	0.026000	0.17262	0.272000	0.26649	0.139000	0.16036	0.565000	0.29255	0.555000	0.69702	CCC	T|0.171;G|0.829		0.766	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000598418.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		17	17	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	2	2		25	24	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
RGPD8	727851	broad.mit.edu	37	2	113147740	113147740	+	Missense_Mutation	SNP	C	C	T	rs201000445	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:113147740C>T	ENST00000302558.3	-	20	2973	c.2782G>A	c.(2782-2784)Gaa>Aaa	p.E928K	RGPD8_ENST00000409750.1_Missense_Mutation_p.E788K	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	928					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						TTTCCTGGTTCCGAAATGCCA	0.408													.|||	85	0.0169728	0.0015	0.0432	5008	,	,		19395	0.0		0.0507	False		,,,				2504	0.002				p.E928K		.											.	.	0			c.G2782A						.						9.0	15.0	13.0					2																	113147740		671	1519	2190	SO:0001583	missense	727851	exon20			CTGGTTCCGAAAT	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.2782G>A	2.37:g.113147740C>T	ENSP00000306637:p.Glu928Lys	251	0		226	11	NM_001164463	0	0	56	56	0	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	-	7.016	0.557839	0.13436	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.44083	0.93;0.93	2.33	2.33	0.28932	.	.	.	.	.	T	0.41373	0.1156	M	0.68317	2.08	0.80722	D	1	D	0.55605	0.972	P	0.46885	0.53	T	0.36138	-0.9760	9	0.13108	T	0.6	-32.8575	10.3919	0.44175	0.0:1.0:0.0:0.0	.	928	O14715	RGPD8_HUMAN	K	928;788	ENSP00000306637:E928K;ENSP00000386511:E788K	ENSP00000306637:E928K	E	-	1	0	RGPD8	112864211	1.000000	0.71417	0.833000	0.33012	0.213000	0.24496	6.744000	0.74854	1.309000	0.44985	0.175000	0.17021	GAA	C|0.998;T|0.002		0.408	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
ANKRD30BL	554226	broad.mit.edu	37	2	132919070	132919070	+	Missense_Mutation	SNP	G	G	C	rs568587234	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:132919070G>C	ENST00000409867.1	-	1	458	c.209C>G	c.(208-210)gCg>gGg	p.A70G	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	70										endometrium(1)|kidney(3)	4						CCTCTTCTTCGCATCTCTTAT	0.617																																					.		.											.	.	0			.						.																																			SO:0001583	missense	554226	.			TTCTTCGCATCTC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.209C>G	2.37:g.132919070G>C	ENSP00000386398:p.Ala70Gly	67	1		74	4	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	8.318	0.823626	0.16678	.	.	ENSG00000163046	ENST00000409867	T	0.65916	-0.18	0.484	-0.968	0.10313	.	.	.	.	.	T	0.50599	0.1625	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45977	-0.9224	5	0.56958	D	0.05	.	.	.	.	.	.	.	.	G	70	ENSP00000386398:A70G	ENSP00000295181:A70G	A	-	2	0	ANKRD30BL	132635540	0.001000	0.12720	0.000000	0.03702	0.020000	0.10135	-0.352000	0.07701	-1.392000	0.02082	-0.876000	0.02978	GCG	.		0.617	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
BMPR2	659	hgsc.bcm.edu	37	2	203379616	203379616	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:203379616C>T	ENST00000374580.4	+	5	1074	c.535C>T	c.(535-537)Cgt>Tgt	p.R179C	BMPR2_ENST00000374574.2_Missense_Mutation_p.R179C	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	179					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						TATAGGAGACCGTAAACAAGG	0.353																																					p.R179C		.											.	BMPR2-1003	0			c.C535T						.						124.0	114.0	117.0					2																	203379616		2203	4300	6503	SO:0001583	missense	659	exon5			GGAGACCGTAAAC	Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.535C>T	2.37:g.203379616C>T	ENSP00000363708:p.Arg179Cys	70	0		32	2	NM_001204	0	0	0	0	0	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361602	0.41801	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.90385	-2.66;-2.62	5.92	5.04	0.67666	Protein kinase-like domain (1);	0.143965	0.64402	D	0.000004	D	0.83403	0.5247	N	0.14661	0.345	0.58432	D	0.999992	B;B	0.19073	0.033;0.025	B;B	0.10450	0.005;0.003	T	0.77928	-0.2404	10	0.37606	T	0.19	.	16.7031	0.85364	0.1302:0.8698:0.0:0.0	.	179;179	Q13161;Q13873	.;BMPR2_HUMAN	C	179	ENSP00000363708:R179C;ENSP00000363702:R179C	ENSP00000363702:R179C	R	+	1	0	BMPR2	203087861	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	3.657000	0.54474	1.474000	0.48178	0.650000	0.86243	CGT	.		0.353	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
DES	1674	hgsc.bcm.edu	37	2	220283238	220283238	+	Silent	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:220283238C>T	ENST00000373960.3	+	1	140	c.54C>T	c.(52-54)ttC>ttT	p.F18F		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	18	Head.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCCGCACCTTCGGCGGGGCCC	0.746																																					p.F18F		.											.	DES-514	0			c.C54T						.						9.0	11.0	11.0					2																	220283238		1801	3589	5390	SO:0001819	synonymous_variant	1674	exon1			CACCTTCGGCGGG	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.54C>T	2.37:g.220283238C>T		0	0		32	15	NM_001927	0	0	0	0	0	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Silent	SNP	ENST00000373960.3	37	CCDS33383.1																																																																																			.		0.746	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927	
SPEG	10290	hgsc.bcm.edu	37	2	220348480	220348480	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:220348480G>C	ENST00000312358.7	+	30	6427	c.6295G>C	c.(6295-6297)Gct>Cct	p.A2099P	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2099					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGGGGGCCGTGCTCGGGACCC	0.731																																					p.A2099P		.											.	SPEG-383	0			c.G6295C						.						3.0	3.0	3.0					2																	220348480		1508	3434	4942	SO:0001583	missense	10290	exon30			GGCCGTGCTCGGG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.6295G>C	2.37:g.220348480G>C	ENSP00000311684:p.Ala2099Pro	0	0		6	5	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	8.687	0.906576	0.17833	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.64991	-0.13	3.92	3.04	0.35103	.	0.000000	0.35096	U	0.003447	T	0.46964	0.1420	N	0.19112	0.55	0.80722	D	1	P	0.48911	0.917	B	0.44315	0.446	T	0.33007	-0.9885	10	0.28530	T	0.3	.	11.108	0.48214	0.0923:0.0:0.9077:0.0	.	2099	Q15772	SPEG_HUMAN	P	2099	ENSP00000311684:A2099P	ENSP00000265327:A2099P	A	+	1	0	SPEG	220056724	0.054000	0.20591	0.083000	0.20561	0.707000	0.40811	2.193000	0.42658	0.873000	0.35799	0.442000	0.29010	GCT	.		0.731	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
ALPPL2	251	hgsc.bcm.edu	37	2	233274476	233274476	+	Missense_Mutation	SNP	G	G	C	rs114768772		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr2:233274476G>C	ENST00000295453.3	+	11	1545	c.1493G>C	c.(1492-1494)cGc>cCc	p.R498P		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CTGGCGCCCCGCGCCGGCACC	0.726																																					p.R498P		.											.	ALPPL2-91	0			c.G1493C						.						12.0	16.0	15.0					2																	233274476		2172	4236	6408	SO:0001583	missense	251	exon11			CGCCCCGCGCCGG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1493G>C	2.37:g.233274476G>C	ENSP00000295453:p.Arg498Pro	0	0		25	12	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	194	0.08882783882783883	42	0.08536585365853659	21	0.058011049723756904	71	0.12412587412587413	60	0.079155672823219	a	0.009	-1.842776	0.00568	.	.	ENSG00000163286	ENST00000295453	D	0.95622	-3.76	2.39	1.49	0.22878	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.05640	0.0148	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55425	-0.8143	10	0.02654	T	1	.	6.1524	0.20318	0.3771:0.4391:0.1839:0.0	.	498	P10696	PPBN_HUMAN	P	498	ENSP00000295453:R498P	ENSP00000295453:R498P	R	+	2	0	ALPPL2	232982720	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.066000	0.11598	-0.037000	0.13646	-2.747000	0.00125	CGC	G|0.946;C|0.054		0.726	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
NECAB3	63941	bcgsc.ca	37	20	32257182	32257182	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr20:32257182A>G	ENST00000246190.6	-	5	441	c.386T>C	c.(385-387)cTg>cCg	p.L129P	NECAB3_ENST00000375238.4_Splice_Site_p.L129P	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	129					protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						TCCACTCACCAGCTTGGTGGC	0.587																																					p.L129P		.											.	NECAB3-91	0			c.T386C						.						47.0	55.0	52.0					20																	32257182		2152	4257	6409	SO:0001630	splice_region_variant	63941	exon5			CTCACCAGCTTGG	AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.387+1T>C	20.37:g.32257182A>G		83	0		65	5	NM_031232	0	0	1	1	0	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Missense_Mutation	SNP	ENST00000246190.6	37	CCDS42866.1	.	.	.	.	.	.	.	.	.	.	A	7.860	0.725809	0.15439	.	.	ENSG00000125967	ENST00000375238;ENST00000246190;ENST00000439478	T;T;T	0.22743	2.26;2.52;1.94	5.16	4.05	0.47172	.	0.708561	0.13227	N	0.403921	T	0.38268	0.1034	L	0.56769	1.78	0.80722	D	1	D;B;B;B	0.76494	0.999;0.011;0.053;0.088	D;B;B;B	0.69654	0.965;0.013;0.027;0.06	T	0.03433	-1.1037	10	0.46703	T	0.11	-15.2278	8.1461	0.31113	0.8215:0.0:0.0:0.1785	.	129;6;129;129	Q96P71-3;E1P5N3;Q96P71;Q96P71-2	.;.;NECA3_HUMAN;.	P	129	ENSP00000364386:L129P;ENSP00000246190:L129P;ENSP00000392064:L129P	ENSP00000246190:L129P	L	-	2	0	NECAB3	31720843	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	2.104000	0.41815	0.966000	0.38159	-0.695000	0.03696	CTG	.		0.587	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078724.2		Missense_Mutation
TNNC2	7125	bcgsc.ca	37	20	44452697	44452697	+	Silent	SNP	C	C	A	rs4629	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr20:44452697C>A	ENST00000372555.3	-	5	476	c.384G>T	c.(382-384)acG>acT	p.T128T	TNNC2_ENST00000372557.1_Silent_p.T113T	NM_003279.2	NP_003270.1	P02585	TNNC2_HUMAN	troponin C type 2 (fast)	128	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				muscle filament sliding (GO:0030049)|regulation of muscle contraction (GO:0006937)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.0122)			Felodipine(DB01023)	TCTCCTCGTCCGTCACGTGCT	0.612													C|||	2027	0.404752	0.1815	0.5476	5008	,	,		17060	0.5308		0.5378	False		,,,				2504	0.3384				p.T128T		.											.	TNNC2-91	0			c.G384T						.	C		1148,3258	406.4+/-333.9	155,838,1210	162.0	141.0	148.0		384	-5.9	0.9	20	dbSNP_52	148	4562,4038	596.6+/-393.6	1206,2150,944	no	coding-synonymous	TNNC2	NM_003279.2		1361,2988,2154	AA,AC,CC		46.9535,26.0554,43.9028		128/161	44452697	5710,7296	2203	4300	6503	SO:0001819	synonymous_variant	7125	exon5			CTCGTCCGTCACG		CCDS13375.1	20q12-q13.11	2013-01-10	2005-09-12		ENSG00000101470	ENSG00000101470		"""EF-hand domain containing"""	11944	protein-coding gene	gene with protein product		191039	"""troponin C2, fast"""			2373703	Standard	NM_003279		Approved		uc002xpr.3	P02585	OTTHUMG00000032623	ENST00000372555.3:c.384G>T	20.37:g.44452697C>A		135	1		88	5	NM_003279	0	0	14	14	0	Q6FH92	Silent	SNP	ENST00000372555.3	37	CCDS13375.1																																																																																			C|0.569;A|0.431		0.612	TNNC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079524.3	NM_003279	
KRTAP10-10	353333	bcgsc.ca	37	21	46057590	46057590	+	Missense_Mutation	SNP	A	A	T	rs9306109	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr21:46057590A>T	ENST00000380095.1	+	1	318	c.256A>T	c.(256-258)Acc>Tcc	p.T86S	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	86	15 X 5 AA repeats of C-C-X(3).		T -> S (in dbSNP:rs9306109).			keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GGATTGCTGCACCTCCTCCCc	0.642													A|||	958	0.191294	0.1415	0.0735	5008	,	,		20959	0.2956		0.1451	False		,,,				2504	0.2822				p.T86S		.											.	KRTAP10-10-90	0			c.A256T						.	A	,SER/THR	702,3704	293.0+/-282.3	51,600,1552	121.0	115.0	117.0		,256	-2.5	0.2	21	dbSNP_119	117	1099,7501	229.3+/-264.0	68,963,3269	no	intron,missense	TSPEAR,KRTAP10-10	NM_144991.2,NM_181688.1	,58	119,1563,4821	TT,TA,AA		12.7791,15.9328,13.8475	,possibly-damaging	,86/252	46057590	1801,11205	2203	4300	6503	SO:0001583	missense	353333	exon1			TGCTGCACCTCCT	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.256A>T	21.37:g.46057590A>T	ENSP00000369438:p.Thr86Ser	132	1		100	6	NM_181688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	362	0.16575091575091574	57	0.11585365853658537	33	0.09116022099447514	160	0.27972027972027974	112	0.14775725593667546	a	6.519	0.463966	0.12402	0.159328	0.127791	ENSG00000221859	ENST00000380095	T	0.01347	4.99	3.11	-2.5	0.06384	.	.	.	.	.	T	0.00012	0.0000	L	0.50333	1.59	0.80722	P	0.0	B	0.14805	0.011	B	0.19666	0.026	T	0.38001	-0.9681	8	0.22109	T	0.4	.	5.492	0.16781	0.374:0.4681:0.0:0.1579	rs9306109	86	P60014	KR10A_HUMAN	S	86	ENSP00000369438:T86S	ENSP00000369438:T86S	T	+	1	0	KRTAP10-10	44882018	0.001000	0.12720	0.193000	0.23327	0.042000	0.13812	-0.170000	0.09897	-0.213000	0.10094	0.383000	0.25322	ACC	A|0.853;T|0.147		0.642	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		200	0		143	54	NM_021076	0	0	57	57	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SAMM50	25813	bcgsc.ca	37	22	44368122	44368122	+	Missense_Mutation	SNP	A	A	G	rs3761472	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr22:44368122A>G	ENST00000350028.4	+	5	486	c.329A>G	c.(328-330)gAc>gGc	p.D110G	SAMM50_ENST00000493161.1_3'UTR|SAMM50_ENST00000396202.3_Intron	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	110			D -> G (in dbSNP:rs3761472). {ECO:0000269|PubMed:14702039}.		cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)		p.D110G(1)		endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TTAGGTGATGACGCACTTCCA	0.363													A|||	1223	0.244209	0.171	0.2968	5008	,	,		17374	0.371		0.1879	False		,,,				2504	0.2331				p.D110G		.											.	SAMM50-91	1	Substitution - Missense(1)	stomach(1)	c.A329G						.	A	GLY/ASP	786,3620	318.5+/-295.7	88,610,1505	123.0	113.0	116.0		329	4.8	0.9	22	dbSNP_107	116	1339,7261	263.0+/-284.7	107,1125,3068	yes	missense	SAMM50	NM_015380.4	94	195,1735,4573	GG,GA,AA		15.5698,17.8393,16.3386	benign	110/470	44368122	2125,10881	2203	4300	6503	SO:0001583	missense	25813	exon5			GTGATGACGCACT	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.329A>G	22.37:g.44368122A>G	ENSP00000345445:p.Asp110Gly	121	1		83	4	NM_015380	0	0	0	0	0	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	ENST00000350028.4	37	CCDS14055.1	554	0.25366300366300365	86	0.17479674796747968	96	0.26519337016574585	232	0.40559440559440557	140	0.18469656992084432	A	14.99	2.701189	0.48307	0.178393	0.155698	ENSG00000100347	ENST00000350028	T	0.54279	0.58	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.53249	1.67	0.09310	P	1.0	B	0.14438	0.01	B	0.17722	0.019	T	0.33574	-0.9863	9	0.48119	T	0.1	-28.447	13.7811	0.63084	1.0:0.0:0.0:0.0	rs3761472;rs11547246;rs52828379;rs57886466;rs3761472	110	Q9Y512	SAM50_HUMAN	G	110	ENSP00000345445:D110G	ENSP00000345445:D110G	D	+	2	0	SAMM50	42699455	0.998000	0.40836	0.898000	0.35279	0.991000	0.79684	3.639000	0.54339	1.916000	0.55485	0.533000	0.62120	GAC	A|0.790;G|0.210		0.363	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318898.2	NM_015380	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	159	1		155	60	NM_001098209	0	1	472	734	261	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
APEH	327	broad.mit.edu	37	3	49723596	49723596	+	IGR	SNP	G	G	A	rs200900272		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:49723596G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.P349L|MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P335L(5)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGAGCCGTCGGGGTTCCGGCA	0.667																																					p.P349L		.											.	MST1-278	5	Substitution - Missense(5)	endometrium(3)|skin(2)	c.C1046T						.						12.0	16.0	15.0					3																	49723596		2189	4280	6469	SO:0001628	intergenic_variant	4485	exon9			CCGTCGGGGTTCC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723596G>A		71	1		71	3	NM_020998	0	0	5	5	0	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	35	5.499226	0.96355	.	.	ENSG00000173531	ENST00000449682	D	0.83250	-1.7	5.47	5.47	0.80525	.	0.000000	0.42053	D	0.000771	D	0.90256	0.6953	M	0.88450	2.955	0.80722	D	1	P	0.35793	0.521	P	0.46419	0.516	D	0.90879	0.4752	10	0.62326	D	0.03	.	18.9304	0.92563	0.0:0.0:1.0:0.0	.	349	G3XAK1	.	L	349	ENSP00000414287:P349L	ENSP00000414287:P349L	P	-	2	0	MST1	49698600	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	9.855000	0.99526	2.561000	0.86390	0.655000	0.94253	CCC	.		0.667	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	0	0		14	9	NM_018397	0	0	1	1	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
FAM208A	23272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	56667845	56667845	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:56667845C>T	ENST00000493960.2	-	18	2984	c.2974G>A	c.(2974-2976)Gac>Aac	p.D992N	FAM208A_ENST00000431842.2_Missense_Mutation_p.D555N|FAM208A_ENST00000355628.5_Missense_Mutation_p.D931N	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	992							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GTCAACACGTCATCCTCAGTG	0.517																																					p.D992N		.											.	.	0			c.G2974A						.						58.0	54.0	55.0					3																	56667845		2203	4300	6503	SO:0001583	missense	23272	exon18			ACACGTCATCCTC	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2974G>A	3.37:g.56667845C>T	ENSP00000417509:p.Asp992Asn	112	0		66	22	NM_001112736	0	0	15	25	10	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988595	0.53934	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.12465	2.68;2.92;2.82	5.62	5.62	0.85841	.	0.256182	0.34245	N	0.004139	T	0.10423	0.0255	N	0.19112	0.55	0.37770	D	0.926632	B;B;B;B	0.34015	0.341;0.435;0.43;0.304	B;B;B;B	0.29862	0.104;0.08;0.108;0.032	T	0.27400	-1.0075	10	0.17369	T	0.5	-15.4126	20.0205	0.97499	0.0:1.0:0.0:0.0	.	992;931;555;992	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	N	555;992;931	ENSP00000399410:D555N;ENSP00000417509:D992N;ENSP00000347845:D931N	ENSP00000347845:D931N	D	-	1	0	C3orf63	56642885	0.189000	0.23263	0.990000	0.47175	0.997000	0.91878	2.761000	0.47589	2.801000	0.96364	0.650000	0.86243	GAC	.		0.517	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
ACPP	55	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132061444	132061444	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:132061444C>T	ENST00000336375.5	+	6	694	c.604C>T	c.(604-606)Ctt>Ttt	p.L202F	ACPP_ENST00000351273.7_Missense_Mutation_p.L202F|ACPP_ENST00000475741.1_Missense_Mutation_p.L169F	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	202					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TGGCCAGGACCTTTTTGGAAT	0.348																																					p.L202F		.											.	ACPP-91	0			c.C604T						.						121.0	126.0	124.0					3																	132061444		2203	4300	6503	SO:0001583	missense	55	exon6			CAGGACCTTTTTG		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.604C>T	3.37:g.132061444C>T	ENSP00000337471:p.Leu202Phe	35	0		40	10	NM_001099	0	0	18	24	6	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	37	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481919	0.84747	.	.	ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273	T;T;T	0.27104	1.69;1.69;1.69	6.08	6.08	0.98989	.	0.092877	0.47852	N	0.000209	T	0.45458	0.1343	L	0.50333	1.59	0.48901	D	0.999721	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.98;0.987	T	0.05178	-1.0901	10	0.35671	T	0.21	.	16.1722	0.81825	0.0:1.0:0.0:0.0	.	202;202;169	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	F	202;169;202	ENSP00000337471:L202F;ENSP00000417744:L169F;ENSP00000323036:L202F	ENSP00000337471:L202F	L	+	1	0	ACPP	133544134	0.961000	0.32948	0.975000	0.42487	0.965000	0.64279	0.494000	0.22467	2.894000	0.99253	0.591000	0.81541	CTT	.		0.348	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
PRR23C	389152	hgsc.bcm.edu	37	3	138763343	138763343	+	Silent	SNP	T	T	G	rs6804898	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:138763343T>G	ENST00000413199.1	-	1	391	c.120A>C	c.(118-120)cgA>cgC	p.R40R	MRPS22_ENST00000495075.1_Intron|PRR23C_ENST00000502927.2_Silent_p.R40R	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	40										breast(2)|lung(7)|skin(2)	11						TGGGCGCCGCTCGGGATTCGG	0.761													G|||	852	0.170128	0.1301	0.2651	5008	,	,		10616	0.2718		0.0845	False		,,,				2504	0.1401				p.R40R		.											.	PRR23C-23	0			c.A120C						.						3.0	5.0	4.0					3																	138763343		573	1394	1967	SO:0001819	synonymous_variant	389152	exon1			CGCCGCTCGGGAT		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.120A>C	3.37:g.138763343T>G		0	0		33	21	NM_001134657	0	0	0	0	0		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			T|0.848;G|0.152		0.761	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
NRROS	375387	broad.mit.edu;bcgsc.ca	37	3	196387651	196387651	+	Silent	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr3:196387651C>T	ENST00000328557.4	+	3	1340	c.1137C>T	c.(1135-1137)acC>acT	p.T379T		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	379					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGCGCTCACCGAGCTGGACC	0.637																																					p.T379T		.											.	LRRC33-92	0			c.C1137T						.						55.0	60.0	58.0					3																	196387651		2203	4300	6503	SO:0001819	synonymous_variant	375387	exon3			GCTCACCGAGCTG	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1137C>T	3.37:g.196387651C>T		57	1		72	22	NM_198565	0	0	1	1	0		Silent	SNP	ENST00000328557.4	37	CCDS3319.1																																																																																			.		0.637	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		0	0		8	6	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
PSAPL1	768239	bcgsc.ca	37	4	7436073	7436073	+	Silent	SNP	C	C	T	rs61740031	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr4:7436073C>T	ENST00000319098.4	-	1	627	c.534G>A	c.(532-534)gcG>gcA	p.A178A	SORCS2_ENST00000511199.1_Intron|SORCS2_ENST00000507866.2_Intron|SORCS2_ENST00000329016.9_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	178					sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				lung(4)	4						CTCCTTCAGGCGCCTGGCGGG	0.627													C|||	637	0.127196	0.0976	0.1369	5008	,	,		17302	0.0764		0.1948	False		,,,				2504	0.1431				p.A178A		.											.	PSAPL1-68	0			c.G534A						.	C	,	464,3454		22,420,1517	12.0	14.0	13.0		534,	-3.3	0.0	4	dbSNP_129	13	1608,6656		161,1286,2685	no	coding-synonymous,intron	SORCS2,PSAPL1	NM_001085382.1,NM_020777.2	,	183,1706,4202	TT,TC,CC		19.4579,11.8428,17.0087	,	178/522,	7436073	2072,10110	1959	4132	6091	SO:0001819	synonymous_variant	768239	exon1			TTCAGGCGCCTGG	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.534G>A	4.37:g.7436073C>T		105	0		73	5	NM_001085382	0	0	0	0	0	A0A184|Q8N7T4	Silent	SNP	ENST00000319098.4	37	CCDS47009.1																																																																																			C|0.870;T|0.130		0.627	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1		
DSPP	1834	bcgsc.ca	37	4	88536953	88536953	+	Missense_Mutation	SNP	G	G	A	rs200486992		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr4:88536953G>A	ENST00000282478.7	+	4	3172	c.3139G>A	c.(3139-3141)Gat>Aat	p.D1047N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1047N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1047	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.527																																					p.D1047N		.											.	DSPP-90	0			c.G3139A						.						46.0	57.0	53.0					4																	88536953		1537	2773	4310	SO:0001583	missense	1834	exon5			AGCAGCGATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3139G>A	4.37:g.88536953G>A	ENSP00000282478:p.Asp1047Asn	347	1		141	12	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	3.566	-0.088574	0.07097	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88201	-2.35;-2.35	1.51	-1.84	0.07809	.	.	.	.	.	T	0.78355	0.4270	L	0.34521	1.04	0.09310	N	1	B	0.26708	0.157	B	0.08055	0.003	T	0.61637	-0.7022	9	0.38643	T	0.18	.	5.2365	0.15448	0.5606:0.0:0.4394:0.0	.	1047	Q9NZW4	DSPP_HUMAN	N	1047	ENSP00000382213:D1047N;ENSP00000282478:D1047N	ENSP00000282478:D1047N	D	+	1	0	DSPP	88755977	0.032000	0.19561	0.079000	0.20413	0.006000	0.05464	0.451000	0.21779	-0.607000	0.05738	-0.791000	0.03333	GAT	.		0.527	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88536999	88536999	+	Missense_Mutation	SNP	A	A	G	rs202222170		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr4:88536999A>G	ENST00000282478.7	+	4	3218	c.3185A>G	c.(3184-3186)gAc>gGc	p.D1062G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1062G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1062	Asp/Ser-rich.			D -> G (in Ref. 1; AAF42472). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgacagcagcgac	0.532																																					p.D1062G		.											.	DSPP-90	0			c.A3185G						.						48.0	61.0	56.0					4																	88536999		1554	2803	4357	SO:0001583	missense	1834	exon5			GCAGTGACAGCAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3185A>G	4.37:g.88536999A>G	ENSP00000282478:p.Asp1062Gly	488	6		251	17	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	6.732	0.503863	0.12822	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88975	-2.45;-2.45	1.51	1.51	0.23008	.	.	.	.	.	D	0.87716	0.6247	L	0.29908	0.895	0.21762	N	0.99955	D	0.76494	0.999	D	0.74023	0.982	T	0.76072	-0.3093	9	0.24483	T	0.36	.	5.1866	0.15187	1.0:0.0:0.0:0.0	.	1062	Q9NZW4	DSPP_HUMAN	G	1062	ENSP00000382213:D1062G;ENSP00000282478:D1062G	ENSP00000282478:D1062G	D	+	2	0	DSPP	88756023	0.386000	0.25180	0.936000	0.37596	0.006000	0.05464	2.307000	0.43682	0.963000	0.38082	0.242000	0.17961	GAC	.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PDCD6	10016	hgsc.bcm.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	CCGGCCCTGGGG	CCGGCCCTGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741														513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798				p.8_12del		.											.	PDCD6-290	2	Deletion - In frame(2)	breast(2)	c.23_34del						.			265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				SO:0001651	inframe_deletion	10016	exon1			ACCGCCCCGGCCC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del	4	2		30	13	NM_013232	0	0	0	0	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	ENST00000264933.4	37	CCDS3854.1																																																																																			.		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
ARRDC3	57561	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	90671379	90671379	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:90671379A>C	ENST00000265138.3	-	4	828	c.562T>G	c.(562-564)Tca>Gca	p.S188A	ARRDC3_ENST00000503192.1_5'UTR	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	188					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		ATTGGGCCTGAGGTACAGAAC	0.398																																					p.S188A		.											.	ARRDC3-136	0			c.T562G						.						127.0	134.0	131.0					5																	90671379		2203	4300	6503	SO:0001583	missense	57561	exon4			GGCCTGAGGTACA	AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.562T>G	5.37:g.90671379A>C	ENSP00000265138:p.Ser188Ala	57	1		77	21	NM_020801	0	0	54	76	22	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	37	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.334267	0.60853	.	.	ENSG00000113369	ENST00000265138	T	0.09163	3.01	5.51	5.51	0.81932	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37320	0.0999	M	0.90082	3.085	0.80722	D	1	D	0.57571	0.98	P	0.60012	0.867	T	0.41875	-0.9484	10	0.51188	T	0.08	-23.7899	15.6179	0.76780	1.0:0.0:0.0:0.0	.	188	Q96B67	ARRD3_HUMAN	A	188	ENSP00000265138:S188A	ENSP00000265138:S188A	S	-	1	0	ARRDC3	90707135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.957000	0.93082	2.094000	0.63399	0.482000	0.46254	TCA	.		0.398	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000505677.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000498871.2_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		5	5	NM_001012761	0	0	0	4	4	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797105	128797105	+	Silent	SNP	G	G	A	rs72663400	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:128797105G>A	ENST00000274487.4	+	2	529	c.384G>A	c.(382-384)ggG>ggA	p.G128G	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	128	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATCCAGCGGGGCTGCCGCCT	0.796													G|||	947	0.189097	0.1846	0.1268	5008	,	,		6055	0.3313		0.1103	False		,,,				2504	0.1738				p.G128G		.											.	ADAMTS19-295	0			c.G384A						.	G		185,1469		5,175,647	1.0	1.0	1.0		384	-0.3	0.9	5	dbSNP_130	1	240,3160		6,228,1466	no	coding-synonymous	ADAMTS19	NM_133638.3		11,403,2113	AA,AG,GG		7.0588,11.185,8.4092		128/1208	128797105	425,4629	827	1700	2527	SO:0001819	synonymous_variant	171019	exon2			CAGCGGGGCTGCC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.384G>A	5.37:g.128797105G>A		0	0		9	7	NM_133638	0	0	0	0	0		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			G|0.815;A|0.185		0.796	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PCDHGA2	56113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140719726	140719726	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:140719726G>T	ENST00000394576.2	+	1	1188	c.1188G>T	c.(1186-1188)aaG>aaT	p.K396N	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	396	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTAGAAAAGTCAGTAGACA	0.438																																					p.K396N		.											.	PCDHGA2-71	0			c.G1188T						.						72.0	75.0	74.0					5																	140719726		2203	4300	6503	SO:0001583	missense	56113	exon1			AGAAAAGTCAGTA	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1188G>T	5.37:g.140719726G>T	ENSP00000378077:p.Lys396Asn	86	0		117	18	NM_018915	0	0	11	15	4	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	3.258	-0.151775	0.06585	.	.	ENSG00000081853	ENST00000394576	T	0.01745	4.66	4.92	2.15	0.27550	Cadherin (4);Cadherin-like (1);	0.531595	0.15445	U	0.262012	T	0.02494	0.0076	L	0.49350	1.555	0.20926	N	0.999825	B;B	0.22003	0.002;0.063	B;B	0.32724	0.047;0.151	T	0.42344	-0.9457	10	0.45353	T	0.12	.	4.9933	0.14226	0.3193:0.2431:0.4377:0.0	.	396;396	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	N	396	ENSP00000378077:K396N	ENSP00000378077:K396N	K	+	3	2	PCDHGA2	140699910	0.000000	0.05858	0.989000	0.46669	0.090000	0.18270	-0.960000	0.03849	0.218000	0.20820	0.561000	0.74099	AAG	.		0.438	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PCDHGA3	56112	mdanderson.org	37	5	140725420	140725420	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:140725420G>A	ENST00000253812.6	+	1	1820	c.1820G>A	c.(1819-1821)cGc>cAc	p.R607H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	607	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTCCTACCGCCTGCTCAAG	0.701																																					p.R607H		.											.	PCDHGA3-68	0			c.G1820A						.						13.0	18.0	16.0					5																	140725420		2118	4177	6295	SO:0001583	missense	56112	exon1			CCTACCGCCTGCT	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1820G>A	5.37:g.140725420G>A	ENSP00000253812:p.Arg607His	134	3		294	47	NM_032011	0	0	33	35	2	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	1.881	-0.457804	0.04508	.	.	ENSG00000254245	ENST00000253812	T	0.53640	0.61	5.27	-1.11	0.09840	Cadherin (4);Cadherin-like (1);	0.537042	0.13722	N	0.367331	T	0.18467	0.0443	N	0.04018	-0.295	0.22066	N	0.999382	B;B	0.24258	0.026;0.1	B;B	0.20767	0.013;0.031	T	0.30794	-0.9966	10	0.02654	T	1	.	9.8531	0.41068	0.7036:0.0:0.2964:0.0	.	607;607	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	H	607	ENSP00000253812:R607H	ENSP00000253812:R607H	R	+	2	0	PCDHGA3	140705604	0.000000	0.05858	0.995000	0.50966	0.972000	0.66771	-0.015000	0.12634	-0.087000	0.12528	-0.336000	0.08194	CGC	.		0.701	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
ARAP3	64411	broad.mit.edu	37	5	141034950	141034950	+	Silent	SNP	C	C	T	rs72792351	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:141034950C>T	ENST00000239440.4	-	32	4193	c.4128G>A	c.(4126-4128)cgG>cgA	p.R1376R	ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000508305.1_Silent_p.R1207R|ARAP3_ENST00000513878.1_Intron	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1376					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						ACAGGGTCCTCCGGTTGTGTA	0.577													C|||	5	0.000998403	0.0	0.0014	5008	,	,		14679	0.0		0.004	False		,,,				2504	0.0				p.R1376R		.											.	ARAP3-291	0			c.G4128A						.	C		6,4386		0,6,2190	76.0	58.0	64.0		4128	5.1	1.0	5	dbSNP_130	64	63,8529		0,63,4233	no	coding-synonymous	ARAP3	NM_022481.5		0,69,6423	TT,TC,CC		0.7332,0.1366,0.5314		1376/1545	141034950	69,12915	2196	4296	6492	SO:0001819	synonymous_variant	64411	exon32			GGTCCTCCGGTTG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4128G>A	5.37:g.141034950C>T		331	1		328	7	NM_022481	0	0	3	3	0	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	37	CCDS4266.1																																																																																			C|0.996;T|0.004		0.577	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
HLA-DQB1	3119	bcgsc.ca	37	6	32629963	32629963	+	Missense_Mutation	SNP	C	C	T	rs1049100	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr6:32629963C>T	ENST00000399082.3	-	2	216	c.172G>A	c.(172-174)Gtc>Atc	p.V58I	HLA-DQB1_ENST00000399084.1_Missense_Mutation_p.V148I|HLA-DQB1_ENST00000460185.1_5'Flank|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.V148I|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.V148I|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.V148I|HLA-DQB1-AS1_ENST00000419852.1_RNA|XXbac-BPG254F23.6_ENST00000443574.1_RNA			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	148	Beta-1.		Y -> G (in allele DQB1*03:05, allele DQB1*03:17, allele DQB1*04:01, allele DQB1*04:02, allele DQB1*05:01, allele DQB1*05:02, allele DQB1*05:03, allele DQB1*05:04, allele DQB1*05:05 and allele DQB1*06:23; requires 2 nucleotide substitutions).|Y -> L (in allele DQB1*02:01, allele DQB1*02:02, allele DQB1*02:03, allele DQB1*02:04, allele DQB1*02:05, allele DQB1*03:02, allele DQB1*03:03, allele DQB1*03:06, allele DQB1*03:07, allele DQB1*03:08, allele DQB1*03:11, allele DQB1*03:12, allele DQB1*03:15, allele DQB1*03:18, allele DQB1*03:20, allele DQB1*03:23, allele DQB1*03:25, allele DQB1*03:26, allele DQB1*04:03, allele DQB1*06:02, allele DQB1*06:03, allele DQB1*06:04, allele DQB1*06:05, allele DQB1*06:06, allele DQB1*06:07, allele DQB1*06:08, allele DQB1*06:09, allele DQB1*06:10, allele DQB1*06:11, allele DQB1*06:12, allele DQB1*06:13, allele DQB1*06:14, allele DQB1*06:15, allele DQB1*06:16, allele DQB1*06:17, allele DQB1*06:18, allele DQB1*06:19, allele DQB1*06:20, allele DQB1*06:21, allele DQB1*06:22, allele DQB1*06:24, allele DQB1*06:25, allele DQB1*06:27, allele DQB1*06:28, allele DQB1*06:29, allele DQB1*06:30, allele DQB1*06:31, allele DQB1*06:32, allele DQB1*06:33, allele DQB1*06:34, allele DQB1*06:36, allele DQB1*06:37, allele DQB1*06:38 and allele DQB1*06:39; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:3584986}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	ACCGAGCAGACCAGCAGGTTG	0.552									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				C|||	1067	0.213059	0.2284	0.1527	5008	,	,		12092	0.244		0.2008	False		,,,				2504	0.2157				p.V148I	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.G442A						.	C	ILE/VAL	766,3122		97,572,1275	26.0	24.0	25.0		442	3.6	1.0	6	dbSNP_86	25	1351,6891		155,1041,2925	no	missense	HLA-DQB1	NM_002123.4	29	252,1613,4200	TT,TC,CC		16.3917,19.7016,17.4526	benign	148/262	32629963	2117,10013	1944	4121	6065	SO:0001583	missense	3119	exon3	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	AGCAGACCAGCAG		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.172G>A	6.37:g.32629963C>T	ENSP00000382032:p.Val58Ile	69	0		47	5	NM_002123	0	0	3	3	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399082.3	37		444	0.2032967032967033	119	0.241869918699187	69	0.19060773480662985	90	0.15734265734265734	166	0.21899736147757257	.	13.20	2.166325	0.38217	0.197016	0.163917	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084;ENST00000447884	T;T;T;T;T	0.02974	4.09;4.09;4.09;4.09;4.09	4.52	3.64	0.41730	.	0.322278	0.29653	N	0.011558	T	0.01421	0.0046	L	0.49256	1.55	0.37850	P	0.07064300000000001	B;B;B;B	0.18310	0.006;0.003;0.002;0.027	B;B;B;B	0.24701	0.02;0.02;0.02;0.055	T	0.29243	-1.0018	9	0.87932	D	0	.	6.057	0.19816	0.0:0.7833:0.0:0.2166	rs1049100;rs3189191;rs16870489	148;113;148;148	A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.	I	58;148;148;148;148;84	ENSP00000382032:V58I;ENSP00000382029:V148I;ENSP00000364080:V148I;ENSP00000407332:V148I;ENSP00000382034:V148I	ENSP00000364080:V148I	V	-	1	0	HLA-DQB1	32737941	0.967000	0.33354	1.000000	0.80357	0.683000	0.39861	0.196000	0.17176	2.065000	0.61736	0.313000	0.20887	GTC	C|0.816;T|0.184		0.552	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000276131.1	NM_002123	
AIM1	202	bcgsc.ca	37	6	106987370	106987370	+	Missense_Mutation	SNP	A	A	C	rs783396	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr6:106987370A>C	ENST00000369066.3	+	7	4074	c.3587A>C	c.(3586-3588)gAa>gCa	p.E1196A	AIM1_ENST00000535438.1_5'Flank	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GATACAGAAGAAGCGTACATT	0.438													C|||	4687	0.935903	0.9418	0.9222	5008	,	,		19328	0.9335		0.9036	False		,,,				2504	0.9734				p.E1196A		.											.	AIM1-139	0			c.A3587C						.	C	ALA/GLU	4139,267	151.8+/-185.6	1941,257,5	138.0	132.0	134.0	http://www.ncbi.nlm.nih.gov/pubmed?term	3587	0.5	0.3	6	dbSNP_86	134	7939,661	168.8+/-220.3	3680,579,41	yes	missense	AIM1	NM_001624.2	107	5621,836,46	CC,CA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	7.686,6.0599,7.1352	benign	1196/1724	106987370	12078,928	2203	4300	6503	SO:0001583	missense	202	exon7			CAGAAGAAGCGTA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3587A>C	6.37:g.106987370A>C	ENSP00000358062:p.Glu1196Ala	104	1		79	5	NM_001624	0	0	3	3	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	2027	0.9281135531135531	462	0.9390243902439024	337	0.930939226519337	543	0.9493006993006993	685	0.9036939313984169	C	7.820	0.717543	0.15372	0.939401	0.92314	ENSG00000112297	ENST00000369066	T	0.74209	-0.82	5.66	0.517	0.17025	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.667489	0.16327	N	0.219292	T	0.41789	0.1174	L	0.27053	0.805	0.09310	P	0.9999999999999384	B	0.02656	0.0	B	0.10450	0.005	T	0.08848	-1.0702	9	0.17832	T	0.49	.	16.1126	0.81273	0.5507:0.4493:0.0:0.0	rs783396;rs17562185;rs52796028;rs61437104;rs783396	1196	Q9Y4K1	AIM1_HUMAN	A	1196	ENSP00000358062:E1196A	ENSP00000358062:E1196A	E	+	2	0	AIM1	107094063	1.000000	0.71417	0.310000	0.25168	0.865000	0.49528	0.938000	0.28965	-0.412000	0.07519	-0.121000	0.15023	GAA	A|0.075;C|0.918		0.438	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
ZC3H12D	340152	hgsc.bcm.edu	37	6	149772190	149772190	+	Missense_Mutation	SNP	G	G	A	rs112722576	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr6:149772190G>A	ENST00000409806.3	-	6	1531	c.1213C>T	c.(1213-1215)Cct>Tct	p.P405S	ZC3H12D_ENST00000542614.1_Missense_Mutation_p.A307V|ZC3H12D_ENST00000416573.2_Missense_Mutation_p.A307V|ZC3H12D_ENST00000498662.1_5'Flank|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.P405S			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	405	Pro-rich. {ECO:0000255}.			P -> S (in Ref. 4; AAI57833). {ECO:0000305}.	negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.P405S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CCGGGCGGAGGCGGGAGGTCG	0.776													G|||	1682	0.335863	0.1619	0.389	5008	,	,		8771	0.7649		0.1412	False		,,,				2504	0.2914				p.P405S		.											.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1213T						.	G	SER/PRO	516,2856		37,442,1207	3.0	5.0	4.0		1213	-1.9	0.0	6	dbSNP_132	4	945,6567		66,813,2877	no	missense	ZC3H12D	NM_207360.2	74	103,1255,4084	AA,AG,GG		12.5799,15.3025,13.4234	benign	405/528	149772190	1461,9423	1686	3756	5442	SO:0001583	missense	340152	exon6			GCGGAGGCGGGAG			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1213C>T	6.37:g.149772190G>A	ENSP00000386616:p.Pro405Ser	0	0		21	21	NM_207360	0	0	0	0	0	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		724|724	0.3315018315018315|0.3315018315018315	94|94	0.1910569105691057|0.1910569105691057	123|123	0.3397790055248619|0.3397790055248619	399|399	0.6975524475524476|0.6975524475524476	108|108	0.1424802110817942|0.1424802110817942	G|G	14.21|14.21	2.466986|2.466986	0.43839|0.43839	0.153025|0.153025	0.125799|0.125799	ENSG00000178199|ENSG00000178199	ENST00000416573;ENST00000542614|ENST00000389942;ENST00000409806	T;T|T;T	0.31247|0.25749	1.53;1.5|1.78;1.78	2.45|2.45	-1.9|-1.9	0.07665|0.07665	.|.	.|.	.|.	.|.	.|.	T|T	0.02193|0.02193	0.0068|0.0068	N|N	0.11427|0.11427	0.14|0.14	0.80722|0.80722	P|P	0.0|0.0	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.04013	0.0|0.001	T|T	0.42085|0.42085	-0.9472|-0.9472	8|8	0.27785|0.06365	T|T	0.31|0.9	1.0E-4|1.0E-4	3.5413|3.5413	0.07812|0.07812	0.5478:0.2181:0.2341:0.0|0.5478:0.2181:0.2341:0.0	.|.	307|405	B7WNU7|A2A288	.|ZC12D_HUMAN	V|S	307|405	ENSP00000408686:A307V;ENSP00000440813:A307V|ENSP00000374592:P405S;ENSP00000386616:P405S	ENSP00000408686:A307V|ENSP00000374592:P405S	A|P	-|-	2|1	0|0	ZC3H12D|ZC3H12D	149813883|149813883	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.563000|0.563000	0.35712|0.35712	0.541000|0.541000	0.23207|0.23207	-0.300000|-0.300000	0.08895|0.08895	0.313000|0.313000	0.20887|0.20887	GCC|CCT	G|0.668;A|0.332		0.776	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
DLL1	28514	broad.mit.edu	37	6	170594743	170594743	+	Missense_Mutation	SNP	C	C	T	rs149768426		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr6:170594743C>T	ENST00000366756.3	-	6	1109	c.776G>A	c.(775-777)cGc>cAc	p.R259H		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	259	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GCCTGGATAGCGGATACACTC	0.592																																					p.R259H		.											.	DLL1-659	0			c.G776A						.						49.0	55.0	53.0					6																	170594743		2203	4300	6503	SO:0001583	missense	28514	exon6			GGATAGCGGATAC	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.776G>A	6.37:g.170594743C>T	ENSP00000355718:p.Arg259His	95	0		56	4	NM_005618	0	0	9	9	0	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	37	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070763	0.76301	.	.	ENSG00000198719	ENST00000366756	T	0.03272	3.99	5.08	5.08	0.68730	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.06600	0.0169	L	0.29908	0.895	0.58432	D	0.999993	D	0.89917	1.0	D	0.77004	0.989	T	0.51387	-0.8712	10	0.42905	T	0.14	.	18.4705	0.90773	0.0:1.0:0.0:0.0	.	259	O00548	DLL1_HUMAN	H	259	ENSP00000355718:R259H	ENSP00000355718:R259H	R	-	2	0	DLL1	170436668	1.000000	0.71417	0.589000	0.28718	0.833000	0.47200	5.939000	0.70179	2.376000	0.81061	0.563000	0.77884	CGC	C|1.000;G|0.000		0.592	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1		
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		0	0		10	10	NM_182924	0	0	0	6	6	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	0	0		26	18	NM_032172	0	0	1	4	3	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
AKR1B15	441282	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134252962	134252962	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:134252962A>G	ENST00000457545.2	+	4	463	c.203A>G	c.(202-204)tAt>tGt	p.Y68C	AKR1B15_ENST00000423958.1_Missense_Mutation_p.Y40C	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	68							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						GATGCAGAATATCGCCACATT	0.443																																					p.Y68C		.											.	AKR1B15-23	0			c.A203G						.						100.0	103.0	102.0					7																	134252962		2203	4300	6503	SO:0001583	missense	441282	exon4			CAGAATATCGCCA		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.203A>G	7.37:g.134252962A>G	ENSP00000389289:p.Tyr68Cys	171	1		146	42	NM_001080538	0	0	0	0	0	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	-	11.58	1.681648	0.29872	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.25912	1.77;1.77	2.72	2.72	0.32119	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.61515	0.2353	H	0.97240	3.965	0.53688	D	0.999975	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.69907	-0.5018	9	0.87932	D	0	.	8.9226	0.35621	1.0:0.0:0.0:0.0	.	40;68;40	C9JRZ8-2;C9JRZ8;A4D1P0	.;AK1BF_HUMAN;.	C	68;40	ENSP00000389289:Y68C;ENSP00000397009:Y40C	ENSP00000397009:Y40C	Y	+	2	0	AKR1B15	133903502	1.000000	0.71417	0.006000	0.13384	0.067000	0.16453	6.644000	0.74338	1.241000	0.43820	0.416000	0.27883	TAT	.		0.443	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
PTN	5764	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	136938212	136938212	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:136938212G>A	ENST00000348225.2	-	3	715	c.288C>T	c.(286-288)ggC>ggT	p.G96G	PTN_ENST00000393083.2_Splice_Site_p.G96G	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	96					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						GAGGCTTACCGCCAAATTGCT	0.433																																					p.G96G		.											.	PTN-516	0			c.C288T						.						137.0	117.0	124.0					7																	136938212		2203	4300	6503	SO:0001630	splice_region_variant	5764	exon3			CTTACCGCCAAAT	M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.289+1C>T	7.37:g.136938212G>A		76	1		88	33	NM_002825	0	0	0	0	0	Q5U0B0|Q6ICQ5|Q9UCC6	Silent	SNP	ENST00000348225.2	37	CCDS5844.1																																																																																			.		0.433	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825	Silent
ASIC3	9311	bcgsc.ca	37	7	150747650	150747650	+	Silent	SNP	G	G	T	rs62001897	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:150747650G>T	ENST00000349064.5	+	3	966	c.768G>T	c.(766-768)ggG>ggT	p.G256G	ASIC3_ENST00000357922.4_Silent_p.G256G|ASIC3_ENST00000297512.8_Silent_p.G256G	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	256					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										TGGGCTTGGGGGTGTCCCCGG	0.622													G|||	148	0.0295527	0.0098	0.0432	5008	,	,		16390	0.0317		0.0606	False		,,,				2504	0.0123				p.G256G		.											.	.	0			c.G768T						.	G	,,	75,4331	67.0+/-104.6	0,75,2128	79.0	85.0	83.0		768,768,768	3.0	1.0	7	dbSNP_129	83	508,8092	145.0+/-200.8	11,486,3803	no	coding-synonymous,coding-synonymous,coding-synonymous	ACCN3	NM_004769.2,NM_020321.2,NM_020322.2	,,	11,561,5931	TT,TG,GG		5.907,1.7022,4.4825	,,	256/532,256/550,256/544	150747650	583,12423	2203	4300	6503	SO:0001819	synonymous_variant	9311	exon3			CTTGGGGGTGTCC	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.768G>T	7.37:g.150747650G>T		83	0		59	5	NM_020322	0	0	0	0	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																			G|0.956;T|0.044		0.622	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55541829	55541829	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:55541829C>T	ENST00000220676.1	+	4	5535	c.5387C>T	c.(5386-5388)aCg>aTg	p.T1796M		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1796					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.T1796M(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCAGGCCCAACGATGGATGAA	0.448																																					p.T1796M	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1-102	1	Substitution - Missense(1)	endometrium(1)	c.C5387T						.						77.0	74.0	75.0					8																	55541829		2203	4300	6503	SO:0001583	missense	6101	exon4			GCCCAACGATGGA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5387C>T	8.37:g.55541829C>T	ENSP00000220676:p.Thr1796Met	173	0		225	50	NM_006269	0	0	0	0	0		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	9.173	1.021724	0.19433	.	.	ENSG00000104237	ENST00000220676	T	0.21191	2.02	5.93	-7.18	0.01505	.	1.642690	0.03391	N	0.201882	T	0.15132	0.0365	L	0.36672	1.1	0.09310	N	1	B	0.31968	0.349	B	0.31191	0.125	T	0.23762	-1.0179	10	0.66056	D	0.02	.	7.0392	0.25010	0.1497:0.3819:0.3642:0.1042	.	1796	P56715	RP1_HUMAN	M	1796	ENSP00000220676:T1796M	ENSP00000220676:T1796M	T	+	2	0	RP1	55704382	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.201000	0.17276	-1.915000	0.01077	-2.053000	0.00404	ACG	.		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	1	0		37	25	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		4	4		21	20	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000527096.1_Silent_p.A1999A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		2	0		31	15	NM_201380	0	0	10	15	5	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000527096.1_Silent_p.L1207L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		3	0		51	26	NM_201380	0	0	4	7	3	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
OPLAH	26873	hgsc.bcm.edu	37	8	145106939	145106940	+	Splice_Site	DEL	CC	CC	-	rs60949781		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:145106939_145106940delCC	ENST00000426825.1	-	26	3580_3581	c.3499_3500delGG	c.(3499-3501)ggc>c	p.G1167fs	CTD-3065J16.6_ENST00000528912.1_RNA|CTD-3065J16.6_ENST00000561181.1_RNA|OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1167					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCCCCGAGCCCCCCGCCGCA	0.748														5008	1.0	1.0	1.0	5008	,	,		7120	1.0		1.0	False		,,,				2504	1.0				.		.											.	OPLAH-68	0			.						.			2721,11		1360,1,5						3.7	0.9		dbSNP_130	11	6356,8		3177,2,3	no	frameshift	OPLAH	NM_017570.3		4537,3,8	A1A1,A1R,RR		0.1257,0.4026,0.2089				9077,19				SO:0001630	splice_region_variant	26873	.			CCCGAGCCCCCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.3499-1GG>-	8.37:g.145106943_145106944delCC		0	0		11	11	.	0	0	0	0	0	A5PKY8|Q75W65|Q9Y4Q0	Splice_Site	DEL	ENST00000426825.1	37																																																																																				.		0.748	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	Frame_Shift_Del
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		32	31	NM_213605	0	0	0	1	1		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
C9orf66	157983	hgsc.bcm.edu	37	9	214706	214706	+	Missense_Mutation	SNP	G	G	C	rs540473	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:214706G>C	ENST00000382387.2	-	1	1187	c.691C>G	c.(691-693)Cga>Gga	p.R231G	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	231	Arg-rich.		R -> G (in dbSNP:rs540473).							central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCCCAGTATCGGGAGGCCAGT	0.791													C|||	2724	0.54393	0.4856	0.5504	5008	,	,		9921	0.7401		0.4324	False		,,,				2504	0.5307				p.R231G		.											.	C9orf66-514	0			c.C691G						.	C	GLY/ARG	1470,1990		362,746,622	3.0	4.0	4.0		691	1.7	0.9	9	dbSNP_83	4	2548,4318		590,1368,1475	no	missense	C9orf66	NM_152569.2	125	952,2114,2097	CC,CG,GG		37.1104,42.4855,38.9115	benign	231/296	214706	4018,6308	1730	3433	5163	SO:0001583	missense	157983	exon1			AGTATCGGGAGGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.691C>G	9.37:g.214706G>C	ENSP00000371824:p.Arg231Gly	0	0		4	4	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	1127	0.5160256410256411	240	0.4878048780487805	182	0.5027624309392266	387	0.6765734265734266	318	0.41952506596306066	.	6.200	0.405074	0.11754	0.424855	0.371104	ENSG00000183784	ENST00000382387	T	0.22743	1.94	3.91	1.74	0.24563	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	8	0.87932	D	0	.	11.1247	0.48310	0.0:0.4274:0.5726:0.0	rs540473;rs13292950	231	Q5T8R8	CI066_HUMAN	G	231	ENSP00000371824:R231G	ENSP00000371824:R231G	R	-	1	2	C9orf66	204706	0.960000	0.32886	0.885000	0.34714	0.005000	0.04900	0.456000	0.21859	0.370000	0.24538	-0.335000	0.08231	CGA	G|0.516;C|0.484		0.791	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
POLR1E	64425	bcgsc.ca	37	9	37493588	37493588	+	Silent	SNP	C	C	T	rs10758434	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:37493588C>T	ENST00000377798.4	+	6	548	c.435C>T	c.(433-435)acC>acT	p.T145T	POLR1E_ENST00000442009.2_Silent_p.T75T|POLR1E_ENST00000377792.3_Silent_p.T207T	NM_022490.1	NP_071935.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide E, 53kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	12				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		TTGGTACCACCAAACAGAAGC	0.468													C|||	1078	0.215256	0.1694	0.3112	5008	,	,		24276	0.244		0.2018	False		,,,				2504	0.1933				p.T145T	Ovarian(116;843 1620 18506 32459 34463)	.											.	POLR1E-90	0			c.C435T						.	C		806,3600	321.0+/-296.9	71,664,1468	124.0	112.0	116.0		435	6.0	1.0	9	dbSNP_120	116	1872,6728	334.9+/-321.2	201,1470,2629	no	coding-synonymous	POLR1E	NM_022490.1		272,2134,4097	TT,TC,CC		21.7674,18.2932,20.5905		145/420	37493588	2678,10328	2203	4300	6503	SO:0001819	synonymous_variant	64425	exon6			TACCACCAAACAG	AK091294	CCDS6611.1	9p13.1	2013-01-21	2006-03-09	2006-03-09	ENSG00000137054	ENSG00000137054		"""RNA polymerase subunits"""	17631	protein-coding gene	gene with protein product	"""RNA polymerase I associated factor 53"""		"""polymerase (RNA) I associated factor 1"""	PRAF1		8641287	Standard	XM_005251547		Approved	FLJ13390, PAF53, FLJ13970	uc003zzy.1	Q9GZS1	OTTHUMG00000019920	ENST00000377798.4:c.435C>T	9.37:g.37493588C>T		160	2		81	4	NM_022490	0	0	30	30	0	O75395|Q5JTE3	Silent	SNP	ENST00000377798.4	37	CCDS6611.1																																																																																			C|0.795;T|0.205		0.468	POLR1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052464.1	NM_022490	
TMEM245	23731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	111812906	111812906	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:111812906G>T	ENST00000374586.3	-	13	1952	c.1921C>A	c.(1921-1923)Ctc>Atc	p.L641I		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	641						integral component of membrane (GO:0016021)											ATGGTCAAGAGTGTAGTGACA	0.473																																					p.L641I		.											.	.	0			c.C1921A						.						129.0	128.0	128.0					9																	111812906		2025	4188	6213	SO:0001583	missense	23731	exon13			TCAAGAGTGTAGT	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1921C>A	9.37:g.111812906G>T	ENSP00000363714:p.Leu641Ile	457	0		244	13	NM_032012	0	0	40	40	0	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	ENST00000374586.3	37	CCDS43858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.292492|4.292492	0.80914|0.80914	.|.	.|.	ENSG00000106771|ENSG00000106771	ENST00000374586;ENST00000223608|ENST00000413712	T|T	0.40756|0.39787	1.02|1.06	5.83|5.83	4.84|4.84	0.62591|0.62591	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.23846|0.23846	0.0577|0.0577	N|N	0.11313|0.11313	0.125|0.125	0.44880|0.44880	D|D	0.99789|0.99789	D;D|.	0.76494|.	0.998;0.999|.	D;D|.	0.87578|.	0.996;0.998|.	T|T	0.08186|0.08186	-1.0734|-1.0734	10|7	0.29301|0.27785	T|T	0.29|0.31	-17.3012|-17.3012	3.8412|3.8412	0.08915|0.08915	0.3238:0.0:0.6762:0.0|0.3238:0.0:0.6762:0.0	.|.	641;641|.	Q9H330-2;Q9H330|.	.;CI005_HUMAN|.	I|N	641|233	ENSP00000363714:L641I|ENSP00000394798:T233N	ENSP00000223608:L641I|ENSP00000394798:T233N	L|T	-|-	1|2	0|0	C9orf5|C9orf5	110852727|110852727	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.925000|0.925000	0.55904|0.55904	4.568000|4.568000	0.60857|0.60857	2.755000|2.755000	0.94549|0.94549	0.650000|0.650000	0.86243|0.86243	CTC|ACT	.		0.473	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
USP20	10868	broad.mit.edu	37	9	132637028	132637028	+	Silent	SNP	G	G	A			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:132637028G>A	ENST00000315480.4	+	18	2072	c.1914G>A	c.(1912-1914)acG>acA	p.T638T	USP20_ENST00000358355.1_Silent_p.T638T|USP20_ENST00000372429.3_Silent_p.T638T			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	638	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				ACCACGGCACGGCAGGCAGTG	0.657																																					p.T638T		.											.	USP20-658	0			c.G1914A						.						73.0	80.0	77.0					9																	132637028		2141	4238	6379	SO:0001819	synonymous_variant	10868	exon18			CGGCACGGCAGGC	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1914G>A	9.37:g.132637028G>A		179	2		111	7	NM_001008563	0	0	0	0	0	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	ENST00000315480.4	37	CCDS43892.1																																																																																			.		0.657	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
LCN15	389812	bcgsc.ca	37	9	139656670	139656670	+	Missense_Mutation	SNP	T	T	C	rs2297722	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:139656670T>C	ENST00000316144.5	-	5	514	c.490A>G	c.(490-492)Aag>Gag	p.K164E	LCN15_ENST00000482511.1_5'UTR	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15	164			K -> E (in dbSNP:rs2297722).		lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						ATCATGTCCTTGGGGAGCCCC	0.652													C|||	3671	0.733027	0.6573	0.7824	5008	,	,		7750	0.8512		0.7803	False		,,,				2504	0.6299				p.K164E		.											.	LCN15-68	0			c.A490G						.	C	GLU/LYS	3020,1360		1042,936,212	18.0	19.0	19.0		490	2.2	0.0	9	dbSNP_100	19	6663,1929		2618,1427,251	yes	missense	LCN15	NM_203347.1	56	3660,2363,463	CC,CT,TT		22.4511,31.0502,25.3546	benign	164/185	139656670	9683,3289	2190	4296	6486	SO:0001583	missense	389812	exon5			TGTCCTTGGGGAG		CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943	ENST00000316144.5:c.490A>G	9.37:g.139656670T>C	ENSP00000313833:p.Lys164Glu	73	0		57	5	NM_203347	0	0	0	0	0		Missense_Mutation	SNP	ENST00000316144.5	37	CCDS7006.1	1679	0.7687728937728938	322	0.6544715447154471	283	0.7817679558011049	499	0.8723776223776224	575	0.758575197889182	C	0	-2.669188	0.00105	0.689498	0.775489	ENSG00000177984	ENST00000316144	T	0.10382	2.88	4.0	2.15	0.27550	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.705140	0.03934	N	0.285771	T	0.00012	0.0000	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.29181	-1.0020	9	0.02654	T	1	.	6.2477	0.20827	0.0:0.6631:0.0:0.3369	rs2297722;rs57003619;rs2297722	164	Q6UWW0	LCN15_HUMAN	E	164	ENSP00000313833:K164E	ENSP00000313833:K164E	K	-	1	0	LCN15	138776491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.226000	0.17776	-0.052000	0.13311	-0.726000	0.03593	AAG	T|0.247;C|0.753		0.652	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055114.2	NM_203347	
ATP1B4	23439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	119504588	119504588	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chrX:119504588A>G	ENST00000218008.3	+	3	404	c.347A>G	c.(346-348)tAc>tGc	p.Y116C	ATP1B4_ENST00000361319.3_Missense_Mutation_p.Y112C|ATP1B4_ENST00000539306.1_Intron	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	116					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						TTACTCATTTACTTCTTCTTC	0.483																																					p.Y116C		.											.	ATP1B4-131	0			c.A347G						.						357.0	272.0	301.0					X																	119504588		2203	4300	6503	SO:0001583	missense	23439	exon3			TCATTTACTTCTT	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.347A>G	X.37:g.119504588A>G	ENSP00000218008:p.Tyr116Cys	109	0		97	32	NM_001142447	0	0	0	0	0	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040954	0.35989	.	.	ENSG00000101892	ENST00000218008;ENST00000361319	T;T	0.55588	0.51;0.51	5.54	5.54	0.83059	.	0.053377	0.85682	D	0.000000	T	0.78947	0.4364	M	0.93420	3.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.84529	0.0632	10	0.87932	D	0	-14.3682	13.3709	0.60713	1.0:0.0:0.0:0.0	.	81;116;112	B7ZKV9;Q9UN42;Q9UN42-2	.;AT1B4_HUMAN;.	C	116;112	ENSP00000218008:Y116C;ENSP00000355346:Y112C	ENSP00000218008:Y116C	Y	+	2	0	ATP1B4	119388616	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	8.569000	0.90744	1.836000	0.53414	0.345000	0.21793	TAC	.		0.483	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
NCOR2	9612	broad.mit.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939				p.G1840delinsSSGG		.											.	NCOR2-229	0			c.5518_5519insAGCAGCGGC						.																																			SO:0001652	inframe_insertion	9612	exon39			CACCCCCGCCGCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	10	0		31	14	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
DSTN	11034	broad.mit.edu	37	20	17581488	17581489	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr20:17581488_17581489insT	ENST00000246069.7	+	2	455_456	c.109_110insT	c.(109-111)attfs	p.I37fs	DSTN_ENST00000474024.1_Frame_Shift_Ins_p.I20fs	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	37	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						GAAGGCTGTCATTTTTTGTCTC	0.386																																					p.I37fs		.											.	DSTN-154	0			c.109_110insT						.																																			SO:0001589	frameshift_variant	11034	exon2			GCTGTCATTTTTT	S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.115dupT	20.37:g.17581494_17581494dupT	ENSP00000246069:p.Ile37fs	185	14		173	24	NM_006870	0	0	0	0	0	B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Frame_Shift_Ins	INS	ENST00000246069.7	37	CCDS13127.1																																																																																			.		0.386	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797315	128797316	+	In_Frame_Ins	INS	-	-	CCCGGC	rs3980042|rs373500239|rs142924298	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr5:128797315_128797316insCCCGGC	ENST00000274487.4	+	2	739_740	c.594_595insCCCGGC	c.(595-597)ccc>CCCGGCccc	p.199_199P>PGP	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	199	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N198_P199insPG(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGCGGCCAAATCCCGGCCCCGG	0.713														951	0.189896	0.1815	0.1254	5008	,	,		13147	0.3294		0.1083	False		,,,				2504	0.1871				p.N198delinsNPG		.											.	ADAMTS19-295	1	Insertion - In frame(1)	breast(1)	c.594_595insCCCGGC						.			443,3611		48,347,1632						-6.8	0.0		dbSNP_134	11	670,7398		63,544,3427	no	coding	ADAMTS19	NM_133638.3		111,891,5059	A1A1,A1R,RR		8.3044,10.9275,9.1817				1113,11009				SO:0001652	inframe_insertion	171019	exon2			GCCAAATCCCGGC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.601_606dupCCCGGC	5.37:g.128797316_128797321dupCCCGGC	Exception_encountered	2	0		48	7	NM_133638	0	0	0	0	0		In_Frame_Ins	INS	ENST00000274487.4	37	CCDS4146.1																																																																																			-|0.817;CCCGGC|0.183		0.713	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	2	0		13	6	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
BHLHE22	27319	broad.mit.edu	37	8	65494007	65494008	+	In_Frame_Ins	INS	-	-	AGCGGC	rs191620115		TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr8:65494007_65494008insAGCGGC	ENST00000321870.1	+	1	1194_1195	c.660_661insAGCGGC	c.(661-663)agc>AGCGGCagc	p.221_221S>SGS	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	221	Gly-rich.|Ser-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						gcggtagcggtagcggcagcgg	0.728																																					p.G220delinsGSG	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	0			c.660_661insAGCGGC						.																																			SO:0001652	inframe_insertion	27319	exon1			TAGCGGTAGCGGC	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.667_672dupAGCGGC	8.37:g.65494008_65494013dupAGCGGC	ENSP00000318799:p.GlySer223dup	4	0		10	5	NM_152414	0	0	0	0	0		In_Frame_Ins	INS	ENST00000321870.1	37	CCDS6179.1																																																																																			.		0.728	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534192	90534193	+	RNA	INS	-	-	TCTTGTCTCCCAGCGTCA	rs567658963|rs536300617	byFrequency	TCGA-OR-A5L8-01A-11D-A29I-10	TCGA-OR-A5L8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d285312e-d9c6-4f00-9667-8509050dda5e	34ed1a7d-b555-4a7c-bd40-e984f13c1eb0	g.chr9:90534192_90534193insTCTTGTCTCCCAGCGTCA	ENST00000602681.1	+	0	938_939							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCCAGCGTCATCTTGTCTCCC	0.594																																					p.H71delinsHLVSQRH		.											.	.	0			c.212_213insTCTTGTCTCCCAGCGTCA						.																																					441452	exon2			AGCGTCATCTTGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534192_90534193insTCTTGTCTCCCAGCGTCA		426	0		226	0	NM_001145124	0	0	0	0	0		In_Frame_Ins	INS	ENST00000602681.1	37																																																																																				.		0.594	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
