#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	hgsc.bcm.edu	37	1	17265507	17265507	+	Missense_Mutation	SNP	C	C	T	rs201951425	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr1:17265507C>T	ENST00000375541.5	+	12	1547	c.1478C>T	c.(1477-1479)cCg>cTg	p.P493L	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGCGGACCCCGTCCCCACCG	0.736																																					p.P493L		.											.	CROCC-137	0			c.C1478T						.	C	LEU/PRO	55,4215		0,55,2080	11.0	11.0	11.0		1478	5.4	1.0	1	dbSNP_134	11	247,8075		0,247,3914	no	missense	CROCC	NM_014675.3	98	0,302,5994	TT,TC,CC		2.968,1.2881,2.3983	probably-damaging	493/2018	17265507	302,12290	2135	4161	6296	SO:0001583	missense	9696	exon12			GGACCCCGTCCCC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1478C>T	1.37:g.17265507C>T	ENSP00000364691:p.Pro493Leu	0	0		14	8	NM_014675	0	0	0	0	0		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	36	0.016483516483516484	9	0.018292682926829267	7	0.019337016574585635	0	0.0	20	0.026385224274406333	C	15.49	2.847709	0.51164	0.012881	0.02968	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.11385	2.78	5.39	5.39	0.77823	.	.	.	.	.	T	0.08268	0.0206	L	0.55481	1.735	0.50813	D	0.99989	D;P;D	0.65815	0.981;0.803;0.995	B;B;P	0.59115	0.421;0.095;0.852	T	0.00200	-1.1927	9	0.27785	T	0.31	.	14.606	0.68478	0.0:0.8534:0.1466:0.0	.	356;356;493	A1L0S8;A1L0S9;Q5TZA2	.;.;CROCC_HUMAN	L	493;374	ENSP00000364691:P493L	ENSP00000364691:P493L	P	+	2	0	CROCC	17138094	0.934000	0.31675	0.991000	0.47740	0.293000	0.27360	5.113000	0.64640	2.702000	0.92279	0.561000	0.74099	CCG	C|0.983;T|0.017		0.736	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
ST6GALNAC5	81849	broad.mit.edu	37	1	77334277	77334279	+	In_Frame_Del	DEL	GCA	GCA	-	rs113832855|rs373434974		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr1:77334277_77334279delGCA	ENST00000477717.1	+	2	346_348	c.111_113delGCA	c.(109-114)ccgcag>ccg	p.Q49del	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	49	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						AGCGGCCCCCgcagcagcagcag	0.7																																					p.37_38del		.											.	ST6GALNAC5-92	0			c.111_113del						.			633,280,2837		87,67,392,25,163,1141						-1.1	1.0		dbSNP_132	16	606,89,6499		39,5,523,5,74,2951	no	codingComplex	ST6GALNAC5	NM_030965.1		126,72,915,30,237,4092	A1A1,A1A2,A1R,A2A2,A2R,RR		9.6608,24.3467,14.693				1239,369,9336				SO:0001651	inframe_deletion	81849	exon2			GCCCCCGCAGCAG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.111_113delGCA	1.37:g.77334286_77334288delGCA	ENSP00000417583:p.Gln49del	87	0		194	8	NM_030965	0	0	0	0	0	B1AK82	In_Frame_Del	DEL	ENST00000477717.1	37	CCDS673.1																																																																																			GCA|0.500;-|0.500		0.700	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
NBPF4	148545	broad.mit.edu	37	1	108769307	108769307	+	Silent	SNP	G	G	A	rs367656931	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr1:108769307G>A	ENST00000415641.3	-	14	2072	c.1869C>T	c.(1867-1869)agC>agT	p.S623S		NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4	623						cytoplasm (GO:0005737)		p.S623S(2)		endometrium(2)|lung(1)|skin(1)	4						TTACCTCTGCGCTCTCAGCAT	0.493													G|||	1100	0.219649	0.025	0.3429	5008	,	,		14496	0.3611		0.1859	False		,,,				2504	0.2843				p.S623S		.											.	.	2	Substitution - coding silent(2)	endometrium(2)	c.C1869T						.						94.0	74.0	81.0					1																	108769307		647	1398	2045	SO:0001819	synonymous_variant	148545	exon14			CTCTGCGCTCTCA	AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.1869C>T	1.37:g.108769307G>A		384	0		137	7	NM_001143989	0	0	0	0	0	Q5T483	Silent	SNP	ENST00000415641.3	37	CCDS44182.1																																																																																			G|0.500;A|0.500		0.493	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031255.5	NM_152488	
TMEM72	643236	bcgsc.ca	37	10	45430462	45430462	+	Silent	SNP	C	C	T	rs17417442	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr10:45430462C>T	ENST00000544540.1	+	4	838	c.354C>T	c.(352-354)gcC>gcT	p.A118A	TMEM72-AS1_ENST00000450287.2_RNA|RP11-285G1.9_ENST00000425541.2_lincRNA			A0PK05	TMM72_HUMAN	transmembrane protein 72	236						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						CCTCCCTCGCCGAAGGTCTGG	0.592													c|||	1670	0.333466	0.3086	0.4438	5008	,	,		18282	0.3274		0.3986	False		,,,				2504	0.228				p.A236A		.											.	TMEM72-90	0			c.C708T						.	G		1040,2096		167,706,695	111.0	113.0	113.0		708	-10.8	0.0	10	dbSNP_123	113	3019,4145		625,1769,1188	no	coding-synonymous	TMEM72	NM_001123376.1		792,2475,1883	TT,TC,CC		42.1413,33.1633,39.4078		236/276	45430462	4059,6241	1568	3582	5150	SO:0001819	synonymous_variant	643236	exon5			CCTCGCCGAAGGT	AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.354C>T	10.37:g.45430462C>T		124	1		124	6	NM_001123376	0	0	0	0	0	A1L181|Q5T740	Silent	SNP	ENST00000544540.1	37																																																																																				C|0.634;T|0.366		0.592	TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376	
GDF10	2662	hgsc.bcm.edu	37	10	48438647	48438649	+	In_Frame_Del	DEL	GCA	GCA	-	rs34420310|rs71023176|rs71522826		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	GCA	GCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr10:48438647_48438649delGCA	ENST00000224605.2	-	1	327_329	c.62_64delTGC	c.(61-66)ctgccg>ccg	p.L21del		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	21					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						agaaacaacggcagcagcagcag	0.729																																					p.21_22del		.											.	GDF10-650	0			c.62_64del						.			30,1862		2,26,918						-1.9	0.0		dbSNP_126	6	155,4939		18,119,2410	no	coding	GDF10	NM_004962.3		20,145,3328	A1A1,A1R,RR		3.0428,1.5856,2.6482				185,6801				SO:0001651	inframe_deletion	2662	exon1			ACAACGGCAGCAG	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.62_64delTGC	10.37:g.48438656_48438658delGCA	ENSP00000224605:p.Leu21del	2	1		34	28	NM_004962	0	0	0	0	0	Q5VSQ8|Q9UCX6	In_Frame_Del	DEL	ENST00000224605.2	37	CCDS7220.1																																																																																			-|0.500;CAG|0.500		0.729	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
TET1	80312	broad.mit.edu	37	10	70451264	70451264	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr10:70451264A>C	ENST00000373644.4	+	12	6313	c.6104A>C	c.(6103-6105)cAc>cCc	p.H2035P		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	2035					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCTGTTGAGCACCCCAACCGT	0.498																																					p.H2035P		.											.	TET1-663	0			c.A6104C						.						68.0	65.0	66.0					10																	70451264		2203	4300	6503	SO:0001583	missense	80312	exon12			TTGAGCACCCCAA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.6104A>C	10.37:g.70451264A>C	ENSP00000362748:p.His2035Pro	62	9		55	13	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.595225	0.46318	.	.	ENSG00000138336	ENST00000373644	T	0.10668	2.85	5.6	1.85	0.25348	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	1.167810	0.05943	N	0.637427	T	0.13713	0.0332	L	0.47716	1.5	0.09310	N	1	P	0.43542	0.81	P	0.46629	0.522	T	0.23476	-1.0187	10	0.33141	T	0.24	.	3.9438	0.09339	0.6668:0.1303:0.0699:0.133	.	2035	Q8NFU7	TET1_HUMAN	P	2035	ENSP00000362748:H2035P	ENSP00000362748:H2035P	H	+	2	0	TET1	70121270	0.009000	0.17119	0.007000	0.13788	0.779000	0.44077	1.318000	0.33643	0.117000	0.18138	0.533000	0.62120	CAC	.		0.498	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
PI4K2A	55361	bcgsc.ca	37	10	99410790	99410790	+	Silent	SNP	T	T	C	rs7915721	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr10:99410790T>C	ENST00000370631.3	+	2	585	c.528T>C	c.(526-528)ccT>ccC	p.P176P	PI4K2A_ENST00000370649.3_Silent_p.P146P|PI4K2A_ENST00000555577.1_Silent_p.P146P	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	176	PI3K/PI4K.				basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)	p.P176P(2)|p.P146P(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		TGTGCTGTCCTTGCTGCTTTG	0.517													C|||	1715	0.342452	0.6233	0.2666	5008	,	,		20300	0.3006		0.2028	False		,,,				2504	0.2035				p.P176P		.											.	PI4K2A-226	3	Substitution - coding silent(3)	prostate(3)	c.T528C						.	C		2425,1981	556.8+/-379.6	676,1073,454	92.0	79.0	83.0		528	3.1	1.0	10	dbSNP_116	83	1911,6689	726.6+/-406.6	192,1527,2581	no	coding-synonymous	PI4K2A	NM_018425.2		868,2600,3035	CC,CT,TT		22.2209,44.9614,33.3385		176/480	99410790	4336,8670	2203	4300	6503	SO:0001819	synonymous_variant	55361	exon2			CTGTCCTTGCTGC	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.528T>C	10.37:g.99410790T>C		169	1		145	5	NM_018425	0	0	0	0	0	D3DR59|Q9NSG8	Silent	SNP	ENST00000370631.3	37	CCDS7469.1																																																																																			T|0.663;C|0.337		0.517	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1	NM_018425	
IRF7	3665	hgsc.bcm.edu	37	11	615103	615103	+	Silent	SNP	G	G	A	rs113083699	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:615103G>A	ENST00000397574.2	-	3	546	c.177C>T	c.(175-177)atC>atT	p.I59I	IRF7_ENST00000397566.1_Silent_p.I72I|IRF7_ENST00000348655.6_Silent_p.I59I|IRF7_ENST00000525445.1_5'UTR|IRF7_ENST00000397570.1_Silent_p.I59I|IRF7_ENST00000397562.3_5'UTR|IRF7_ENST00000330243.5_Silent_p.I72I	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	59					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCACCTTGAAGATGCGCGCGT	0.721													G|||	203	0.0405351	0.0772	0.0375	5008	,	,		12225	0.001		0.0527	False		,,,				2504	0.0215				p.I72I		.											.	IRF7-90	0			c.C216T						.	G	,,	153,3775		1,151,1812	5.0	6.0	6.0		177,177,216	3.6	1.0	11	dbSNP_132	6	310,7558		4,302,3628	no	coding-synonymous,coding-synonymous,coding-synonymous	IRF7	NM_001572.3,NM_004029.2,NM_004031.2	,,	5,453,5440	AA,AG,GG		3.94,3.8951,3.9251	,,	59/504,59/475,72/517	615103	463,11333	1964	3934	5898	SO:0001819	synonymous_variant	3665	exon1			CTTGAAGATGCGC	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.177C>T	11.37:g.615103G>A		0	0		10	9	NM_004031	0	0	1	1	0	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Silent	SNP	ENST00000397574.2	37	CCDS7703.1																																																																																			G|0.949;A|0.051		0.721	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	NM_001572	
MUC6	4588	bcgsc.ca	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:1016835A>G	ENST00000421673.2	-	31	6016	c.5966T>C	c.(5965-5967)tTc>tCc	p.F1989S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1989	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.F1989Y(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567																																					p.F1989S		.											.	MUC6-23	2	Substitution - Missense(2)	lung(2)	c.T5966C						.						1541.0	1526.0	1531.0					11																	1016835		2203	4299	6502	SO:0001583	missense	4588	exon31			GTCTGGAAGGATG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5966T>C	11.37:g.1016835A>G	ENSP00000406861:p.Phe1989Ser	2412	42		1957	82	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002866	0.35320	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	3.08	-0.788	0.10939	.	.	.	.	.	T	0.12390	0.0301	L	0.38531	1.155	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.41106	-0.9527	9	0.07644	T	0.81	.	6.7728	0.23602	0.4725:0.0:0.5275:0.0	.	1989	Q6W4X9	MUC6_HUMAN	S	1989	ENSP00000406861:F1989S	ENSP00000406861:F1989S	F	-	2	0	MUC6	1006835	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.386000	0.07370	-0.019000	0.14055	0.254000	0.18369	TTC	.		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC2	4583	broad.mit.edu	37	11	1093314	1093314	+	Silent	SNP	A	A	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:1093314A>T	ENST00000441003.2	+	30	5160	c.5133A>T	c.(5131-5133)ccA>ccT	p.P1711P	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.P1678P|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccaacacccaccg	0.637																																					p.P1711P		.											.	MUC2-90	0			c.A5133T						.						148.0	194.0	178.0					11																	1093314		1911	3574	5485	SO:0001819	synonymous_variant	4583	exon30			AACCCCAACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5133A>T	11.37:g.1093314A>T		111	1		208	8	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
ART5	116969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	3661315	3661315	+	Missense_Mutation	SNP	C	C	T	rs560195676		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:3661315C>T	ENST00000397068.3	-	2	736	c.344G>A	c.(343-345)cGg>cAg	p.R115Q	TRPC2_ENST00000526541.1_RNA|ART5_ENST00000359918.4_Missense_Mutation_p.R115Q|ART5_ENST00000397067.3_Missense_Mutation_p.R115Q	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	115					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCGCCCGTCCGCACGGCCTG	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		17997	0.001		0.0	False		,,,				2504	0.0				p.R115Q		.											.	ART5-91	0			c.G344A						.						104.0	106.0	105.0					11																	3661315		2201	4298	6499	SO:0001583	missense	116969	exon2			CCCGTCCGCACGG	Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.344G>A	11.37:g.3661315C>T	ENSP00000380258:p.Arg115Gln	143	0		141	8	NM_053017	0	0	0	0	0	C9IYG7|Q6UX84|Q86W02	Missense_Mutation	SNP	ENST00000397068.3	37	CCDS7743.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060646	0.36373	.	.	ENSG00000167311	ENST00000397068;ENST00000397067;ENST00000359918	T;T;T	0.13420	2.59;2.59;2.59	6.07	5.17	0.71159	.	0.118179	0.56097	N	0.000036	T	0.21921	0.0528	M	0.76433	2.335	0.34830	D	0.739546	B;P	0.41345	0.448;0.746	B;B	0.42188	0.08;0.379	T	0.36407	-0.9749	10	0.51188	T	0.08	-22.3377	13.1895	0.59702	0.0:0.9234:0.0:0.0766	.	115;115	Q96L15-2;Q96L15	.;NAR5_HUMAN	Q	115	ENSP00000380258:R115Q;ENSP00000380257:R115Q;ENSP00000352992:R115Q	ENSP00000352992:R115Q	R	-	2	0	ART5	3617891	0.020000	0.18652	0.769000	0.31535	0.070000	0.16714	1.581000	0.36558	1.578000	0.49821	0.655000	0.94253	CGG	.		0.582	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017	
NLRP14	338323	broad.mit.edu	37	11	7064833	7064833	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:7064833A>C	ENST00000299481.4	+	4	1922	c.1576A>C	c.(1576-1578)Aca>Cca	p.T526P		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	526					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CCCCCATTTGACACAGATGAA	0.383																																					p.T526P		.											.	NLRP14-295	0			c.A1576C						.						78.0	81.0	80.0					11																	7064833		2201	4296	6497	SO:0001583	missense	338323	exon4			CATTTGACACAGA	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1576A>C	11.37:g.7064833A>C	ENSP00000299481:p.Thr526Pro	55	0		71	4	NM_176822	0	0	0	0	0	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	A	4.324	0.059508	0.08339	.	.	ENSG00000158077	ENST00000299481	D	0.83914	-1.78	4.55	-0.311	0.12761	.	2.255640	0.01604	N	0.022204	T	0.74884	0.3775	L	0.46819	1.47	0.09310	N	1	B	0.17268	0.021	B	0.18871	0.023	T	0.49370	-0.8947	10	0.29301	T	0.29	.	0.3988	0.00422	0.4164:0.1882:0.2136:0.1818	.	526	Q86W24	NAL14_HUMAN	P	526	ENSP00000299481:T526P	ENSP00000299481:T526P	T	+	1	0	NLRP14	7021409	0.935000	0.31712	0.017000	0.16124	0.172000	0.22775	1.754000	0.38369	0.054000	0.16065	0.533000	0.62120	ACA	.		0.383	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		0	0		5	5	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
USP2	9099	hgsc.bcm.edu	37	11	119234664	119234664	+	Intron	SNP	G	G	C	rs201288742	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr11:119234664G>C	ENST00000260187.2	-	3	1069				USP2_ENST00000525735.1_Silent_p.P14P|USP2_ENST00000455332.2_Intron	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2						cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		AGGGGGCGGCGGGGGGGTCCT	0.736													G|||	30	0.00599042	0.0008	0.0101	5008	,	,		5033	0.0		0.0199	False		,,,				2504	0.002				p.P14P		.											.	USP2-661	0			c.C42G						.						2.0	2.0	2.0					11																	119234664		1456	3127	4583	SO:0001627	intron_variant	9099	exon1			GGCGGCGGGGGGG	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.775-3720C>G	11.37:g.119234664G>C		3	0		21	19	NM_171997	0	0	0	0	0	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Silent	SNP	ENST00000260187.2	37	CCDS8422.1																																																																																			G|0.991;C|0.009		0.736	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
ATXN2	6311	hgsc.bcm.edu	37	12	112036797	112036797	+	Silent	SNP	C	C	T	rs4098854	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:112036797C>T	ENST00000377617.3	-	1	683	c.522G>A	c.(520-522)caG>caA	p.Q174Q	ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000550104.1_Silent_p.Q174Q|ATXN2_ENST00000549455.1_5'UTR|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000608853.1_Silent_p.Q14Q|ATXN2_ENST00000389153.4_5'Flank	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	174	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731													C|||	3289	0.656749	0.5734	0.6787	5008	,	,		4944	0.622		0.7167	False		,,,				2504	0.728				p.Q174Q		.											.	ATXN2-136	0			c.G522A						.						1.0	1.0	1.0					12																	112036797		720	1770	2490	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.522G>A	12.37:g.112036797C>T		0	0		10	10	NM_002973	0	0	4	4	0	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			C|0.429;T|0.571		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		2	0		10	5	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
SRRM4	84530	hgsc.bcm.edu	37	12	119594447	119594447	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:119594447A>C	ENST00000267260.4	+	13	2068	c.1680A>C	c.(1678-1680)agA>agC	p.R560S		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	560	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						ggagccggagacggagccgga	0.736																																					p.R560S		.											.	SRRM4-2	0			c.A1680C						.						6.0	8.0	8.0					12																	119594447		1970	4135	6105	SO:0001583	missense	84530	exon13			CCGGAGACGGAGC	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1680A>C	12.37:g.119594447A>C	ENSP00000267260:p.Arg560Ser	8	0		74	17	NM_194286	0	0	0	0	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	A	9.506	1.104372	0.20632	.	.	ENSG00000139767	ENST00000267260	T	0.18338	2.22	5.61	1.72	0.24424	.	0.162693	0.52532	N	0.000070	T	0.06508	0.0167	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	9	.	.	.	-3.8367	4.911	0.13821	0.1374:0.5626:0.0:0.3	.	560	A7MD48	SRRM4_HUMAN	S	560	ENSP00000267260:R560S	.	R	+	3	2	SRRM4	118078830	0.028000	0.19301	0.045000	0.18777	0.360000	0.29518	-1.168000	0.03123	0.332000	0.23536	-0.775000	0.03384	AGA	.		0.736	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
SRRM4	84530	hgsc.bcm.edu	37	12	119594453	119594453	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:119594453C>A	ENST00000267260.4	+	13	2074	c.1686C>A	c.(1684-1686)agC>agA	p.S562R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	562	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						ggagacggagccggaCCCGCA	0.736																																					p.S562R		.											.	SRRM4-2	0			c.C1686A						.						6.0	8.0	7.0					12																	119594453		1971	4126	6097	SO:0001583	missense	84530	exon13			ACGGAGCCGGACC	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1686C>A	12.37:g.119594453C>A	ENSP00000267260:p.Ser562Arg	6	0		59	10	NM_194286	0	0	0	0	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530109	0.45073	.	.	ENSG00000139767	ENST00000267260	T	0.38722	1.12	4.84	3.94	0.45596	.	0.000000	0.85682	D	0.000000	T	0.35740	0.0942	N	0.08118	0	0.28436	N	0.917054	D	0.64830	0.994	P	0.60682	0.878	T	0.12167	-1.0558	9	.	.	.	-2.3885	10.1265	0.42652	0.0:0.9021:0.0:0.0979	.	562	A7MD48	SRRM4_HUMAN	R	562	ENSP00000267260:S562R	.	S	+	3	2	SRRM4	118078836	0.974000	0.33945	0.902000	0.35471	0.844000	0.47949	0.453000	0.21811	2.242000	0.73789	0.650000	0.86243	AGC	.		0.736	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
EP400	57634	bcgsc.ca	37	12	132547090	132547090	+	Silent	SNP	A	A	G	rs7974276	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:132547090A>G	ENST00000333577.4	+	48	8395	c.8286A>G	c.(8284-8286)caA>caG	p.Q2762Q	EP400_ENST00000332482.4_Silent_p.Q2689Q|EP400_ENST00000389561.2_Silent_p.Q2726Q|EP400_ENST00000330386.6_Silent_p.Q2645Q|EP400_ENST00000389562.2_Silent_p.Q2725Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2762	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacaacagcagc	0.557													G|||	1450	0.289537	0.6316	0.1671	5008	,	,		15386	0.1865		0.1322	False		,,,				2504	0.182				p.Q2726Q		.											.	EP400-520	0			c.A8178G						.						26.0	30.0	29.0					12																	132547090		2181	4250	6431	SO:0001819	synonymous_variant	57634	exon47			GCAGCAACAACAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8286A>G	12.37:g.132547090A>G		166	2		270	11	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.794;G|0.206		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
HNRNPA1L2	144983	hgsc.bcm.edu	37	13	53217493	53217493	+	Missense_Mutation	SNP	A	A	G	rs78872760	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr13:53217493A>G	ENST00000357495.2	+	1	926	c.866A>G	c.(865-867)tAt>tGt	p.Y289C	HNRNPA1L2_ENST00000398039.1_Missense_Mutation_p.Y289C|HNRNPA1L2_ENST00000342657.3_Missense_Mutation_p.Y289C			Q32P51	RA1L2_HUMAN	heterogeneous nuclear ribonucleoprotein A1-like 2	289	Gly-rich.|Nuclear targeting sequence. {ECO:0000250}.			Y -> C (in Ref. 4; AAI08267). {ECO:0000305}.	alternative mRNA splicing, via spliceosome (GO:0000380)|mRNA transport (GO:0051028)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			cervix(1)|large_intestine(1)|lung(5)	7						TCTGGCCCCTATGGCGGTGGA	0.463													-|||	857	0.171126	0.0174	0.1066	5008	,	,		21078	0.4206		0.1551	False		,,,				2504	0.184				p.Y289C		.											.	HNRNPA1L2-90	0			c.A866G						.	G	CYS/TYR,CYS/TYR	103,3207		1,101,1553	43.0	51.0	48.0		866,866	-0.7	0.8	13	dbSNP_131	48	806,5424		52,702,2361	no	missense,missense	HNRNPA1L2	NM_001011724.1,NM_001011725.1	194,194	53,803,3914	GG,GA,AA		12.9374,3.1118,9.5283	probably-damaging,probably-damaging	289/321,289/321	53217493	909,8631	1655	3115	4770	SO:0001583	missense	144983	exon7			GCCCCTATGGCGG		CCDS31980.1	13q14.3	2013-02-12			ENSG00000139675	ENSG00000139675		"""RNA binding motif (RRM) containing"""	27067	protein-coding gene	gene with protein product						12477932	Standard	NM_001011724		Approved	LOC144983	uc001vgy.1	Q32P51	OTTHUMG00000016972	ENST00000357495.2:c.866A>G	13.37:g.53217493A>G	ENSP00000350090:p.Tyr289Cys	0	0		4	4	NM_001011724	0	0	129	132	3	Q5TBS2	Missense_Mutation	SNP	ENST00000357495.2	37	CCDS31980.1	417	0.19093406593406592	15	0.03048780487804878	45	0.12430939226519337	237	0.4143356643356643	120	0.158311345646438	N	3.587	-0.084471	0.07097	0.031118	0.129374	ENSG00000139675	ENST00000342657;ENST00000398039;ENST00000357495	D;D;D	0.86097	-2.07;-2.07;-2.07	0.352	-0.704	0.11256	.	.	.	.	.	T	0.00012	0.0000	L	0.52759	1.655	0.45621	P	0.0014499999999999513	D	0.63046	0.992	P	0.49451	0.611	T	0.22906	-1.0203	8	0.56958	D	0.05	.	4.0376	0.09737	0.7167:0.0:0.2833:0.0	.	289	Q32P51	RA1L2_HUMAN	C	289	ENSP00000341285:Y289C;ENSP00000381119:Y289C;ENSP00000350090:Y289C	ENSP00000341285:Y289C	Y	+	2	0	HNRNPA1L2	52115494	0.998000	0.40836	0.839000	0.33178	0.057000	0.15508	2.154000	0.42291	-1.490000	0.01842	-2.001000	0.00444	TAT	A|0.826;G|0.174		0.463	HNRNPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045098.1	NM_001011724	
ARHGEF7	8874	bcgsc.ca	37	13	111870037	111870037	+	Silent	SNP	T	T	C	rs2296354	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr13:111870037T>C	ENST00000375741.2	+	6	793	c.543T>C	c.(541-543)gaT>gaC	p.D181D	ARHGEF7_ENST00000370623.3_Silent_p.D88D|ARHGEF7_ENST00000375723.1_Silent_p.D3D|ARHGEF7_ENST00000375737.5_Silent_p.D78D|ARHGEF7_ENST00000317133.5_Silent_p.D160D|ARHGEF7_ENST00000375736.4_Silent_p.D3D|ARHGEF7_ENST00000218789.5_Silent_p.D3D|ARHGEF7_ENST00000375739.2_Silent_p.D131D|ARHGEF7_ENST00000544132.1_5'UTR|ARHGEF7_ENST00000426073.2_Silent_p.D3D	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	181					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			ACATGACCGATAATAGCAACA	0.388													T|||	1246	0.248802	0.025	0.1225	5008	,	,		18731	0.6825		0.174	False		,,,				2504	0.271				p.D181D		.											.	ARHGEF7-232	0			c.T543C						.	T	,,,,	223,4183	134.5+/-170.7	3,217,1983	115.0	109.0	111.0		543,393,9,9,480	-3.1	0.4	13	dbSNP_100	111	1437,7163	276.7+/-292.4	115,1207,2978	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ARHGEF7	NM_001113511.1,NM_001113512.1,NM_001113513.1,NM_003899.3,NM_145735.2	,,,,	118,1424,4961	CC,CT,TT		16.7093,5.0613,12.7633	,,,,	181/804,131/754,3/647,3/647,160/783	111870037	1660,11346	2203	4300	6503	SO:0001819	synonymous_variant	8874	exon6			GACCGATAATAGC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.543T>C	13.37:g.111870037T>C		215	0		204	8	NM_001113511	0	0	0	0	0	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	37	CCDS45068.1																																																																																			T|0.807;C|0.193		0.388	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
NDRG2	57447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21488972	21488972	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr14:21488972C>G	ENST00000556147.1	-	7	1379	c.439G>C	c.(439-441)Gct>Cct	p.A147P	NDRG2_ENST00000397856.3_Missense_Mutation_p.A133P|NDRG2_ENST00000397853.3_Missense_Mutation_p.A147P|NDRG2_ENST00000554104.1_Missense_Mutation_p.A60P|NDRG2_ENST00000397855.3_Missense_Mutation_p.A133P|NDRG2_ENST00000554277.1_5'UTR|NDRG2_ENST00000555158.1_Missense_Mutation_p.A133P|NDRG2_ENST00000553503.1_Missense_Mutation_p.A133P|NDRG2_ENST00000298687.5_Missense_Mutation_p.A147P|NDRG2_ENST00000350792.3_Missense_Mutation_p.A133P|NDRG2_ENST00000397858.1_Missense_Mutation_p.A147P|NDRG2_ENST00000403829.3_Missense_Mutation_p.A143P|NDRG2_ENST00000397851.2_Missense_Mutation_p.A147P|NDRG2_ENST00000397844.2_Missense_Mutation_p.A133P|NDRG2_ENST00000360463.3_Missense_Mutation_p.A133P|NDRG2_ENST00000397847.2_Missense_Mutation_p.A147P|NDRG2_ENST00000298684.5_Missense_Mutation_p.A133P|NDRG2_ENST00000554143.1_Missense_Mutation_p.A133P			Q9UN36	NDRG2_HUMAN	NDRG family member 2	147					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TAGGCTCCAGCTCCAACACCA	0.458																																					p.A147P		.											.	NDRG2-154	0			c.G439C						.						100.0	98.0	99.0					14																	21488972		2203	4300	6503	SO:0001583	missense	57447	exon7			CTCCAGCTCCAAC	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.439G>C	14.37:g.21488972C>G	ENSP00000451712:p.Ala147Pro	36	0		34	22	NM_201537	0	0	0	2	2	B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	ENST00000556147.1	37	CCDS9565.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.310095|4.310095	0.81358|0.81358	.|.	.|.	ENSG00000165795|ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000557633;ENST00000554104;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556366;ENST00000556974;ENST00000555026;ENST00000553867;ENST00000449431;ENST00000557169;ENST00000555869;ENST00000557182;ENST00000555733;ENST00000555384;ENST00000554094;ENST00000553442;ENST00000556420;ENST00000553784;ENST00000557149;ENST00000555142;ENST00000554531;ENST00000557264;ENST00000557676;ENST00000556924;ENST00000556329;ENST00000554398;ENST00000554472;ENST00000554483|ENST00000553593	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.30981|.	1.51;1.51;1.51;1.76;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.76;1.76;1.51;1.51;1.51;1.51;1.51;1.51;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.046306|.	0.85682|.	D|.	0.000000|.	D|D	0.84800|0.84800	0.5552|0.5552	M|M	0.90309|0.90309	3.105|3.105	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.79108|.	0.988;0.987;0.979;0.979;0.992;0.98|.	D|D	0.87073|0.87073	0.2161|0.2161	10|5	0.87932|.	D|.	0|.	-14.9714|-14.9714	17.3958|17.3958	0.87444|0.87444	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	143;147;133;128;147;133|.	B4DE86;Q9UN36-3;Q9UN36-5;G3V3N4;Q9UN36;Q9UN36-4|.	.;.;.;.;NDRG2_HUMAN;.|.	P|D	147;133;128;147;90;60;133;133;147;133;147;133;147;147;133;133;133;133;143;133;60;133;133;147;108;133;133;92;147;147;133;133;133;147;133;133;136;133;133;133;133;147;147;133|62	ENSP00000298687:A147P;ENSP00000344620:A133P;ENSP00000380956:A147P;ENSP00000450835:A90P;ENSP00000452216:A60P;ENSP00000452038:A133P;ENSP00000452306:A133P;ENSP00000380951:A147P;ENSP00000353649:A133P;ENSP00000451712:A147P;ENSP00000452006:A133P;ENSP00000380949:A147P;ENSP00000380945:A147P;ENSP00000380954:A133P;ENSP00000380953:A133P;ENSP00000298684:A133P;ENSP00000380943:A133P;ENSP00000385889:A143P;ENSP00000451966:A133P;ENSP00000452413:A60P;ENSP00000452362:A133P;ENSP00000451274:A133P;ENSP00000450691:A147P;ENSP00000397250:A108P;ENSP00000452334:A133P;ENSP00000451105:A133P;ENSP00000450545:A92P;ENSP00000452482:A147P;ENSP00000451094:A147P;ENSP00000452278:A133P;ENSP00000450493:A133P;ENSP00000451951:A133P;ENSP00000451059:A147P;ENSP00000452592:A133P;ENSP00000450513:A133P;ENSP00000451302:A136P;ENSP00000451471:A133P;ENSP00000452548:A133P;ENSP00000450504:A133P;ENSP00000452262:A133P;ENSP00000451185:A147P;ENSP00000451348:A147P;ENSP00000451472:A133P|.	ENSP00000298684:A133P|.	A|E	-|-	1|3	0|2	NDRG2|NDRG2	20558812|20558812	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.406000|0.406000	0.30931|0.30931	7.147000|7.147000	0.77382|0.77382	2.706000|2.706000	0.92434|0.92434	0.563000|0.563000	0.77884|0.77884	GCT|GAG	.		0.458	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1		
SAMD4A	23034	hgsc.bcm.edu	37	14	55227152	55227152	+	Missense_Mutation	SNP	G	G	T	rs149416017	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr14:55227152G>T	ENST00000554335.1	+	7	2113	c.1450G>T	c.(1450-1452)Gcc>Tcc	p.A484S	SAMD4A_ENST00000251091.5_Missense_Mutation_p.A396S|SAMD4A_ENST00000357634.3_Missense_Mutation_p.A483S|SAMD4A_ENST00000392067.3_Missense_Mutation_p.A484S|SAMD4A_ENST00000555192.1_Missense_Mutation_p.A75S			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	484					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TGGGGAGCTGGCCGTCGCCCC	0.682													G|||	40	0.00798722	0.0023	0.0159	5008	,	,		13068	0.0		0.0249	False		,,,				2504	0.001				p.A484S		.											.	SAMD4A-90	0			c.G1450T						.	G	SER/ALA,SER/ALA,SER/ALA	21,3909		0,21,1944	4.0	6.0	5.0		1183,223,1447	5.2	1.0	14	dbSNP_134	5	153,7591		3,147,3722	no	missense,missense,missense	SAMD4A	NM_001161576.2,NM_001161577.1,NM_015589.5	99,99,99	3,168,5666	TT,TG,GG		1.9757,0.5344,1.4905	benign,benign,benign	395/630,75/346,483/718	55227152	174,11500	1965	3872	5837	SO:0001583	missense	23034	exon6			GAGCTGGCCGTCG	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.1450G>T	14.37:g.55227152G>T	ENSP00000452535:p.Ala484Ser	1	0		4	4	NM_015589	0	0	0	0	0	A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	ENST00000554335.1	37	CCDS32084.2	29	0.013278388278388278	1	0.0020325203252032522	8	0.022099447513812154	0	0.0	20	0.026385224274406333	G	15.72	2.917871	0.52546	0.005344	0.019757	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000305831;ENST00000251091;ENST00000357634;ENST00000555192	.	.	.	5.22	5.22	0.72569	.	0.112512	0.64402	D	0.000017	T	0.20251	0.0487	N	0.12182	0.205	0.34882	D	0.744671	B;B;B	0.16802	0.019;0.011;0.003	B;B;B	0.23574	0.047;0.037;0.002	T	0.34650	-0.9820	9	0.28530	T	0.3	-24.0747	18.9689	0.92707	0.0:0.0:1.0:0.0	.	75;396;484	G3V2R1;Q9UPU9-3;Q9UPU9	.;.;SMAG1_HUMAN	S	484;484;396;395;483;75	.	ENSP00000251091:A113S	A	+	1	0	SAMD4A	54296902	1.000000	0.71417	0.999000	0.59377	0.774000	0.43823	5.707000	0.68370	2.711000	0.92665	0.609000	0.83330	GCC	G|0.987;T|0.013		0.682	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	1	0		11	9	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
PLIN1	5346	hgsc.bcm.edu	37	15	90209135	90209135	+	Silent	SNP	G	G	A	rs8179074	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr15:90209135G>A	ENST00000300055.5	-	9	1413	c.1248C>T	c.(1246-1248)ttC>ttT	p.F416F	PLIN1_ENST00000430628.2_Silent_p.F416F	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	416					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						CGATGTCCCGGAATTCGCTCT	0.741													G|||	104	0.0207668	0.0015	0.0288	5008	,	,		8462	0.0		0.0716	False		,,,				2504	0.0102				p.F416F		.											.	PLIN1-91	0			c.C1248T						.	G	,	31,3055		0,31,1512	4.0	5.0	4.0		1248,1248	0.6	1.0	15	dbSNP_117	4	256,5878		2,252,2813	no	coding-synonymous,coding-synonymous	PLIN1	NM_001145311.1,NM_002666.4	,	2,283,4325	AA,AG,GG		4.1735,1.0045,3.1128	,	416/523,416/523	90209135	287,8933	1543	3067	4610	SO:0001819	synonymous_variant	5346	exon9			GTCCCGGAATTCG	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1248C>T	15.37:g.90209135G>A		0	0		9	9	NM_001145311	0	0	0	0	0	Q8N5Y6	Silent	SNP	ENST00000300055.5	37	CCDS10353.1																																																																																			G|0.976;A|0.024		0.741	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		0	0		10	10	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
ANKS3	124401	hgsc.bcm.edu	37	16	4748461	4748461	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr16:4748461G>C	ENST00000304283.4	-	14	1985	c.1691C>G	c.(1690-1692)gCc>gGc	p.A564G	ANKS3_ENST00000446014.2_Missense_Mutation_p.A435G|ANKS3_ENST00000585773.1_Missense_Mutation_p.A491G	NM_133450.3	NP_597707.1	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain containing 3	564										endometrium(5)|kidney(4)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	19						AGCATCCCGGGCCAGGGCCCA	0.741																																					p.A564G		.											.	ANKS3-90	0			c.C1691G						.						5.0	7.0	6.0					16																	4748461		2074	4112	6186	SO:0001583	missense	124401	exon14			TCCCGGGCCAGGG	AK057329	CCDS10520.1, CCDS73820.1	16p13.3	2013-01-10			ENSG00000168096	ENSG00000168096		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	29422	protein-coding gene	gene with protein product						11853319	Standard	NM_133450		Approved	KIAA1977, FLJ32345, FLJ32767	uc002cxj.2	Q6ZW76	OTTHUMG00000129478	ENST00000304283.4:c.1691C>G	16.37:g.4748461G>C	ENSP00000304586:p.Ala564Gly	3	0		21	5	NM_133450	0	0	1	1	0	B4DWU4|D3DUE2|Q8TF25	Missense_Mutation	SNP	ENST00000304283.4	37	CCDS10520.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052383	0.55218	.	.	ENSG00000168096	ENST00000304283;ENST00000446014	T;T	0.38722	1.12;2.84	5.46	3.39	0.38822	.	0.177969	0.50627	D	0.000117	T	0.36991	0.0987	M	0.64997	1.995	0.51233	D	0.999918	B	0.32245	0.361	B	0.27608	0.081	T	0.37126	-0.9719	10	0.62326	D	0.03	-21.4157	9.6942	0.40147	0.0772:0.1417:0.7811:0.0	.	564	Q6ZW76	ANKS3_HUMAN	G	564;435	ENSP00000304586:A564G;ENSP00000406796:A435G	ENSP00000304586:A564G	A	-	2	0	ANKS3	4688462	0.937000	0.31787	0.017000	0.16124	0.006000	0.05464	2.972000	0.49256	1.312000	0.45043	0.551000	0.68910	GCC	.		0.741	ANKS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251642.3	NM_133450	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		12	12	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
SPNS3	201305	bcgsc.ca	37	17	4391132	4391132	+	Silent	SNP	C	C	T	rs2291743	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:4391132C>T	ENST00000355530.2	+	12	1762	c.1482C>T	c.(1480-1482)aaC>aaT	p.N494N	RP13-580F15.2_ENST00000576086.1_RNA|SPNS3_ENST00000333476.2_Silent_p.N367N	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	494					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.N494N(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						TGGACAGCAACGACCTGGAGA	0.622													C|||	775	0.154752	0.0567	0.1715	5008	,	,		18930	0.0437		0.3171	False		,,,				2504	0.2229				p.N494N		.											.	SPNS3-153	1	Substitution - coding silent(1)	stomach(1)	c.C1482T						.	C		402,4004	200.4+/-223.7	21,360,1822	130.0	119.0	123.0		1482	-3.1	0.0	17	dbSNP_100	123	2582,6018	419.5+/-353.1	371,1840,2089	no	coding-synonymous	SPNS3	NM_182538.4		392,2200,3911	TT,TC,CC		30.0233,9.1239,22.9433		494/513	4391132	2984,10022	2203	4300	6503	SO:0001819	synonymous_variant	201305	exon12			CAGCAACGACCTG		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1482C>T	17.37:g.4391132C>T		266	2		244	8	NM_182538	0	0	2	2	0	Q8IZ31	Silent	SNP	ENST00000355530.2	37	CCDS11045.1																																																																																			C|0.793;T|0.207		0.622	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
SPNS3	201305	bcgsc.ca	37	17	4391153	4391153	+	Silent	SNP	A	A	G	rs333122	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:4391153A>G	ENST00000355530.2	+	12	1783	c.1503A>G	c.(1501-1503)ctA>ctG	p.L501L	RP13-580F15.2_ENST00000576086.1_RNA|SPNS3_ENST00000333476.2_Silent_p.L374L	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	501					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.L501L(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GACAAGGCCTACTTTCGGGCG	0.622													G|||	869	0.173522	0.1256	0.1729	5008	,	,		18292	0.0446		0.3171	False		,,,				2504	0.2239				p.L501L		.											.	SPNS3-153	1	Substitution - coding silent(1)	stomach(1)	c.A1503G						.	G		626,3780	767.8+/-413.5	50,526,1627	114.0	104.0	107.0		1503	1.2	0.0	17	dbSNP_79	107	2537,6063	692.6+/-404.6	364,1809,2127	no	coding-synonymous	SPNS3	NM_182538.4		414,2335,3754	GG,GA,AA		29.5,14.2079,24.3195		501/513	4391153	3163,9843	2203	4300	6503	SO:0001819	synonymous_variant	201305	exon12			AGGCCTACTTTCG		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1503A>G	17.37:g.4391153A>G		262	4		228	8	NM_182538	0	0	3	3	0	Q8IZ31	Silent	SNP	ENST00000355530.2	37	CCDS11045.1																																																																																			A|0.784;G|0.216		0.622	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438793.1	NM_182538	
RAI1	10743	ucsc.edu	37	17	17697102	17697102	+	Silent	SNP	G	G	A	rs398124422|rs34083643|rs398124421|rs587780431		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:17697102G>A	ENST00000353383.1	+	3	1309	c.840G>A	c.(838-840)caG>caA	p.Q280Q	RAI1_ENST00000261641.6_Silent_p.Q280Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	280	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.Q280fs*84(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ACcagcagcagcagcagcagc	0.627																																					p.Q280Q		.											.	RAI1-91	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	c.G840A						.						20.0	25.0	23.0					17																	17697102		2038	4033	6071	SO:0001819	synonymous_variant	10743	exon3			GCAGCAGCAGCAG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.840G>A	17.37:g.17697102G>A		56	2		94	10	NM_030665	0	0	0	0	0	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	37	CCDS11188.1																																																																																			.		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
RNF135	84282	hgsc.bcm.edu	37	17	29298390	29298390	+	Missense_Mutation	SNP	A	A	G	rs368080023	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:29298390A>G	ENST00000328381.5	+	1	1172	c.299A>G	c.(298-300)cAc>cGc	p.H100R	RP11-848P1.2_ENST00000580979.1_RNA|RNF135_ENST00000443677.2_Missense_Mutation_p.H100R|RNF135_ENST00000535306.2_Missense_Mutation_p.H100R|RNF135_ENST00000324689.4_Missense_Mutation_p.H100R	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	100					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				GACCCTGCCCACTGCCCCTGC	0.756													A|||	6	0.00119808	0.0	0.0029	5008	,	,		10218	0.0		0.004	False		,,,				2504	0.0				p.H100R		.											.	RNF135-227	1	Unknown(1)	central_nervous_system(1)	c.A299G						.	A	ARG/HIS,ARG/HIS,ARG/HIS	0,2936		0,0,1468	2.0	2.0	2.0		299,299,299	-1.2	0.0	17		2	12,5934		0,12,2961	no	missense,missense,missense	RNF135	NM_001184992.1,NM_032322.3,NM_197939.1	29,29,29	0,12,4429	GG,GA,AA		0.2018,0.0,0.1351	benign,benign,benign	100/287,100/433,100/211	29298390	12,8870	1468	2973	4441	SO:0001583	missense	84282	exon1			CTGCCCACTGCCC	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.299A>G	17.37:g.29298390A>G	ENSP00000328340:p.His100Arg	2	0		9	5	NM_197939	0	0	0	0	0	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	.	.	.	.	.	.	.	.	.	.	a	0.017	-1.494607	0.01009	0.0	0.002018	ENSG00000181481	ENST00000328381;ENST00000324689;ENST00000535306;ENST00000443677	T;T;T	0.55588	0.51;3.04;3.0	0.605	-1.21	0.09524	Zinc finger, RING/FYVE/PHD-type (1);	0.542584	0.13900	N	0.354951	T	0.25644	0.0624	N	0.08118	0	0.09310	N	1	B;B;B;B	0.14012	0.003;0.009;0.005;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.10543	-1.0625	10	0.25106	T	0.35	-2.718	6.0937	0.20008	0.7348:0.2652:0.0:0.0	.	100;100;100;100	F5GX60;Q8IUD6-2;B2R7G9;Q8IUD6	.;.;.;RN135_HUMAN	R	100;100;100;34	ENSP00000328340:H100R;ENSP00000323693:H100R;ENSP00000440470:H100R	ENSP00000323693:H100R	H	+	2	0	RNF135	26322516	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.954000	0.03873	-1.399000	0.02063	-0.708000	0.03648	CAC	.		0.756	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
ARL5C	390790	broad.mit.edu;bcgsc.ca	37	17	37316988	37316988	+	Missense_Mutation	SNP	T	T	C	rs16522	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:37316988T>C	ENST00000269586.7	-	5	346	c.347A>G	c.(346-348)cAg>cGg	p.Q116R	ARL5C_ENST00000444555.1_Missense_Mutation_p.Q116R	NM_001143968.1	NP_001137440.1	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C	116					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)										TGAAGCATCCTGTAGAGCCTG	0.557													C|||	698	0.139377	0.0439	0.1124	5008	,	,		21098	0.2609		0.168	False		,,,				2504	0.1329				p.Q116R		.											.	ARL5C-68	0			c.A347G						.	C	ARG/GLN	103,1281		1,101,590	47.0	44.0	45.0		347	-1.9	0.0	17	dbSNP_54	45	459,2723		25,409,1157	yes	missense	ARL5C	NM_001143968.1	43	26,510,1747	CC,CT,TT		14.4249,7.4422,12.3084	benign	116/180	37316988	562,4004	692	1591	2283	SO:0001583	missense	390790	exon5			GCATCCTGTAGAG		CCDS45664.1	17q12	2014-05-09	2005-11-08	2005-11-08	ENSG00000141748	ENSG00000141748		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31111	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 12"""	ARL12			Standard	NM_001143968		Approved		uc010wea.2	A6NH57		ENST00000269586.7:c.347A>G	17.37:g.37316988T>C	ENSP00000269586:p.Gln116Arg	109	0		100	6	NM_001143968	0	0	0	0	0		Missense_Mutation	SNP	ENST00000269586.7	37	CCDS45664.1	340	0.15567765567765568	28	0.056910569105691054	48	0.13259668508287292	137	0.2395104895104895	127	0.16754617414248021	C	0.038	-1.296182	0.01364	0.074422	0.144249	ENSG00000141748	ENST00000444555;ENST00000269586	T;T	0.61980	0.06;0.06	3.81	-1.94	0.07571	Small GTP-binding protein domain (1);	0.515982	0.18278	N	0.146105	T	0.00012	0.0000	N	0.04018	-0.295	0.80722	P	0.0	B	0.02656	0.0	B	0.09377	0.004	T	0.07868	-1.0750	9	0.02654	T	1	-0.2891	5.5222	0.16939	0.1521:0.2667:0.0:0.5812	rs16522;rs60715918;rs16522	116	A6NH57	ARL5C_HUMAN	R	116	ENSP00000387615:Q116R;ENSP00000269586:Q116R	ENSP00000269586:Q116R	Q	-	2	0	ARL5C	34570514	0.003000	0.15002	0.000000	0.03702	0.036000	0.12997	-0.024000	0.12435	-0.826000	0.04284	-0.119000	0.15052	CAG	A|0.012;C|0.144		0.557	ARL5C-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444566.1	NM_001143968	
TTLL6	284076	hgsc.bcm.edu	37	17	46846505	46846505	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:46846505G>T	ENST00000393382.3	-	15	2663	c.2522C>A	c.(2521-2523)aCt>aAt	p.T841N	TTLL6_ENST00000433608.2_Missense_Mutation_p.T534N	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GTCCCTCAGAGTAACATTATA	0.567																																					p.T841N		.											.	TTLL6-90	0			c.C2522A						.						60.0	52.0	54.0					17																	46846505		2203	4300	6503	SO:0001583	missense	284076	exon15			CTCAGAGTAACAT	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.2522C>A	17.37:g.46846505G>T	ENSP00000377043:p.Thr841Asn	108	0		78	4	NM_001130918	0	0	0	0	0		Missense_Mutation	SNP	ENST00000393382.3	37	CCDS45724.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820358	0.32145	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	.	.	.	5.52	4.49	0.54785	.	.	.	.	.	T	0.31009	0.0783	L	0.36672	1.1	0.09310	N	1	P;B	0.34462	0.454;0.187	B;B	0.25140	0.038;0.058	T	0.14282	-1.0478	8	0.45353	T	0.12	.	11.8241	0.52256	0.0:0.1763:0.8237:0.0	.	793;534	Q8N841;G5E937	TTLL6_HUMAN;.	N	841;534;519;793	.	ENSP00000302547:T534N	T	-	2	0	TTLL6	44201504	0.007000	0.16637	0.010000	0.14722	0.014000	0.08584	1.170000	0.31883	2.767000	0.95098	0.563000	0.77884	ACT	.		0.567	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
EVPL	2125	bcgsc.ca	37	17	74014668	74014668	+	Missense_Mutation	SNP	T	T	C	rs2071192	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:74014668T>C	ENST00000301607.3	-	12	1551	c.1298A>G	c.(1297-1299)cAg>cGg	p.Q433R	EVPL_ENST00000586740.1_Missense_Mutation_p.Q433R	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	433	Globular 1.		Q -> R (in dbSNP:rs2071192).		epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCGCTCACCCTGCAGCAGCTG	0.672													C|||	3385	0.675919	0.6286	0.6326	5008	,	,		14530	0.755		0.6193	False		,,,				2504	0.7474				p.Q433R		.											.	EVPL-93	0			c.A1298G						.	C	ARG/GLN	2822,1584		928,966,309	20.0	23.0	22.0		1298	0.9	0.1	17	dbSNP_96	22	5547,3051		1793,1961,545	yes	missense	EVPL	NM_001988.2	43	2721,2927,854	CC,CT,TT		35.485,35.951,35.6429	benign	433/2034	74014668	8369,4635	2203	4299	6502	SO:0001583	missense	2125	exon12			TCACCCTGCAGCA	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1298A>G	17.37:g.74014668T>C	ENSP00000301607:p.Gln433Arg	190	2		230	8	NM_001988	0	0	0	0	0	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	1434	0.6565934065934066	306	0.6219512195121951	228	0.6298342541436464	423	0.7395104895104895	477	0.6292875989445911	C	0.007	-1.969808	0.00457	0.64049	0.64515	ENSG00000167880	ENST00000301607	T	0.55930	0.49	5.12	0.862	0.19056	.	0.111675	0.64402	N	0.000020	T	0.00012	0.0000	N	0.00128	-2.045	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45963	-0.9225	9	0.02654	T	1	-37.7909	10.6638	0.45717	0.0:0.6588:0.0:0.3412	rs2071192;rs60805472;rs2071192	433;433	B7ZLH8;Q92817	.;EVPL_HUMAN	R	433	ENSP00000301607:Q433R	ENSP00000301607:Q433R	Q	-	2	0	EVPL	71526263	0.000000	0.05858	0.082000	0.20525	0.039000	0.13416	0.965000	0.29319	-0.158000	0.11040	-0.930000	0.02707	CAG	T|0.239;G|0.223		0.672	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
UTS2R	2837	broad.mit.edu	37	17	80333066	80333066	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:80333066C>A	ENST00000313135.2	+	1	914	c.866C>A	c.(865-867)gCg>gAg	p.A289E		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	289					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			GCCCCGCTGGCGCCGCGGACG	0.672																																					p.A289E		.											.	UTS2R-153	0			c.C866A						.																																			SO:0001583	missense	2837	exon1			CGCTGGCGCCGCG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.866C>A	17.37:g.80333066C>A	ENSP00000323516:p.Ala289Glu	32	1		114	7	NM_018949	0	0	0	0	0	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313287	0.40996	.	.	ENSG00000181408	ENST00000313135	T	0.72051	-0.62	4.95	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.338048	0.28257	U	0.016009	T	0.61375	0.2342	N	0.17723	0.515	0.09310	N	1	P	0.42973	0.796	P	0.50791	0.65	T	0.55711	-0.8098	10	0.07644	T	0.81	.	14.9821	0.71319	0.0:0.5448:0.4552:0.0	.	289	Q9UKP6	UR2R_HUMAN	E	289	ENSP00000323516:A289E	ENSP00000323516:A289E	A	+	2	0	UTS2R	77926355	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.380000	0.20602	0.518000	0.28383	0.637000	0.83480	GCG	.		0.672	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
ZFR2	23217	hgsc.bcm.edu	37	19	3831404	3831404	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:3831404G>C	ENST00000262961.4	-	5	759	c.749C>G	c.(748-750)tCg>tGg	p.S250W	ZFR2_ENST00000591965.1_5'Flank	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	250	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CGGTGGCTTCGAGTCGGCCCT	0.716																																					p.S250W		.											.	ZFR2-70	0			c.C749G						.																																			SO:0001583	missense	23217	exon5			GGCTTCGAGTCGG	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.749C>G	19.37:g.3831404G>C	ENSP00000262961:p.Ser250Trp	2	0		19	10	NM_015174	0	0	0	0	0		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904941	0.33628	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15487	3.19;2.42	3.52	-0.00659	0.14012	.	.	.	.	.	T	0.07728	0.0194	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.31916	-0.9926	9	0.72032	D	0.01	4.7946	4.4246	0.11497	0.2239:0.3961:0.3801:0.0	.	250	Q9UPR6	ZFR2_HUMAN	W	250	ENSP00000262961:S250W;ENSP00000388974:S250W	ENSP00000262961:S250W	S	-	2	0	ZFR2	3782404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.000000	0.12993	-0.076000	0.12775	-1.121000	0.02013	TCG	.		0.716	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
PLIN5	440503	hgsc.bcm.edu	37	19	4524016	4524016	+	Missense_Mutation	SNP	G	G	A	rs1062223	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:4524016G>A	ENST00000381848.3	-	8	996	c.916C>T	c.(916-918)Cgg>Tgg	p.R306W		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	306	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.		R -> W (in dbSNP:rs1062223). {ECO:0000269|PubMed:17234449}.		lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GGCAGGCCCCGCACGCTGGAC	0.711													G|||	464	0.0926518	0.0091	0.2104	5008	,	,		13130	0.0288		0.1958	False		,,,				2504	0.0818				p.R306W		.											.	PLIN5-22	0			c.C916T						.	G	TRP/ARG	154,3340		10,134,1603	3.0	4.0	4.0		916	4.6	1.0	19	dbSNP_86	4	1294,5560		114,1066,2247	yes	missense	PLIN5	NM_001013706.2	101	124,1200,3850	AA,AG,GG		18.8795,4.4076,13.993	probably-damaging	306/464	4524016	1448,8900	1747	3427	5174	SO:0001583	missense	440503	exon8			GGCCCCGCACGCT	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.916C>T	19.37:g.4524016G>A	ENSP00000371272:p.Arg306Trp	0	0		8	6	NM_001013706	0	0	0	0	0	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	234	0.10714285714285714	10	0.02032520325203252	65	0.17955801104972377	18	0.03146853146853147	141	0.18601583113456466	.	17.14	3.314611	0.60524	0.044076	0.188795	ENSG00000214456	ENST00000381848	T	0.19938	2.11	4.59	4.59	0.56863	.	0.906390	0.09191	U	0.835949	T	0.00073	0.0002	L	0.47716	1.5	0.09310	P	1.0	D	0.89917	1.0	D	0.71184	0.972	T	0.05666	-1.0871	9	0.87932	D	0	-24.5419	14.8561	0.70338	0.0:0.0:1.0:0.0	rs1062223;rs3170378	306	Q00G26	PLIN5_HUMAN	W	306	ENSP00000371272:R306W	ENSP00000371272:R306W	R	-	1	2	PLIN5	4475016	0.995000	0.38212	0.996000	0.52242	0.090000	0.18270	5.443000	0.66581	2.080000	0.62538	0.511000	0.50034	CGG	G|0.892;A|0.108		0.711	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
ZNF266	10781	bcgsc.ca	37	19	9524185	9524185	+	Silent	SNP	A	A	G	rs2241356	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:9524185A>G	ENST00000592904.1	-	5	3492	c.1416T>C	c.(1414-1416)gcT>gcC	p.A472A	ZNF266_ENST00000588221.1_Silent_p.A472A|ZNF266_ENST00000588933.1_Silent_p.A472A|ZNF266_ENST00000590306.1_Silent_p.A472A|ZNF266_ENST00000361151.1_Silent_p.A472A|ZNF266_ENST00000361451.2_Silent_p.A472A|ZNF266_ENST00000592292.1_Silent_p.A472A			Q14584	ZN266_HUMAN	zinc finger protein 266	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A472A(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						GAAACTTAAAAGCTTTGCCAC	0.428													G|||	2976	0.594249	0.7466	0.5663	5008	,	,		21979	0.4613		0.5716	False		,,,				2504	0.5685				p.A472A		.											.	ZNF266-91	1	Substitution - coding silent(1)	stomach(1)	c.T1416C						.	G	,	3187,1219	423.0+/-339.9	1135,917,151	72.0	57.0	62.0		1416,1416	1.4	0.1	19	dbSNP_98	62	5079,3521	512.3+/-377.9	1513,2053,734	no	coding-synonymous,coding-synonymous	ZNF266	NM_006631.2,NM_198058.1	,	2648,2970,885	GG,GA,AA		40.9419,27.6668,36.4447	,	472/550,472/550	9524185	8266,4740	2203	4300	6503	SO:0001819	synonymous_variant	10781	exon11			CTTAAAAGCTTTG	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1416T>C	19.37:g.9524185A>G		161	1		176	6	NM_001271314	0	0	1	1	0	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Silent	SNP	ENST00000592904.1	37	CCDS12213.1																																																																																			A|0.383;G|0.617		0.428	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
NWD1	284434	broad.mit.edu	37	19	16859997	16859997	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:16859997G>A	ENST00000552788.1	+	4	544	c.544G>A	c.(544-546)Gaa>Aaa	p.E182K	NWD1_ENST00000339803.6_Missense_Mutation_p.E47K|NWD1_ENST00000379808.3_Missense_Mutation_p.E182K|NWD1_ENST00000524140.2_Missense_Mutation_p.E182K|NWD1_ENST00000549814.1_Missense_Mutation_p.E182K|NWD1_ENST00000523826.1_5'UTR			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	182							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGAGGACCGGGAACAGGGAGC	0.572																																					p.E182K		.											.	NWD1-7	0			c.G544A						.						69.0	55.0	60.0					19																	16859997		2203	4300	6503	SO:0001583	missense	284434	exon6			GACCGGGAACAGG	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.544G>A	19.37:g.16859997G>A	ENSP00000447224:p.Glu182Lys	182	0		204	6	NM_001007525	0	0	0	0	0	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	g	0.284	-0.984184	0.02180	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000552788;ENST00000339803	T;T;T;T;T	0.54675	1.84;1.84;1.84;1.84;0.56	4.15	3.11	0.35812	.	1.135850	0.06493	N	0.735008	T	0.22704	0.0548	N	0.02011	-0.69	0.23396	N	0.997761	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.26395	-1.0104	10	0.06099	T	0.92	-6.1753	6.8731	0.24131	0.1279:0.0:0.8721:0.0	.	182;47	Q149M9-3;C9J2Y8	.;.	K	47;182;182;182;182;47	ENSP00000428579:E182K;ENSP00000447548:E182K;ENSP00000369136:E182K;ENSP00000447224:E182K;ENSP00000340159:E47K	ENSP00000340159:E47K	E	+	1	0	NWD1	16720997	0.293000	0.24371	0.007000	0.13788	0.005000	0.04900	2.408000	0.44574	1.879000	0.54435	0.442000	0.29010	GAA	.		0.572	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
GDF1	2657	hgsc.bcm.edu	37	19	18980172	18980172	+	Missense_Mutation	SNP	G	G	A	rs4808863	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:18980172G>A	ENST00000247005.6	-	8	1698	c.353C>T	c.(352-354)gCc>gTc	p.A118V	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	118			A -> V (in dbSNP:rs4808863). {ECO:0000269|PubMed:2034669}.		growth (GO:0040007)	extracellular space (GO:0005615)											CGCGGCCGAGGCAGGCTCCGA	0.716													g|||	1171	0.233826	0.0401	0.4986	5008	,	,		5099	0.1687		0.3946	False		,,,				2504	0.2096				p.A118V		.											.	GDF1-226	0			c.C353T						.						2.0	2.0	2.0					19																	18980172		1157	2328	3485	SO:0001583	missense	2657	exon8			GCCGAGGCAGGCT	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.353C>T	19.37:g.18980172G>A	ENSP00000247005:p.Ala118Val	0	0		12	11	NM_001492	0	0	0	0	0	O43344	Missense_Mutation	SNP	ENST00000247005.6	37	CCDS42526.1	621	0.28434065934065933	39	0.07926829268292683	184	0.5082872928176796	110	0.19230769230769232	288	0.37994722955145116	g	11.82	1.752739	0.31046	.	.	ENSG00000130283	ENST00000247005	T	0.78481	-1.18	3.33	0.926	0.19430	.	0.692776	0.14240	U	0.332130	T	0.00012	0.0000	L	0.44542	1.39	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.41805	-0.9488	7	0.16896	T	0.51	.	9.0728	0.36502	0.0:0.4429:0.5571:0.0	rs4808863	.	.	.	V	118	ENSP00000247005:A118V	ENSP00000247005:A118V	A	-	2	0	GDF1	18841172	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.201000	0.17276	-0.047000	0.13423	-0.546000	0.04227	GCC	G|0.715;A|0.285		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465926.1	NM_001492	
ZNF676	163223	hgsc.bcm.edu	37	19	22363460	22363460	+	Silent	SNP	A	A	G	rs78757874		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:22363460A>G	ENST00000397121.2	-	3	1376	c.1059T>C	c.(1057-1059)acT>acC	p.T353T		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCTTATGTTTAGTAAGGATTG	0.398																																					p.T353T		.											.	ZNF676-90	0			c.T1059C						.																																			SO:0001819	synonymous_variant	163223	exon3			ATGTTTAGTAAGG	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1059T>C	19.37:g.22363460A>G		20	0		40	5	NM_001001411	0	0	0	0	0	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																			.		0.398	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
PTGIR	5739	hgsc.bcm.edu	37	19	47127439	47127439	+	Missense_Mutation	SNP	A	A	G	rs200213497	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:47127439A>G	ENST00000291294.2	-	2	177	c.44T>C	c.(43-45)gTg>gCg	p.V15A	PTGIR_ENST00000596260.1_Missense_Mutation_p.V15A|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	15					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GGCCGGCCCCACCGAGCCCCG	0.721													A|||	11	0.00219649	0.0	0.0014	5008	,	,		14750	0.0		0.002	False		,,,				2504	0.0082				p.V15A		.											.	PTGIR-522	0			c.T44C						.	A	ALA/VAL	4,3360		0,4,1678	5.0	3.0	4.0		44	3.5	1.0	19		4	17,6937		0,17,3460	yes	missense	PTGIR	NM_000960.3	64	0,21,5138	GG,GA,AA		0.2445,0.1189,0.2035	possibly-damaging	15/387	47127439	21,10297	1682	3477	5159	SO:0001583	missense	5739	exon2			GGCCCCACCGAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.44T>C	19.37:g.47127439A>G	ENSP00000291294:p.Val15Ala	0	0		6	5	NM_000960	0	0	0	0	0		Missense_Mutation	SNP	ENST00000291294.2	37	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	A	4.849	0.157768	0.09236	0.001189	0.002445	ENSG00000160013	ENST00000291294	T	0.08807	3.05	4.57	3.5	0.40072	.	0.139105	0.45606	D	0.000349	T	0.04318	0.0119	N	0.14661	0.345	0.09310	N	1	B	0.27351	0.176	B	0.22753	0.041	T	0.41805	-0.9488	10	0.20519	T	0.43	-14.9576	8.3423	0.32252	0.6766:0.3234:0.0:0.0	.	15	P43119	PI2R_HUMAN	A	15	ENSP00000291294:V15A	ENSP00000291294:V15A	V	-	2	0	PTGIR	51819279	0.000000	0.05858	0.973000	0.42090	0.990000	0.78478	0.141000	0.16076	1.917000	0.55516	0.402000	0.26972	GTG	.		0.721	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
PPP1R15A	23645	bcgsc.ca	37	19	49377873	49377873	+	Silent	SNP	G	G	A	rs35023389	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:49377873G>A	ENST00000200453.5	+	2	1652	c.1383G>A	c.(1381-1383)ttG>ttA	p.L461L		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	461	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		AAGCAGCCTTGGGAGAAGCTG	0.562													G|||	419	0.0836661	0.0877	0.0793	5008	,	,		18197	0.003		0.164	False		,,,				2504	0.0818				p.L461L		.											.	PPP1R15A-226	0			c.G1383A						.	G		576,3830	255.2+/-260.5	35,506,1662	73.0	74.0	73.0		1383	0.6	0.0	19	dbSNP_126	73	1549,7051	290.4+/-299.8	128,1293,2879	no	coding-synonymous	PPP1R15A	NM_014330.3		163,1799,4541	AA,AG,GG		18.0116,13.0731,16.3386		461/675	49377873	2125,10881	2203	4300	6503	SO:0001819	synonymous_variant	23645	exon2			AGCCTTGGGAGAA	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1383G>A	19.37:g.49377873G>A		222	2		189	8	NM_014330	0	0	11	11	0	B4DKQ3|Q6IA96|Q9NVU6	Silent	SNP	ENST00000200453.5	37	CCDS12738.1																																																																																			G|0.861;A|0.139		0.562	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
GYS1	2997	bcgsc.ca	37	19	49485548	49485548	+	Silent	SNP	G	G	A	rs5464	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:49485548G>A	ENST00000323798.3	-	7	1222	c.1026C>T	c.(1024-1026)ttC>ttT	p.F342F	GYS1_ENST00000541188.1_Silent_p.F262F|GYS1_ENST00000544287.1_5'UTR|GYS1_ENST00000540532.1_Missense_Mutation_p.S223F|GYS1_ENST00000263276.6_Silent_p.F278F	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	342					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		ATGCCTCCAGGAAGACGTCAG	0.517													G|||	1275	0.254593	0.2943	0.2608	5008	,	,		17958	0.2183		0.2922	False		,,,				2504	0.1953				p.F342F		.											.	GYS1-524	0			c.C1026T						.	G	,	1243,3163	431.0+/-342.8	197,849,1157	110.0	101.0	104.0		834,1026	4.2	1.0	19	dbSNP_52	104	2535,6065	415.4+/-351.8	365,1805,2130	no	coding-synonymous,coding-synonymous	GYS1	NM_001161587.1,NM_002103.4	,	562,2654,3287	AA,AG,GG		29.4767,28.2115,29.0481	,	278/674,342/738	49485548	3778,9228	2203	4300	6503	SO:0001819	synonymous_variant	2997	exon7			CTCCAGGAAGACG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1026C>T	19.37:g.49485548G>A		230	0		182	7	NM_002103	0	0	0	0	0	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1	589	0.2696886446886447	156	0.3170731707317073	100	0.27624309392265195	134	0.23426573426573427	199	0.262532981530343	G	12.39	1.922336	0.33908	0.282115	0.294767	ENSG00000104812	ENST00000540532	T	0.26373	1.74	5.21	4.16	0.48862	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.39974	P	0.025175999999999976	.	.	.	.	.	.	T	0.43669	-0.9377	4	.	.	.	-31.0172	8.5832	0.33642	0.1731:0.0:0.8269:0.0	rs5464;rs2228476;rs8192706;rs13306416;rs16981011;rs16981013;rs17206756;rs5464	.	.	.	F	223	ENSP00000445197:S223F	.	S	-	2	0	GYS1	54177360	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.703000	0.37846	2.613000	0.88420	0.650000	0.86243	TCC	G|0.713;A|0.287		0.517	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
CGB7	94027	ucsc.edu	37	19	49558216	49558216	+	Missense_Mutation	SNP	C	C	T	rs35728583		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:49558216C>T	ENST00000597853.1	-	4	2936	c.65G>A	c.(64-66)aGg>aAg	p.R22K	CGB7_ENST00000593309.1_5'Flank|CGB7_ENST00000377280.3_Missense_Mutation_p.R22K|CGB7_ENST00000596965.1_Missense_Mutation_p.R22K|CGB7_ENST00000356213.4_Missense_Mutation_p.R20K			P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	22			K -> R (in dbSNP:rs6518). {ECO:0000269|PubMed:11861891}.		apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			lung(3)|urinary_tract(2)	5		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		AAGCATCTCCCTGGATGCCCA	0.657																																					p.R22K		.											.	CGB7-90	0			c.G65A						.						93.0	71.0	79.0					19																	49558216		1501	2676	4177	SO:0001583	missense	94027	exon2			ATCTCCCTGGATG	K00092	CCDS33071.1	19q13.32	2008-02-05				ENSG00000196337			16451	protein-coding gene	gene with protein product		608826				6194155	Standard	NM_033142		Approved	CG-beta-a		P01233		ENST00000597853.1:c.65G>A	19.37:g.49558216C>T	ENSP00000470813:p.Arg22Lys	35	2		28	10	NM_033142	0	0	0	0	0	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Missense_Mutation	SNP	ENST00000597853.1	37	CCDS33071.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.450441	0.01080	.	.	ENSG00000196337	ENST00000377280;ENST00000356213	T;T	0.37235	1.21;1.21	2.0	-0.353	0.12594	.	0.756883	0.12433	N	0.469369	T	0.12987	0.0315	.	.	.	0.21652	N	0.999605	.	.	.	.	.	.	T	0.31052	-0.9957	7	0.07175	T	0.84	-4.9346	5.7377	0.18075	0.0:0.7882:0.0:0.2118	rs35728583;rs62127884	.	.	.	K	22;20	ENSP00000366493:R22K;ENSP00000348545:R20K	ENSP00000348545:R20K	R	-	2	0	CGB7	54250028	0.041000	0.20044	0.676000	0.29932	0.004000	0.04260	0.530000	0.23036	0.027000	0.15297	-2.696000	0.00138	AGG	C|0.674;T|0.326		0.657	CGB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466254.1	NM_033142	
ZNF83	55769	bcgsc.ca	37	19	53116856	53116856	+	Missense_Mutation	SNP	T	T	A	rs199873537		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:53116856T>A	ENST00000597597.1	-	2	3215	c.962A>T	c.(961-963)gAg>gTg	p.E321V	ZNF83_ENST00000391789.4_Missense_Mutation_p.E293V|ZNF83_ENST00000541777.2_Missense_Mutation_p.E321V|ZNF83_ENST00000544146.1_Missense_Mutation_p.E321V|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Missense_Mutation_p.E321V|ZNF83_ENST00000536937.1_Missense_Mutation_p.E321V|ZNF83_ENST00000301096.3_Missense_Mutation_p.E321V|ZNF83_ENST00000601257.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTTGCCACACTCATTACATTT	0.413																																					p.E321V		.											.	ZNF83-91	0			c.A962T						.						100.0	105.0	103.0					19																	53116856		2203	4300	6503	SO:0001583	missense	55769	exon3			CCACACTCATTAC	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.962A>T	19.37:g.53116856T>A	ENSP00000472619:p.Glu321Val	121	2		185	10	NM_018300	0	0	5	6	1	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	9.585	1.124585	0.20959	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;3.42	2.1	2.1	0.27182	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25269	0.0614	N	0.01668	-0.77	0.09310	N	0.999997	D;D	0.76494	0.965;0.999	P;D	0.91635	0.74;0.999	T	0.21724	-1.0237	9	0.52906	T	0.07	.	9.0405	0.36314	0.0:0.0:0.0:1.0	.	293;321	P51522-2;P51522	.;ZNF83_HUMAN	V	321;321;321;293;321;321;293	ENSP00000445993:E321V;ENSP00000301096:E321V;ENSP00000445470:E321V;ENSP00000440713:E321V;ENSP00000439681:E321V;ENSP00000375666:E293V	ENSP00000301096:E321V	E	-	2	0	ZNF83	57808668	0.000000	0.05858	0.523000	0.27875	0.041000	0.13682	-0.692000	0.05127	0.984000	0.38629	0.324000	0.21423	GAG	.		0.413	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
ZBTB45	84878	hgsc.bcm.edu	37	19	59028585	59028585	+	Silent	SNP	G	G	A	rs11545185	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr19:59028585G>A	ENST00000594051.1	-	2	936	c.456C>T	c.(454-456)cgC>cgT	p.R152R	ZBTB45_ENST00000600990.1_Silent_p.R152R|ZBTB45_ENST00000354590.3_Silent_p.R152R			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	152	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GGTGGCGCAGGCGGTGACGCA	0.751											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	783	0.15635	0.171	0.1571	5008	,	,		12592	0.0556		0.2097	False		,,,				2504	0.1851				p.R152R	NSCLC(164;1383 2017 5233 27540 46677)	.											.	ZBTB45-90	0			c.C456T						.	G		607,3451		44,519,1466	9.0	12.0	11.0		456	0.6	1.0	19	dbSNP_120	11	1218,6788		98,1022,2883	no	coding-synonymous	ZBTB45	NM_032792.2		142,1541,4349	AA,AG,GG		15.2136,14.9581,15.1277		152/512	59028585	1825,10239	2029	4003	6032	SO:0001819	synonymous_variant	84878	exon2			GCGCAGGCGGTGA	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.456C>T	19.37:g.59028585G>A		0	0	1035	4	4	NM_032792	0	0	0	0	0		Silent	SNP	ENST00000594051.1	37	CCDS12984.1																																																																																			G|0.844;A|0.156		0.751	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792	
TMEM247	388946	bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	187	2		292	30	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
BCL11A	53335	broad.mit.edu	37	2	60688968	60688968	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr2:60688968A>G	ENST00000335712.6	-	4	1306	c.1079T>C	c.(1078-1080)cTc>cCc	p.L360P	BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.L326P|BCL11A_ENST00000358510.4_Missense_Mutation_p.L326P|BCL11A_ENST00000356842.4_Missense_Mutation_p.L360P|BCL11A_ENST00000537768.1_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	360	Pro-rich.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CAGAGGAGGGAGGGGGGGCGT	0.632			T	IGH@	B-CLL																																p.L360P		.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A-1149	0			c.T1079C						.						38.0	47.0	44.0					2																	60688968		2198	4297	6495	SO:0001583	missense	53335	exon4			GGAGGGAGGGGGG	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1079T>C	2.37:g.60688968A>G	ENSP00000338774:p.Leu360Pro	59	5		87	9	NM_018014	0	0	0	0	0	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	A	10.14	1.269549	0.23221	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000335712;ENST00000358510	T;T;T;T	0.10573	2.86;3.12;3.1;3.05	5.74	5.74	0.90152	.	0.069904	0.64402	N	0.000020	T	0.30103	0.0754	L	0.59436	1.845	0.80722	D	1	D;D;B;D	0.89917	0.999;0.997;0.024;1.0	D;P;B;D	0.78314	0.991;0.855;0.039;0.991	T	0.00677	-1.1614	10	0.48119	T	0.1	-2.4653	16.0382	0.80645	1.0:0.0:0.0:0.0	.	326;326;360;360	F5H2Y4;Q9H165-6;Q9H165;D9YZV9	.;.;BC11A_HUMAN;.	P	360;396;326;360;326	ENSP00000349300:L360P;ENSP00000438303:L326P;ENSP00000338774:L360P;ENSP00000351307:L326P	ENSP00000338774:L360P	L	-	2	0	BCL11A	60542472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.272000	0.58908	2.194000	0.70268	0.533000	0.62120	CTC	.		0.632	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
COPS7B	64708	broad.mit.edu;bcgsc.ca	37	2	232659056	232659056	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr2:232659056A>G	ENST00000350033.3	+	4	463	c.322A>G	c.(322-324)Atg>Gtg	p.M108V	COPS7B_ENST00000410024.1_Missense_Mutation_p.M108V|COPS7B_ENST00000409295.1_Missense_Mutation_p.M74V|COPS7B_ENST00000373608.3_Missense_Mutation_p.M108V|COPS7B_ENST00000410017.1_Missense_Mutation_p.M108V|COPS7B_ENST00000409091.1_Start_Codon_SNP_p.M1V	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B	108	PCI.				cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GGCATCAAGAATGAAGGTACG	0.512																																					p.M108V		.											.	COPS7B-228	0			c.A322G						.						160.0	124.0	136.0					2																	232659056		2203	4300	6503	SO:0001583	missense	64708	exon4			TCAAGAATGAAGG	AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000350033.3:c.322A>G	2.37:g.232659056A>G	ENSP00000272995:p.Met108Val	90	0		58	4	NM_022730	0	0	0	0	0	Q53S22|Q5BJG3|Q9H7V6	Missense_Mutation	SNP	ENST00000350033.3	37	CCDS2488.1	.	.	.	.	.	.	.	.	.	.	A	8.704	0.910493	0.17833	.	.	ENSG00000144524	ENST00000410024;ENST00000409295;ENST00000409091;ENST00000350033;ENST00000410017;ENST00000373608;ENST00000537799	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	6.17	6.17	0.99709	Proteasome component (PCI) domain (2);	0.042949	0.85682	D	0.000000	T	0.22666	0.0547	N	0.17082	0.46	0.50632	D	0.999888	B;B;B	0.29253	0.105;0.01;0.239	B;B;B	0.31191	0.065;0.032;0.125	T	0.07046	-1.0793	10	0.24483	T	0.36	-0.2698	16.8222	0.85835	1.0:0.0:0.0:0.0	.	108;108;108	Q53GQ2;Q9H9Q2-3;Q9H9Q2	.;.;CSN7B_HUMAN	V	108;74;1;108;108;108;1	ENSP00000386567:M108V;ENSP00000386438:M74V;ENSP00000272995:M108V;ENSP00000386880:M108V;ENSP00000362710:M108V	ENSP00000272995:M108V	M	+	1	0	COPS7B	232367300	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	6.711000	0.74675	2.371000	0.80710	0.533000	0.62120	ATG	.		0.512	COPS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256964.2	NM_022730	
FAM182A	284800	broad.mit.edu	37	20	26061803	26061803	+	RNA	SNP	C	C	A	rs78281752	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr20:26061803C>A	ENST00000376398.2	+	0	823					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						ATTTCAGTTTCTTTTGATTTC	0.443																																					.		.											.	.	0			.						.						13.0	11.0	12.0					20																	26061803		692	1589	2281			284800	.			CAGTTTCTTTTGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061803C>A		23	0		60	11	.	0	0	1	1	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	9.534	1.111620	0.20714	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.55847	0.1946	.	.	.	0.33448	D	0.583239	.	.	.	.	.	.	T	0.67142	-0.5745	4	0.87932	D	0	.	.	.	.	.	.	.	.	Y	52	.	ENSP00000246000:S52Y	S	+	2	0	FAM182A	26009803	0.964000	0.33143	0.497000	0.27552	0.480000	0.33159	0.675000	0.25232	0.451000	0.26802	0.123000	0.15791	TCT	C|0.649;A|0.351		0.443	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	567	8		726	23	.	0	0	3	3	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	broad.mit.edu	37	20	29625971	29625971	+	Missense_Mutation	SNP	C	C	A	rs145033899		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr20:29625971C>A	ENST00000278882.3	+	5	595	c.215C>A	c.(214-216)cCa>cAa	p.P72Q	FRG1B_ENST00000439954.2_Missense_Mutation_p.P77Q|FRG1B_ENST00000358464.4_Missense_Mutation_p.P72Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	72										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CAATGGGAACCAGTCTTTCAA	0.328																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			GGGAACCAGTCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.215C>A	20.37:g.29625971C>A	ENSP00000278882:p.Pro72Gln	102	1		145	6	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	12.14	1.847531	0.32606	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49720	0.77	1.68	1.68	0.24146	.	0.112402	0.64402	D	0.000009	T	0.63271	0.2497	.	.	.	0.49483	D	0.999795	D	0.63046	0.992	D	0.79784	0.993	T	0.65948	-0.6044	9	0.66056	D	0.02	.	9.3557	0.38164	0.0:1.0:0.0:0.0	.	77	F5H5R5	.	Q	72;77;72	ENSP00000408863:P77Q	ENSP00000278882:P72Q	P	+	2	0	FRG1B	28239632	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	6.442000	0.73443	1.250000	0.43966	0.184000	0.17185	CCA	.		0.328	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
WISP2	8839	hgsc.bcm.edu	37	20	43348735	43348735	+	Silent	SNP	C	C	A	rs2296530	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr20:43348735C>A	ENST00000372868.2	+	3	601	c.258C>A	c.(256-258)ggC>ggA	p.G86G	RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000372865.4_Silent_p.G86G|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000190983.4_Silent_p.G86G			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	86	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GACCCGGTGGCCGGGGGGCCC	0.706													C|||	1984	0.396166	0.4803	0.4452	5008	,	,		15685	0.3909		0.339	False		,,,				2504	0.3119				p.G86G		.											.	WISP2-130	0			c.C258A						.	C		1905,2317		492,921,698	5.0	5.0	5.0		258	5.5	0.1	20	dbSNP_100	5	2588,5598		519,1550,2024	no	coding-synonymous	WISP2	NM_003881.2		1011,2471,2722	AA,AC,CC		31.615,45.1208,36.2105		86/251	43348735	4493,7915	2111	4093	6204	SO:0001819	synonymous_variant	8839	exon2			CGGTGGCCGGGGG	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.258C>A	20.37:g.43348735C>A		0	0		9	9	NM_003881	0	0	0	1	1	B2R9N4|E1P612|Q6PEG3	Silent	SNP	ENST00000372868.2	37	CCDS13336.1																																																																																			C|0.615;A|0.385		0.706	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
MN1	4330	broad.mit.edu	37	22	28194934	28194936	+	In_Frame_Del	DEL	TGC	TGC	-	rs34890218|rs45480998|rs45597040	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr22:28194934_28194936delTGC	ENST00000302326.4	-	1	2550_2552	c.1596_1598delGCA	c.(1594-1599)cagcaa>caa	p.532_533QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	532	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q532Q(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ctgctgctgttgctgctgctgct	0.65			T	ETV6	"""AML, meningioma"""																																p.532_533del		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	1	Substitution - coding silent(1)	prostate(1)	c.1596_1598del						.			226,138,2110		41,6,138,37,58,957						-0.4	1.0		dbSNP_126	5	429,825,4222		34,24,337,178,445,1720	no	codingComplex	MN1	NM_002430.2		75,30,475,215,503,2677	A1A1,A1A2,A1R,A2A2,A2R,RR		22.8999,14.713,20.3522				655,963,6332				SO:0001651	inframe_deletion	4330	exon1			TGCTGTTGCTGCT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598delGCA	22.37:g.28194943_28194945delTGC	ENSP00000304956:p.Gln550del	10	0		100	7	NM_002430	0	0	0	0	0	A9Z1V9	In_Frame_Del	DEL	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.650	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		4	4	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
FBLN2	2199	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	13612958	13612958	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:13612958T>C	ENST00000295760.7	+	2	1172	c.1103T>C	c.(1102-1104)gTc>gCc	p.V368A	FBLN2_ENST00000492059.1_Missense_Mutation_p.V368A|FBLN2_ENST00000535798.1_Missense_Mutation_p.V394A|FBLN2_ENST00000404922.3_Missense_Mutation_p.V368A	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	368	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GCTGCTCTCGTCCCAACTCAG	0.657																																					p.V368A		.											.	FBLN2-91	0			c.T1103C						.						34.0	46.0	42.0					3																	13612958		2146	4237	6383	SO:0001583	missense	2199	exon2			CTCTCGTCCCAAC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1103T>C	3.37:g.13612958T>C	ENSP00000295760:p.Val368Ala	33	0		110	8	NM_001998	0	0	0	0	0	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	T	5.917	0.353273	0.11182	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79653	-1.29;-1.22;-1.2;-1.22	4.64	-9.27	0.00659	.	1.979650	0.02165	N	0.059121	T	0.58366	0.2117	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23185	0.028;0.081;0.065	B;B;B	0.20767	0.022;0.031;0.023	T	0.52283	-0.8596	10	0.12103	T	0.63	.	6.5128	0.22232	0.087:0.5133:0.1657:0.234	.	368;368;394	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	A	394;368;368;368	ENSP00000445705:V394A;ENSP00000384169:V368A;ENSP00000295760:V368A;ENSP00000420042:V368A	ENSP00000295760:V368A	V	+	2	0	FBLN2	13587959	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.963000	0.01513	-2.194000	0.00753	-0.296000	0.09543	GTC	.		0.657	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
HHATL	57467	bcgsc.ca	37	3	42735150	42735150	+	Missense_Mutation	SNP	T	T	C	rs11079	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:42735150T>C	ENST00000441594.1	-	10	1468	c.1207A>G	c.(1207-1209)Atg>Gtg	p.M403V	HHATL_ENST00000310417.5_Missense_Mutation_p.M403V	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	403			M -> V (in dbSNP:rs11079).		negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		AGTTTTTGCATCCAGAGCTCA	0.572													C|||	3251	0.649161	0.6785	0.6787	5008	,	,		17935	0.7113		0.5924	False		,,,				2504	0.5828				p.M403V		.											.	HHATL-93	0			c.A1207G						.		VAL/MET	2878,1528	483.9+/-359.9	934,1010,259	50.0	46.0	47.0		1207	4.3	1.0	3	dbSNP_52	47	5072,3528	513.4+/-378.2	1462,2148,690	yes	missense	HHATL	NM_020707.3	21	2396,3158,949	CC,CT,TT		41.0233,34.68,38.8744	benign	403/505	42735150	7950,5056	2203	4300	6503	SO:0001583	missense	57467	exon10			TTTGCATCCAGAG	AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1207A>G	3.37:g.42735150T>C	ENSP00000405423:p.Met403Val	111	0		117	8	NM_020707	0	0	3	3	0	Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	CCDS2704.1	1409	0.6451465201465202	338	0.6869918699186992	236	0.6519337016574586	393	0.6870629370629371	442	0.58311345646438	c	4.841	0.156349	0.09236	0.6532	0.589767	ENSG00000010282	ENST00000310417;ENST00000441594	T;T	0.72394	-0.65;-0.65	4.35	4.35	0.52113	.	0.060080	0.64402	N	0.000003	T	0.00012	0.0000	N	0.00044	-2.455	0.39949	P	0.025487000000000037	B	0.02656	0.0	B	0.01281	0.0	T	0.45131	-0.9282	9	0.07030	T	0.85	-3.6735	12.4847	0.55866	0.0:0.9175:0.0:0.0825	rs11079;rs1046552;rs3172382;rs17237886;rs60079680;rs11079	403	Q9HCP6	HHATL_HUMAN	V	403	ENSP00000310621:M403V;ENSP00000405423:M403V	ENSP00000310621:M403V	M	-	1	0	HHATL	42710154	1.000000	0.71417	0.999000	0.59377	0.630000	0.37929	3.125000	0.50469	0.827000	0.34685	-0.404000	0.06349	ATG	T|0.381;C|0.619		0.572	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707	
NBEAL2	23218	broad.mit.edu	37	3	47036675	47036675	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:47036675G>T	ENST00000450053.3	+	13	1629	c.1450G>T	c.(1450-1452)Gcc>Tcc	p.A484S	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.A484S	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	484					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CAGCTGCCCTGCCAGCCGTGC	0.677																																					p.A484S		.											.	NBEAL2-69	0			c.G1450T						.						7.0	8.0	8.0					3																	47036675		1952	4070	6022	SO:0001583	missense	23218	exon13			TGCCCTGCCAGCC	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.1450G>T	3.37:g.47036675G>T	ENSP00000415034:p.Ala484Ser	23	0		97	9	NM_015175	0	0	0	0	0	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	4.150	0.026253	0.08054	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.49720	0.77;0.77	4.59	1.62	0.23740	Armadillo-like helical (1);Armadillo-type fold (1);	0.449291	0.22539	N	0.058757	T	0.25457	0.0619	L	0.28274	0.84	0.80722	D	1	B;B	0.25667	0.131;0.006	B;B	0.21151	0.033;0.005	T	0.04320	-1.0960	10	0.09843	T	0.71	.	5.4741	0.16686	0.1981:0.2893:0.5126:0.0	.	450;484	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	S	484;484;450	ENSP00000292309:A484S;ENSP00000415034:A484S	ENSP00000292309:A484S	A	+	1	0	NBEAL2	47011679	0.893000	0.30496	0.997000	0.53966	0.951000	0.60555	1.393000	0.34497	0.674000	0.31244	-0.224000	0.12420	GCC	.		0.677	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		8	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	1	0		8	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
PPP2R3A	5523	bcgsc.ca	37	3	135722264	135722264	+	Missense_Mutation	SNP	A	A	G	rs17197552	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr3:135722264A>G	ENST00000264977.3	+	2	2541	c.1924A>G	c.(1924-1926)Agt>Ggt	p.S642G	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	642			S -> G (in dbSNP:rs17197552).		eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGTCTGTAGAAGTCCTGTTGG	0.423													A|||	865	0.172724	0.1505	0.1412	5008	,	,		17582	0.0288		0.2783	False		,,,				2504	0.2648				p.S642G		.											.	PPP2R3A-662	0			c.A1924G						.	A	,GLY/SER	770,3634	291.0+/-281.2	64,642,1496	82.0	77.0	79.0		,1924	3.5	1.0	3	dbSNP_123	79	2708,5892	418.8+/-352.9	415,1878,2007	yes	intron,missense	PPP2R3A	NM_001190447.1,NM_002718.4	,56	479,2520,3503	GG,GA,AA		31.4884,17.4841,26.7456	,benign	,642/1151	135722264	3478,9526	2202	4300	6502	SO:0001583	missense	5523	exon2			TGTAGAAGTCCTG	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1924A>G	3.37:g.135722264A>G	ENSP00000264977:p.Ser642Gly	150	0		125	7	NM_002718	0	0	0	0	0	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	340	0.15567765567765568	66	0.13414634146341464	57	0.1574585635359116	13	0.022727272727272728	204	0.2691292875989446	A	9.126	1.010279	0.19277	0.174841	0.314884	ENSG00000073711	ENST00000264977	T	0.06218	3.33	5.83	3.47	0.39725	.	0.643751	0.17330	N	0.178150	T	0.00012	0.0000	N	0.24115	0.695	0.09310	P	0.999999999742355	B	0.02656	0.0	B	0.04013	0.001	T	0.47636	-0.9102	9	0.44086	T	0.13	.	8.2194	0.31532	0.8457:0.0:0.1543:0.0	rs17197552;rs52827295;rs17197552	642	Q06190	P2R3A_HUMAN	G	642	ENSP00000264977:S642G	ENSP00000264977:S642G	S	+	1	0	PPP2R3A	137204954	0.878000	0.30173	0.996000	0.52242	0.962000	0.63368	1.520000	0.35899	0.481000	0.27557	0.460000	0.39030	AGT	A|0.779;G|0.221		0.423	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
SPON2	10417	hgsc.bcm.edu	37	4	1165131	1165131	+	Missense_Mutation	SNP	C	C	T	rs193114328	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:1165131C>T	ENST00000290902.5	-	3	696	c.364G>A	c.(364-366)Gcg>Acg	p.A122T	SPON2_ENST00000431380.1_Missense_Mutation_p.A122T	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	122	Spondin. {ECO:0000255|PROSITE- ProRule:PRU00364}.		E -> A (in dbSNP:rs11247975). {ECO:0000269|PubMed:10512675, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15815621, ECO:0000269|Ref.5}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		GAAAACACCGCGTGCACGCTC	0.741													C|||	23	0.00459265	0.0015	0.0029	5008	,	,		7766	0.0		0.0149	False		,,,				2504	0.0041				p.A122T		.											.	SPON2-90	0			c.G364A						.	C	THR/ALA,THR/ALA,THR/ALA	14,4172		0,14,2079	9.0	10.0	10.0		364,364,364	2.4	0.2	4		10	121,8139		1,119,4010	no	missense,missense,missense	SPON2	NM_001128325.2,NM_001199021.1,NM_012445.3	58,58,58	1,133,6089	TT,TC,CC		1.4649,0.3344,1.0847	,,	122/332,122/332,122/332	1165131	135,12311	2093	4130	6223	SO:0001583	missense	10417	exon3			ACACCGCGTGCAC	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.364G>A	4.37:g.1165131C>T	ENSP00000290902:p.Ala122Thr	0	0		36	31	NM_012445	0	0	0	0	0	D3DVN9|Q4W5N4|Q9ULW1	Missense_Mutation	SNP	ENST00000290902.5	37	CCDS3347.1	22	0.010073260073260074	4	0.008130081300813009	6	0.016574585635359115	0	0.0	12	0.0158311345646438	C	15.05	2.718085	0.48622	0.003344	0.014649	ENSG00000159674	ENST00000290902;ENST00000431380	T;T	0.41065	1.01;1.01	4.59	2.44	0.29823	.	0.467518	0.24691	N	0.036396	T	0.07413	0.0187	N	0.02916	-0.46	0.32399	N	0.552237	B	0.32409	0.37	B	0.21360	0.034	T	0.17349	-1.0372	10	0.14252	T	0.57	.	11.5526	0.50729	0.0:0.8175:0.0:0.1825	.	122	D3DVN9	.	T	122	ENSP00000290902:A122T;ENSP00000394832:A122T	ENSP00000290902:A122T	A	-	1	0	SPON2	1155131	0.920000	0.31207	0.153000	0.22517	0.296000	0.27459	3.433000	0.52834	0.915000	0.36847	0.511000	0.50034	GCG	C|0.990;T|0.010		0.741	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
CRIPAK	285464	hgsc.bcm.edu	37	4	1388664	1388664	+	Missense_Mutation	SNP	T	T	C	rs199774688	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:1388664T>C	ENST00000324803.4	+	1	3325	c.365T>C	c.(364-366)aTg>aCg	p.M122T		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	122					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.682													N|||	3	0.000599042	0.0008	0.0	5008	,	,		14509	0.0		0.001	False		,,,				2504	0.001				p.M122T		.											.	CRIPAK-90	0			c.T365C						.						141.0	131.0	134.0					4																	1388664		2203	4300	6503	SO:0001583	missense	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.365T>C	4.37:g.1388664T>C	ENSP00000323978:p.Met122Thr	26	0		135	8	NM_175918	0	0	2	2	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.697	-0.062261	0.07317	.	.	ENSG00000179979	ENST00000324803	T	0.16897	2.31	0.948	0.948	0.19561	Post-SET domain (1);	.	.	.	.	T	0.07188	0.0182	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14023	0.01	T	0.39375	-0.9617	9	0.21540	T	0.41	.	6.1496	0.20304	0.0:0.0:0.0:1.0	.	122	Q8N1N5	CRPAK_HUMAN	T	122	ENSP00000323978:M122T	ENSP00000323978:M122T	M	+	2	0	CRIPAK	1378664	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.813000	0.04491	0.697000	0.31718	0.102000	0.15555	ATG	T|0.995;C|0.005		0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
HTT	3064	bcgsc.ca	37	4	3215835	3215835	+	Missense_Mutation	SNP	T	T	C	rs362331	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:3215835T>C	ENST00000355072.5	+	50	7070	c.6925T>C	c.(6925-6927)Tac>Cac	p.Y2309H		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2309			Y -> H (in dbSNP:rs362331).		anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTCCCTCATCTACTGTGTGCA	0.582													C|||	2210	0.441294	0.5862	0.4294	5008	,	,		19331	0.3859		0.4334	False		,,,				2504	0.319				p.Y2309H		.											.	HTT-281	0			c.T6925C						.	C	HIS/TYR	2355,1813		681,993,410	34.0	38.0	36.0		6925	5.7	1.0	4	dbSNP_79	36	3533,4873		764,2005,1434	yes	missense	HTT	NM_002111.6	83	1445,2998,1844	CC,CT,TT		42.0295,43.4981,46.8268	benign	2309/3143	3215835	5888,6686	2084	4203	6287	SO:0001583	missense	3064	exon50			CTCATCTACTGTG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.6925T>C	4.37:g.3215835T>C	ENSP00000347184:p.Tyr2309His	109	1		82	5	NM_002111	0	0	0	0	0	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	995	0.4555860805860806	281	0.5711382113821138	161	0.4447513812154696	220	0.38461538461538464	333	0.4393139841688654	C	9.562	1.118641	0.20877	0.565019	0.420295	ENSG00000197386	ENST00000355072	T	0.04603	3.59	5.7	5.7	0.88788	.	0.117131	0.64402	N	0.000015	T	0.00012	0.0000	N	0.00583	-1.355	0.47065	P	6.969999999999477E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.21518	-1.0243	9	0.13853	T	0.58	.	8.2136	0.31499	0.2523:0.6699:0.0:0.0778	rs362331;rs878244;rs2229983;rs3821970;rs17793687;rs52791365;rs58994081;rs362331	2309	P42858	HD_HUMAN	H	2309	ENSP00000347184:Y2309H	ENSP00000347184:Y2309H	Y	+	1	0	HTT	3185633	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.175000	0.50855	1.427000	0.47276	-0.119000	0.15052	TAC	C|0.453;N|0.000		0.582	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	0	0		4	4	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071E		.											.	DSPP-90	0			c.C3213A						.						56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu	812	8		912	41	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC	.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537090	88537090	+	Silent	SNP	T	T	C	rs376726974	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:88537090T>C	ENST00000282478.7	+	4	3309	c.3276T>C	c.(3274-3276)aaT>aaC	p.N1092N	DSPP_ENST00000399271.1_Silent_p.N1092N|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1092	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcaatagcagtgaca	0.542													C|||	281	0.0561102	0.1029	0.0288	5008	,	,		11943	0.0407		0.0467	False		,,,				2504	0.0378				p.N1092N		.											.	DSPP-90	0			c.T3276C						.						20.0	30.0	27.0					4																	88537090		782	1592	2374	SO:0001819	synonymous_variant	1834	exon5			CAGCAATAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3276T>C	4.37:g.88537090T>C		648	38		377	51	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
ADH6	130	broad.mit.edu	37	4	100137315	100137316	+	Splice_Site	DEL	TA	TA	-			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:100137315_100137316delTA	ENST00000237653.7	-	2	505		c.e2+1		RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000407820.2_Splice_Site|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000394897.1_Splice_Site|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394899.2_Splice_Site	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)						ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	tttttttttttACCTTTATGCG	0.371																																					.		.											.	ADH6-228	0			.						.																																			SO:0001630	splice_region_variant	130	.			TTTTTTTACCTTT	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.120+1TA>-	4.37:g.100137315_100137316delTA		4	0		9	4	.	0	0	0	0	0	B3KS45|Q58F53	Splice_Site	DEL	ENST00000237653.7	37	CCDS3647.1																																																																																			T|1.000		0.371	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672	Intron
COL25A1	84570	bcgsc.ca	37	4	109863370	109863370	+	Missense_Mutation	SNP	C	C	T	rs17531474	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:109863370C>T	ENST00000399127.1	-	8	894	c.547G>A	c.(547-549)Gtc>Atc	p.V183I	COL25A1_ENST00000399132.1_Intron|COL25A1_ENST00000399126.1_Intron	NM_001256074.1	NP_001243003.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CAAACCTTGACGGTGAGGATC	0.517													C|||	240	0.0479233	0.0144	0.1153	5008	,	,		19844	0.002		0.1113	False		,,,				2504	0.0276				p.V183I		.											.	COL25A1-92	0			c.G547A						.																																			SO:0001583	missense	84570	exon7			CCTTGACGGTGAG	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399127.1:c.547G>A	4.37:g.109863370C>T	ENSP00000382078:p.Val183Ile	396	3		345	14	NM_001256074	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399127.1	37	CCDS58922.1	132	0.06043956043956044	4	0.008130081300813009	45	0.12430939226519337	1	0.0017482517482517483	82	0.10817941952506596	C	16.50	3.140536	0.56936	.	.	ENSG00000188517	ENST00000399127	D	0.90444	-2.67	5.54	5.54	0.83059	.	.	.	.	.	T	0.29190	0.0726	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.64952	-0.6286	4	.	.	.	.	19.9261	0.97102	0.0:1.0:0.0:0.0	rs17531474;rs61271252;rs17531474	.	.	.	I	183	ENSP00000382078:V183I	.	V	-	1	0	COL25A1	110082819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.442000	0.80503	2.778000	0.95560	0.650000	0.86243	GTC	C|0.940;T|0.060		0.517	COL25A1-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000315940.1	NM_032518	
LRIT3	345193	broad.mit.edu	37	4	110772859	110772859	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr4:110772859C>A	ENST00000594814.1	+	2	316	c.316C>A	c.(316-318)Caa>Aaa	p.Q106K	LRIT3_ENST00000379920.3_Missense_Mutation_p.Q61K|LRIT3_ENST00000327908.3_5'UTR	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	106					regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		CAACCTGAAGCAACTGCATGA	0.532																																					p.Q106K		.											.	LRIT3-90	0			c.C316A						.						98.0	84.0	88.0					4																	110772859		692	1591	2283	SO:0001583	missense	345193	exon2			CTGAAGCAACTGC	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.316C>A	4.37:g.110772859C>A	ENSP00000469759:p.Gln106Lys	64	0		68	7	NM_198506	0	0	0	0	0	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	C	7.573	0.667179	0.14710	.	.	ENSG00000183423	ENST00000379920	T	0.55413	0.52	6.17	5.32	0.75619	.	.	.	.	.	T	0.32041	0.0816	N	0.03999	-0.3	0.80722	D	1	B	0.27932	0.194	B	0.27076	0.076	T	0.13764	-1.0497	9	0.15499	T	0.54	.	17.4526	0.87596	0.0:0.8757:0.1243:0.0	.	61	Q3SXY7	LRIT3_HUMAN	K	61	ENSP00000369252:Q61K	ENSP00000369252:Q61K	Q	+	1	0	LRIT3	110992308	0.996000	0.38824	0.106000	0.21319	0.953000	0.61014	2.447000	0.44917	1.587000	0.49959	0.655000	0.94253	CAA	.		0.532	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000504286.1_3'UTR|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|NSUN2_ENST00000506139.1_5'Flank|NSUN2_ENST00000539938.1_5'Flank	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		6	6	NM_001047	0	0	0	0	0	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
GABRG2	2566	hgsc.bcm.edu	37	5	161529571	161529571	+	Intron	SNP	A	A	G	rs211035	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr5:161529571A>G	ENST00000361925.4	+	5	851				GABRG2_ENST00000414552.2_Missense_Mutation_p.I215V|GABRG2_ENST00000393933.4_Intron|GABRG2_ENST00000356592.3_Intron			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2						adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	gtctcgttctattgcccaggc	0.473													G|||	4113	0.821286	0.8608	0.8646	5008	,	,		16083	0.7202		0.8042	False		,,,				2504	0.8589				p.I215V		.											.	GABRG2-95	0			c.A643G						.																																			SO:0001627	intron_variant	2566	exon6			CGTTCTATTGCCC		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.631+1248A>G	5.37:g.161529571A>G		0	0		6	6	NM_198903	0	0	0	0	0	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	1762	0.8067765567765568	426	0.8658536585365854	303	0.8370165745856354	420	0.7342657342657343	613	0.8087071240105541	G	0.003	-2.502500	0.00157	.	.	ENSG00000113327	ENST00000414552	T	0.13307	2.6	0.225	0.225	0.15325	.	.	.	.	.	T	0.00012	0.0000	N	0.01640	-0.785	0.80722	P	0.0	B	0.13145	0.007	B	0.01281	0.0	T	0.28138	-1.0053	7	0.02654	T	1	.	.	.	.	rs211035;rs388537;rs58765528	215	F5HB82	.	V	215	ENSP00000410732:I215V	ENSP00000410732:I215V	I	+	1	0	GABRG2	161462149	.	.	0.003000	0.11579	0.003000	0.03518	.	.	-0.690000	0.05142	-0.684000	0.03749	ATT	A|0.193;G|0.807		0.473	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
HLA-B	3106	bcgsc.ca	37	6	31324516	31324516	+	Missense_Mutation	SNP	C	C	A	rs1131215	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:31324516C>A	ENST00000412585.2	-	2	320	c.292G>T	c.(292-294)Gac>Tac	p.D98Y		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	98	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CTCTCTCGGTCAGTCTGTGCC	0.682									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	3525	0.703874	0.7163	0.7507	5008	,	,		6748	0.6419		0.5954	False		,,,				2504	0.8292				p.D98Y		.											.	HLA-B-90	0			c.G292T						.	A	TYR/ASP	2329,1909		891,547,681	50.0	52.0	52.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	292	-6.4	0.0	6	dbSNP_86	52	3737,4619		1270,1197,1711	no	missense	HLA-B	NM_005514.6	160	2161,1744,2392	AA,AC,CC		44.7224,45.0448,48.1658		98/363	31324516	6066,6528	2119	4178	6297	SO:0001583	missense	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	CTCGGTCAGTCTG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.292G>T	6.37:g.31324516C>A	ENSP00000399168:p.Asp98Tyr	147	4		89	37	NM_005514	0	0	6	6	0	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	1363	0.6240842490842491	310	0.6300813008130082	257	0.7099447513812155	374	0.6538461538461539	422	0.5567282321899736	N	3.390	-0.124570	0.06795	0.549552	0.447224	ENSG00000234745	ENST00000412585;ENST00000434333	T;T	0.00009	9.52;9.52	3.2	-6.41	0.01938	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	6.155240	0.01158	U	0.006566	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;D	0.89917	0.354;0.057;1.0	B;B;D	0.97110	0.291;0.083;1.0	T	0.62120	-0.6921	9	0.02654	T	1	.	2.0223	0.03512	0.3366:0.364:0.0893:0.21	rs1131215;rs3177922;rs3190915;rs9266166;rs17413622	98;98;73	P30480;P01889;Q92671	1B42_HUMAN;1B07_HUMAN;.	Y	98;109	ENSP00000399168:D98Y;ENSP00000405931:D109Y	ENSP00000399168:D98Y	D	-	1	0	HLA-B	31432495	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.850000	0.01670	-2.027000	0.00932	-6.206000	0.00000	GAC	C|0.417;A|0.583		0.682	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-B	3106	bcgsc.ca	37	6	31324586	31324586	+	Silent	SNP	C	C	T	rs1050556|rs281864598	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:31324586C>T	ENST00000412585.2	-	2	250	c.222G>A	c.(220-222)ccG>ccA	p.P74P		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	74	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GCTCTATCCACGGCGCCCGCG	0.662									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	3211	0.641174	0.5855	0.6383	5008	,	,		7989	0.7133		0.5417	False		,,,				2504	0.7464				p.P74P		.											.	HLA-B-90	0			c.G222A						.	T		1533,2743		437,659,1042	42.0	41.0	41.0		222	-4.5	0.0	6	dbSNP_86	41	2590,5718		796,998,2360	no	coding-synonymous	HLA-B	NM_005514.6		1233,1657,3402	TT,TC,CC		31.1748,35.8513,32.7638		74/363	31324586	4123,8461	2138	4154	6292	SO:0001819	synonymous_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	TATCCACGGCGCC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.222G>A	6.37:g.31324586C>T		170	3		89	28	NM_005514	0	0	67	67	0	Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.662	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
TNXB	7148	hgsc.bcm.edu	37	6	32063513	32063514	+	Frame_Shift_Del	DEL	AC	AC	-	rs144556766		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:32063513_32063514delAC	ENST00000479795.1	-	3	2256_2257	c.2116_2117delGT	c.(2116-2118)gtafs	p.V706fs	TNXB_ENST00000375247.2_Frame_Shift_Del_p.V706fs|TNXB_ENST00000375244.3_Frame_Shift_Del_p.V706fs			P22105	TENX_HUMAN	tenascin XB	706	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAAGCCCTCTACACACACACAC	0.668																																					p.706_706del		.											.	TNXB-90	0			c.2116_2117del						.																																			SO:0001589	frameshift_variant	7148	exon3			CCCTCTACACACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2116_2117delGT	6.37:g.32063523_32063524delAC	ENSP00000418248:p.Val706fs	247	2		403	11	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	ENST00000479795.1	37																																																																																				.		0.668	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
HLA-DRB1	3123	bcgsc.ca	37	6	32557436	32557436	+	Missense_Mutation	SNP	C	C	G	rs201614260	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:32557436C>G	ENST00000360004.5	-	1	189	c.84G>C	c.(82-84)ttG>ttC	p.L28F		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	28					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TGTCCCCAGACAAAGCCAGTG	0.562										Multiple Myeloma(14;0.17)			C|||	367	0.0732827	0.1203	0.0418	5008	,	,		18341	0.0645		0.0467	False		,,,				2504	0.0685				p.L28F		.											.	HLA-DRB1-1	0			c.G84C						.						60.0	74.0	69.0					6																	32557436		1511	2703	4214	SO:0001583	missense	3123	exon1			CCCAGACAAAGCC	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.84G>C	6.37:g.32557436C>G	ENSP00000353099:p.Leu28Phe	222	3		143	18	NM_002124	0	0	0	0	0	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	9.089	1.001307	0.19121	.	.	ENSG00000196126	ENST00000360004	T	0.00285	8.3	4.4	1.61	0.23674	MHC classes I/II-like antigen recognition protein (1);	2.322490	0.02041	N	0.049330	T	0.00241	0.0007	M	0.66939	2.045	0.09310	N	1	D	0.71674	0.998	D	0.78314	0.991	T	0.52094	-0.8621	10	0.59425	D	0.04	.	4.7485	0.13049	0.0:0.6181:0.18:0.202	.	28	P01911	2B1F_HUMAN	F	28	ENSP00000353099:L28F	ENSP00000353099:L28F	L	-	3	2	HLA-DRB1	32665414	0.061000	0.20836	0.005000	0.12908	0.026000	0.11368	0.237000	0.17985	0.518000	0.28383	-0.359000	0.07587	TTG	C|0.936;G|0.064		0.562	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
TRERF1	55809	broad.mit.edu	37	6	42196330	42196330	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:42196330G>T	ENST00000372922.4	-	18	3918	c.3356C>A	c.(3355-3357)gCt>gAt	p.A1119D	TRERF1_ENST00000372917.4_Missense_Mutation_p.A1048D|TRERF1_ENST00000541110.1_Missense_Mutation_p.A1139D|TRERF1_ENST00000354325.2_Missense_Mutation_p.A1036D|TRERF1_ENST00000340840.2_Missense_Mutation_p.A1048D	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1119	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CGCCTTCTGAGCCTTTTGCCT	0.547																																					p.A1119D		.											.	TRERF1-230	0			c.C3356A						.						240.0	269.0	259.0					6																	42196330		2203	4300	6503	SO:0001583	missense	55809	exon18			TTCTGAGCCTTTT	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3356C>A	6.37:g.42196330G>T	ENSP00000362013:p.Ala1119Asp	25	0		24	3	NM_033502	0	0	1	1	0	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554640	0.65425	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.89	5.03	0.67393	.	0.000000	0.64402	D	0.000017	T	0.33702	0.0872	L	0.27053	0.805	0.51012	D	0.999908	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.997;0.997;0.999;0.996	T	0.37267	-0.9713	10	0.72032	D	0.01	-13.0755	16.6624	0.85244	0.0:0.0:0.8691:0.1309	.	1036;1139;1119;875;887	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	D	1139;1048;1119;1048;1036	ENSP00000439689:A1139D;ENSP00000362008:A1048D;ENSP00000362013:A1119D;ENSP00000339438:A1048D;ENSP00000346285:A1036D	ENSP00000339438:A1048D	A	-	2	0	TRERF1	42304308	1.000000	0.71417	0.942000	0.38095	0.416000	0.31233	5.462000	0.66707	1.515000	0.48885	-0.224000	0.12420	GCT	.		0.547	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
FAM46A	55603	broad.mit.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G|FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																					p.39_44del		.											.	FAM46A-90	0			c.117_131del						.																																			SO:0001651	inframe_deletion	55603	exon2			CCGCCACCGCCGA	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del	34	0		80	10	NM_017633	0	0	0	0	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
SYTL3	94120	broad.mit.edu	37	6	159086557	159086557	+	Missense_Mutation	SNP	C	C	T	rs150257129		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:159086557C>T	ENST00000297239.9	+	4	435	c.241C>T	c.(241-243)Cgg>Tgg	p.R81W	SYTL3_ENST00000360448.3_Missense_Mutation_p.R81W|SYTL3_ENST00000367081.3_5'UTR			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	81	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CGCCGTGTGCCGGGGCTGCAG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		15938	0.0		0.001	False		,,,				2504	0.0				p.R81W		.											.	SYTL3-90	0			c.C241T						.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	4,4390		0,4,2193	27.0	25.0	26.0		241,241,241,241	4.9	0.9	6	dbSNP_134	26	16,8570		0,16,4277	no	missense,missense,missense,missense	SYTL3	NM_001009991.3,NM_001242384.1,NM_001242394.1,NM_001242395.1	101,101,101,101	0,20,6470	TT,TC,CC		0.1863,0.091,0.1541	probably-damaging,probably-damaging,probably-damaging,probably-damaging	81/543,81/611,81/611,81/543	159086557	20,12960	2197	4293	6490	SO:0001583	missense	94120	exon6			GTGTGCCGGGGCT	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.241C>T	6.37:g.159086557C>T	ENSP00000297239:p.Arg81Trp	39	1		92	4	NM_001242384	0	0	0	0	0	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	ENST00000297239.9	37	CCDS56458.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	17.65	3.441920	0.63067	9.1E-4	0.001863	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239	T;T	0.79247	-1.25;-1.25	5.8	4.93	0.64822	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	1.302330	0.04573	N	0.393563	T	0.79423	0.4443	M	0.69358	2.11	0.80722	D	1	D;D	0.71674	0.995;0.998	P;P	0.52856	0.517;0.711	T	0.70464	-0.4864	10	0.62326	D	0.03	.	13.0579	0.58990	0.4301:0.5699:0.0:0.0	.	81;81	Q4VX76;Q4VX76-2	SYTL3_HUMAN;.	W	81	ENSP00000353631:R81W;ENSP00000297239:R81W	ENSP00000297239:R81W	R	+	1	2	SYTL3	159006545	0.996000	0.38824	0.950000	0.38849	0.789000	0.44602	0.745000	0.26259	1.453000	0.47775	0.561000	0.74099	CGG	C|0.998;T|0.002		0.657	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
EGFR	1956	bcgsc.ca	37	7	55249063	55249063	+	Silent	SNP	G	G	A	rs1050171	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr7:55249063G>A	ENST00000275493.2	+	20	2538	c.2361G>A	c.(2359-2361)caG>caA	p.Q787Q	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Silent_p.Q742Q|EGFR_ENST00000454757.2_Silent_p.Q734Q	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	787	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Q -> R (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CCACCGTGCAGCTCATCACGC	0.612		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			G|||	2167	0.432708	0.4175	0.5519	5008	,	,		21551	0.1825		0.6074	False		,,,				2504	0.4468				p.Q787Q		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR-44910	0			c.G2361A	GRCh37	CM067987	EGFR	M	rs1050171	.	G		1862,2544	540.1+/-375.4	382,1098,723	107.0	92.0	97.0		2361	4.9	1.0	7	dbSNP_86	97	5193,3407	638.8+/-399.4	1572,2049,679	no	coding-synonymous	EGFR	NM_005228.3		1954,3147,1402	AA,AG,GG		39.6163,42.2606,45.7558		787/1211	55249063	7055,5951	2203	4300	6503	SO:0001819	synonymous_variant	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	CGTGCAGCTCATC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2361G>A	7.37:g.55249063G>A		250	1		263	8	NM_005228	0	0	0	0	0	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1																																																																																			G|0.497;A|0.503		0.612	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
GAL3ST4	79690	bcgsc.ca	37	7	99758136	99758136	+	Silent	SNP	T	T	G	rs3800951	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr7:99758136T>G	ENST00000360039.4	-	4	1268	c.876A>C	c.(874-876)gcA>gcC	p.A292A	C7orf43_ENST00000457641.1_5'Flank|C7orf43_ENST00000419841.1_5'Flank|GAL3ST4_ENST00000426974.2_Silent_p.A230A|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000411994.1_Missense_Mutation_p.H191P|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.H191P|GAL3ST4_ENST00000413800.1_Silent_p.A292A	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	292					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGTCCAGCCATGCCAGACCCC	0.527													G|||	2721	0.543331	0.4622	0.4366	5008	,	,		20997	0.6438		0.5606	False		,,,				2504	0.6074				p.A292A		.											.	GAL3ST4-47	0			c.A876C						.	G		2219,2187		551,1117,535	97.0	89.0	92.0		876	0.7	1.0	7	dbSNP_107	92	4919,3681		1421,2077,802	no	coding-synonymous	GAL3ST4	NM_024637.4		1972,3194,1337	GG,GT,TT		42.8023,49.6369,45.1176		292/487	99758136	7138,5868	2203	4300	6503	SO:0001819	synonymous_variant	79690	exon4			CAGCCATGCCAGA	AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.876A>C	7.37:g.99758136T>G		161	1		132	6	NM_024637	0	0	0	0	0	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Silent	SNP	ENST00000360039.4	37	CCDS5688.1	1132	0.5183150183150184	204	0.4146341463414634	155	0.4281767955801105	343	0.5996503496503497	430	0.5672823218997362	G	9.010	0.982263	0.18889	0.503631	0.571977	ENSG00000197093	ENST00000423751;ENST00000411994	.	.	.	4.82	0.712	0.18167	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999823277	.	.	.	.	.	.	T	0.43877	-0.9364	4	0.87932	D	0	-9.2138	3.645	0.08181	0.269:0.0:0.4415:0.2895	rs3800951;rs17845360;rs17858211;rs56997718;rs3800951	.	.	.	P	191	.	ENSP00000414733:H191P	H	-	2	0	GAL3ST4	99596072	0.108000	0.22018	0.991000	0.47740	0.906000	0.53458	-0.016000	0.12613	-0.279000	0.09167	-0.285000	0.09966	CAT	T|0.464;G|0.536		0.527	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637	
RELN	5649	broad.mit.edu	37	7	103206814	103206814	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr7:103206814A>G	ENST00000428762.1	-	33	4952	c.4793T>C	c.(4792-4794)aTg>aCg	p.M1598T	RELN_ENST00000424685.2_Missense_Mutation_p.M1598T|RELN_ENST00000343529.5_Missense_Mutation_p.M1598T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1598					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCTGTCATTCATTCCTATAAG	0.393																																					p.M1598T	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.T4793C						.						92.0	91.0	91.0					7																	103206814		2203	4300	6503	SO:0001583	missense	5649	exon33			TCATTCATTCCTA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4793T>C	7.37:g.103206814A>G	ENSP00000392423:p.Met1598Thr	47	0		66	3	NM_173054	0	0	0	0	0	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588830	0.66105	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.38560	1.13;1.91;1.13	6.08	6.08	0.98989	.	0.038217	0.85682	D	0.000000	T	0.59266	0.2181	M	0.70595	2.14	0.52501	D	0.999951	D;P	0.55385	0.971;0.892	P;P	0.58210	0.832;0.835	T	0.55897	-0.8068	10	0.29301	T	0.29	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	1598;1598	P78509-2;P78509	.;RELN_HUMAN	T	1598	ENSP00000392423:M1598T;ENSP00000345694:M1598T;ENSP00000388446:M1598T	ENSP00000345694:M1598T	M	-	2	0	RELN	102994050	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.711000	0.91396	2.333000	0.79357	0.533000	0.62120	ATG	.		0.393	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
SLC37A3	84255	bcgsc.ca	37	7	140080087	140080087	+	Missense_Mutation	SNP	C	C	G	rs62490396	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr7:140080087C>G	ENST00000326232.9	-	3	396	c.193G>C	c.(193-195)Gtg>Ctg	p.V65L	SLC37A3_ENST00000340308.3_Missense_Mutation_p.V65L|SLC37A3_ENST00000429996.2_Missense_Mutation_p.V65L|SLC37A3_ENST00000447932.2_Missense_Mutation_p.V65L|SLC37A3_ENST00000461089.1_Intron	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	65				V -> L (in Ref. 1; BAC11231). {ECO:0000305}.	carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.V65L(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTTACCTCCACAGGCAGCTCA	0.463													C|||	1875	0.374401	0.2103	0.3602	5008	,	,		18303	0.4474		0.4592	False		,,,				2504	0.4438				p.V65L	Esophageal Squamous(133;211 1716 4665 11387 37873)	.											.	SLC37A3-93	1	Substitution - Missense(1)	stomach(1)	c.G193C						.	C	LEU/VAL,LEU/VAL	1109,3297	399.2+/-331.1	139,831,1233	121.0	96.0	105.0		193,193	1.9	0.4	7	dbSNP_129	105	3941,4659	548.9+/-385.4	888,2165,1247	yes	missense,missense	SLC37A3	NM_032295.2,NM_207113.1	32,32	1027,2996,2480	GG,GC,CC		45.8256,25.1702,38.8282	benign,benign	65/444,65/495	140080087	5050,7956	2203	4300	6503	SO:0001583	missense	84255	exon3			CCTCCACAGGCAG	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.193G>C	7.37:g.140080087C>G	ENSP00000321498:p.Val65Leu	110	0		96	5	NM_207113	0	0	0	0	0	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	846	0.3873626373626374	102	0.2073170731707317	140	0.3867403314917127	253	0.4423076923076923	351	0.4630606860158311	C	8.305	0.820809	0.16678	0.251702	0.458256	ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232;ENST00000429996;ENST00000539816;ENST00000469193	T;T;T;T;T	0.42131	2.3;2.58;2.59;0.98;1.0	4.93	1.88	0.25563	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.920160	0.02218	N	0.063802	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B;B;B	0.15473	0.0;0.002;0.013;0.002	B;B;B;B	0.13407	0.002;0.004;0.009;0.007	T	0.41502	-0.9505	9	0.20519	T	0.43	-23.4191	4.7566	0.13086	0.0:0.6204:0.1791:0.2005	rs62490396	65;65;65;65	F5H743;Q8NCC5-2;Q8NCC5-3;Q8NCC5	.;.;.;SPX3_HUMAN	L	65	ENSP00000343358:V65L;ENSP00000397481:V65L;ENSP00000321498:V65L;ENSP00000412208:V65L;ENSP00000419024:V65L	ENSP00000321498:V65L	V	-	1	0	SLC37A3	139726556	0.028000	0.19301	0.408000	0.26446	0.771000	0.43674	0.407000	0.21049	1.078000	0.41014	0.313000	0.20887	GTG	C|0.599;G|0.401		0.463	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	0	0		8	7	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
WWP1	11059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87437479	87437479	+	Silent	SNP	T	T	G			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:87437479T>G	ENST00000517970.1	+	10	1396	c.1089T>G	c.(1087-1089)ggT>ggG	p.G363G	WWP1_ENST00000341922.2_Silent_p.G233G|WWP1_ENST00000265428.4_Silent_p.G363G|WWP1_ENST00000349423.2_Silent_p.G145G	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	363	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						ATCCTCATGGTAGAACCTATT	0.343																																					p.G363G		.											.	WWP1-659	0			c.T1089G						.						97.0	84.0	88.0					8																	87437479		2203	4298	6501	SO:0001819	synonymous_variant	11059	exon10			TCATGGTAGAACC	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1089T>G	8.37:g.87437479T>G		32	0		56	19	NM_007013	0	0	0	0	0	O00307|Q5YLC1|Q96BP4	Silent	SNP	ENST00000517970.1	37	CCDS6242.1																																																																																			.		0.343	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		10	10	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
THEM6	51337	hgsc.bcm.edu	37	8	143809193	143809193	+	Silent	SNP	C	C	T	rs2257840	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:143809193C>T	ENST00000336138.3	+	1	573	c.429C>T	c.(427-429)ggC>ggT	p.G143G	CTD-2292P10.2_ENST00000519782.1_RNA|CTD-2292P10.4_ENST00000520572.1_RNA	NM_016647.2	NP_057731.1	Q8WUY1	THEM6_HUMAN	thioesterase superfamily member 6	143						extracellular region (GO:0005576)											TGCGGGACGGCTTCGTGTGCG	0.736													C|||	2369	0.473043	0.584	0.4496	5008	,	,		13930	0.4196		0.4722	False		,,,				2504	0.3957				p.G143G		.											.	.	0			c.C429T						.	C		1812,1920		513,786,567	3.0	3.0	3.0		429	2.5	1.0	8	dbSNP_100	3	2967,4315		724,1519,1398	no	coding-synonymous	C8orf55	NM_016647.2		1237,2305,1965	TT,TC,CC		40.7443,48.5531,43.3902		143/209	143809193	4779,6235	1866	3641	5507	SO:0001819	synonymous_variant	51337	exon1			GGACGGCTTCGTG	BC001311	CCDS6386.1	8q24.3	2012-05-03	2012-04-13	2012-04-13	ENSG00000130193	ENSG00000130193			29656	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 55"""	C8orf55		12477932	Standard	XM_005250955		Approved	DSCD75	uc003yww.1	Q8WUY1	OTTHUMG00000164673	ENST00000336138.3:c.429C>T	8.37:g.143809193C>T		0	0		10	10	NM_016647	0	0	0	0	0	B2RDN6|Q8NBN2|Q9NYI2	Silent	SNP	ENST00000336138.3	37	CCDS6386.1																																																																																			C|0.534;T|0.466		0.736	THEM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379706.1	NM_016647	
PLEC	5339	hgsc.bcm.edu	37	8	144990396	144990396	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:144990396G>T	ENST00000322810.4	-	32	14173	c.14004C>A	c.(14002-14004)taC>taA	p.Y4668*	PLEC_ENST00000436759.2_Nonsense_Mutation_p.Y4558*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.Y4509*|PLEC_ENST00000354589.3_Nonsense_Mutation_p.Y4531*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.Y4554*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.Y4535*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.Y4517*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.Y4499*|PLEC_ENST00000345136.3_Nonsense_Mutation_p.Y4531*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4668	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						ACCCCGAGGCGTAGCGGCGGC	0.736																																					p.Y4668X		.											.	PLEC-141	0			c.C14004A						.						2.0	2.0	2.0					8																	144990396		1014	2605	3619	SO:0001587	stop_gained	5339	exon32			CGAGGCGTAGCGG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.14004C>A	8.37:g.144990396G>T	ENSP00000323856:p.Tyr4668*	17	0		63	4	NM_201380	0	0	5	5	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	54	22.069074	0.99945	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	5.05	-3.4	0.04853	.	0.098474	0.41938	U	0.000797	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2579	0.54634	0.6136:0.0:0.3864:0.0	.	.	.	.	X	4531;4535;4531;4499;4668;4509;4517;4558;4554	.	ENSP00000323856:Y4668X	Y	-	3	2	PLEC	145062384	0.729000	0.28090	0.947000	0.38551	0.913000	0.54294	0.100000	0.15231	-0.491000	0.06697	-0.323000	0.08544	TAC	.		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998514	144998514	+	Silent	SNP	C	C	T	rs75586449	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:144998514C>T	ENST00000322810.4	-	31	6163	c.5994G>A	c.(5992-5994)gcG>gcA	p.A1998A	PLEC_ENST00000436759.2_Silent_p.A1888A|PLEC_ENST00000354958.2_Silent_p.A1839A|PLEC_ENST00000354589.3_Silent_p.A1861A|PLEC_ENST00000527096.1_Silent_p.A1884A|PLEC_ENST00000357649.2_Silent_p.A1865A|PLEC_ENST00000356346.3_Silent_p.A1847A|PLEC_ENST00000398774.2_Silent_p.A1829A|PLEC_ENST00000345136.3_Silent_p.A1861A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1998	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCGTTCTCCGCCTCCTTCT	0.726													T|||	349	0.0696885	0.0113	0.1412	5008	,	,		11250	0.0437		0.0358	False		,,,				2504	0.1595				p.A1998A		.											.	PLEC-141	0			c.G5994A						.	T	,,,,,,,	38,3548		0,38,1755	7.0	9.0	8.0		5664,5541,5517,5994,5487,5583,5595,5583	-5.2	0.8	8	dbSNP_131	8	272,7344		2,268,3538	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	2,306,5293	TT,TC,CC		3.5714,1.0597,2.7674	,,,,,,,	1888/4575,1847/4534,1839/4526,1998/4685,1829/4516,1861/4548,1865/4552,1861/4548	144998514	310,10892	1793	3808	5601	SO:0001819	synonymous_variant	5339	exon31			GTTCTCCGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5994G>A	8.37:g.144998514C>T		0	0		10	5	NM_201380	0	0	1	1	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.961;T|0.039		0.726	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		9	4	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		0	0		13	13	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
AQP7	364	ucsc.edu	37	9	33385287	33385287	+	3'UTR	SNP	T	T	C	rs74557595		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr9:33385287T>C	ENST00000537089.1	-	0	1145				AQP7_ENST00000377425.4_Intron			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TTCTCCCCATTGCTGCAGGCA	0.612																																					p.N249D		.											.	AQP7-90	0			c.A745G						.						59.0	62.0	61.0					9																	33385287		2202	4298	6500	SO:0001624	3_prime_UTR_variant	364	exon8			CCCCATTGCTGCA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*329A>G	9.37:g.33385287T>C		27	2		31	8	NM_001170	0	0	0	0	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	c	9.798	1.179797	0.21787	.	.	ENSG00000165269	ENST00000379507;ENST00000297988;ENST00000439678	T;T;T	0.11063	2.81;2.81;2.81	4.27	3.35	0.38373	Aquaporin-like (2);	.	.	.	.	T	0.07683	0.0193	.	.	.	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.35301	-0.9794	8	0.39692	T	0.17	-1.4238	6.1852	0.20493	0.0:0.7595:0.0:0.2405	.	249	O14520	AQP7_HUMAN	D	248;249;157	ENSP00000368821:N248D;ENSP00000297988:N249D;ENSP00000410138:N157D	ENSP00000297988:N249D	N	-	1	0	AQP7	33375287	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.126000	0.15769	0.443000	0.26582	-0.251000	0.11542	AAT	.		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
CA9	768	hgsc.bcm.edu	37	9	35675852	35675852	+	Silent	SNP	C	C	G	rs2301370	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr9:35675852C>G	ENST00000378357.4	+	3	632	c.528C>G	c.(526-528)gcC>gcG	p.A176A		NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	176	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	TCTGCCCGGCCCTGCGCCCCC	0.746													C|||	384	0.0766773	0.1036	0.0231	5008	,	,		9673	0.1458		0.0417	False		,,,				2504	0.0429				p.A176A		.											.	CA9-95	0			c.C528G						.	C		277,3595		7,263,1666	11.0	13.0	12.0		528	2.0	1.0	9	dbSNP_100	12	173,7849		1,171,3839	no	coding-synonymous	CA9	NM_001216.2		8,434,5505	GG,GC,CC		2.1566,7.1539,3.7834		176/460	35675852	450,11444	1936	4011	5947	SO:0001819	synonymous_variant	768	exon3			CCCGGCCCTGCGC	X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.528C>G	9.37:g.35675852C>G		3	0		27	16	NM_001216	0	0	0	0	0	Q5T4R1	Silent	SNP	ENST00000378357.4	37	CCDS6585.1																																																																																			C|0.941;G|0.059		0.746	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
RABL6	55684	bcgsc.ca	37	9	139732331	139732331	+	Missense_Mutation	SNP	G	G	C	rs2811741	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr9:139732331G>C	ENST00000311502.7	+	10	1380	c.1144G>C	c.(1144-1146)Gag>Cag	p.E382Q	RABL6_ENST00000432842.2_Missense_Mutation_p.E344Q|RABL6_ENST00000371663.4_Missense_Mutation_p.E383Q|RABL6_ENST00000371675.3_Missense_Mutation_p.E267Q|RABL6_ENST00000357466.2_Intron			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	382	Pro-rich.		E -> Q (in dbSNP:rs2811741). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16582619, ECO:0000269|Ref.5}.		small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCCGGCCGCAGAGGGCCCAGC	0.642													G|||	4034	0.805511	0.8079	0.7104	5008	,	,		14169	0.8681		0.8171	False		,,,				2504	0.7935				p.E383Q		.											.	.	0			c.G1147C						.	G	GLN/GLU,GLN/GLU	3158,666		1295,568,49	20.0	23.0	22.0		1147,1144	4.3	0.2	9	dbSNP_100	22	6564,1434		2688,1188,123	yes	missense,missense	C9orf86	NM_001173988.1,NM_024718.4	29,29	3983,1756,172	CC,CG,GG		17.9295,17.4163,17.7635	probably-damaging,probably-damaging	383/731,382/730	139732331	9722,2100	1912	3999	5911	SO:0001583	missense	55684	exon10			GCCGCAGAGGGCC	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1144G>C	9.37:g.139732331G>C	ENSP00000311134:p.Glu382Gln	458	1		490	16	NM_001173988	0	0	1	1	0	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	37	CCDS48058.1	1766	0.8086080586080586	383	0.7784552845528455	266	0.7348066298342542	494	0.8636363636363636	623	0.8218997361477572	.	15.54	2.865124	0.51482	0.825837	0.820705	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000432842;ENST00000371675;ENST00000435930	T;T;T;T;T	0.66099	-0.15;-0.15;0.86;-0.15;-0.19	4.29	4.29	0.51040	.	0.727918	0.12514	N	0.462204	T	0.00012	0.0000	M	0.63428	1.95	0.80722	P	0.0	D;D;D	0.76494	0.999;0.998;0.996	D;D;P	0.67382	0.943;0.951;0.895	T	0.21314	-1.0249	9	0.30854	T	0.27	-26.66	15.766	0.78126	0.0:0.0:1.0:0.0	rs2811741;rs3739953	176;383;382	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	Q	383;382;344;267;176	ENSP00000360727:E383Q;ENSP00000311134:E382Q;ENSP00000414081:E344Q;ENSP00000360740:E267Q;ENSP00000408442:E176Q	ENSP00000311134:E382Q	E	+	1	0	C9orf86	138852152	1.000000	0.71417	0.192000	0.23308	0.005000	0.04900	3.689000	0.54706	1.950000	0.56595	0.313000	0.20887	GAG	G|0.806;C|0.194		0.642	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
SRPX	8406	broad.mit.edu	37	X	38079976	38079978	+	In_Frame_Del	DEL	GCA	GCA	-	rs35523939|rs72249350|rs139109693		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:38079976_38079978delGCA	ENST00000378533.3	-	1	174_176	c.68_70delTGC	c.(67-72)ctgcgc>cgc	p.L23del	SRPX_ENST00000432886.2_In_Frame_Del_p.L23del|SRPX_ENST00000544439.1_In_Frame_Del_p.L23del|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Intron|RP13-43E11.1_ENST00000423919.1_RNA|SRPX_ENST00000538295.1_In_Frame_Del_p.L23del	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	23			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:8634709, ECO:0000269|PubMed:9162095}.		autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.L23delL(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						GGCGGGACGCgcagcagcagcag	0.729											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		636	0.168477	0.1657	0.1398	3775	,	,		8591	0.0129		0.2028	False		,,,				2504	0.1053				p.23_24del		.											.	SRPX-130	2	Deletion - In frame(2)	prostate(2)	c.68_70del						.																																			SO:0001651	inframe_deletion	8406	exon1			GGACGCGCAGCAG	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.68_70delTGC	X.37:g.38079985_38079987delGCA	ENSP00000367794:p.Leu23del	5	0	875	43	0	NM_001170751	0	0	0	0	0	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	In_Frame_Del	DEL	ENST00000378533.3	37	CCDS14245.1																																																																																			-|1.000;|0.000		0.729	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
HDAC6	10013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48676475	48676475	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:48676475C>A	ENST00000334136.5	+	21	2131	c.1953C>A	c.(1951-1953)caC>caA	p.H651Q	HDAC6_ENST00000444343.2_Missense_Mutation_p.H665Q|HDAC6_ENST00000376619.2_Missense_Mutation_p.H651Q			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	651	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GGGATGTCCACCACGGTAATG	0.607																																					p.H651Q	Pancreas(112;205 1675 2305 8976 15959)	.											.	HDAC6-230	0			c.C1953A						.						87.0	57.0	67.0					X																	48676475		2203	4297	6500	SO:0001583	missense	10013	exon21			TGTCCACCACGGT	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1953C>A	X.37:g.48676475C>A	ENSP00000334061:p.His651Gln	321	0		492	204	NM_006044	0	0	1	1	0	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406829	0.62399	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	D;D;D	0.96041	-3.89;-3.89;-3.89	5.35	-2.56	0.06268	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.98324	0.9444	H	0.98918	4.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97489	1.0052	10	0.87932	D	0	-17.7276	12.1152	0.53861	0.0:0.6338:0.0:0.3662	.	641;299;651	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	Q	665;651;651;651	ENSP00000398566:H665Q;ENSP00000334061:H651Q;ENSP00000365804:H651Q	ENSP00000334061:H651Q	H	+	3	2	HDAC6	48561419	1.000000	0.71417	0.967000	0.41034	0.791000	0.44710	0.638000	0.24674	-0.356000	0.08187	-0.912000	0.02778	CAC	.		0.607	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
FAM155B	27112	broad.mit.edu	37	X	68725179	68725181	+	In_Frame_Del	DEL	CTG	CTG	-	rs374286243		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:68725179_68725181delCTG	ENST00000252338.4	+	1	96_98	c.54_56delCTG	c.(52-57)atctgc>atc	p.C24del	AL158069.1_ENST00000579664.1_RNA	NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	24	Poly-Cys.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						CGCTGACTATctgctgctgctgc	0.685																																					p.18_19del		.											.	FAM155B-131	0			c.54_56del						.			301,2703		28,218,27,1101,283						2.6	1.0			5	381,4605		40,195,106,1663,1084	no	coding	FAM155B	NM_015686.2		68,413,133,2764,1367	A1A1,A1R,A1,RR,R		7.6414,10.02,8.5357				682,7308				SO:0001651	inframe_deletion	27112	exon1			GACTATCTGCTGC	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.54_56delCTG	X.37:g.68725188_68725190delCTG	ENSP00000252338:p.Cys24del	10	0		84	8	NM_015686	0	0	0	0	0	B1ALV6|B9EGK1|D3DVU1	In_Frame_Del	DEL	ENST00000252338.4	37	CCDS35317.1																																																																																			.		0.685	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
ZMYM3	9203	ucsc.edu;bcgsc.ca	37	X	70467669	70467669	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:70467669C>T	ENST00000353904.2	-	12	2250	c.2063G>A	c.(2062-2064)cGc>cAc	p.R688H	ZMYM3_ENST00000373984.3_Missense_Mutation_p.R690H|ZMYM3_ENST00000314425.5_Missense_Mutation_p.R688H|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.R690H|ZMYM3_ENST00000373998.1_Missense_Mutation_p.R688H	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	688					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GGTGACTCCGCGCTGGCAGGT	0.547																																					p.R688H		.											.	ZMYM3-131	0			c.G2063A						.						56.0	44.0	48.0					X																	70467669		2203	4300	6503	SO:0001583	missense	9203	exon12			ACTCCGCGCTGGC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.2063G>A	X.37:g.70467669C>T	ENSP00000343909:p.Arg688His	321	2		441	181	NM_005096	0	0	0	0	0	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	c	21.9	4.210017	0.79240	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988	T;T;T;T;T	0.49139	1.4;0.79;1.4;1.39;1.4	4.57	4.57	0.56435	TRASH (1);Zinc finger, MYM-type (1);	0.089541	0.48286	D	0.000191	T	0.54711	0.1875	N	0.19112	0.55	0.37070	D	0.898502	D;D	0.89917	1.0;1.0	D;D	0.79784	0.988;0.993	T	0.65747	-0.6093	10	0.62326	D	0.03	-8.8255	16.7485	0.85479	0.0:1.0:0.0:0.0	.	688;688	Q14202-2;Q14202	.;ZMYM3_HUMAN	H	688;688;688;690;690	ENSP00000322845:R688H;ENSP00000363110:R688H;ENSP00000343909:R688H;ENSP00000363096:R690H;ENSP00000363100:R690H	ENSP00000322845:R688H	R	-	2	0	ZMYM3	70384394	0.987000	0.35691	0.932000	0.37286	0.965000	0.64279	2.713000	0.47194	2.127000	0.65507	0.429000	0.28392	CGC	.		0.547	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
GPRASP2	114928	broad.mit.edu	37	X	101971018	101971018	+	Silent	SNP	T	T	C			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:101971018T>C	ENST00000535209.1	+	4	2052	c.1221T>C	c.(1219-1221)tgT>tgC	p.C407C	GPRASP2_ENST00000332262.5_Silent_p.C407C|GPRASP2_ENST00000543253.1_Silent_p.C407C			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	407						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CAGCAATCTGTGAATCTGAGC	0.557																																					p.C407C		.											.	GPRASP2-131	0			c.T1221C						.						61.0	64.0	63.0					X																	101971018		2203	4300	6503	SO:0001819	synonymous_variant	114928	exon4			AATCTGTGAATCT	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1221T>C	X.37:g.101971018T>C		77	2		173	13	NM_138437	0	0	0	0	0	D3DXA0|Q8NAB4	Silent	SNP	ENST00000535209.1	37	CCDS14501.1																																																																																			.		0.557	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
G6PD	2539	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153761190	153761190	+	Missense_Mutation	SNP	C	C	T	rs369603624		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chrX:153761190C>T	ENST00000393564.2	-	9	1130	c.1018G>A	c.(1018-1020)Gtc>Atc	p.V340I	G6PD_ENST00000497281.1_5'Flank|G6PD_ENST00000369620.2_Missense_Mutation_p.V386I|G6PD_ENST00000393562.2_Missense_Mutation_p.V370I	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	340					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TAGAGGACGACGGCTGCAAAA	0.647																																					p.V370I		.											.	G6PD-135	0			c.G1108A						.		ILE/VAL,ILE/VAL	0,3835		0,0,1632,571	94.0	73.0	80.0		1018,1108	5.8	0.0	X		80	1,6727		0,1,2427,1872	no	missense,missense	G6PD	NM_001042351.1,NM_000402.3	29,29	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign,benign	340/516,370/546	153761190	1,10562	2203	4300	6503	SO:0001583	missense	2539	exon9			GGACGACGGCTGC	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.1018G>A	X.37:g.153761190C>T	ENSP00000377194:p.Val340Ile	271	1		473	163	NM_000402	0	0	11	11	0	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870278	0.33069	0.0	1.49E-4	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620	D;D;D	0.99803	-6.82;-6.82;-6.82	5.77	5.77	0.91146	Glucose-6-phosphate dehydrogenase, C-terminal (1);	0.201958	0.42172	D	0.000750	D	0.98429	0.9477	N	0.24115	0.695	0.20307	N	0.999917	B;B	0.25441	0.047;0.126	B;B	0.19391	0.025;0.015	D	0.92868	0.6312	10	0.11182	T	0.66	-31.3068	16.198	0.82043	0.0:1.0:0.0:0.0	.	340;370	P11413;P11413-3	G6PD_HUMAN;.	I	370;340;340;386	ENSP00000377192:V370I;ENSP00000377194:V340I;ENSP00000358633:V386I	ENSP00000291567:V340I	V	-	1	0	G6PD	153414384	0.982000	0.34865	0.008000	0.14137	0.002000	0.02628	3.617000	0.54181	2.428000	0.82296	0.509000	0.49947	GTC	.		0.647	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402	
VWF	7450	broad.mit.edu	37	12	6132943	6132944	+	Frame_Shift_Ins	INS	-	-	C	rs267607316		TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr12:6132943_6132944insC	ENST00000261405.5	-	25	3486_3487	c.3232_3233insG	c.(3232-3234)gagfs	p.E1078fs		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1078					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGATATGGCTCGGGGTCCACC	0.564																																					p.E1078fs		.											.	VWF-163	0			c.3233_3234insG	GRCh37	CM043597	VWF	M		.																																			SO:0001589	frameshift_variant	7450	exon25			TATGGCTCGGGGT		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3233dupG	12.37:g.6132944_6132944dupC	ENSP00000261405:p.Glu1078fs	364	0		616	9	NM_000552	0	0	0	0	0	Q8TCE8|Q99806	Frame_Shift_Ins	INS	ENST00000261405.5	37	CCDS8539.1																																																																																			.		0.564	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
KRTAP4-5	85289	broad.mit.edu	37	17	39305775	39305776	+	In_Frame_Ins	INS	-	-	GGCAGCAGCTGGGGC	rs535144703|rs141265645|rs58117746|rs146438235	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:39305775_39305776insGGCAGCAGCTGGGGC	ENST00000343246.4	-	1	278_279	c.244_245insGCCCCAGCTGCTGCC	c.(244-246)cag>cGCCCCAGCTGCTGCCag	p.81_82insRPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcaggtggtctggcagcagcag	0.653														2119	0.423123	0.5401	0.4236	5008	,	,		17097	0.3065		0.3897	False		,,,				2504	0.4192				p.Q82delinsRPSCCQ		.											.	KRTAP4-5-90	0			c.245_246insGCCCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	85289	exon1			GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.244_245insGCCCCAGCTGCTGCC	17.37:g.39305775_39305776insGGCAGCAGCTGGGGC	ENSP00000340546:p.Cys81_Gln82insArgProSerCysCys	29	0		97	51	NM_033188	0	0	0	0	0		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
FADS6	283985	hgsc.bcm.edu	37	17	72889676	72889677	+	In_Frame_Ins	INS	-	-	GGCTCCGTAGGTTCCATC	rs4319809|rs1625113	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr17:72889676_72889677insGGCTCCGTAGGTTCCATC	ENST00000310226.6	-	1	31_32	c.17_18insGATGGAACCTACGGAGCC	c.(16-18)ccc>ccGATGGAACCTACGGAGCCc	p.6_6P>PMEPTEP		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	12	3 X 6 AA tandem repeat of M-E-P-T-E-P.				fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					TAGGTTCCATGGGCTCCGTGGG	0.728																																					p.P6delinsPMEPTEP		.											.	FADS6-22	0			c.18_19insGATGGAACCTACGGAGCC						.																																			SO:0001652	inframe_insertion	283985	exon1			TTCCATGGGCTCC	AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.17_18insGATGGAACCTACGGAGCC	17.37:g.72889676_72889677insGGCTCCGTAGGTTCCATC	ENSP00000307821:p.MetGluProThrGluPro12dup	37	0		114	0	NM_178128	0	0	0	0	0	Q17RQ7|Q6XYE1	In_Frame_Ins	INS	ENST00000310226.6	37	CCDS54163.1																																																																																			.		0.728	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1		
DSTN	11034	broad.mit.edu	37	20	17581488	17581489	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr20:17581488_17581489insT	ENST00000246069.7	+	2	455_456	c.109_110insT	c.(109-111)attfs	p.I37fs	DSTN_ENST00000474024.1_Frame_Shift_Ins_p.I20fs	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	37	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						GAAGGCTGTCATTTTTTGTCTC	0.386																																					p.I37fs		.											.	DSTN-154	0			c.109_110insT						.																																			SO:0001589	frameshift_variant	11034	exon2			GCTGTCATTTTTT	S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.115dupT	20.37:g.17581494_17581494dupT	ENSP00000246069:p.Ile37fs	120	3		203	22	NM_006870	0	0	0	0	0	B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Frame_Shift_Ins	INS	ENST00000246069.7	37	CCDS13127.1																																																																																			.		0.386	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534192	90534193	+	RNA	INS	-	-	TCTTGTCTCCCAGCGTCA	rs567658963|rs536300617	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr9:90534192_90534193insTCTTGTCTCCCAGCGTCA	ENST00000602681.1	+	0	938_939							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCCAGCGTCATCTTGTCTCCC	0.594																																					p.H71delinsHLVSQRH		.											.	.	0			c.212_213insTCTTGTCTCCCAGCGTCA						.																																					441452	exon2			AGCGTCATCTTGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534192_90534193insTCTTGTCTCCCAGCGTCA		414	0		358	0	NM_001145124	0	0	0	0	0		In_Frame_Ins	INS	ENST00000602681.1	37																																																																																				.		0.594	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762844	+	Missense_Mutation	DNP	GG	GG	CT	rs2607015|rs2753960|rs67600122	byFrequency	TCGA-OR-A5L9-01A-11D-A29I-10	TCGA-OR-A5L9-10B-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f6161f8d-580d-41fc-baa3-0dee1add1df0	388e61b1-2a1f-4cc8-b1c9-d1f0709621ec	g.chr6:31762843_31762844GG>CT	ENST00000375663.3	-	2	591_592	c.151_152CC>AG	c.(151-153)CCc>AGc	p.P51S	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCTA	0.733																																					p.P51S		.											.	VARS-93	0			c.C151A						.																																			SO:0001583	missense	7407	exon2			GAAAGGGAGTCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.151_152delinsCT	6.37:g.31762843_31762844delinsCT	ENSP00000364815:p.Pro51Ser	1	0		6	0	NM_006295	0	0	0	0	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	DNP	ENST00000375663.3	37	CCDS34412.1																																																																																			G|0.721;T|0.279		0.733	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
