#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		11	10	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
KANK4	163782	bcgsc.ca	37	1	62732421	62732421	+	Missense_Mutation	SNP	T	T	C	rs11207949	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:62732421T>C	ENST00000371153.4	-	6	2680	c.2302A>G	c.(2302-2304)Acc>Gcc	p.T768A	KANK4_ENST00000354381.3_Missense_Mutation_p.T140A|KANK4_ENST00000371150.1_Missense_Mutation_p.T124A	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	768			T -> A (in dbSNP:rs11207949).			cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TGGTCTGTGGTGGTCCCAGTT	0.408													T|||	1530	0.305511	0.2095	0.3977	5008	,	,		20974	0.5873		0.2654	False		,,,				2504	0.1207				p.T768A		.											.	KANK4-74	0			c.A2302G						.	T	ALA/THR	982,3424	367.8+/-318.4	110,762,1331	109.0	114.0	112.0		2302	3.6	0.0	1	dbSNP_120	112	2106,6494	363.6+/-333.2	286,1534,2480	yes	missense	KANK4	NM_181712.4	58	396,2296,3811	CC,CT,TT		24.4884,22.2878,23.7429	benign	768/996	62732421	3088,9918	2203	4300	6503	SO:0001583	missense	163782	exon6			CTGTGGTGGTCCC	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2302A>G	1.37:g.62732421T>C	ENSP00000360195:p.Thr768Ala	255	0		240	7	NM_181712	0	0	0	0	0	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	772	0.3534798534798535	115	0.23373983739837398	134	0.3701657458563536	321	0.5611888111888111	202	0.26649076517150394	T	3.448	-0.112649	0.06881	0.222878	0.244884	ENSG00000132854	ENST00000371153;ENST00000354381;ENST00000371150	T;T;T	0.45668	0.9;0.89;0.9	4.73	3.57	0.40892	.	0.198316	0.25247	N	0.032045	T	0.00012	0.0000	L	0.49640	1.575	0.80722	P	0.0	B;B	0.12630	0.001;0.006	B;B	0.14578	0.01;0.011	T	0.44019	-0.9355	9	0.32370	T	0.25	-6.4429	12.177	0.54190	0.0:0.0:0.1429:0.8571	rs11207949;rs17379933;rs52816310;rs56522827;rs61507558;rs11207949	140;768	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	A	768;140;124	ENSP00000360195:T768A;ENSP00000346352:T140A;ENSP00000360192:T124A	ENSP00000346352:T140A	T	-	1	0	KANK4	62505009	0.935000	0.31712	0.040000	0.18447	0.454000	0.32378	2.380000	0.44327	0.867000	0.35654	0.482000	0.46254	ACC	T|0.722;C|0.278		0.408	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
LHX8	431707	ucsc.edu;bcgsc.ca	37	1	75622742	75622742	+	Silent	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:75622742G>A	ENST00000294638.5	+	9	1639	c.975G>A	c.(973-975)gcG>gcA	p.A325A	LHX8_ENST00000356261.3_Silent_p.A315A	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	325					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						TGTTAACTGCGCTGCATAGTT	0.458																																					p.A325A		.											.	LHX8-93	0			c.G975A						.						183.0	166.0	172.0					1																	75622742		2203	4300	6503	SO:0001819	synonymous_variant	431707	exon9			AACTGCGCTGCAT	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.975G>A	1.37:g.75622742G>A		184	2		213	54	NM_001001933	0	0	0	0	0	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																			.		0.458	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
KIAA1324	57535	bcgsc.ca	37	1	109656946	109656946	+	Silent	SNP	T	T	C	rs667524	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:109656946T>C	ENST00000369939.3	+	1	324	c.141T>C	c.(139-141)caT>caC	p.H47H	C1orf194_ENST00000369945.3_5'Flank|C1orf194_ENST00000369949.4_5'Flank|C1orf194_ENST00000369948.3_5'Flank|KIAA1324_ENST00000529753.1_Silent_p.H47H	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	47					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CGGAGCTTCATGCCTGCAAAG	0.637													C|||	2690	0.537141	0.7511	0.4841	5008	,	,		15146	0.4812		0.3718	False		,,,				2504	0.5133				p.H47H		.											.	KIAA1324-157	0			c.T141C						.	C		2967,1439		986,995,222	20.0	22.0	22.0		141	4.4	1.0	1	dbSNP_83	22	3079,5515		586,1907,1804	no	coding-synonymous	KIAA1324	NM_020775.3		1572,2902,2026	CC,CT,TT		35.8273,32.66,46.5077		47/1014	109656946	6046,6954	2203	4297	6500	SO:0001819	synonymous_variant	57535	exon1			GCTTCATGCCTGC	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.141T>C	1.37:g.109656946T>C		265	1		190	7	NM_020775	0	0	0	0	0	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	ENST00000369939.3	37	CCDS794.1																																																																																			T|0.512;C|0.488		0.637	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
HIPK1	204851	broad.mit.edu	37	1	114483599	114483599	+	Silent	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:114483599G>T	ENST00000369558.1	+	2	826	c.594G>T	c.(592-594)cgG>cgT	p.R198R	HIPK1_ENST00000369554.2_Silent_p.R198R|HIPK1_ENST00000426820.2_Silent_p.R198R|HIPK1_ENST00000369559.4_Silent_p.R198R|HIPK1_ENST00000369561.4_Silent_p.R198R|HIPK1_ENST00000369555.2_Silent_p.R198R			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTAGGCCGGGGGACATTTG	0.502																																					p.R198R		.											.	HIPK1-361	0			c.G594T						.						69.0	73.0	72.0					1																	114483599		2203	4300	6503	SO:0001819	synonymous_variant	204851	exon2			AGGCCGGGGGACA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.594G>T	1.37:g.114483599G>T		64	0		47	4	NM_152696	0	0	0	0	0	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Silent	SNP	ENST00000369558.1	37	CCDS867.1																																																																																			.		0.502	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		11	7	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
SPRR3	6707	broad.mit.edu	37	1	152975659	152975682	+	In_Frame_Del	DEL	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	-	rs568163793|rs553429466|rs74134624	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENST00000295367.4	+	2	205_228	c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	c.(163-186)gagccaggctgtaccaaggtccctdel	p.EPGCTKVP95del	SPRR3_ENST00000542696.1_In_Frame_Del_p.EPGCTKVP87del|SPRR3_ENST00000331860.3_In_Frame_Del_p.EPGCTKVP95del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	95	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGATTCCAGAGCCAGGCTGTACCAAGGTCCCTGAGCCAGGCT	0.562																																					p.55_62del		.											.	SPRR3-45	0			c.163_186del						.		,	2036,1952		740,556,698					,	-1.4	0.0		dbSNP_130	70	3135,4775		852,1431,1672	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1592,1987,2370	A1A1,A1R,RR		39.6334,48.9468,43.4611	,	,		5171,6727				SO:0001651	inframe_deletion	6707	exon2			ATTCCAGAGCCAG	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	1.37:g.152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENSP00000295367:p.Glu95_Pro102del	160	0		145	40	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	CCDS1033.1																																																																																			.		0.562	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
GON4L	54856	broad.mit.edu	37	1	155733245	155733245	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:155733245C>T	ENST00000368331.1	-	22	4632	c.4584G>A	c.(4582-4584)gaG>gaA	p.E1528E	GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000271883.5_Silent_p.E1528E|GON4L_ENST00000437809.1_Silent_p.E1528E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1528	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E1528E(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cttcttcttcctcctcttctt	0.488																																					p.E1528E		.											.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.G4584A						.						35.0	35.0	35.0					1																	155733245		1944	4157	6101	SO:0001819	synonymous_variant	54856	exon22			TTCTTCCTCCTCT	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4584G>A	1.37:g.155733245C>T		57	1		54	7	NM_001037533	0	0	0	0	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GON4L	54856	broad.mit.edu	37	1	155733257	155733257	+	Silent	SNP	T	T	C	rs607834	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:155733257T>C	ENST00000368331.1	-	22	4620	c.4572A>G	c.(4570-4572)ccA>ccG	p.P1524P	GON4L_ENST00000471341.1_5'Flank|GON4L_ENST00000271883.5_Silent_p.P1524P|GON4L_ENST00000437809.1_Silent_p.P1524P	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1524	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P1524P(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					cctcttcttctGGCTCAGAGT	0.488																																					p.P1524P		.											.	GON4L-93	2	Substitution - coding silent(2)	endometrium(2)	c.A4572G						.						33.0	32.0	33.0					1																	155733257		1912	4128	6040	SO:0001819	synonymous_variant	54856	exon22			TTCTTCTGGCTCA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4572A>G	1.37:g.155733257T>C		43	1		49	11	NM_001037533	0	0	0	0	0	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				T|0.054;C|0.946		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
KIRREL	55243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158058203	158058203	+	Missense_Mutation	SNP	C	C	T	rs548707549		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:158058203C>T	ENST00000359209.6	+	8	1070	c.1003C>T	c.(1003-1005)Ccc>Tcc	p.P335S	KIRREL_ENST00000392272.2_Missense_Mutation_p.P232S|KIRREL_ENST00000368173.3_Missense_Mutation_p.P335S|KIRREL_ENST00000416935.2_Missense_Mutation_p.P235S|KIRREL_ENST00000368172.1_Missense_Mutation_p.P133S|KIRREL_ENST00000360089.4_Missense_Mutation_p.P171S			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	335	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GGTTGGGAATCCCCCCCTCAC	0.453																																					p.P335S		.											.	KIRREL-91	0			c.C1003T						.						111.0	109.0	110.0					1																	158058203		2203	4300	6503	SO:0001583	missense	55243	exon8			GGGAATCCCCCCC	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1003C>T	1.37:g.158058203C>T	ENSP00000352138:p.Pro335Ser	170	0		190	40	NM_018240	0	0	0	0	0	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788294	0.90367	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.13	5.13	0.70059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39985	N	0.001217	T	0.67078	0.2855	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	T	0.75852	-0.3171	10	0.87932	D	0	-35.5546	16.0652	0.80865	0.0:1.0:0.0:0.0	.	235;171;133;335	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	S	171;335;232;335;235;133	ENSP00000353202:P171S;ENSP00000357155:P335S;ENSP00000376098:P232S;ENSP00000352138:P335S;ENSP00000389674:P235S;ENSP00000357154:P133S	ENSP00000352138:P335S	P	+	1	0	KIRREL	156324827	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.195000	0.77798	2.389000	0.81357	0.557000	0.71058	CCC	.		0.453	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
SELE	6401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169697005	169697005	+	Missense_Mutation	SNP	A	A	G	rs199700651	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:169697005A>G	ENST00000333360.7	-	9	1482	c.1343T>C	c.(1342-1344)aTt>aCt	p.I448T	SELE_ENST00000367776.1_Missense_Mutation_p.I385T|SELE_ENST00000367777.1_Intron|SELE_ENST00000367782.4_Intron|SELE_ENST00000367779.4_Intron|SELE_ENST00000367780.4_Missense_Mutation_p.I323T|SELE_ENST00000367774.1_Intron|SELE_ENST00000367775.1_Missense_Mutation_p.I323T|SELE_ENST00000367781.4_Missense_Mutation_p.I385T|C1orf112_ENST00000498289.1_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	448	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	GAATTCTCCAATAGGGGAATG	0.493													A|||	2	0.000399361	0.0	0.0	5008	,	,		18222	0.001		0.001	False		,,,				2504	0.0				p.I448T		.											.	SELE-95	0			c.T1343C						.						99.0	95.0	97.0					1																	169697005		2203	4300	6503	SO:0001583	missense	6401	exon9			TCTCCAATAGGGG	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1343T>C	1.37:g.169697005A>G	ENSP00000331736:p.Ile448Thr	83	0		124	32	NM_000450	0	0	0	0	0	A2RRD6|P16111	Missense_Mutation	SNP	ENST00000333360.7	37	CCDS1283.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	A	8.820	0.937451	0.18206	.	.	ENSG00000007908	ENST00000367781;ENST00000367780;ENST00000333360;ENST00000367775;ENST00000367776	T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76	5.9	2.87	0.33458	Complement control module (2);Sushi/SCR/CCP (3);	0.679876	0.12945	N	0.426287	T	0.15262	0.0368	N	0.00690	-1.25	0.09310	N	0.999994	B	0.02656	0.0	B	0.06405	0.002	T	0.35375	-0.9791	10	0.11794	T	0.64	-0.1422	5.2307	0.15420	0.1822:0.1683:0.6495:0.0	.	448	P16581	LYAM2_HUMAN	T	385;323;448;323;385	ENSP00000356755:I385T;ENSP00000356754:I323T;ENSP00000331736:I448T;ENSP00000356749:I323T;ENSP00000356750:I385T	ENSP00000331736:I448T	I	-	2	0	SELE	167963629	0.000000	0.05858	0.126000	0.21872	0.595000	0.36748	-0.000000	0.12993	0.821000	0.34540	-0.248000	0.11899	ATT	A|0.999;G|0.001		0.493	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
MTR	4548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237060314	237060314	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr1:237060314T>A	ENST00000366577.5	+	32	4001	c.3607T>A	c.(3607-3609)Tta>Ata	p.L1203I	MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_Missense_Mutation_p.L1152I	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1203	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	AGGCATTAGGTTAACAGAATC	0.463																																					p.L1203I		.											.	MTR-92	0			c.T3607A						.						207.0	203.0	204.0					1																	237060314		2203	4300	6503	SO:0001583	missense	4548	exon32			ATTAGGTTAACAG	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3607T>A	1.37:g.237060314T>A	ENSP00000355536:p.Leu1203Ile	78	0		90	9	NM_000254	0	0	0	0	0	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.339216	0.41398	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	D;D;D	0.85702	-2.02;-2.02;-2.02	5.77	-2.97	0.05530	Vitamin B12-dependent methionine synthase, activation domain (4);	0.000000	0.64402	D	0.000003	D	0.90331	0.6975	M	0.78456	2.415	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.97110	1.0;1.0;1.0	D	0.85532	0.1210	10	0.51188	T	0.08	-6.7923	14.9693	0.71220	0.0:0.596:0.0:0.404	.	1203;1152;1203	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	I	1057;1203;1152;757	ENSP00000355536:L1203I;ENSP00000441845:L1152I;ENSP00000355535:L757I	ENSP00000355535:L757I	L	+	1	2	MTR	235126937	0.000000	0.05858	0.029000	0.17559	0.195000	0.23768	-0.659000	0.05323	-0.401000	0.07644	-0.250000	0.11733	TTA	.		0.463	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
MRC1	4360	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	18122634	18122634	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:18122634G>A	ENST00000239761.3	+	4	747	c.644G>A	c.(643-645)gGc>gAc	p.G215D		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	215					receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						ACAGTTGAGGGCAGTGAAAGC	0.418																																					p.G215D	GBM(115;1153 1594 28187 28781 35884)	.											.	MRC1-68	0			c.G644A						.						27.0	27.0	27.0					10																	18122634		1705	3664	5369	SO:0001583	missense	4360	exon4			TTGAGGGCAGTGA	J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.644G>A	10.37:g.18122634G>A	ENSP00000239761:p.Gly215Asp	202	0		227	69	NM_002438	0	0	0	0	0	A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	ENST00000239761.3	37	CCDS7123.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877205	0.33162	.	.	ENSG00000120586	ENST00000239761	T	0.05319	3.46	3.78	2.87	0.33458	C-type lectin fold (1);	0.260679	0.26891	U	0.021968	T	0.13970	0.0338	M	0.62088	1.915	0.09310	N	1	D	0.65815	0.995	P	0.59546	0.859	T	0.06463	-1.0825	10	0.31617	T	0.26	-8.2288	6.9525	0.24552	0.2906:0.0:0.7094:0.0	.	215	P22897	MRC1_HUMAN	D	215	ENSP00000239761:G215D	ENSP00000239761:G215D	G	+	2	0	MRC1	18162640	0.018000	0.18449	0.993000	0.49108	0.977000	0.68977	0.324000	0.19610	0.777000	0.33496	0.436000	0.28706	GGC	.		0.418	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047057.1	NM_002438	
GPRIN2	9721	ucsc.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		.											.	GPRIN2-90	0			c.G721A						.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	109	0		180	25	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.639;A|0.361		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
TYSND1	219743	hgsc.bcm.edu	37	10	71906010	71906010	+	Silent	SNP	C	C	G	rs11549688	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:71906010C>G	ENST00000287078.6	-	1	332	c.333G>C	c.(331-333)gcG>gcC	p.A111A	TYSND1_ENST00000335494.5_Silent_p.A111A|TYSND1_ENST00000494143.1_5'Flank	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	111		Cleavage. {ECO:0000250}.			protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						GCTCGAGGCTCGCGCACTGGG	0.791													C|||	169	0.033746	0.0265	0.0072	5008	,	,		9519	0.0526		0.0368	False		,,,				2504	0.0399				p.A111A		.											.	TYSND1-135	0			c.G333C						.	C	,	40,2142		0,40,1051	1.0	2.0	2.0		333,333	-5.2	0.0	10	dbSNP_120	2	121,4671		0,121,2275	no	coding-synonymous,coding-synonymous	TYSND1	NM_001040273.1,NM_173555.2	,	0,161,3326	GG,GC,CC		2.525,1.8332,2.3086	,	111/399,111/567	71906010	161,6813	1091	2396	3487	SO:0001819	synonymous_variant	219743	exon1			GAGGCTCGCGCAC	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.333G>C	10.37:g.71906010C>G		0	0		16	10	NM_173555	0	0	0	0	0	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Silent	SNP	ENST00000287078.6	37	CCDS31213.1																																																																																			C|0.964;G|0.036		0.791	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
BTAF1	9044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93711281	93711281	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:93711281G>C	ENST00000265990.6	+	5	830	c.522G>C	c.(520-522)ttG>ttC	p.L174F		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	174					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				ATGAGGATTTGGATTATACCC	0.358																																					p.L174F		.											.	BTAF1-92	0			c.G522C						.						122.0	123.0	123.0					10																	93711281		2203	4300	6503	SO:0001583	missense	9044	exon5			GGATTTGGATTAT	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.522G>C	10.37:g.93711281G>C	ENSP00000265990:p.Leu174Phe	78	0		103	31	NM_003972	0	0	0	0	0	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128845	0.56721	.	.	ENSG00000095564	ENST00000265990	D	0.91792	-2.91	5.13	3.29	0.37713	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.94663	0.8279	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.93347	0.6715	10	0.45353	T	0.12	10.6559	11.6269	0.51151	0.1449:0.0:0.8551:0.0	.	174	O14981	BTAF1_HUMAN	F	174	ENSP00000265990:L174F	ENSP00000265990:L174F	L	+	3	2	BTAF1	93701261	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	7.591000	0.82666	0.687000	0.31509	-0.229000	0.12294	TTG	.		0.358	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
TBC1D12	23232	hgsc.bcm.edu	37	10	96163039	96163039	+	Silent	SNP	C	C	G	rs2477534	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:96163039C>G	ENST00000225235.4	+	1	779	c.669C>G	c.(667-669)ccC>ccG	p.P223P		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	223							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGACAGCCCCGCCAGCAGCT	0.751													G|||	3411	0.68111	0.6165	0.5648	5008	,	,		8936	0.8373		0.6342	False		,,,				2504	0.7382				p.P223P		.											.	TBC1D12-68	0			c.C669G						.	G		1895,863		709,477,193	2.0	3.0	3.0		669	-2.0	0.0	10	dbSNP_100	3	4435,1895		1664,1107,394	yes	coding-synonymous	TBC1D12	NM_015188.1		2373,1584,587	GG,GC,CC		29.9368,31.2908,30.3477		223/776	96163039	6330,2758	1379	3165	4544	SO:0001819	synonymous_variant	23232	exon1			CAGCCCCGCCAGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.669C>G	10.37:g.96163039C>G		0	0		36	36	NM_015188	0	0	0	0	0	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			C|0.339;G|0.661		0.751	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
GOT1	2805	broad.mit.edu	37	10	101157345	101157345	+	Missense_Mutation	SNP	C	C	T	rs371927397		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:101157345C>T	ENST00000370508.5	-	9	1228	c.1201G>A	c.(1201-1203)Gtg>Atg	p.V401M	GOT1_ENST00000543866.1_Missense_Mutation_p.V380M	NM_002079.2	NP_002070.1	P17174	AATC_HUMAN	glutamic-oxaloacetic transaminase 1, soluble	401					2-oxoglutarate metabolic process (GO:0006103)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to insulin stimulus (GO:0032869)|fatty acid homeostasis (GO:0055089)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|glycerol biosynthetic process (GO:0006114)|L-methionine biosynthetic process from methylthioadenosine (GO:0019509)|oxaloacetate metabolic process (GO:0006107)|polyamine metabolic process (GO:0006595)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	carboxylic acid binding (GO:0031406)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-cysteine:2-oxoglutarate aminotransferase activity (GO:0047801)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|phosphatidylserine decarboxylase activity (GO:0004609)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)	16		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)	GAGGTGGCCACGTAATCTAGA	0.483																																					p.V401M	Melanoma(173;770 3544 21601)	.											.	GOT1-90	0			c.G1201A						.	C	MET/VAL	0,4406		0,0,2203	314.0	250.0	272.0		1201	3.9	0.9	10		272	1,8599	1.2+/-3.3	0,1,4299	no	missense	GOT1	NM_002079.2	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	401/414	101157345	1,13005	2203	4300	6503	SO:0001583	missense	2805	exon9			TGGCCACGTAATC	M37400	CCDS7479.1	10q24.1-q25.1	2013-05-29	2013-05-29		ENSG00000120053	ENSG00000120053	2.6.1.1		4432	protein-coding gene	gene with protein product	"""aspartate aminotransferase 1"", ""aspartate transaminase 1"""	138180	"""glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)"""			1974457	Standard	NM_002079		Approved		uc001kpr.3	P17174	OTTHUMG00000018882	ENST00000370508.5:c.1201G>A	10.37:g.101157345C>T	ENSP00000359539:p.Val401Met	168	0		287	7	NM_002079	0	0	0	0	0	B2R6R7|B7Z7E9|Q5VW80	Missense_Mutation	SNP	ENST00000370508.5	37	CCDS7479.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976189	0.74360	0.0	1.16E-4	ENSG00000120053	ENST00000370508;ENST00000535447;ENST00000543866	D;D	0.91237	-2.81;-2.81	4.86	3.93	0.45458	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.135962	0.50627	D	0.000109	D	0.96513	0.8862	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	D	0.97737	1.0206	10	0.72032	D	0.01	-18.7246	15.3282	0.74182	0.0:0.8596:0.1404:0.0	.	401	P17174	AATC_HUMAN	M	401;354;380	ENSP00000359539:V401M;ENSP00000445578:V380M	ENSP00000359539:V401M	V	-	1	0	GOT1	101147335	1.000000	0.71417	0.874000	0.34290	0.942000	0.58702	5.806000	0.69150	1.359000	0.45940	0.655000	0.94253	GTG	.		0.483	GOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049794.1	NM_002079	
SEMA4G	57715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	102740027	102740027	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:102740027G>A	ENST00000370250.4	+	10	1650	c.1277G>A	c.(1276-1278)cGc>cAc	p.R426H	MRPL43_ENST00000318325.2_Intron|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000517724.1_Missense_Mutation_p.R426H|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000370242.4_Intron|SEMA4G_ENST00000210633.3_Missense_Mutation_p.R426H	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	426	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CGCAACATACGCTACACACAC	0.582																																					p.R426H		.											.	SEMA4G-154	0			c.G1277A						.						112.0	96.0	101.0					10																	102740027		2203	4300	6503	SO:0001583	missense	57715	exon10			ACATACGCTACAC	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1277G>A	10.37:g.102740027G>A	ENSP00000359270:p.Arg426His	170	0		353	70	NM_001203244	0	0	0	0	0	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.	.	.	.	.	.	.	.	.	.	G	9.911	1.209556	0.22289	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	5.09	4.12	0.48240	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.230650	0.42548	D	0.000686	T	0.08758	0.0217	N	0.25031	0.7	0.27724	N	0.945015	B;B;B	0.15141	0.006;0.012;0.007	B;B;B	0.11329	0.003;0.006;0.005	T	0.10894	-1.0610	10	0.40728	T	0.16	.	7.6013	0.28077	0.0:0.153:0.5502:0.2968	.	426;426;426	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	H	426	ENSP00000428896:R426H;ENSP00000359270:R426H;ENSP00000430175:R426H;ENSP00000210633:R426H	ENSP00000210633:R426H	R	+	2	0	SEMA4G	102730017	0.817000	0.29147	1.000000	0.80357	0.235000	0.25334	1.200000	0.32247	2.370000	0.80446	0.484000	0.47621	CGC	.		0.582	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
C10orf95	79946	hgsc.bcm.edu	37	10	104210735	104210735	+	Missense_Mutation	SNP	C	C	A	rs2281878	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:104210735C>A	ENST00000239125.1	-	2	327	c.253G>T	c.(253-255)Gct>Tct	p.A85S	RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000492465.2_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	85	Arg/Pro-rich.									liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		GCTGCGGAAGCTGTGGGCCTG	0.766													C|||	1422	0.283946	0.2481	0.2147	5008	,	,		8527	0.3661		0.2107	False		,,,				2504	0.3722				p.A85S		.											.	C10orf95-91	0			c.G253T						.	C	SER/ALA	686,2688		69,548,1070	4.0	6.0	5.0		253	0.9	1.0	10	dbSNP_100	5	1301,5815		124,1053,2381	yes	missense	C10orf95	NM_024886.1	99	193,1601,3451	AA,AC,CC		18.2827,20.332,18.9418	possibly-damaging	85/258	104210735	1987,8503	1687	3558	5245	SO:0001583	missense	79946	exon2			CGGAAGCTGTGGG	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.253G>T	10.37:g.104210735C>A	ENSP00000239125:p.Ala85Ser	0	0		28	18	NM_024886	0	0	0	0	0	A0AVQ7	Missense_Mutation	SNP	ENST00000239125.1	37	CCDS7534.1	525	0.2403846153846154	101	0.20528455284552846	71	0.19613259668508287	200	0.34965034965034963	153	0.20184696569920843	C	12.47	1.948662	0.34377	0.20332	0.182827	ENSG00000120055	ENST00000239125	.	.	.	4.68	0.951	0.19579	.	0.773948	0.10608	N	0.654824	T	0.00012	0.0000	N	0.08118	0	0.53688	P	2.5000000000052758E-5	B	0.33807	0.426	B	0.32090	0.14	T	0.45891	-0.9230	8	0.33940	T	0.23	-38.6243	6.6233	0.22816	0.0:0.3488:0.0:0.6512	rs2281878	85	Q9H7T3	CJ095_HUMAN	S	85	.	ENSP00000239125:A85S	A	-	1	0	C10orf95	104200725	0.997000	0.39634	0.987000	0.45799	0.038000	0.13279	0.038000	0.13862	0.047000	0.15862	-0.350000	0.07774	GCT	C|0.759;A|0.241		0.766	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	0	0		23	9	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
SORCS1	114815	hgsc.bcm.edu	37	10	108924150	108924150	+	Silent	SNP	G	G	C	rs61732174	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:108924150G>C	ENST00000263054.6	-	1	142	c.135C>G	c.(133-135)tcC>tcG	p.S45S	SORCS1_ENST00000344440.6_Silent_p.S45S	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	45					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGCGTGGAGCGGAGCTGGGGT	0.761													C|||	193	0.0385383	0.0182	0.072	5008	,	,		7914	0.001		0.0765	False		,,,				2504	0.0419				p.S45S		.											.	SORCS1-153	0			c.C135G						.						1.0	2.0	1.0					10																	108924150		1086	2538	3624	SO:0001819	synonymous_variant	114815	exon1			TGGAGCGGAGCTG	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.135C>G	10.37:g.108924150G>C		2	0		22	14	NM_001206572	0	0	0	0	0	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	CCDS7559.1																																																																																			G|0.939;C|0.061		0.761	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
KNDC1	85442	hgsc.bcm.edu	37	10	135012315	135012315	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr10:135012315A>G	ENST00000304613.3	+	14	2324	c.2303A>G	c.(2302-2304)aAc>aGc	p.N768S	KNDC1_ENST00000368572.2_Missense_Mutation_p.N768S|KNDC1_ENST00000368571.2_Missense_Mutation_p.N703S			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	768	Pro-rich.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GCCCCAGCAAACCAGCCAGAG	0.736																																					p.N768S		.											.	KNDC1-229	0			c.A2303G						.						5.0	8.0	7.0					10																	135012315		2040	4117	6157	SO:0001583	missense	85442	exon14			CAGCAAACCAGCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2303A>G	10.37:g.135012315A>G	ENSP00000304437:p.Asn768Ser	1	0		45	24	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	A	1.135	-0.651330	0.03506	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.16597	2.82;2.82;2.33	3.73	-7.45	0.01374	.	6.068490	0.00357	N	0.000025	T	0.06462	0.0166	N	0.16368	0.405	0.09310	N	1	P;B;B	0.36837	0.571;0.003;0.009	B;B;B	0.30646	0.118;0.006;0.005	T	0.29579	-1.0007	10	0.09084	T	0.74	-3.5356	3.5755	0.07933	0.152:0.5321:0.1842:0.1317	.	768;703;768	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	S	768;768;703	ENSP00000304437:N768S;ENSP00000357561:N768S;ENSP00000357560:N703S	ENSP00000304437:N768S	N	+	2	0	KNDC1	134862305	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.634000	0.05477	-1.103000	0.03019	0.255000	0.18592	AAC	.		0.736	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
PNPLA2	57104	hgsc.bcm.edu	37	11	824789	824789	+	Missense_Mutation	SNP	T	T	C	rs1138693	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:824789T>C	ENST00000336615.4	+	10	1644	c.1442T>C	c.(1441-1443)cTg>cCg	p.L481P	EFCAB4A_ENST00000450448.1_5'Flank|AP006621.8_ENST00000532946.1_RNA|AP006621.8_ENST00000528982.1_RNA|EFCAB4A_ENST00000528542.2_5'Flank	NM_020376.3	NP_065109.1	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	481			L -> P (in dbSNP:rs1138693). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16644682, ECO:0000269|Ref.2}.		acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of sequestering of triglyceride (GO:0010891)|phospholipid metabolic process (GO:0006644)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|lung(4)|prostate(1)|urinary_tract(1)	9		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGCACCAGCTGGCCGGGCCT	0.751													-|||	3277	0.654353	0.7133	0.7709	5008	,	,		10714	0.6002		0.7058	False		,,,				2504	0.4949				p.L481P		.											.	PNPLA2-90	0			c.T1442C						.	-	PRO/LEU	1997,839		756,485,177	2.0	3.0	3.0		1442		0.0	11	dbSNP_86	3	4530,1868		1710,1110,379	no	missense	PNPLA2	NM_020376.3	98	2466,1595,556	CC,CT,TT		29.1966,29.5839,29.3156	possibly-damaging	481/505	824789	6527,2707	1418	3199	4617	SO:0001583	missense	57104	exon10			ACCAGCTGGCCGG	AJ278475	CCDS7718.1	11p15.5	2014-03-14			ENSG00000177666	ENSG00000177666	3.1.1.3	"""Patatin-like phospholipase domain containing"""	30802	protein-coding gene	gene with protein product		609059				8619474, 16799181, 19029121	Standard	NM_020376		Approved	desnutrin, TTS-2.2, ATGL, FP17548, iPLA2zeta	uc001lrt.3	Q96AD5	OTTHUMG00000133309	ENST00000336615.4:c.1442T>C	11.37:g.824789T>C	ENSP00000337701:p.Leu481Pro	0	0		6	6	NM_020376	0	0	0	0	0	O60643|Q5EFF5|Q6XYE5|Q96ET6|Q9NQ61|Q9NQ62	Missense_Mutation	SNP	ENST00000336615.4	37	CCDS7718.1	1526	0.6987179487179487	356	0.7235772357723578	265	0.7320441988950276	378	0.6608391608391608	527	0.6952506596306068	-	10.58	1.389293	0.25118	0.704161	0.708034	ENSG00000177666	ENST00000336615	T	0.32272	1.46	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.51240	0.943	P	0.55011	0.766	T	0.23940	-1.0174	6	0.07175	T	0.84	.	.	.	.	rs1138693;rs3202695;rs17851512;rs57764436	481	Q96AD5	PLPL2_HUMAN	P	481	ENSP00000337701:L481P	ENSP00000337701:L481P	L	+	2	0	PNPLA2	814789	0.003000	0.15002	0.009000	0.14445	0.006000	0.05464	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CTG	T|0.300;C|0.700		0.751	PNPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257106.1	NM_020376	
MUC2	4583	broad.mit.edu	37	11	1092966	1092966	+	Silent	SNP	C	C	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:1092966C>A	ENST00000441003.2	+	30	4812	c.4785C>A	c.(4783-4785)acC>acA	p.T1595T	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tgaccccaaccccaacaccca	0.637																																					p.T1595T		.											.	MUC2-90	0			c.C4785A						.						48.0	83.0	71.0					11																	1092966		1785	3239	5024	SO:0001819	synonymous_variant	4583	exon30			CCCAACCCCAACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4785C>A	11.37:g.1092966C>A		78	0		166	11	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093292	1093292	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:1093292C>T	ENST00000441003.2	+	30	5138	c.5111C>T	c.(5110-5112)aCc>aTc	p.T1704I	MUC2_ENST00000359061.5_Missense_Mutation_p.T1671I|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.637																																					p.T1704I		.											.	MUC2-90	0			c.C5111T						.						107.0	156.0	138.0					11																	1093292		1878	3453	5331	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5111C>T	11.37:g.1093292C>T	ENSP00000415183:p.Thr1704Ile	101	2		131	14	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.150	-0.394632	0.04899	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11063	2.81;2.84	1.6	-2.66	0.06077	.	2.760050	0.04005	U	0.297091	T	0.06416	0.0165	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.36286	-0.9754	9	0.36615	T	0.2	.	2.477	0.04578	0.4942:0.3128:0.0:0.1931	.	1704	E7EUV1	.	I	1704;1671	ENSP00000415183:T1704I;ENSP00000351956:T1671I	ENSP00000351956:T1671I	T	+	2	0	MUC2	1083292	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.330000	0.19715	-0.514000	0.06488	0.184000	0.17185	ACC	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CHRNA10	57053	hgsc.bcm.edu	37	11	3688934	3688934	+	Silent	SNP	G	G	A	rs147957618	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:3688934G>A	ENST00000250699.2	-	4	494	c.423C>T	c.(421-423)gcC>gcT	p.A141A	CHRNA10_ENST00000534359.1_5'UTR|Y_RNA_ENST00000363331.1_RNA|CHRNA10_ENST00000493827.2_5'Flank	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	141					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	CCCAGCGCACGGCGCCATCGT	0.721													G|||	10	0.00199681	0.0008	0.0072	5008	,	,		12408	0.0		0.004	False		,,,				2504	0.0				p.A141A	Melanoma(153;17 1869 2949 7120 36888)	.											.	CHRNA10-91	0			c.C423T						.	G		6,4192		0,6,2093	7.0	7.0	7.0		423	-8.4	0.5	11	dbSNP_134	7	37,7967		0,37,3965	no	coding-synonymous	CHRNA10	NM_020402.2		0,43,6058	AA,AG,GG		0.4623,0.1429,0.3524		141/451	3688934	43,12159	2099	4002	6101	SO:0001819	synonymous_variant	57053	exon4			GCGCACGGCGCCA	AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.423C>T	11.37:g.3688934G>A		0	0		40	26	NM_020402	0	0	0	0	0		Silent	SNP	ENST00000250699.2	37	CCDS7745.1																																																																																			G|0.995;A|0.005		0.721	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2		
RBMXL2	27288	hgsc.bcm.edu	37	11	7110751	7110751	+	Missense_Mutation	SNP	A	A	G	rs11041171	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:7110751A>G	ENST00000306904.5	+	1	587	c.400A>G	c.(400-402)Acg>Gcg	p.T134A		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	134	Arg/Gly/Pro-rich.		T -> A (in dbSNP:rs11041171). {ECO:0000269|PubMed:10958650, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGGCGGCTACACGGCGGATTT	0.786													G|||	4837	0.965855	0.8744	0.9928	5008	,	,		3958	1.0		1.0	False		,,,				2504	1.0				p.T134A		.											.	RBMXL2-68	0			c.A400G						.						1.0	1.0	1.0					11																	7110751		553	1369	1922	SO:0001583	missense	27288	exon1			GGCTACACGGCGG	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.400A>G	11.37:g.7110751A>G	ENSP00000304139:p.Thr134Ala	0	0		6	6	NM_014469	0	0	0	0	0	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	ENST00000306904.5	37	CCDS7777.1	2013	0.9217032967032966	395	0.8028455284552846	339	0.93646408839779	560	0.9790209790209791	719	0.9485488126649076	G	0.046	-1.264680	0.01433	.	.	ENSG00000170748	ENST00000306904	T	0.75050	-0.9	2.1	-2.91	0.05631	.	0.996198	0.08132	N	0.993048	T	0.00012	0.0000	N	0.11560	0.145	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32025	-0.9922	9	0.14252	T	0.57	.	1.3858	0.02240	0.2169:0.2957:0.3372:0.1502	rs11041171;rs17857473	134	O75526	HNRGT_HUMAN	A	134	ENSP00000304139:T134A	ENSP00000304139:T134A	T	+	1	0	RBMXL2	7067327	0.014000	0.17966	0.000000	0.03702	0.013000	0.08279	-1.159000	0.03150	-1.383000	0.02106	-2.179000	0.00317	ACG	A|0.078;G|0.922		0.786	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		0	0		17	9	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
DGKZ	8525	hgsc.bcm.edu	37	11	46387868	46387868	+	Missense_Mutation	SNP	A	A	G	rs1317826	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:46387868A>G	ENST00000454345.1	+	2	187	c.62A>G	c.(61-63)cAg>cGg	p.Q21R	DGKZ_ENST00000527911.1_Intron|DGKZ_ENST00000456247.2_Intron|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000421244.2_Intron|DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000343674.6_Intron|DGKZ_ENST00000395574.3_Intron|DGKZ_ENST00000532868.2_Intron|DGKZ_ENST00000318201.8_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	21			Q -> R (in dbSNP:rs1317826). {ECO:0000269|PubMed:9159104}.		blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GAGGGGCAGCAGCGGCCCAGC	0.701													G|||	2181	0.435503	0.9107	0.2493	5008	,	,		13838	0.1458		0.3111	False		,,,				2504	0.3517				p.Q21R		.											.	DGKZ-676	0			c.A62G						.	G	ARG/GLN,,,,,,	2682,930		1027,628,151	8.0	9.0	9.0		62,,,,,,	4.5	1.0	11	dbSNP_88	9	2229,5713		386,1457,2128	yes	missense,intron,intron,intron,intron,intron,intron	DGKZ	NM_001105540.1,NM_001199266.1,NM_001199267.1,NM_001199268.1,NM_003646.3,NM_201532.2,NM_201533.3	43,,,,,,	1413,2085,2279	GG,GA,AA		28.066,25.7475,42.5048	benign,,,,,,	21/1118,,,,,,	46387868	4911,6643	1806	3971	5777	SO:0001583	missense	8525	exon2			GGCAGCAGCGGCC	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.62A>G	11.37:g.46387868A>G	ENSP00000412178:p.Gln21Arg	3	0		5	4	NM_001105540	0	0	0	0	0	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	872	0.3992673992673993	446	0.9065040650406504	95	0.26243093922651933	97	0.16958041958041958	234	0.3087071240105541	G	2.360	-0.346808	0.05208	0.742525	0.28066	ENSG00000149091	ENST00000454345	T	0.64260	-0.09	4.53	4.53	0.55603	.	0.291635	0.22594	N	0.058046	T	0.00012	0.0000	N	0.02916	-0.46	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	9	0.02654	T	1	.	13.0604	0.59003	0.0784:0.0:0.9216:0.0	rs1317826	21	Q13574	DGKZ_HUMAN	R	21	ENSP00000412178:Q21R	ENSP00000412178:Q21R	Q	+	2	0	DGKZ	46344444	1.000000	0.71417	0.991000	0.47740	0.097000	0.18754	3.832000	0.55783	1.049000	0.40321	-0.213000	0.12676	CAG	A|0.608;G|0.392		0.701	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
TRIM51	84767	hgsc.bcm.edu;broad.mit.edu	37	11	55658957	55658957	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:55658957C>G	ENST00000449290.2	+	7	1300	c.1208C>G	c.(1207-1209)cCa>cGa	p.P403R	TRIM51_ENST00000244891.3_Missense_Mutation_p.P260R	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	403	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										CAATATGTTCCAAGACCTACC	0.453																																					p.P403R		.											.	.	0			c.C1208G						.						46.0	45.0	45.0					11																	55658957		2144	4151	6295	SO:0001583	missense	84767	exon7			ATGTTCCAAGACC	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1208C>G	11.37:g.55658957C>G	ENSP00000395086:p.Pro403Arg	27	0		72	9	NM_032681	0	0	0	0	0	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	8.791	0.930660	0.18131	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.61040	0.14;0.14	0.655	-1.31	0.09230	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.50411	0.1614	L	0.33245	0.995	0.09310	N	1	D	0.55172	0.97	P	0.56788	0.806	T	0.43814	-0.9368	8	0.13470	T	0.59	.	.	.	.	.	403	Q9BSJ1	SPRY5_HUMAN	R	403;260	ENSP00000395086:P403R;ENSP00000244891:P260R	ENSP00000244891:P260R	P	+	2	0	SPRYD5	55415533	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	0.192000	0.17096	-0.672000	0.05266	0.162000	0.16502	CCA	.		0.453	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
TNKS1BP1	85456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57076797	57076797	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:57076797C>T	ENST00000532437.1	-	5	3699	c.3388G>A	c.(3388-3390)Gac>Aac	p.D1130N	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.D1130N			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1130	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CTCACTCTGTCGTTGCCAATG	0.577																																					p.D1130N		.											.	TNKS1BP1-91	0			c.G3388A						.						92.0	87.0	89.0					11																	57076797		2201	4296	6497	SO:0001583	missense	85456	exon6			CTCTGTCGTTGCC	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3388G>A	11.37:g.57076797C>T	ENSP00000437271:p.Asp1130Asn	82	0		114	28	NM_033396	0	0	0	0	0	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575315	0.45902	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.40476	1.03;1.03	4.88	3.02	0.34903	.	0.260088	0.27354	N	0.019748	T	0.57373	0.2049	M	0.62723	1.935	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.48163	-0.9059	10	0.72032	D	0.01	-21.5336	9.0938	0.36627	0.0:0.8276:0.0:0.1724	.	1130	Q9C0C2	TB182_HUMAN	N	1130	ENSP00000350990:D1130N;ENSP00000437271:D1130N	ENSP00000350990:D1130N	D	-	1	0	TNKS1BP1	56833373	0.001000	0.12720	0.006000	0.13384	0.409000	0.31022	1.212000	0.32394	0.499000	0.27970	0.462000	0.41574	GAC	.		0.577	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
INCENP	3619	hgsc.bcm.edu	37	11	61914282	61914282	+	Silent	SNP	G	G	A	rs113981632	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:61914282G>A	ENST00000394818.3	+	15	2314	c.2112G>A	c.(2110-2112)gaG>gaA	p.E704E	INCENP_ENST00000278849.4_Silent_p.E700E	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	704					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						agcggcgcgagcaggagcggc	0.751													G|||	148	0.0295527	0.0439	0.0303	5008	,	,		10530	0.002		0.0507	False		,,,				2504	0.0164				p.E704E		.											.	INCENP-227	0			c.G2112A						.	G	,	138,3434		2,134,1650	3.0	5.0	4.0		2112,2100	0.2	0.0	11	dbSNP_132	4	293,6883		6,281,3301	no	coding-synonymous,coding-synonymous	INCENP	NM_001040694.1,NM_020238.2	,	8,415,4951	AA,AG,GG		4.0831,3.8634,4.01	,	704/919,700/915	61914282	431,10317	1786	3588	5374	SO:0001819	synonymous_variant	3619	exon15			GCGCGAGCAGGAG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2112G>A	11.37:g.61914282G>A		2	0		25	13	NM_001040694	0	0	0	0	0	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	37	CCDS44624.1																																																																																			A|0.035;G|0.965		0.751	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
NRXN2	9379	hgsc.bcm.edu	37	11	64480641	64480641	+	Silent	SNP	G	G	A	rs2518907	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:64480641G>A	ENST00000377551.1	-	1	742	c.531C>T	c.(529-531)ggC>ggT	p.G177G	NRXN2_ENST00000265459.6_Silent_p.G177G|NRXN2_ENST00000377559.3_Silent_p.G177G|NRXN2_ENST00000409571.1_Silent_p.G177G			Q9P2S2	NRX2A_HUMAN	neurexin 2	177	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGGCCAAGAGGCCGCGGAAGG	0.756													G|||	2672	0.533546	0.2216	0.5403	5008	,	,		8112	0.5407		0.7604	False		,,,				2504	0.7096				p.G177G		.											.	NRXN2-232	0			c.C531T						.	G	,	1316,1684		331,654,515	2.0	2.0	2.0		531,531	1.3	1.0	11	dbSNP_100	2	4949,1205		2080,789,208	no	coding-synonymous,coding-synonymous	NRXN2	NM_015080.3,NM_138732.2	,	2411,1443,723	AA,AG,GG		19.5808,43.8667,31.56	,	177/1713,177/1643	64480641	6265,2889	1500	3077	4577	SO:0001819	synonymous_variant	9379	exon2			CAAGAGGCCGCGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.531C>T	11.37:g.64480641G>A		0	0		5	5	NM_138732	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			G|0.449;A|0.551		0.756	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		0	0		39	23	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		0	0		8	8	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751543	76751604	+	Frame_Shift_Del	DEL	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	rs544232471|rs34153015|rs182310862|rs11292200|rs77209527|rs539994853|rs201940118|rs11292199|rs200788398	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1086_1147	c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	c.(946-1011)cttggagcgcgccggcctggcgcccagcggccacgagggcatcctggcccttcggcgtgcagcttgfs	p.LGARRPGAQRPRGHPGPSACSL316fs	B3GNT6_ENST00000421061.1_Splice_Site_p.GARRPGAQRPRGHPGP200fs|B3GNT6_ENST00000354301.5_Splice_Site_p.LERAGLAPSGHEGILALRRAA316fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GCATGTGTCTTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.71																																					p.316_336del		.											.	.	0			c.947_1006del						.																																			SO:0001589	frameshift_variant	192134	exon3			GTGTCTTGGAGCG	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	11.37:g.76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Leu316fs	1	0		39	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.710	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751604	+	Frame_Shift_Del	DEL	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	rs200788398|rs34153015|rs11292200|rs201940118|rs11292199	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr11:76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1128_1147	c.990_1009delTGGCCCTTCGGCGTGCAGCT	c.(988-1011)cctggcccttcggcgtgcagcttgfs	p.GPSACSL331fs	B3GNT6_ENST00000421061.1_Splice_Site_p.IGPSACS209fs|B3GNT6_ENST00000354301.5_Splice_Site_p.WPFGVQL330fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.686																																					p.330_336del		.											.	.	0			c.989_1006del						.																																			SO:0001589	frameshift_variant	192134	exon4			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.990_1009delTGGCCCTTCGGCGTGCAGCT	11.37:g.76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Gly331fs	2	0		45	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.686	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
PRICKLE1	144165	bcgsc.ca	37	12	42854208	42854208	+	Silent	SNP	A	A	G	rs3747563|rs111643910	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:42854208A>G	ENST00000455697.1	-	8	2184	c.1899T>C	c.(1897-1899)ttT>ttC	p.F633F	PRICKLE1_ENST00000445766.2_Silent_p.F633F|PRICKLE1_ENST00000548696.1_Silent_p.F633F|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Silent_p.F633F|PRICKLE1_ENST00000345127.3_Silent_p.F633F	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	633					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CATCATCAGAAAACTTGACCT	0.488													A|||	1355	0.270567	0.1634	0.3847	5008	,	,		18152	0.256		0.3678	False		,,,				2504	0.2495				p.F633F		.											.	PRICKLE1-518	0			c.T1899C						.	A	,,,	887,3519		115,657,1431	99.0	94.0	96.0		1899,1899,1899,1899	-4.5	0.5	12	dbSNP_107	96	3013,5587		588,1837,1875	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PRICKLE1	NM_001144881.1,NM_001144882.1,NM_001144883.1,NM_153026.2	,,,	703,2494,3306	GG,GA,AA		35.0349,20.1316,29.9862	,,,	633/832,633/832,633/832,633/832	42854208	3900,9106	2203	4300	6503	SO:0001819	synonymous_variant	144165	exon8			ATCAGAAAACTTG	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1899T>C	12.37:g.42854208A>G		91	0		156	5	NM_001144882	0	0	0	0	0	Q14C83|Q71QF8|Q96N00	Silent	SNP	ENST00000455697.1	37	CCDS8742.1																																																																																			A|0.686;G|0.314		0.488	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
NACA	4666	hgsc.bcm.edu	37	12	57107325	57107325	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:57107325G>T	ENST00000454682.1	-	6	6247	c.5966C>A	c.(5965-5967)gCc>gAc	p.A1989D	NACA_ENST00000546392.1_Missense_Mutation_p.A126D|NACA_ENST00000550952.1_Missense_Mutation_p.A836D|NACA_ENST00000552540.1_Missense_Mutation_p.A126D|NACA_ENST00000551793.1_5'Flank|NACA_ENST00000548563.1_Missense_Mutation_p.A47D|NACA_ENST00000356769.3_Missense_Mutation_p.A126D|NACA_ENST00000393891.4_Missense_Mutation_p.A126D	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1989	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						ACTCACCTTGGCTTCCCCAAA	0.433			T	BCL6	NHL																																p.A836D		.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA-254	0			c.C2507A						.						111.0	112.0	112.0					12																	57107325		2203	4300	6503	SO:0001583	missense	4666	exon8			ACCTTGGCTTCCC	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5966C>A	12.37:g.57107325G>T	ENSP00000403817:p.Ala1989Asp	78	0		61	4	NM_001113203	0	0	0	0	0		Missense_Mutation	SNP	ENST00000454682.1	37		.	.	.	.	.	.	.	.	.	.	G	32	5.127972	0.94473	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000548563;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000546862;ENST00000549855	T;T;T;T;T;T;T;T;T;T	0.75477	0.43;0.15;-0.06;0.44;0.44;0.44;0.44;0.42;0.4;-0.94	5.15	5.15	0.70609	Nascent polypeptide-associated complex NAC (2);	0.000000	0.85682	D	0.000000	D	0.90061	0.6896	H	0.94886	3.595	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.89	D;D;P	0.81914	0.995;0.991;0.801	D	0.92872	0.6315	10	0.87932	D	0	.	17.3906	0.87430	0.0:0.0:1.0:0.0	.	1989;836;126	E9PAV3;F8VU71;Q13765	.;.;NACA_HUMAN	D	124;1989;836;126;126;126;47;126;126;122;47;126	ENSP00000448039:A124D;ENSP00000403817:A1989D;ENSP00000448035:A836D;ENSP00000349212:A126D;ENSP00000447821:A126D;ENSP00000377469:A126D;ENSP00000446801:A126D;ENSP00000447133:A126D;ENSP00000450383:A122D;ENSP00000447764:A126D	ENSP00000349212:A126D	A	-	2	0	NACA	55393592	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.704000	0.98716	2.409000	0.81822	0.557000	0.71058	GCC	.		0.433	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
LRP1	4035	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57559628	57559628	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:57559628C>T	ENST00000243077.3	+	16	3037	c.2571C>T	c.(2569-2571)ggC>ggT	p.G857G		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	857	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCCAGCCAGGCGAGTTTGCCT	0.622																																					p.G857G		.											.	LRP1-596	0			c.C2571T						.						65.0	61.0	63.0					12																	57559628		2203	4300	6503	SO:0001819	synonymous_variant	4035	exon16			GCCAGGCGAGTTT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2571C>T	12.37:g.57559628C>T		163	1		268	54	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1																																																																																			.		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81769579	81769579	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:81769579C>T	ENST00000549396.1	-	10	1287	c.1127G>A	c.(1126-1128)cGg>cAg	p.R376Q	PPFIA2_ENST00000550359.2_Missense_Mutation_p.R223Q|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R358Q|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R376Q|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R376Q|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R358Q|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R302Q|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R277Q|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R376Q	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	376	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTGAACCTGCCGCAGGATAGC	0.393																																					p.R376Q		.											.	PPFIA2-231	0			c.G1127A						.						142.0	141.0	141.0					12																	81769579		1898	4104	6002	SO:0001583	missense	8499	exon9			ACCTGCCGCAGGA	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1127G>A	12.37:g.81769579C>T	ENSP00000450337:p.Arg376Gln	114	0		132	45	NM_001220476	0	0	0	0	0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.861303|4.861303	0.91433|0.91433	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000548790|ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	.|T;T;T;T;T;T;T	.|0.77489	.|1.44;1.44;1.44;-1.1;1.44;1.44;1.44	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83649|0.83649	0.5300|0.5300	M|M	0.87682|0.87682	2.9|2.9	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56968	.|0.978;0.921	.|P;B	.|0.44623	.|0.455;0.254	D|D	0.86913|0.86913	0.2062|0.2062	5|10	.|0.59425	.|D	.|0.04	-3.2321|-3.2321	19.6803|19.6803	0.95960|0.95960	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|276;376	.|B7Z4H8;O75334	.|.;LIPA2_HUMAN	S|Q	194|376;358;302;387;358;376;277;376	.|ENSP00000450337:R376Q;ENSP00000450298:R358Q;ENSP00000385093:R302Q;ENSP00000327416:R358Q;ENSP00000449338:R376Q;ENSP00000388373:R277Q;ENSP00000447868:R376Q	.|ENSP00000327416:R358Q	G|R	-|-	1|2	0|0	PPFIA2|PPFIA2	80293710|80293710	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.827000|0.827000	0.46813|0.46813	5.979000|5.979000	0.70508|0.70508	2.723000|2.723000	0.93209|0.93209	0.650000|0.650000	0.86243|0.86243	GGC|CGG	.		0.393	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
CCDC59	29080	bcgsc.ca	37	12	82752037	82752037	+	Missense_Mutation	SNP	T	T	G	rs79245219	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:82752037T>G	ENST00000256151.7	-	1	530	c.119A>C	c.(118-120)aAc>aCc	p.N40T	CCDC59_ENST00000548126.1_Intron|METTL25_ENST00000248306.3_5'Flank	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	40					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						TTGCGGGTGGTTAGGCCGCCA	0.532											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	62	0.0123802	0.0053	0.0231	5008	,	,		16867	0.0		0.0358	False		,,,				2504	0.0031				p.N40T		.											.	CCDC59-90	0			c.A119C						.	T	THR/ASN	50,4356	50.9+/-86.3	0,50,2153	66.0	61.0	63.0		119	1.6	0.0	12	dbSNP_131	63	351,8249	118.8+/-178.2	7,337,3956	yes	missense	CCDC59	NM_014167.4	65	7,387,6109	GG,GT,TT		4.0814,1.1348,3.0832	benign	40/242	82752037	401,12605	2203	4300	6503	SO:0001583	missense	29080	exon1			GGGTGGTTAGGCC	AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.119A>C	12.37:g.82752037T>G	ENSP00000256151:p.Asn40Thr	116	0	1216	131	5	NM_014167	0	0	0	0	0	Q9H2V5|Q9NW62	Missense_Mutation	SNP	ENST00000256151.7	37	CCDS9023.1	39	0.017857142857142856	1	0.0020325203252032522	10	0.027624309392265192	0	0.0	28	0.036939313984168866	T	12.09	1.833070	0.32421	0.011348	0.040814	ENSG00000133773	ENST00000552377;ENST00000256151	.	.	.	5.18	1.6	0.23607	.	0.450111	0.26915	N	0.021850	T	0.05273	0.0140	L	0.27053	0.805	0.09310	N	1	B	0.33826	0.427	B	0.34722	0.188	T	0.06954	-1.0798	9	0.32370	T	0.25	-16.0678	7.0407	0.25019	0.0:0.2709:0.0:0.7291	.	40	Q9P031	TAP26_HUMAN	T	40	.	ENSP00000256151:N40T	N	-	2	0	CCDC59	81276168	0.001000	0.12720	0.003000	0.11579	0.018000	0.09664	0.476000	0.22180	0.320000	0.23234	0.477000	0.44152	AAC	T|0.971;G|0.029		0.532	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408186.1	NM_014167	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		23	14	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	6	0		44	16	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
PTPN11	5781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112893833	112893833	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:112893833A>G	ENST00000351677.2	+	6	920	c.722A>G	c.(721-723)gAt>gGt	p.D241G	PTPN11_ENST00000392597.1_Missense_Mutation_p.D241G	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	241					abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GAGACCACAGATAAAGTCAAA	0.378			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.D241G		.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11-7239	0			c.A722G						.						56.0	54.0	55.0					12																	112893833		2203	4300	6503	SO:0001583	missense	5781	exon6	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CCACAGATAAAGT	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.722A>G	12.37:g.112893833A>G	ENSP00000340944:p.Asp241Gly	332	1		379	77	NM_080601	0	0	0	0	0	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.58|13.58	2.281034|2.281034	0.40394|0.40394	.|.	.|.	ENSG00000179295|ENSG00000179295	ENST00000392597;ENST00000351677|ENST00000530818	D;D|.	0.99226|.	-5.59;-5.59|.	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	0.044972|.	0.85682|.	D|.	0.000000|.	T|T	0.47488|0.47488	0.1448|0.1448	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.44003|0.44003	-0.9356|-0.9356	10|5	0.31617|.	T|.	0.26|.	.|.	14.76|14.76	0.69600|0.69600	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	241;241|.	Q06124-2;Q06124-3|.	.;.|.	G|V	241|86	ENSP00000376376:D241G;ENSP00000340944:D241G|.	ENSP00000340944:D241G|.	D|I	+|+	2|1	0|0	PTPN11|PTPN11	111378216|111378216	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.893000|8.893000	0.92498|0.92498	1.898000|1.898000	0.54952|0.54952	0.374000|0.374000	0.22700|0.22700	GAT|ATA	.		0.378	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
FBRSL1	57666	hgsc.bcm.edu	37	12	133067343	133067343	+	Missense_Mutation	SNP	A	A	G	rs4883578	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:133067343A>G	ENST00000434748.2	+	1	1207	c.187A>G	c.(187-189)Acc>Gcc	p.T63A	FBRSL1_ENST00000261673.6_Intron	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	63							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						cgcgccccgcaccgcgcgtcc	0.791													G|||	3981	0.794928	0.7103	0.8213	5008	,	,		4145	0.5516		0.9642	False		,,,				2504	0.9673				p.T63A		.											.	FBRSL1-70	0			c.A187G						.						2.0	1.0	2.0					12																	133067343		433	922	1355	SO:0001583	missense	57666	exon1			CCCCGCACCGCGC		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.187A>G	12.37:g.133067343A>G	ENSP00000396160:p.Thr63Ala	0	0		11	11	NM_001142641	0	0	0	0	0	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	1489	0.6817765567765568	281	0.5711382113821138	266	0.7348066298342542	310	0.541958041958042	632	0.8337730870712401	G	0.079	-1.186384	0.01620	.	.	ENSG00000112787	ENST00000434748	T	0.28666	1.6	2.57	1.49	0.22878	.	.	.	.	.	T	0.00012	0.0000	N	0.00926	-1.1	0.38645	P	0.04829399999999995	B	0.02656	0.0	B	0.01281	0.0	T	0.34354	-0.9832	8	0.02654	T	1	.	4.1252	0.10125	0.4152:0.0:0.5848:0.0	rs4883578	63	Q9HCM7	FBSL_HUMAN	A	63	ENSP00000396160:T63A	ENSP00000396160:T63A	T	+	1	0	FBRSL1	131577416	0.008000	0.16893	0.647000	0.29507	0.071000	0.16799	0.128000	0.15810	0.267000	0.21916	-0.677000	0.03784	ACC	T|0.318;C|0.682		0.791	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
PXMP2	5827	hgsc.bcm.edu	37	12	133264332	133264332	+	Silent	SNP	C	C	T	rs11538534	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:133264332C>T	ENST00000317479.3	+	1	141	c.76C>T	c.(76-78)Ctg>Ttg	p.L26L	RP13-672B3.2_ENST00000537262.1_5'Flank|PXMP2_ENST00000545677.1_5'Flank|PXMP2_ENST00000428960.2_5'Flank|POLE_ENST00000535270.1_5'Flank|POLE_ENST00000320574.5_5'Flank|PXMP2_ENST00000539093.1_5'Flank|PXMP2_ENST00000543589.1_Silent_p.L26L	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	26						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)				large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		CGCCCAGTACCTGCTCTTCCT	0.801													c|||	1952	0.389776	0.2231	0.464	5008	,	,		4712	0.3244		0.5706	False		,,,				2504	0.4438				p.L26L		.											.	PXMP2-90	0			c.C76T						.						1.0	1.0	1.0					12																	133264332		888	1858	2746	SO:0001819	synonymous_variant	5827	exon1			CAGTACCTGCTCT		CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.76C>T	12.37:g.133264332C>T		0	0		5	5	NM_018663	0	0	0	0	0		Silent	SNP	ENST00000317479.3	37	CCDS9279.1																																																																																			C|0.572;T|0.428		0.801	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397553.1	NM_018663	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000464141.1_Intron|ING1_ENST00000375775.3_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		0	0		6	6	NM_005537	0	0	0	0	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
CDC16	8881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	115027384	115027384	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr13:115027384C>G	ENST00000356221.3	+	15	1445	c.1337C>G	c.(1336-1338)cCt>cGt	p.P446R	CDC16_ENST00000252458.6_Missense_Mutation_p.P301R|CDC16_ENST00000375312.3_Missense_Mutation_p.P301R|CDC16_ENST00000360383.3_Missense_Mutation_p.P446R|CDC16_ENST00000375308.1_Missense_Mutation_p.P352R|CDC16_ENST00000252457.5_Missense_Mutation_p.P445R|CDC16_ENST00000375310.1_Missense_Mutation_p.P352R			Q13042	CDC16_HUMAN	cell division cycle 16	446					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AAATGGGAACCTTTGTTGAAC	0.353																																					p.P446R		.											.	CDC16-226	0			c.C1337G						.						200.0	195.0	196.0					13																	115027384		2203	4300	6503	SO:0001583	missense	8881	exon15			GGGAACCTTTGTT	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.1337C>G	13.37:g.115027384C>G	ENSP00000348554:p.Pro446Arg	143	0		148	30	NM_003903	0	0	0	0	0	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	ENST00000356221.3	37	CCDS9542.2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725685	0.89298	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	T;T;T;T;T;T;T	0.75821	0.69;-0.97;0.69;0.69;0.69;0.69;-0.97	5.72	5.72	0.89469	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.87509	0.6195	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.982;0.995;0.998	D	0.87005	0.2119	9	.	.	.	-24.4811	19.8731	0.96858	0.0:1.0:0.0:0.0	.	394;445;446	Q13042-3;Q13042-2;Q13042	.;.;CDC16_HUMAN	R	446;301;446;352;445;352;301	ENSP00000353549:P446R;ENSP00000364461:P301R;ENSP00000348554:P446R;ENSP00000364459:P352R;ENSP00000252457:P445R;ENSP00000364457:P352R;ENSP00000252458:P301R	.	P	+	2	0	CDC16	114045486	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.067000	0.76741	2.705000	0.92388	0.557000	0.71058	CCT	.		0.353	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1	NM_003903	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		11	0		81	5	NM_080687	0	0	0	0	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ZNF219	51222	hgsc.bcm.edu	37	14	21560753	21560758	+	In_Frame_Del	DEL	GAGGCT	GAGGCT	-	rs71794845|rs11278664|rs3841049	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GAGGCT	GAGGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:21560753_21560758delGAGGCT	ENST00000360947.3	-	3	1109_1114	c.698_703delAGCCTC	c.(697-705)cagcctcca>cca	p.QP233del	RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_In_Frame_Del_p.QP233del|ZNF219_ENST00000421093.2_In_Frame_Del_p.QP233del|ZNF219_ENST00000556101.1_5'Flank	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	233				Missing (in Ref. 4; AAH00694). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q233_P234delQP(3)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ggctggggtggaggctgaggctgagg	0.743											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		1230	0.245607	0.2549	0.3775	5008	,	,		14407	0.125		0.1879	False		,,,				2504	0.3231				p.233_235del		.											.	ZNF219-90	3	Deletion - In frame(3)	large_intestine(1)|prostate(1)|breast(1)	c.698_703del						.		,,	821,2789		238,345,1222					,,	2.7	1.0		dbSNP_107	4	1173,6075		279,615,2730	no	coding,coding,coding	ZNF219	NM_016423.2,NM_001102454.1,NM_001101672.1	,,	517,960,3952	A1A1,A1R,RR		16.1838,22.7424,18.3643	,,	,,		1994,8864				SO:0001651	inframe_deletion	51222	exon3			GGGGTGGAGGCTG	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.698_703delAGCCTC	14.37:g.21560759_21560764delGAGGCT	ENSP00000354206:p.Gln233_Pro234del	0	0	749	49	21	NM_001102454	0	0	0	0	0	D3DS16|Q53Y57|Q8IYC1|Q9BW28	In_Frame_Del	DEL	ENST00000360947.3	37	CCDS9568.1																																																																																			.		0.743	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
MBIP	51562	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	36789780	36789780	+	Silent	SNP	C	C	G	rs138198154	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:36789780C>G	ENST00000416007.4	-	1	102	c.15G>C	c.(13-15)acG>acC	p.T5T	MBIP_ENST00000318473.7_Silent_p.T5T|MBIP_ENST00000359527.7_Silent_p.T5T	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	5					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		GATTAAGCTCCGTGGCAGCAG	0.592																																					p.T5T		.											.	MBIP-658	0			c.G15C						.						54.0	43.0	47.0					14																	36789780		2203	4300	6503	SO:0001819	synonymous_variant	51562	exon1			AAGCTCCGTGGCA	BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.15G>C	14.37:g.36789780C>G		45	1		69	19	NM_016586	0	0	0	0	0	Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Silent	SNP	ENST00000416007.4	37	CCDS9658.1	.	.	.	.	.	.	.	.	.	.	C	1.458	-0.563098	0.03939	.	.	ENSG00000151332	ENST00000553977	.	.	.	5.05	-5.09	0.02920	.	.	.	.	.	T	0.28101	0.0693	.	.	.	0.32911	D	0.514544	.	.	.	.	.	.	T	0.34850	-0.9812	4	.	.	.	0.1003	1.7716	0.03012	0.1252:0.2175:0.3454:0.3118	.	.	.	.	R	2	.	.	G	-	1	0	MBIP	35859531	0.001000	0.12720	0.007000	0.13788	0.162000	0.22319	-0.409000	0.07160	-1.243000	0.02519	-0.218000	0.12543	GGA	C|0.998;T|0.002		0.592	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276685.2	NM_016586	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		14	14	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
DDHD1	80821	bcgsc.ca	37	14	53619554	53619554	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:53619554T>G	ENST00000323669.5	-	1	262	c.263A>C	c.(262-264)aAc>aCc	p.N88T	DDHD1_ENST00000395606.1_Missense_Mutation_p.N88T|DDHD1_ENST00000357758.3_Missense_Mutation_p.N88T|RP11-547D23.1_ENST00000554235.1_RNA|AL356020.1_ENST00000584587.1_RNA	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	88					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GAAGTCATAGTTCTCGTCACT	0.706																																					p.N88T		.											.	DDHD1-92	0			c.A263C						.						30.0	34.0	33.0					14																	53619554		2201	4299	6500	SO:0001583	missense	80821	exon1			TCATAGTTCTCGT	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.263A>C	14.37:g.53619554T>G	ENSP00000327104:p.Asn88Thr	117	2		356	74	NM_001160147	0	0	0	0	0	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763313	0.31228	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.82	-6.29	0.02013	.	0.746150	0.11810	N	0.527247	T	0.08670	0.0215	N	0.00926	-1.1	0.19575	N	0.999963	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.41980	-0.9478	9	0.02654	T	1	-0.632	11.6581	0.51330	0.1126:0.0:0.706:0.1815	.	88;88;88	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	T	88	.	ENSP00000327104:N88T	N	-	2	0	DDHD1	52689304	1.000000	0.71417	0.957000	0.39632	0.991000	0.79684	0.699000	0.25586	-0.745000	0.04772	0.374000	0.22700	AAC	.		0.706	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
HSPA2	3306	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65009483	65009483	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:65009483A>G	ENST00000394709.1	+	2	1992	c.1916A>G	c.(1915-1917)gAc>gGc	p.D639G	HSPA2_ENST00000247207.6_Missense_Mutation_p.D639G|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	639					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GAAGAAGTGGACTAAGCTTGC	0.522																																					p.D639G	Pancreas(136;1211 1835 24894 31984 38227)	.											.	HSPA2-226	0			c.A1916G						.						15.0	18.0	17.0					14																	65009483		2195	4298	6493	SO:0001583	missense	3306	exon1			AAGTGGACTAAGC	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1916A>G	14.37:g.65009483A>G	ENSP00000378199:p.Asp639Gly	79	1		57	13	NM_021979	0	0	0	0	0	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.329915	0.60743	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01685	4.69;4.69	5.43	5.43	0.79202	.	0.000000	0.56097	U	0.000026	T	0.13457	0.0326	M	0.90650	3.135	0.45129	D	0.998143	D	0.63880	0.993	D	0.68192	0.956	T	0.00505	-1.1700	10	0.87932	D	0	-0.4074	15.5354	0.75998	1.0:0.0:0.0:0.0	.	639	P54652	HSP72_HUMAN	G	639;639;413	ENSP00000378199:D639G;ENSP00000247207:D639G	ENSP00000247207:D639G	D	+	2	0	HSPA2	64079236	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.071000	0.62044	0.456000	0.33151	GAC	.		0.522	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
NRXN3	9369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	79434571	79434571	+	Silent	SNP	C	C	T	rs564964171		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:79434571C>T	ENST00000554719.1	+	11	2396	c.1905C>T	c.(1903-1905)ctC>ctT	p.L635L	NRXN3_ENST00000335750.5_Silent_p.L635L	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	239					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCCCAAAGCTCGTGGCCTCTC	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		15032	0.0		0.0	False		,,,				2504	0.001				p.L635L		.											.	NRXN3-587	0			c.C1905T						.						127.0	113.0	117.0					14																	79434571		2203	4300	6503	SO:0001819	synonymous_variant	9369	exon11			AAAGCTCGTGGCC	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1905C>T	14.37:g.79434571C>T		157	0		253	52	NM_004796	0	0	0	0	0	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	37	CCDS9870.1																																																																																			.		0.502	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000555019.1_Missense_Mutation_p.H515P|ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P		.											.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	48	11		213	50	NM_001202429	0	0	0	0	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		0	0		20	14	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
KIF26A	26153	hgsc.bcm.edu	37	14	104644147	104644147	+	Silent	SNP	C	C	T	rs11621644	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:104644147C>T	ENST00000423312.2	+	12	5022	c.5022C>T	c.(5020-5022)tcC>tcT	p.S1674S	KIF26A_ENST00000315264.7_Silent_p.S1535S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1674					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCAGCGCCTCCTCCGCCCCTG	0.716													C|||	1581	0.315695	0.1112	0.379	5008	,	,		13472	0.4415		0.3549	False		,,,				2504	0.3773				p.S1674S		.											.	KIF26A-24	0			c.C5022T						.	C		442,3276		34,374,1451	4.0	5.0	5.0		5022	2.6	1.0	14	dbSNP_120	5	2372,5338		411,1550,1894	no	coding-synonymous	KIF26A	NM_015656.1		445,1924,3345	TT,TC,CC		30.7652,11.8881,24.6237		1674/1883	104644147	2814,8614	1859	3855	5714	SO:0001819	synonymous_variant	26153	exon12			CGCCTCCTCCGCC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5022C>T	14.37:g.104644147C>T		1	0		12	10	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			C|0.681;T|0.319		0.716	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
CEP170B	283638	broad.mit.edu	37	14	105352650	105352650	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr14:105352650T>G	ENST00000414716.3	+	12	2302	c.2074T>G	c.(2074-2076)Tcc>Gcc	p.S692A	CEP170B_ENST00000418279.1_Missense_Mutation_p.S622A|CEP170B_ENST00000556508.1_Missense_Mutation_p.S622A|CEP170B_ENST00000453495.1_Missense_Mutation_p.S693A	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	692						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GCCGGAGGGGTCCCTGCCTGT	0.706																																					p.S692A		.											.	.	0			c.T2074G						.						5.0	8.0	7.0					14																	105352650		1942	4056	5998	SO:0001583	missense	283638	exon12			GAGGGGTCCCTGC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2074T>G	14.37:g.105352650T>G	ENSP00000404151:p.Ser692Ala	16	1		127	23	NM_001112726	0	0	0	0	0	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	T	2.744	-0.261591	0.05791	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.31	-5.94	0.02247	.	1.355880	0.04923	N	0.455350	T	0.06508	0.0167	N	0.03000	-0.44	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.0;0.001	T	0.23048	-1.0199	10	0.39692	T	0.17	-2.6107	0.2864	0.00252	0.3513:0.2081:0.2099:0.2307	.	692;692;622	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	A	622;692;693;622	ENSP00000451249:S622A;ENSP00000404151:S692A;ENSP00000407238:S693A;ENSP00000415006:S622A	ENSP00000404151:S692A	S	+	1	0	KIAA0284	104423695	0.000000	0.05858	0.473000	0.27253	0.365000	0.29674	-1.765000	0.01799	-1.026000	0.03330	-0.302000	0.09304	TCC	.		0.706	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
KIF23	9493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69721517	69721517	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr15:69721517G>A	ENST00000260363.4	+	10	1154	c.1037G>A	c.(1036-1038)cGg>cAg	p.R346Q	KIF23_ENST00000352331.4_Missense_Mutation_p.R346Q|KIF23_ENST00000559279.1_Missense_Mutation_p.R346Q|KIF23_ENST00000537891.1_Missense_Mutation_p.R163Q|KIF23_ENST00000558585.1_Missense_Mutation_p.R163Q|KIF23_ENST00000395392.2_Missense_Mutation_p.R346Q	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	346	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						AGAACTAACCGGACCAGAGCA	0.363																																					p.R346Q		.											.	KIF23-227	0			c.G1037A						.						106.0	95.0	98.0					15																	69721517		2199	4298	6497	SO:0001583	missense	9493	exon10			CTAACCGGACCAG	X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.1037G>A	15.37:g.69721517G>A	ENSP00000260363:p.Arg346Gln	120	0		139	33	NM_138555	0	0	0	0	0	Q8WVP0	Missense_Mutation	SNP	ENST00000260363.4	37	CCDS32278.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062735	0.93898	.	.	ENSG00000137807	ENST00000260363;ENST00000352331;ENST00000395392;ENST00000537891	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	4.75	4.75	0.60458	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	T	0.82042	0.4951	L	0.45422	1.42	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.99;0.995	D	0.84247	0.0475	10	0.72032	D	0.01	.	16.7146	0.85395	0.0:0.0:1.0:0.0	.	163;346;346	B4E1K0;Q02241-2;Q02241	.;.;KIF23_HUMAN	Q	346;346;346;163	ENSP00000260363:R346Q;ENSP00000304978:R346Q;ENSP00000378790:R346Q;ENSP00000442969:R163Q	ENSP00000260363:R346Q	R	+	2	0	KIF23	67508571	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.080000	0.76837	2.167000	0.68274	0.591000	0.81541	CGG	.		0.363	KIF23-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
C1QTNF8	390664	hgsc.bcm.edu	37	16	1143513	1143529	+	Frame_Shift_Del	DEL	GGCCGGCTTGACCAGGT	GGCCGGCTTGACCAGGT	-	rs536627036|rs558754523|rs536120563	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GGCCGGCTTGACCAGGT	GGCCGGCTTGACCAGGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:1143513_1143529delGGCCGGCTTGACCAGGT	ENST00000328449.5	-	4	1004_1020	c.731_747delACCTGGTCAAGCCGGCC	c.(730-747)cacctggtcaagccggccfs	p.HLVKPA244fs		NM_207419.3	NP_997302.2	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	244	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				lung(2)|prostate(1)|skin(1)	4		Hepatocellular(780;0.00369)				ACAGCTCGGCGGCCGGCTTGACCAGGTGGCCGCTGAA	0.71																																					p.244_249del		.											.	C1QTNF8-91	0			c.731_747del						.																																			SO:0001589	frameshift_variant	390664	exon4			CTCGGCGGCCGGC	AY358832	CCDS32358.1	16p13.3	2014-08-12			ENSG00000184471	ENSG00000184471			31374	protein-coding gene	gene with protein product		614147				12975309	Standard	NM_207419		Approved	UNQ5829, CTRP8	uc010uuw.1	P60827	OTTHUMG00000167756	ENST00000328449.5:c.731_747delACCTGGTCAAGCCGGCC	16.37:g.1143513_1143529delGGCCGGCTTGACCAGGT	ENSP00000330426:p.His244fs	30	0		176	25	NM_207419	0	0	0	0	0	B7U178	Frame_Shift_Del	DEL	ENST00000328449.5	37	CCDS32358.1																																																																																			.		0.710	C1QTNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396120.1	XM_372606	
CACNA1H	8912	broad.mit.edu	37	16	1250295	1250295	+	Silent	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:1250295G>A	ENST00000348261.5	+	7	1091	c.843G>A	c.(841-843)acG>acA	p.T281T	CACNA1H_ENST00000565831.1_Silent_p.T281T|CACNA1H_ENST00000358590.4_Silent_p.T281T	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	281					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ACTACCAGACGGAGGAGGGCG	0.637																																					p.T281T		.											.	CACNA1H-67	0			c.G843A						.						29.0	30.0	30.0					16																	1250295		2089	4203	6292	SO:0001819	synonymous_variant	8912	exon7			CCAGACGGAGGAG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.843G>A	16.37:g.1250295G>A		73	0		173	5	NM_021098	0	0	0	0	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1																																																																																			.		0.637	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		9	9	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
SLC12A4	6560	bcgsc.ca	37	16	67984589	67984589	+	Silent	SNP	A	A	G	rs11542821	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:67984589A>G	ENST00000316341.3	-	11	1562	c.1422T>C	c.(1420-1422)ggT>ggC	p.G474G	SLC12A4_ENST00000576616.1_Silent_p.G474G|SLC12A4_ENST00000572010.1_5'Flank|SLC12A4_ENST00000572037.1_Silent_p.G426G|SLC12A4_ENST00000541864.2_Silent_p.G443G|SLC12A4_ENST00000422611.2_Silent_p.G476G|SLC12A4_ENST00000338335.3_Silent_p.G474G|SLC12A4_ENST00000537830.2_Silent_p.G468G	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	474					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAATGCAGGCACCAAAGAGAA	0.622													G|||	743	0.148363	0.4312	0.0793	5008	,	,		18579	0.006		0.0467	False		,,,				2504	0.0665				p.G476G		.											.	SLC12A4-91	0			c.T1428C						.	G	,,,,	1615,2781	637.4+/-396.7	303,1009,886	108.0	97.0	100.0		1422,1428,1404,1329,1422	-5.9	1.0	16	dbSNP_120	100	431,8169	780.6+/-407.7	13,405,3882	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLC12A4	NM_001145961.1,NM_001145962.1,NM_001145963.1,NM_001145964.1,NM_005072.4	,,,,	316,1414,4768	GG,GA,AA		5.0116,36.7379,15.7433	,,,,	474/1080,476/1088,468/1080,443/1055,474/1086	67984589	2046,10950	2198	4300	6498	SO:0001819	synonymous_variant	6560	exon10			GCAGGCACCAAAG		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1422T>C	16.37:g.67984589A>G		112	1		107	5	NM_001145962	0	0	0	0	0	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Silent	SNP	ENST00000316341.3	37	CCDS10855.1																																																																																			A|0.851;G|0.149		0.622	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000567413.1_3'UTR	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		16	5	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		26	23	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		24	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		23	22	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		23	22	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ANKRD11	29123	hgsc.bcm.edu	37	16	89346883	89346883	+	Missense_Mutation	SNP	C	C	G	rs60520302	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:89346883C>G	ENST00000301030.4	-	9	6527	c.6067G>C	c.(6067-6069)Gcc>Ccc	p.A2023P	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A2023P	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2023	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GCGTACGGGGCAGGAGAGGCG	0.736													C|||	188	0.0375399	0.028	0.0245	5008	,	,		12625	0.0744		0.0507	False		,,,				2504	0.0082				p.A2023P		.											.	ANKRD11-139	0			c.G6067C						.	C	PRO/ALA	54,2948		0,54,1447	6.0	8.0	7.0		6067	0.2	0.0	16	dbSNP_129	7	203,6379		8,187,3096	no	missense	ANKRD11	NM_013275.4	27	8,241,4543	GG,GC,CC		3.0842,1.7988,2.6816	benign	2023/2664	89346883	257,9327	1501	3291	4792	SO:0001583	missense	29123	exon9			ACGGGGCAGGAGA	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6067G>C	16.37:g.89346883C>G	ENSP00000301030:p.Ala2023Pro	2	0		24	9	NM_001256183	0	0	0	0	0	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	104	0.047619047619047616	12	0.024390243902439025	6	0.016574585635359115	38	0.06643356643356643	48	0.0633245382585752	c	0.719	-0.784169	0.02907	0.017988	0.030842	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.37584	1.19;1.19	0.207	0.207	0.15214	.	0.876393	0.09724	N	0.764014	T	0.01092	0.0036	N	0.14661	0.345	0.09310	N	0.999998	B	0.34372	0.451	B	0.20384	0.029	T	0.09640	-1.0665	9	0.34782	T	0.22	.	.	.	.	rs60520302	2023	Q6UB99	ANR11_HUMAN	P	2023	ENSP00000301030:A2023P;ENSP00000367581:A2023P	ENSP00000301030:A2023P	A	-	1	0	ANKRD11	87874384	0.046000	0.20272	0.026000	0.17262	0.028000	0.11728	0.465000	0.22004	0.293000	0.22520	0.298000	0.19748	GCC	C|0.952;G|0.048		0.736	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000567815.1_Silent_p.A47A|RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		0	0		31	20	NM_001243131	0	0	0	0	0	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
GAS8	2622	bcgsc.ca	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																					p.G65S		.											.	C16orf3-90	1	Substitution - Missense(1)	lung(1)	c.G193A						.						25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	750	exon1			GGCAGCCTACGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T		145	3		268	18	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		12	12	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
FXR2	9513	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7495630	7495630	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:7495630C>T	ENST00000250113.7	-	16	2202	c.1868G>A	c.(1867-1869)cGc>cAc	p.R623H	MPDU1_ENST00000423172.2_Intron|SOX15_ENST00000250055.2_5'Flank|SOX15_ENST00000570788.1_5'Flank|FXR2_ENST00000573057.1_5'UTR|SOX15_ENST00000538513.2_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	623						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		TGGCCTCTGGCGGCTCTGAGA	0.512																																					p.R623H		.											.	.	0			c.G1868A						.						126.0	126.0	126.0					17																	7495630		1984	4173	6157	SO:0001583	missense	9513	exon16			CTCTGGCGGCTCT	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1868G>A	17.37:g.7495630C>T	ENSP00000250113:p.Arg623His	58	0		43	4	NM_004860	0	0	0	0	0	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	37	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621994	0.87460	.	.	ENSG00000129245	ENST00000250113	T	0.58506	0.33	4.89	4.89	0.63831	.	0.051732	0.64402	D	0.000001	T	0.68146	0.2969	L	0.39898	1.24	0.58432	D	0.999997	D	0.76494	0.999	D	0.73380	0.98	T	0.70619	-0.4822	10	0.87932	D	0	-3.7171	15.9292	0.79646	0.0:1.0:0.0:0.0	.	623	P51116	FXR2_HUMAN	H	623	ENSP00000250113:R623H	ENSP00000250113:R623H	R	-	2	0	FXR2	7436355	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.135000	0.77276	2.709000	0.92574	0.655000	0.94253	CGC	.		0.512	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		11	11	NM_001199417	0	0	0	0	0		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
MSL1	339287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38289309	38289309	+	Silent	SNP	T	T	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:38289309T>C	ENST00000398532.4	+	6	1818	c.1503T>C	c.(1501-1503)agT>agC	p.S501S	MSL1_ENST00000578648.1_Silent_p.S485S|MSL1_ENST00000579565.1_Silent_p.S238S	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)	501	Interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						TGGATGACAGTGTGTTTTCGA	0.433																																					p.S238S		.											.	MSL1-68	0			c.T714C						.						76.0	76.0	76.0					17																	38289309		1938	4153	6091	SO:0001819	synonymous_variant	339287	exon7			TGACAGTGTGTTT		CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.1503T>C	17.37:g.38289309T>C		107	0		118	22	NM_001012241	0	0	0	0	0	Q0VF46|Q69Z03	Silent	SNP	ENST00000398532.4	37																																																																																				.		0.433	MSL1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000447409.2	NM_001012241	
KCNH4	23415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40322162	40322162	+	Silent	SNP	C	C	T	rs140040426	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:40322162C>T	ENST00000264661.3	-	8	1685	c.1353G>A	c.(1351-1353)gcG>gcA	p.A451A	KCNH4_ENST00000607371.1_Silent_p.A451A	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	451					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGATCTTCTCCGCGTCGGTGT	0.627																																					p.A451A	NSCLC(117;707 1703 2300 21308 31858)	.											.	KCNH4-153	0			c.G1353A						.	G		2,4404		0,2,2201	72.0	60.0	64.0		1353	-7.8	0.5	17	dbSNP_134	64	0,8600		0,0,4300	no	coding-synonymous	KCNH4	NM_012285.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		451/1018	40322162	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23415	exon8			CTTCTCCGCGTCG	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1353G>A	17.37:g.40322162C>T		114	0		220	62	NM_012285	0	0	0	0	0		Silent	SNP	ENST00000264661.3	37	CCDS11420.1																																																																																			C|1.000;T|0.000		0.627	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
ASB16	92591	hgsc.bcm.edu	37	17	42254417	42254417	+	Missense_Mutation	SNP	A	A	G	rs7212854	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:42254417A>G	ENST00000293414.1	+	3	965	c.881A>G	c.(880-882)aAc>aGc	p.N294S	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000591166.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	294				N -> S (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTTGTGCCAACGGCTGCGGG	0.751													A|||	2275	0.454273	0.5756	0.379	5008	,	,		8774	0.6925		0.2714	False		,,,				2504	0.2863				p.N294S		.											.	ASB16-227	0			c.A881G						.	A	SER/ASN,	429,1345		24,381,482	1.0	2.0	1.0		881,204	3.8	1.0	17	dbSNP_116	1	576,3936		27,522,1707	no	missense,coding-synonymous	ASB16,C17orf65	NM_080863.4,NM_178542.3	46,	51,903,2189	GG,GA,AA		12.766,24.1826,15.9879	probably-damaging,	294/454,68/194	42254417	1005,5281	887	2256	3143	SO:0001583	missense	92591	exon3			GTGCCAACGGCTG	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.881A>G	17.37:g.42254417A>G	ENSP00000293414:p.Asn294Ser	0	0		21	11	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1014	0.4642857142857143	292	0.5934959349593496	125	0.3453038674033149	385	0.6730769230769231	212	0.2796833773087071	A	18.19	3.568823	0.65765	0.241826	0.12766	ENSG00000161664	ENST00000293414	D	0.82984	-1.67	4.86	3.78	0.43462	Ankyrin repeat-containing domain (4);	0.044733	0.85682	D	0.000000	T	0.00012	0.0000	L	0.28458	0.855	0.23010	P	0.99843442	B	0.25441	0.126	B	0.27170	0.077	T	0.48514	-0.9029	9	0.39692	T	0.17	-14.5205	9.4601	0.38778	0.9148:0.0:0.0852:0.0	rs7212854	294	Q96NS5	ASB16_HUMAN	S	294	ENSP00000293414:N294S	ENSP00000293414:N294S	N	+	2	0	ASB16	39609943	0.987000	0.35691	0.978000	0.43139	0.956000	0.61745	3.125000	0.50469	0.883000	0.36040	0.454000	0.30748	AAC	A|0.590;G|0.410		0.751	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
NT5C	30833	hgsc.bcm.edu	37	17	73127683	73127683	+	Silent	SNP	T	T	C	rs4788867	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:73127683T>C	ENST00000245552.2	-	1	207	c.120A>G	c.(118-120)caA>caG	p.Q40Q	NT5C_ENST00000582170.1_Silent_p.Q40Q|NT5C_ENST00000578337.1_5'Flank|NT5C_ENST00000582160.1_5'Flank|NT5C_ENST00000579082.1_5'UTR	NM_014595.2	NP_055410.1	Q8TCD5	NT5C_HUMAN	5', 3'-nucleotidase, cytosolic	40					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|pyrimidine nucleotide binding (GO:0019103)					all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Lamivudine(DB00709)	AGCCGCGGCGTTGCTCCAGCG	0.766													C|||	2491	0.497404	0.4372	0.5115	5008	,	,		10373	0.2817		0.66	False		,,,				2504	0.6237				p.Q40Q		.											.	NT5C-90	0			c.A120G						.						1.0	1.0	1.0					17																	73127683		1084	2247	3331	SO:0001819	synonymous_variant	30833	exon1			GCGGCGTTGCTCC	AF154829	CCDS11715.1	17q25	2011-03-29	2002-05-23		ENSG00000125458	ENSG00000125458	3.1.3.5		17144	protein-coding gene	gene with protein product		191720	"""5' nucleotidase, deoxy (pyrimidine), cytosolic type C"", ""uridine 5-prime monophosphate hydrolase 2"""	UMPH2		10899995	Standard	NM_014595		Approved	DNT1, DNT-1, PN-I, cdN, dNT-1	uc002jmx.3	Q8TCD5		ENST00000245552.2:c.120A>G	17.37:g.73127683T>C		0	0		5	5	NM_001252377	0	0	0	0	0	Q96HS6|Q9NP82	Silent	SNP	ENST00000245552.2	37	CCDS11715.1																																																																																			T|0.502;C|0.498		0.766	NT5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445853.1		
C17orf70	80233	broad.mit.edu	37	17	79517591	79517591	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:79517591delT	ENST00000327787.8	-	3	975	c.929delA	c.(928-930)gacfs	p.D310fs	C17orf70_ENST00000537152.1_Frame_Shift_Del_p.D159fs|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	310					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CACCAGGCAGTCACAGTGCAC	0.612																																					p.D310fs		.											.	C17orf70-92	0			c.929delA						.						47.0	49.0	48.0					17																	79517591		2202	4300	6502	SO:0001589	frameshift_variant	80233	exon3			AGGCAGTCACAGT	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.929delA	17.37:g.79517591delT	ENSP00000333283:p.Asp310fs	89	0		200	8	NM_025161	0	0	0	0	0	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Frame_Shift_Del	DEL	ENST00000327787.8	37	CCDS32765.2																																																																																			.		0.612	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
UTS2R	2837	hgsc.bcm.edu	37	17	80332223	80332223	+	Missense_Mutation	SNP	C	C	G	rs41344948	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:80332223C>G	ENST00000313135.2	+	1	71	c.23C>G	c.(22-24)cCg>cGg	p.P8R		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	8					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			CCCGAGTCCCCGAGCAGCTTC	0.721													.|||	29	0.00579073	0.0	0.0043	5008	,	,		12181	0.001		0.0209	False		,,,				2504	0.0041				p.P8R		.											.	UTS2R-153	0			c.C23G						.	C	ARG/PRO	6,4024		0,6,2009	5.0	7.0	6.0		23	0.0	0.0	17	dbSNP_127	6	93,8081		0,93,3994	no	missense	UTS2R	NM_018949.1	103	0,99,6003	GG,GC,CC		1.1378,0.1489,0.8112	benign	8/390	80332223	99,12105	2015	4087	6102	SO:0001583	missense	2837	exon1			AGTCCCCGAGCAG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.23C>G	17.37:g.80332223C>G	ENSP00000323516:p.Pro8Arg	1	0		48	27	NM_018949	0	0	0	0	0	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	21	0.009615384615384616	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	18	0.023746701846965697	C	11.31	1.599551	0.28534	0.001489	0.011378	ENSG00000181408	ENST00000313135	T	0.68765	-0.35	4.74	0.0383	0.14199	.	2.746610	0.02267	U	0.068090	T	0.26810	0.0656	N	0.08118	0	0.09310	N	1	B	0.28291	0.206	B	0.22386	0.039	T	0.28808	-1.0032	10	0.46703	T	0.11	.	1.8089	0.03087	0.1357:0.4144:0.1195:0.3304	rs41344948	8	Q9UKP6	UR2R_HUMAN	R	8	ENSP00000323516:P8R	ENSP00000323516:P8R	P	+	2	0	UTS2R	77925512	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.716000	0.04991	0.161000	0.19458	0.655000	0.94253	CCG	C|0.990;G|0.010		0.721	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
TMEM200C	645369	hgsc.bcm.edu	37	18	5890571	5890571	+	Missense_Mutation	SNP	T	T	C	rs7506026	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:5890571T>C	ENST00000581347.2	-	3	2137	c.1492A>G	c.(1492-1494)Agc>Ggc	p.S498G	TMEM200C_ENST00000383490.2_Missense_Mutation_p.S498G|RP11-945C19.4_ENST00000582939.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	498	Pro-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						GCCAGAGGGCTGGAGTCCGGG	0.791													T|||	237	0.0473243	0.0847	0.0375	5008	,	,		7356	0.001		0.0775	False		,,,				2504	0.0204				p.S498G		.											.	.	0			c.A1492G						.	T	GLY/SER	155,2477		3,149,1164	3.0	3.0	3.0		1492	-1.2	0.0	18	dbSNP_116	3	267,5869		4,259,2805	no	missense	TMEM200C	NM_001080209.1	56	7,408,3969	CC,CT,TT		4.3514,5.8891,4.813	benign	498/622	5890571	422,8346	1316	3068	4384	SO:0001583	missense	645369	exon1			GAGGGCTGGAGTC		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1492A>G	18.37:g.5890571T>C	ENSP00000463375:p.Ser498Gly	2	0		23	8	NM_001080209	0	0	0	0	0		Missense_Mutation	SNP	ENST00000581347.2	37	CCDS45825.1	128	0.05860805860805861	46	0.09349593495934959	17	0.04696132596685083	3	0.005244755244755245	62	0.08179419525065963	T	13.97	2.397165	0.42512	0.058891	0.043514	ENSG00000206432	ENST00000383490	.	.	.	4.37	-1.18	0.09617	.	.	.	.	.	T	0.00496	0.0016	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	8	0.08599	T	0.76	.	4.9842	0.14182	0.1362:0.3204:0.0:0.5434	rs7506026	498	A6NKL6	T200C_HUMAN	G	498	.	ENSP00000372982:S498G	S	-	1	0	TMEM200C	5880571	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.166000	0.09954	-0.178000	0.10672	0.459000	0.35465	AGC	T|0.941;C|0.059		0.791	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	NM_001080209	
L3MBTL4	91133	broad.mit.edu;bcgsc.ca	37	18	6093437	6093437	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:6093437delT	ENST00000284898.6	-	15	1490	c.1290delA	c.(1288-1290)gaafs	p.E430fs	L3MBTL4_ENST00000400105.2_Frame_Shift_Del_p.E430fs|L3MBTL4_ENST00000535782.1_Frame_Shift_Del_p.E243fs|L3MBTL4_ENST00000317931.7_Frame_Shift_Del_p.E430fs|L3MBTL4_ENST00000400104.3_Frame_Shift_Del_p.E430fs	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	430					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				AAGAGTCTGATTCCAAATTTG	0.393																																					p.E430fs	Esophageal Squamous(41;748 902 17366 28959 43175)	.											.	L3MBTL4-93	0			c.1290delA						.						165.0	157.0	160.0					18																	6093437		2203	4300	6503	SO:0001589	frameshift_variant	91133	exon15			GTCTGATTCCAAA	BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1290delA	18.37:g.6093437delT	ENSP00000284898:p.Glu430fs	32	0		36	9	NM_173464	0	0	0	0	0	A8MTL8|Q8IXS3	Frame_Shift_Del	DEL	ENST00000284898.6	37	CCDS11839.2																																																																																			.		0.393	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	7023307	7023307	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:7023307C>T	ENST00000389658.3	-	19	2650	c.2557G>A	c.(2557-2559)Ggc>Agc	p.G853S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	853	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TCCACGTTGCCGCTGCAGTCA	0.547																																					p.G853S		.											.	LAMA1-149	0			c.G2557A						.						97.0	87.0	91.0					18																	7023307		2203	4300	6503	SO:0001583	missense	284217	exon19			CGTTGCCGCTGCA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2557G>A	18.37:g.7023307C>T	ENSP00000374309:p.Gly853Ser	114	0		177	37	NM_005559	0	0	0	0	0		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122117	0.77436	.	.	ENSG00000101680	ENST00000389658	T	0.66460	-0.21	5.47	5.47	0.80525	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	T	0.81541	0.4844	M	0.86097	2.795	0.58432	D	0.999995	D	0.62365	0.991	P	0.57283	0.817	T	0.82337	-0.0507	10	0.42905	T	0.14	.	19.336	0.94319	0.0:1.0:0.0:0.0	.	853	P25391	LAMA1_HUMAN	S	853	ENSP00000374309:G853S	ENSP00000374309:G853S	G	-	1	0	LAMA1	7013307	0.995000	0.38212	0.969000	0.41365	0.487000	0.33371	3.276000	0.51646	2.578000	0.87016	0.643000	0.83706	GGC	.		0.547	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28651720	28651720	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:28651720G>T	ENST00000280904.6	-	13	2419	c.1976C>A	c.(1975-1977)tCt>tAt	p.S659Y	DSC2_ENST00000251081.6_Missense_Mutation_p.S659Y|snoU13_ENST00000459603.1_RNA	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	659	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			AGTGACACTAGACATGCCAAG	0.418																																					p.S659Y		.											.	DSC2-517	0			c.C1976A						.						133.0	105.0	114.0					18																	28651720		2203	4300	6503	SO:0001583	missense	1824	exon13			ACACTAGACATGC	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1976C>A	18.37:g.28651720G>T	ENSP00000280904:p.Ser659Tyr	163	0		234	54	NM_024422	0	0	0	0	0		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114294	0.56505	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.62105	0.05;0.05	6.16	5.28	0.74379	Cadherin (2);Cadherin-like (1);	0.000000	0.31415	N	0.007693	T	0.67543	0.2904	M	0.65320	2	0.09310	N	1	P;P	0.44877	0.715;0.845	P;P	0.49799	0.541;0.622	T	0.62982	-0.6738	10	0.49607	T	0.09	.	12.3352	0.55062	0.0:0.1633:0.7211:0.1155	.	659;659	Q02487;Q02487-2	DSC2_HUMAN;.	Y	659;659;425;672	ENSP00000251081:S659Y;ENSP00000280904:S659Y	ENSP00000251081:S659Y	S	-	2	0	DSC2	26905718	0.000000	0.05858	0.012000	0.15200	0.001000	0.01503	0.401000	0.20948	1.586000	0.49944	0.650000	0.86243	TCT	.		0.418	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
TCEB3C	162699	broad.mit.edu;bcgsc.ca	37	18	44555127	44555127	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:44555127G>A	ENST00000330682.2	-	1	1322	c.1087C>T	c.(1087-1089)Ctt>Ttt	p.L363F	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_145653.3	NP_663628.2	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide 3C (elongin A3)	363	Activation domain. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(16)|skin(2)	30						ACGGGTTCAAGAACCGAGTAG	0.612																																					p.L363F		.											.	TCEB3C-68	0			c.C1087T						.						381.0	364.0	369.0					18																	44555127		1954	3933	5887	SO:0001583	missense	162699	exon1			GTTCAAGAACCGA	AB076840	CCDS11931.1	18q21.1	2008-08-13			ENSG00000183791	ENSG00000183791			24617	protein-coding gene	gene with protein product	"""elongin A3"""					11932239, 11994304	Standard	NM_145653		Approved	HsT829, TCEB3L2	uc010xdb.2	Q8NG57	OTTHUMG00000132651	ENST00000330682.2:c.1087C>T	18.37:g.44555127G>A	ENSP00000328232:p.Leu363Phe	496	2		841	27	NM_145653	0	0	0	0	0		Missense_Mutation	SNP	ENST00000330682.2	37	CCDS11931.1	.	.	.	.	.	.	.	.	.	.	g	13.23	2.174864	0.38413	.	.	ENSG00000183791	ENST00000330682	T	0.45668	0.89	1.75	-0.255	0.12988	.	0.348573	0.20511	N	0.090899	T	0.38241	0.1033	M	0.83118	2.625	0.18873	N	0.999988	B	0.23540	0.087	B	0.21360	0.034	T	0.43637	-0.9379	10	0.87932	D	0	-3.0851	2.3019	0.04164	0.1919:0.0:0.5109:0.2972	.	363	Q8NG57	ELOA3_HUMAN	F	363	ENSP00000328232:L363F	ENSP00000328232:L363F	L	-	1	0	TCEB3C	42809125	0.047000	0.20315	0.000000	0.03702	0.007000	0.05969	0.881000	0.28173	-0.071000	0.12886	0.485000	0.47835	CTT	.		0.612	TCEB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255902.1	NM_145653	
MEX3C	51320	hgsc.bcm.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GCCGCCGCG	GCCGCCGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																					p.179_182del		.											.	MEX3C-659	0			c.537_545del						.			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				SO:0001627	intron_variant	51320	exon1			GCCGCCGCCGCCG	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		0	0		41	23	NM_016626	0	0	0	0	0	A1L022|Q9NZE3	In_Frame_Del	DEL	ENST00000591040.1	37																																																																																				.		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		0	0		51	28	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
SBNO2	22904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1127619	1127619	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:1127619G>A	ENST00000361757.3	-	5	662	c.425C>T	c.(424-426)cCc>cTc	p.P142L	SBNO2_ENST00000587024.1_Missense_Mutation_p.P142L|SBNO2_ENST00000438103.2_Missense_Mutation_p.P85L	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	142					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGGTGGAGGGGGCAGGGTT	0.682																																					p.P142L		.											.	.	0			c.C425T						.						66.0	78.0	74.0					19																	1127619		2134	4228	6362	SO:0001583	missense	22904	exon5			GTGGAGGGGGCAG	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.425C>T	19.37:g.1127619G>A	ENSP00000354733:p.Pro142Leu	69	0		116	39	NM_014963	0	0	0	0	0	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.766427	0.31228	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	3.57	2.39	0.29439	.	2.543690	0.01842	U	0.035404	T	0.28863	0.0716	L	0.34521	1.04	0.09310	N	1	B;B;P;P	0.39782	0.116;0.418;0.561;0.688	B;B;B;B	0.34242	0.036;0.054;0.118;0.178	T	0.27468	-1.0073	9	0.25751	T	0.34	-6.6121	10.1595	0.42842	0.0:0.0:0.7254:0.2746	.	85;142;142;85	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	L	142;85;99	.	ENSP00000250872:P99L	P	-	2	0	SBNO2	1078619	0.412000	0.25392	0.021000	0.16686	0.010000	0.07245	3.739000	0.55075	1.927000	0.55829	0.491000	0.48974	CCC	.		0.682	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000453954.2_Silent_p.S350S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		1	0		26	7	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
LINGO3	645191	hgsc.bcm.edu	37	19	2290499	2290499	+	Missense_Mutation	SNP	C	C	T	rs7258841	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:2290499C>T	ENST00000585527.1	-	1	1524	c.1277G>A	c.(1276-1278)cGc>cAc	p.R426H	LINGO3_ENST00000404279.1_Missense_Mutation_p.R426H			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	426	Ig-like C2-type.		R -> H (in dbSNP:rs7258841).			integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCAGAGGAAGCGGACGTCTTC	0.756													C|||	1440	0.28754	0.4017	0.2536	5008	,	,		9136	0.3363		0.1292	False		,,,				2504	0.2699				p.R426H		.											.	.	0			c.G1277A						.						1.0	2.0	2.0					19																	2290499		1143	2693	3836	SO:0001583	missense	645191	exon2			AGGAAGCGGACGT	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1277G>A	19.37:g.2290499C>T	ENSP00000467753:p.Arg426His	1	0		11	10	NM_001101391	0	0	0	0	0		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	581	0.266025641025641	199	0.40447154471544716	83	0.2292817679558011	203	0.3548951048951049	96	0.1266490765171504	c	8.925	0.961929	0.18583	.	.	ENSG00000220008	ENST00000404279	T	0.68624	-0.34	4.12	2.99	0.34606	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	N	0.12527	0.23	0.37498	P	0.08333100000000004	B	0.12013	0.005	B	0.12156	0.007	T	0.28744	-1.0034	8	0.10902	T	0.67	.	10.7018	0.45931	0.0:0.5797:0.4203:0.0	rs7258841	426	P0C6S8	LIGO3_HUMAN	H	426	ENSP00000384979:R426H	ENSP00000384979:R426H	R	-	2	0	LINGO3	2241499	0.985000	0.35326	1.000000	0.80357	0.779000	0.44077	0.931000	0.28871	1.852000	0.53769	0.462000	0.41574	CGC	C|0.734;T|0.266		0.756	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
MCOLN1	57192	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	7594484	7594484	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:7594484C>T	ENST00000264079.6	+	11	1370	c.1245C>T	c.(1243-1245)atC>atT	p.I415I		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	415					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGATCCTCATCGCCACACTGC	0.662																																					p.I415I		.											.	MCOLN1-153	0			c.C1245T						.						101.0	76.0	84.0					19																	7594484		2203	4300	6503	SO:0001819	synonymous_variant	57192	exon11			CCTCATCGCCACA	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1245C>T	19.37:g.7594484C>T		135	1		110	45	NM_020533	0	0	0	0	0	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	ENST00000264079.6	37	CCDS12180.1																																																																																			.		0.662	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2	NM_020533	
ZNF799	90576	ucsc.edu	37	19	12501907	12501907	+	Silent	SNP	A	A	G	rs556226523	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:12501907A>G	ENST00000430385.3	-	4	1505	c.1305T>C	c.(1303-1305)tcT>tcC	p.S435S	ZNF799_ENST00000419318.1_Silent_p.S403S|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCCTTCGAAGAGAACTGGAAA	0.368													A|||	35	0.00698882	0.0166	0.0	5008	,	,		23529	0.0		0.003	False		,,,				2504	0.0102				p.S435S		.											.	ZNF799-74	0			c.T1305C						.						101.0	104.0	103.0					19																	12501907		2203	4300	6503	SO:0001819	synonymous_variant	90576	exon4			TCGAAGAGAACTG	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1305T>C	19.37:g.12501907A>G		108	4		62	8	NM_001080821	0	0	0	0	0		Silent	SNP	ENST00000430385.3	37	CCDS45989.1																																																																																			.		0.368	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ATP13A1	57130	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	19764811	19764811	+	Silent	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:19764811G>A	ENST00000357324.6	-	14	1982	c.1956C>T	c.(1954-1956)gcC>gcT	p.A652A	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Silent_p.A534A	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	652						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCCCCTTCACGGCCGCGATGT	0.637																																					p.A652A	Esophageal Squamous(142;920 1789 9047 14684 24777)	.											.	ATP13A1-138	0			c.C1956T						.						27.0	30.0	29.0					19																	19764811		2202	4297	6499	SO:0001819	synonymous_variant	57130	exon14			CTTCACGGCCGCG	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1956C>T	19.37:g.19764811G>A		48	0		42	13	NM_020410	0	0	0	0	0	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2																																																																																			.		0.637	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000306065.4_5'Flank|ANKRD27_ENST00000587352.1_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	0	0		12	12	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
NPHS1	4868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36342537	36342537	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:36342537C>T	ENST00000378910.5	-	2	95	c.96G>A	c.(94-96)cgG>cgA	p.R32R	NPHS1_ENST00000353632.6_Silent_p.R32R|NPHS1_ENST00000591817.1_5'Flank	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	32	Ig-like C2-type 1.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCAGAAGCCCCGGGGAACGG	0.642																																					p.R32R		.											.	NPHS1-49	0			c.G96A						.						18.0	20.0	19.0					19																	36342537		2203	4300	6503	SO:0001819	synonymous_variant	4868	exon2			GAAGCCCCGGGGA		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.96G>A	19.37:g.36342537C>T		173	0		307	61	NM_004646	0	0	0	0	0	A6NDH2|C3RX61	Silent	SNP	ENST00000378910.5	37	CCDS32996.1																																																																																			.		0.642	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
SYNE4	163183	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36494356	36494364	+	In_Frame_Del	DEL	GAGGAGGAA	GAGGAGGAA	-			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GAGGAGGAA	GAGGAGGAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:36494356_36494364delGAGGAGGAA	ENST00000324444.3	-	8	1201_1209	c.1090_1098delTTCCTCCTC	c.(1090-1098)ttcctcctcdel	p.FLL364del	SYNE4_ENST00000340477.5_In_Frame_Del_p.FLL251del	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	364	KASH. {ECO:0000255|PROSITE- ProRule:PRU00385}.				establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											CACCCACCaggaggaggaagaggaggaag	0.584																																					p.364_366del		.											.	.	0			c.1090_1098del						.			0,3832		0,0,1916						4.0	0.8			34	4,7964		1,2,3981	no	coding	C19orf46	NM_001039876.1		1,2,5897	A1A1,A1R,RR		0.0502,0.0,0.0339				4,11796				SO:0001651	inframe_deletion	163183	exon8			CACCAGGAGGAGG	BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.1090_1098delTTCCTCCTC	19.37:g.36494365_36494373delGAGGAGGAA	ENSP00000316130:p.Phe364_Leu366del	139	0		186	19	NM_001039876	0	0	0	0	0	A8MRS0|A8MYE3|Q7Z7L3	In_Frame_Del	DEL	ENST00000324444.3	37	CCDS42553.1																																																																																			.		0.584	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109525.3	NM_001039876	
CAPNS1	826	broad.mit.edu	37	19	36633865	36633865	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:36633865C>T	ENST00000246533.3	+	5	986	c.388C>T	c.(388-390)Cga>Tga	p.R130*	CAPNS1_ENST00000587718.1_Nonsense_Mutation_p.R130*|CAPNS1_ENST00000588780.1_Nonsense_Mutation_p.R130*|CAPNS1_ENST00000588815.1_Nonsense_Mutation_p.R130*|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000590874.1_Nonsense_Mutation_p.R100*|CAPNS1_ENST00000589146.1_Intron	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	130					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGTTGTGACACGACGTAAGTG	0.537																																					p.R130X	Esophageal Squamous(129;1541 1691 5780 18353 34150)	.											.	CAPNS1-90	0			c.C388T						.						131.0	112.0	118.0					19																	36633865		2203	4300	6503	SO:0001587	stop_gained	826	exon5			GTGACACGACGTA	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.388C>T	19.37:g.36633865C>T	ENSP00000246533:p.Arg130*	173	0		313	6	NM_001749	0	0	0	0	0	A8K0P1|Q8WTX3|Q96EW0	Nonsense_Mutation	SNP	ENST00000246533.3	37	CCDS12489.1	.	.	.	.	.	.	.	.	.	.	c	37	6.326432	0.97476	.	.	ENSG00000126247	ENST00000246533	.	.	.	4.85	3.8	0.43715	.	0.071261	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	10.4944	0.44768	0.3526:0.6474:0.0:0.0	.	.	.	.	X	130	.	ENSP00000246533:R130X	R	+	1	2	CAPNS1	41325705	0.974000	0.33945	1.000000	0.80357	0.948000	0.59901	2.415000	0.44635	1.372000	0.46190	0.655000	0.94253	CGA	.		0.537	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2		
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000602238.1_5'Flank|RINL_ENST00000340740.3_Missense_Mutation_p.P288L			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	0	0		50	48	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
LTBP4	8425	broad.mit.edu	37	19	41119074	41119074	+	Silent	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:41119074G>T	ENST00000308370.7	+	19	2604	c.2604G>T	c.(2602-2604)gcG>gcT	p.A868A	LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000396819.3_Silent_p.A801A|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Silent_p.A321A|LTBP4_ENST00000204005.9_Silent_p.A831A	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	868	Cys-rich.|EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.A868A(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTACCGGGCGCCGTCGGGTC	0.692																																					.		.											.	LTBP4-93	1	Substitution - coding silent(1)	prostate(1)	.						.						14.0	15.0	14.0					19																	41119074		1885	4101	5986	SO:0001819	synonymous_variant	8425	.			CCGGGCGCCGTCG	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2604G>T	19.37:g.41119074G>T		31	0		175	16	.	0	0	0	0	0	O00508|O75412|O75413	Silent	SNP	ENST00000308370.7	37																																																																																				.		0.692	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
C19orf54	284325	hgsc.bcm.edu;broad.mit.edu	37	19	41248646	41248647	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:41248646_41248647delTG	ENST00000378313.2	-	6	866_867	c.747_748delCA	c.(745-750)cccagtfs	p.S250fs	C19orf54_ENST00000594163.1_5'Flank|C19orf54_ENST00000339153.3_Frame_Shift_Del_p.S78fs|C19orf54_ENST00000598485.2_Intron|C19orf54_ENST00000470681.1_3'UTR|C19orf54_ENST00000598729.1_Frame_Shift_Del_p.S78fs	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	250										breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TAGCCGAGACTGGGCACAGCCC	0.673																																					p.249_250del		.											.	.	0			c.747_748del						.																																			SO:0001589	frameshift_variant	284325	exon6			CGAGACTGGGCAC	AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.747_748delCA	19.37:g.41248646_41248647delTG	ENSP00000367564:p.Ser250fs	119	0		239	0	NM_198476	0	0	0	0	0	A8MSZ5|B4DNU7	Frame_Shift_Del	DEL	ENST00000378313.2	37	CCDS12564.2																																																																																			.		0.673	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316701.1	NM_198476	
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		0	0		9	6	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
PRR12	57479	hgsc.bcm.edu	37	19	50104897	50104897	+	Missense_Mutation	SNP	C	C	T	rs189937355	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:50104897C>T	ENST00000418929.2	+	6	4507	c.4495C>T	c.(4495-4497)Ccg>Tcg	p.P1499S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		accaccgccaccgccgctgcc	0.771													c|||	32	0.00638978	0.0008	0.0043	5008	,	,		6634	0.0		0.0249	False		,,,				2504	0.0031				p.P1499S		.											.	PRR12-70	0			c.C4495T						.	C	SER/PRO	12,2760		0,12,1374	2.0	4.0	3.0		4495	3.2	0.0	19		3	134,6078		1,132,2973	no	missense	PRR12	NM_020719.1	74	1,144,4347	TT,TC,CC		2.1571,0.4329,1.6251	benign	1499/2037	50104897	146,8838	1386	3106	4492	SO:0001583	missense	57479	exon6			CCGCCACCGCCGC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4495C>T	19.37:g.50104897C>T	ENSP00000394510:p.Pro1499Ser	2	0		20	13	NM_020719	0	0	0	0	0	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	30	0.013736263736263736	0	0.0	5	0.013812154696132596	0	0.0	25	0.032981530343007916	c	6.729	0.503296	0.12822	0.004329	0.021571	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	3.24	3.24	0.37175	.	.	.	.	.	T	0.09247	0.0228	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.05989	-1.0852	7	0.30078	T	0.28	.	5.0687	0.14594	0.0:0.7427:0.0:0.2573	.	1499	Q9ULL5-3	.	S	1499;679;679	.	ENSP00000246798:P679S	P	+	1	0	PRR12	54796709	0.005000	0.15991	0.005000	0.12908	0.003000	0.03518	-0.209000	0.09358	1.642000	0.50584	0.313000	0.20887	CCG	C|0.986;T|0.014		0.771	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		16	16	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
TSEN34	79042	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	54695770	54695770	+	Missense_Mutation	SNP	G	G	A	rs373921569		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:54695770G>A	ENST00000396383.1	+	3	753	c.442G>A	c.(442-444)Gat>Aat	p.D148N	MBOAT7_ENST00000245615.1_5'Flank|MBOAT7_ENST00000391754.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|MBOAT7_ENST00000474910.1_5'Flank|TSEN34_ENST00000429671.2_Missense_Mutation_p.D148N|TSEN34_ENST00000302937.4_Missense_Mutation_p.D148N|MBOAT7_ENST00000338624.6_5'Flank|MBOAT7_ENST00000431666.2_5'Flank|TSEN34_ENST00000396388.2_Missense_Mutation_p.D148N			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	148					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGCCAAAGAGGATGAGACCAG	0.592																																					p.D148N	Esophageal Squamous(37;841 964 4869 42824)	.											.	TSEN34-90	0			c.G442A						.						45.0	51.0	49.0					19																	54695770		2043	4173	6216	SO:0001583	missense	79042	exon3			AAAGAGGATGAGA	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.442G>A	19.37:g.54695770G>A	ENSP00000379667:p.Asp148Asn	89	0		153	13	NM_024075	0	0	0	0	0	A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Missense_Mutation	SNP	ENST00000396383.1	37	CCDS42609.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.208802	0.00292	.	.	ENSG00000170892	ENST00000455798;ENST00000456872;ENST00000302937;ENST00000429671;ENST00000396383;ENST00000396388	T;T;T;T;T;T	0.64085	-0.08;-0.04;-0.03;-0.04;-0.03;-0.03	3.8	0.526	0.17078	.	2.074600	0.01597	N	0.021866	T	0.39091	0.1065	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24512	-1.0158	10	0.10902	T	0.67	.	5.619	0.17448	0.6157:0.0:0.3843:0.0	.	148;148	E7EQB3;Q9BSV6	.;SEN34_HUMAN	N	148;151;148;148;148;148	ENSP00000400743:D148N;ENSP00000408689:D151N;ENSP00000305524:D148N;ENSP00000397402:D148N;ENSP00000379667:D148N;ENSP00000379671:D148N	ENSP00000305524:D148N	D	+	1	0	TSEN34	59387582	0.001000	0.12720	0.002000	0.10522	0.006000	0.05464	0.159000	0.16442	0.160000	0.19432	-0.340000	0.08031	GAT	.		0.592	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075	
LILRB3	11025	ucsc.edu	37	19	54725992	54725992	+	Silent	SNP	G	G	A	rs148339740	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:54725992G>A	ENST00000391750.1	-	5	502	c.366C>T	c.(364-366)agC>agT	p.S122S	LILRB3_ENST00000407860.2_Silent_p.S122S|LILRB3_ENST00000245620.9_Silent_p.S122S|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000424807.1_Silent_p.S122S|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000346401.6_Silent_p.S122S|LILRB3_ENST00000469273.1_5'Flank|LILRA6_ENST00000440558.2_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	122	Ig-like C2-type 2.		S -> N (in dbSNP:rs3826750). {ECO:0000269|PubMed:9278324}.		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGTGGGTTTGCTGTAGGCTC	0.592													.|||	959	0.191494	0.1029	0.1744	5008	,	,		13407	0.1071		0.2495	False		,,,				2504	0.3507				p.S122S		.											.	LILRB3-93	0			c.C366T						.						62.0	40.0	48.0					19																	54725992		2132	3919	6051	SO:0001819	synonymous_variant	11025	exon4			GGGTTTGCTGTAG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.366C>T	19.37:g.54725992G>A		91	9		103	16	NM_006864	0	0	0	0	0	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			G|0.881;A|0.119		0.592	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
PTPRH	5794	bcgsc.ca	37	19	55715359	55715359	+	Missense_Mutation	SNP	A	A	G	rs45493898	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:55715359A>G	ENST00000376350.3	-	5	699	c.677T>C	c.(676-678)cTg>cCg	p.L226P	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	226	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTCCCAGCTCAGGGAGATGGA	0.532													A|||	70	0.0139776	0.0015	0.0144	5008	,	,		16370	0.0		0.0537	False		,,,				2504	0.0041				p.L226P		.											.	PTPRH-138	0			c.T677C						.	A	,PRO/LEU	28,4378	32.6+/-62.9	0,28,2175	97.0	80.0	86.0		,677	3.4	0.0	19	dbSNP_127	86	360,8240	118.1+/-177.6	7,346,3947	yes	intron,missense	PTPRH	NM_001161440.1,NM_002842.3	,98	7,374,6122	GG,GA,AA		4.186,0.6355,2.9832	,probably-damaging	,226/1116	55715359	388,12618	2203	4300	6503	SO:0001583	missense	5794	exon5			CAGCTCAGGGAGA		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.677T>C	19.37:g.55715359A>G	ENSP00000365528:p.Leu226Pro	50	0		71	5	NM_002842	0	0	0	0	0	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	55	0.025183150183150184	1	0.0020325203252032522	7	0.019337016574585635	0	0.0	47	0.06200527704485488	A	14.69	2.610037	0.46527	0.006355	0.04186	ENSG00000080031	ENST00000376350	T	0.08720	3.06	3.44	3.44	0.39384	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.397404	0.14892	N	0.292365	T	0.03348	0.0097	M	0.83012	2.62	0.46901	D	0.999242	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.00087	-1.2093	10	0.72032	D	0.01	.	8.8474	0.35179	1.0:0.0:0.0:0.0	rs45493898	48;226	Q9HD43-2;Q9HD43	.;PTPRH_HUMAN	P	226	ENSP00000365528:L226P	ENSP00000365528:L226P	L	-	2	0	PTPRH	60407171	0.147000	0.22687	0.020000	0.16555	0.003000	0.03518	3.737000	0.55060	1.512000	0.48834	0.413000	0.27773	CTG	A|0.972;G|0.028		0.532	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	0	0		22	6	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
ZNF784	147808	hgsc.bcm.edu	37	19	56133261	56133261	+	Silent	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:56133261G>A	ENST00000325351.4	-	2	867	c.828C>T	c.(826-828)caC>caT	p.H276H	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	276					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GCCCCGGCCCGTGGAAGTGGG	0.716																																					p.H276H		.											.	ZNF784-68	0			c.C828T						.						21.0	18.0	19.0					19																	56133261		2198	4296	6494	SO:0001819	synonymous_variant	147808	exon2			CGGCCCGTGGAAG	AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.828C>T	19.37:g.56133261G>A		5	0		35	8	NM_203374	0	0	0	0	0		Silent	SNP	ENST00000325351.4	37	CCDS12930.1																																																																																			.		0.716	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453355.2	NM_203374	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	2	2		30	30	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3391826	3391826	+	Silent	SNP	C	C	T	rs11127423	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:3391826C>T	ENST00000324266.5	+	2	627	c.432C>T	c.(430-432)gcC>gcT	p.A144A	TRAPPC12_ENST00000382110.2_Silent_p.A144A	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	144					vesicle-mediated transport (GO:0016192)												GCAGCGAAGCCGCGCGCCCGG	0.781													C|||	1528	0.305112	0.2352	0.1628	5008	,	,		6707	0.4048		0.2435	False		,,,				2504	0.4611				p.A144A		.											.	.	0			c.C432T						.						2.0	2.0	2.0					2																	3391826		1308	2977	4285	SO:0001819	synonymous_variant	51112	exon2			CGAAGCCGCGCGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.432C>T	2.37:g.3391826C>T		0	0		5	4	NM_016030	0	0	0	0	0	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1																																																																																			C|0.719;T|0.281		0.781	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
RHOB	388	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	20647308	20647308	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:20647308G>C	ENST00000272233.4	+	1	474	c.82G>C	c.(82-84)Gac>Cac	p.D28H		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	28					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	GTTCAGTAAGGACGAGTTCCC	0.662																																					p.D28H		.											.	RHOB-848	0			c.G82C						.						120.0	119.0	120.0					2																	20647308		2203	4300	6503	SO:0001583	missense	388	exon1			AGTAAGGACGAGT		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.82G>C	2.37:g.20647308G>C	ENSP00000272233:p.Asp28His	128	1		227	55	NM_004040	0	0	0	0	0	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	37	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.662099	0.67700	.	.	ENSG00000143878	ENST00000272233	T	0.71461	-0.57	5.74	5.74	0.90152	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	T	0.80336	0.4604	L	0.55103	1.725	0.80722	D	1	D	0.54047	0.964	P	0.58520	0.84	T	0.80926	-0.1164	10	0.72032	D	0.01	-19.4386	19.9145	0.97053	0.0:0.0:1.0:0.0	.	28	P62745	RHOB_HUMAN	H	28	ENSP00000272233:D28H	ENSP00000272233:D28H	D	+	1	0	RHOB	20510789	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	9.674000	0.98633	2.709000	0.92574	0.655000	0.94253	GAC	.		0.662	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
RMDN2	151393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	38216713	38216713	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:38216713A>T	ENST00000406384.1	+	6	1015	c.821A>T	c.(820-822)gAg>gTg	p.E274V	RMDN2_ENST00000407257.1_Missense_Mutation_p.E452V|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000354545.2_Missense_Mutation_p.E274V|RMDN2_ENST00000417700.2_Missense_Mutation_p.E129V|RMDN2_ENST00000234195.3_Missense_Mutation_p.E452V	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	274						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											TATGTATCTGAGTTTGAGGGT	0.343																																					p.E452V		.											.	.	0			c.A1355T						.						174.0	159.0	164.0					2																	38216713		2203	4300	6503	SO:0001583	missense	151393	exon6			TATCTGAGTTTGA	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.821A>T	2.37:g.38216713A>T	ENSP00000386004:p.Glu274Val	38	0		37	7	NM_144713	0	0	0	0	0	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	ENST00000406384.1	37	CCDS54351.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.7|23.7	4.449360|4.449360	0.84101|0.84101	.|.	.|.	ENSG00000115841|ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857|ENST00000425641	T;T;T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61;0.61;0.61|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.116777|.	0.56097|.	D|.	0.000028|.	T|.	0.77638|.	0.4160|.	M|M	0.84326|0.84326	2.69|2.69	0.45762|0.45762	D|D	0.998651|0.998651	D;P;P;P|.	0.64830|.	0.994;0.903;0.903;0.943|.	D;P;P;P|.	0.66847|.	0.947;0.65;0.65;0.65|.	T|.	0.79769|.	-0.1664|.	10|.	0.72032|.	D|.	0.01|.	-9.7342|-9.7342	14.086|14.086	0.64957|0.64957	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	452;129;274;129|.	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3|.	.;.;RMD2_HUMAN;.|.	V|C	274;274;452;129;452;129|8	ENSP00000346549:E274V;ENSP00000386004:E274V;ENSP00000385049:E452V;ENSP00000392977:E129V;ENSP00000234195:E452V;ENSP00000416367:E129V|.	ENSP00000234195:E452V|.	E|X	+|+	2|3	0|0	FAM82A1|FAM82A1	38070217|38070217	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.253000|5.253000	0.65452|0.65452	2.216000|2.216000	0.71823|0.71823	0.528000|0.528000	0.53228|0.53228	GAG|TGA	.		0.343	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
C2orf81	388963	broad.mit.edu	37	2	74643337	74643337	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:74643337A>C	ENST00000290390.5	-	2	367	c.59T>G	c.(58-60)gTg>gGg	p.V20G	C2orf81_ENST00000517883.1_5'UTR	NM_001145054.1	NP_001138526.1	A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	14										endometrium(3)|kidney(1)	4						GGACCGGGTCACCCCGCGGTC	0.597																																					p.V20G		.											.	.	0			c.T59G						.						17.0	23.0	22.0					2																	74643337		692	1591	2283	SO:0001583	missense	388963	exon2			CGGGTCACCCCGC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000290390.5:c.59T>G	2.37:g.74643337A>C	ENSP00000290390:p.Val20Gly	52	5		90	19	NM_001145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000290390.5	37		.	.	.	.	.	.	.	.	.	.	A	9.492	1.100890	0.20552	.	.	ENSG00000159239	ENST00000290390;ENST00000517896;ENST00000518401	.	.	.	4.99	-1.8	0.07907	.	1.539860	0.04123	N	0.316611	T	0.46678	0.1405	L	0.50333	1.59	0.34144	D	0.666743	B	0.28850	0.225	B	0.30316	0.114	T	0.51020	-0.8758	9	0.72032	D	0.01	-7.1038	6.5718	0.22543	0.3534:0.0:0.4986:0.148	.	20	G3XAA6	.	G	20;20;45	.	ENSP00000290390:V20G	V	-	2	0	C2orf81	74496845	0.202000	0.23423	0.217000	0.23759	0.970000	0.65996	0.435000	0.21510	-0.075000	0.12798	0.383000	0.25322	GTG	.		0.597	C2orf81-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001145054	
HTRA2	27429	hgsc.bcm.edu	37	2	74757554	74757554	+	Missense_Mutation	SNP	G	G	T	rs72470544	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:74757554G>T	ENST00000258080.3	+	1	1051	c.421G>T	c.(421-423)Gct>Tct	p.A141S	AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000467961.1_Intron|HTRA2_ENST00000352222.3_Missense_Mutation_p.A141S	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	141			A -> S (polymorphism; associated with a 2.15-fold increased risk of PD; reduced protease activity; dbSNP:rs72470544). {ECO:0000269|PubMed:15961413, ECO:0000269|PubMed:18401856}.		adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CCCGCCGCCCGCTTCTCCCCG	0.672													g|||	61	0.0121805	0.003	0.0144	5008	,	,		12081	0.0		0.0278	False		,,,				2504	0.0194				p.A141S		.											.	HTRA2-91	0			c.G421T	GRCh37	CM052354	HTRA2	M	rs72470544	.		SER/ALA,SER/ALA	17,4251		0,17,2117	8.0	10.0	9.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	421,421	-1.0	0.8	2	dbSNP_130	9	214,8194		3,208,3993	no	missense,missense	HTRA2	NM_013247.4,NM_145074.2	99,99	3,225,6110	TT,TG,GG		2.5452,0.3983,1.8223	benign,benign	141/459,141/362	74757554	231,12445	2134	4204	6338	SO:0001583	missense	27429	exon1			CCGCCCGCTTCTC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.421G>T	2.37:g.74757554G>T	ENSP00000258080:p.Ala141Ser	2	0		12	5	NM_013247	0	0	0	0	0	Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	ENST00000258080.3	37	CCDS1951.1	34	0.015567765567765568	1	0.0020325203252032522	6	0.016574585635359115	0	0.0	27	0.03562005277044855	g	3.126	-0.179462	0.06380	0.003983	0.025452	ENSG00000115317	ENST00000258080;ENST00000352222;ENST00000437202	T;T;T	0.12984	2.63;2.63;2.63	5.46	-1.04	0.10068	.	0.657026	0.16618	N	0.206604	T	0.00695	0.0023	N	0.01874	-0.695	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.41142	-0.9525	10	0.08599	T	0.76	-1.03	3.5815	0.07955	0.5223:0.0:0.1797:0.298	.	141;141;141;141	A8K7G2;O43464-3;O43464-2;O43464	.;.;.;HTRA2_HUMAN	S	141;141;128	ENSP00000258080:A141S;ENSP00000312893:A141S;ENSP00000399166:A128S	ENSP00000258080:A141S	A	+	1	0	HTRA2	74611062	0.000000	0.05858	0.782000	0.31804	0.294000	0.27393	-0.504000	0.06375	0.044000	0.15775	-0.689000	0.03729	GCT	G|0.983;T|0.017		0.672	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
ATOH8	84913	hgsc.bcm.edu	37	2	85981761	85981761	+	Missense_Mutation	SNP	T	T	C	rs17851881	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:85981761T>C	ENST00000306279.3	+	1	745	c.449T>C	c.(448-450)cTg>cCg	p.L150P		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	150	Pro-rich.		L -> P (in dbSNP:rs17851881). {ECO:0000269|PubMed:12419857, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGCCGGGTCTGCGTCCTCGC	0.786													T|||	2860	0.571086	0.4758	0.6383	5008	,	,		10130	0.7421		0.6093	False		,,,				2504	0.4366				p.L150P		.											.	ATOH8-90	0			c.T449C						.	T	PRO/LEU	1790,1646		523,744,451	5.0	7.0	6.0		449	2.5	0.8	2	dbSNP_123	6	3836,2834		1197,1442,696	no	missense	ATOH8	NM_032827.6	98	1720,2186,1147	CC,CT,TT		42.4888,47.9045,44.3301	possibly-damaging	150/322	85981761	5626,4480	1718	3335	5053	SO:0001583	missense	84913	exon1			CGGGTCTGCGTCC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.449T>C	2.37:g.85981761T>C	ENSP00000304676:p.Leu150Pro	0	0		5	5	NM_032827	0	0	0	0	0	Q504S2|Q659B0	Missense_Mutation	SNP	ENST00000306279.3	37	CCDS1985.1	1347	0.6167582417582418	233	0.4735772357723577	232	0.6408839779005525	433	0.756993006993007	449	0.5923482849604221	T	13.11	2.140335	0.37825	0.520955	0.575112	ENSG00000168874	ENST00000306279	D	0.94650	-3.48	3.6	2.45	0.29901	.	0.166402	0.23793	N	0.044509	T	0.00012	0.0000	N	0.24115	0.695	0.26047	P	0.9815344	B;B	0.10296	0.003;0.001	B;B	0.08055	0.002;0.003	T	0.45352	-0.9267	9	0.72032	D	0.01	-10.2738	5.5522	0.17097	0.0:0.126:0.0:0.874	rs17851881	150;150	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	P	150	ENSP00000304676:L150P	ENSP00000304676:L150P	L	+	2	0	ATOH8	85835272	0.913000	0.31002	0.756000	0.31282	0.353000	0.29299	1.683000	0.37638	0.758000	0.33059	0.374000	0.22700	CTG	T|0.382;C|0.618		0.786	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
TEKT4	150483	broad.mit.edu	37	2	95537377	95537377	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:95537377C>A	ENST00000295201.4	+	1	190	c.53C>A	c.(52-54)gCc>gAc	p.A18D	TEKT4_ENST00000427593.2_Missense_Mutation_p.A18D|AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	18					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						TACGACGTGGCCCGTAACACG	0.667																																					p.A18D		.											.	TEKT4-155	0			c.C53A						.						17.0	20.0	19.0					2																	95537377		2173	4246	6419	SO:0001583	missense	150483	exon1			ACGTGGCCCGTAA	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.53C>A	2.37:g.95537377C>A	ENSP00000295201:p.Ala18Asp	109	1		369	14	NM_144705	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	13.19	2.163471	0.38217	.	.	ENSG00000163060	ENST00000295201;ENST00000427593	T;T	0.12672	3.8;2.66	1.85	0.697	0.18081	.	0.148875	0.43260	D	0.000583	T	0.06050	0.0157	N	0.08118	0	0.39270	D	0.964368	P	0.49635	0.926	P	0.44597	0.454	T	0.43734	-0.9373	10	0.16896	T	0.51	-0.2223	6.9409	0.24492	0.2688:0.7311:0.0:0.0	.	18	Q8WW24	TEKT4_HUMAN	D	18	ENSP00000295201:A18D;ENSP00000407596:A18D	ENSP00000295201:A18D	A	+	2	0	TEKT4	94901104	0.315000	0.24571	0.812000	0.32479	0.129000	0.20672	0.555000	0.23422	1.021000	0.39600	0.460000	0.39030	GCC	.		0.667	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
CNNM3	26505	hgsc.bcm.edu	37	2	97482167	97482167	+	Silent	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:97482167A>G	ENST00000305510.3	+	1	181	c.153A>G	c.(151-153)ggA>ggG	p.G51G	CNNM3_ENST00000377060.3_Silent_p.G51G|RP11-353K11.1_ENST00000608609.1_lincRNA	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3	51					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						GGGTACGCGGAGGGGCGGCGC	0.771																																					p.G51G		.											.	CNNM3-91	0			c.A153G						.						2.0	3.0	3.0					2																	97482167		1458	2999	4457	SO:0001819	synonymous_variant	26505	exon1			ACGCGGAGGGGCG	AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	ENST00000305510.3:c.153A>G	2.37:g.97482167A>G		1	0		49	23	NM_199078	0	0	0	0	0	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	Silent	SNP	ENST00000305510.3	37	CCDS2025.1																																																																																			.		0.771	CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252952.2	NM_017623	
ZC3H6	376940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113079374	113079374	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:113079374T>C	ENST00000409871.1	+	8	1419	c.1018T>C	c.(1018-1020)Tac>Cac	p.Y340H	ZC3H6_ENST00000343936.4_Missense_Mutation_p.Y340H	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	340							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						AGCAAAATGTTACCAGGGAGA	0.289																																					p.Y340H		.											.	ZC3H6-93	0			c.T1018C						.						55.0	48.0	50.0					2																	113079374		1797	4066	5863	SO:0001583	missense	376940	exon8			AAATGTTACCAGG	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.1018T>C	2.37:g.113079374T>C	ENSP00000386764:p.Tyr340His	114	0		126	33	NM_198581	0	0	0	0	0	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	37	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.027160	0.75390	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.42131	0.98;0.98	5.53	5.53	0.82687	Zinc finger, CCCH-type (2);	0.000000	0.85682	D	0.000000	T	0.55909	0.1950	L	0.41236	1.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52931	-0.8509	10	0.38643	T	0.18	-11.8959	15.9464	0.79796	0.0:0.0:0.0:1.0	.	340	P61129	ZC3H6_HUMAN	H	340;340;317	ENSP00000386764:Y340H;ENSP00000340298:Y340H	ENSP00000340298:Y340H	Y	+	1	0	ZC3H6	112795845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.223000	0.72356	0.519000	0.50382	TAC	.		0.289	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
HS6ST1	9394	bcgsc.ca	37	2	129075961	129075961	+	Silent	SNP	T	T	C	rs61732881	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:129075961T>C	ENST00000259241.6	-	1	190	c.177A>G	c.(175-177)acA>acG	p.T59T	HS6ST1_ENST00000494089.1_5'UTR	NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	59					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GGGGGTCGGGTGTGGGGAACA	0.667													C|||	3623	0.723442	0.8971	0.7839	5008	,	,		8563	0.8304		0.6044	False		,,,				2504	0.4581				p.T59T		.											.	HS6ST1-91	0			c.A177G						.						7.0	15.0	12.0					2																	129075961		1621	3941	5562	SO:0001819	synonymous_variant	9394	exon1			GTCGGGTGTGGGG	AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.177A>G	2.37:g.129075961T>C		33	12		128	70	NM_004807	0	0	0	0	0	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Silent	SNP	ENST00000259241.6	37	CCDS42748.1																																																																																			T|0.332;C|0.668		0.667	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
ABCB11	8647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169853195	169853195	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:169853195T>C	ENST00000263817.6	-	6	551	c.427A>G	c.(427-429)Agt>Ggt	p.S143G		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	143	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GCATAGTAACTGGCAAATTTG	0.388																																					p.S143G		.											.	ABCB11-139	0			c.A427G						.						77.0	74.0	75.0					2																	169853195		1865	4107	5972	SO:0001583	missense	8647	exon6			AGTAACTGGCAAA	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.427A>G	2.37:g.169853195T>C	ENSP00000263817:p.Ser143Gly	91	0		81	20	NM_003742	0	0	0	0	0	Q53TL2|Q9UNB2	Missense_Mutation	SNP	ENST00000263817.6	37	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.961683	0.34659	.	.	ENSG00000073734	ENST00000263817	D	0.89485	-2.52	5.18	0.924	0.19418	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.672934	0.16792	N	0.199327	T	0.69097	0.3073	N	0.02960	-0.455	0.18873	N	0.999986	B	0.02656	0.0	B	0.01281	0.0	T	0.58165	-0.7684	10	0.37606	T	0.19	-11.8405	3.3889	0.07282	0.2447:0.2465:0.0:0.5088	.	143	O95342	ABCBB_HUMAN	G	143	ENSP00000263817:S143G	ENSP00000263817:S143G	S	-	1	0	ABCB11	169561441	0.174000	0.23070	0.571000	0.28486	0.877000	0.50540	0.611000	0.24268	-0.035000	0.13691	0.528000	0.53228	AGT	.		0.388	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
TMEM194B	100131211	hgsc.bcm.edu	37	2	191399378	191399378	+	Missense_Mutation	SNP	C	C	G	rs13412879	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:191399378C>G	ENST00000409150.3	-	1	70	c.4G>C	c.(4-6)Ggg>Cgg	p.G2R	AC093388.3_ENST00000457407.1_RNA|TMEM194B_ENST00000492292.1_5'Flank	NM_001142645.1	NP_001136117.1	A6NFY4	T194B_HUMAN	transmembrane protein 194B	2						integral component of membrane (GO:0016021)											TGGCGCGGCCCCATTTCGTTA	0.736													G|||	715	0.142772	0.1271	0.0994	5008	,	,		11081	0.1389		0.1998	False		,,,				2504	0.1401				p.G2R		.											.	.	0			c.G4C						.						1.0	3.0	2.0					2																	191399378		437	1202	1639	SO:0001583	missense	100131211	exon1			GCGGCCCCATTTC		CCDS46476.1	2q32.2	2008-06-10			ENSG00000189362	ENSG00000189362			33700	protein-coding gene	gene with protein product							Standard	NM_001142645		Approved		uc010zgf.2	A6NFY4	OTTHUMG00000154454	ENST00000409150.3:c.4G>C	2.37:g.191399378C>G	ENSP00000386292:p.Gly2Arg	2	0		8	6	NM_001142645	0	0	0	0	0	B4DYG6	Missense_Mutation	SNP	ENST00000409150.3	37	CCDS46476.1	355	0.16254578754578755	65	0.13211382113821138	50	0.13812154696132597	92	0.16083916083916083	148	0.19525065963060687	G	0.006	-2.115233	0.00349	.	.	ENSG00000189362	ENST00000409150	T	0.41400	1.0	3.19	0.247	0.15521	.	1.634660	0.05384	N	0.537665	T	0.00012	0.0000	N	0.08118	0	0.51767	P	7.00000000000145E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.11036	-1.0604	9	0.06099	T	0.92	.	3.8823	0.09083	0.1049:0.1644:0.5731:0.1577	rs13412879	2	A6NFY4	T194B_HUMAN	R	2	ENSP00000386292:G2R	ENSP00000340087:G2R	G	-	1	0	TMEM194B	191107623	0.000000	0.05858	0.416000	0.26546	0.005000	0.04900	-1.034000	0.03567	-0.400000	0.07656	-3.777000	0.00021	GGG	C|0.836;G|0.164		0.736	TMEM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335299.1	XM_001723498	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216299458	216299458	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:216299458C>T	ENST00000359671.1	-	2	503	c.238G>A	c.(238-240)Gga>Aga	p.G80R	FN1_ENST00000446046.1_Missense_Mutation_p.G80R|FN1_ENST00000443816.1_Missense_Mutation_p.G80R|FN1_ENST00000356005.4_Missense_Mutation_p.G80R|FN1_ENST00000354785.4_Missense_Mutation_p.G80R|FN1_ENST00000323926.6_Missense_Mutation_p.G80R|FN1_ENST00000432072.2_Missense_Mutation_p.G80R|FN1_ENST00000426059.1_Missense_Mutation_p.G80R|AC012462.1_ENST00000412951.1_RNA|FN1_ENST00000336916.4_Missense_Mutation_p.G80R|FN1_ENST00000346544.3_Missense_Mutation_p.G80R|FN1_ENST00000357009.2_Missense_Mutation_p.G80R|FN1_ENST00000421182.1_Missense_Mutation_p.G80R|FN1_ENST00000345488.5_Missense_Mutation_p.G80R|FN1_ENST00000357867.4_Missense_Mutation_p.G80R			P02751	FINC_HUMAN	fibronectin 1	80	Fibrin- and heparin-binding 1.|Fibronectin type-I 1. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CGGCTTCCTCCATAACAAGTA	0.403																																					p.G80R		.											.	FN1-584	0			c.G238A						.						212.0	194.0	200.0					2																	216299458		2203	4300	6503	SO:0001583	missense	2335	exon2			TTCCTCCATAACA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.238G>A	2.37:g.216299458C>T	ENSP00000352696:p.Gly80Arg	75	0		135	19	NM_212476	0	0	0	0	0	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	35	5.572910	0.96553	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32;-3.32	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000002	D	0.96278	0.8786	L	0.60455	1.87	0.80722	D	1	D;D;P;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.808;0.992;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;P;P;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.642;0.862;0.986;0.992;0.998;0.994;0.986;0.986;1.0	D	0.95978	0.8975	10	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	80;80;80;80;80;80;80;80;80;80;80	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	R	80	ENSP00000394423:G80R;ENSP00000323534:G80R;ENSP00000338200:G80R;ENSP00000350534:G80R;ENSP00000346839:G80R;ENSP00000352696:G80R;ENSP00000265312:G80R;ENSP00000273049:G80R;ENSP00000349509:G80R;ENSP00000410422:G80R;ENSP00000415018:G80R;ENSP00000399538:G80R;ENSP00000348285:G80R;ENSP00000398907:G80R	ENSP00000265313:G80R	G	-	1	0	FN1	216007703	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.463000	0.80869	2.882000	0.98803	0.655000	0.94253	GGA	.		0.403	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
SPHKAP	80309	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228883336	228883336	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr2:228883336C>T	ENST00000392056.3	-	7	2280	c.2234G>A	c.(2233-2235)aGg>aAg	p.R745K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.R745K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	745						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCTGTCTCCCTCCTTCTGAT	0.483																																					p.R745K		.											.	SPHKAP-167	0			c.G2234A						.						147.0	140.0	142.0					2																	228883336		2203	4300	6503	SO:0001583	missense	80309	exon7			GTCTCCCTCCTTC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2234G>A	2.37:g.228883336C>T	ENSP00000375909:p.Arg745Lys	109	1		145	30	NM_030623	0	0	0	0	0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	0.206	-1.040706	0.02013	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.10382	2.88;2.88	5.27	-2.41	0.06562	.	0.414668	0.27495	N	0.019103	T	0.04318	0.0119	N	0.20685	0.6	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.11329	0.001;0.006	T	0.44406	-0.9330	10	0.02654	T	1	.	7.3873	0.26891	0.0:0.263:0.1316:0.6053	.	745;745	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	K	745	ENSP00000375909:R745K;ENSP00000339886:R745K	ENSP00000339886:R745K	R	-	2	0	SPHKAP	228591580	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-0.687000	0.05156	-0.462000	0.06984	-0.373000	0.07131	AGG	.		0.483	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	CGG	CGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del		.											.	ZCCHC3-90	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del						.																																			SO:0001651	inframe_deletion	85364	exon1			ATGAGCCGGCGGC	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	3	3		20	20	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																			.		0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		13	13	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
CD93	22918	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23065458	23065458	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:23065458A>C	ENST00000246006.4	-	1	1519	c.1372T>G	c.(1372-1374)Tgg>Ggg	p.W458G		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	458	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCCAGCACCCAGCCTGGCAGG	0.637																																					p.W458G		.											.	CD93-153	0			c.T1372G						.						36.0	45.0	42.0					20																	23065458		2197	4299	6496	SO:0001583	missense	22918	exon1			GCACCCAGCCTGG	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1372T>G	20.37:g.23065458A>C	ENSP00000246006:p.Trp458Gly	59	1		132	28	NM_012072	0	0	0	0	0	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.464722	0.26335	.	.	ENSG00000125810	ENST00000246006	D	0.92858	-3.12	5.56	0.296	0.15757	EGF-like region, conserved site (1);EGF-like calcium-binding (1);	1.171960	0.06067	N	0.659358	D	0.90342	0.6978	M	0.80616	2.505	0.09310	N	1	P	0.42827	0.791	B	0.35240	0.198	T	0.78775	-0.2072	10	0.62326	D	0.03	-4.7086	7.0313	0.24969	0.4845:0.1231:0.0:0.3924	.	458	Q9NPY3	C1QR1_HUMAN	G	458	ENSP00000246006:W458G	ENSP00000246006:W458G	W	-	1	0	CD93	23013458	0.214000	0.23563	0.483000	0.27378	0.373000	0.29922	1.720000	0.38022	-0.250000	0.09555	-0.336000	0.08194	TGG	.		0.637	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		4	0		35	19	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
WISP2	8839	hgsc.bcm.edu	37	20	43348735	43348735	+	Silent	SNP	C	C	A	rs2296530	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:43348735C>A	ENST00000372868.2	+	3	601	c.258C>A	c.(256-258)ggC>ggA	p.G86G	WISP2_ENST00000372865.4_Silent_p.G86G|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000190983.4_Silent_p.G86G|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	86	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GACCCGGTGGCCGGGGGGCCC	0.706													C|||	1984	0.396166	0.4803	0.4452	5008	,	,		15685	0.3909		0.339	False		,,,				2504	0.3119				p.G86G		.											.	WISP2-130	0			c.C258A						.	C		1905,2317		492,921,698	5.0	5.0	5.0		258	5.5	0.1	20	dbSNP_100	5	2588,5598		519,1550,2024	no	coding-synonymous	WISP2	NM_003881.2		1011,2471,2722	AA,AC,CC		31.615,45.1208,36.2105		86/251	43348735	4493,7915	2111	4093	6204	SO:0001819	synonymous_variant	8839	exon2			CGGTGGCCGGGGG	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.258C>A	20.37:g.43348735C>A		0	0		16	9	NM_003881	0	0	0	0	0	B2R9N4|E1P612|Q6PEG3	Silent	SNP	ENST00000372868.2	37	CCDS13336.1																																																																																			C|0.615;A|0.385		0.706	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000243938.4_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000481847.1_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		0	0		21	21	NM_052951	0	0	0	0	0	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
KCNG1	3755	broad.mit.edu	37	20	49626376	49626376	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:49626376C>A	ENST00000371571.4	-	2	785	c.500G>T	c.(499-501)cGc>cTc	p.R167L	KCNG1_ENST00000506387.1_5'Flank|KCNG1_ENST00000396017.3_Missense_Mutation_p.R167L|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	167					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.R167H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CAGGTAGCGGCGCTTGCAGCA	0.687																																					p.R167L		.											.	KCNG1-515	1	Substitution - Missense(1)	urinary_tract(1)	c.G500T						.						39.0	40.0	40.0					20																	49626376		2203	4295	6498	SO:0001583	missense	3755	exon2			TAGCGGCGCTTGC	AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.500G>T	20.37:g.49626376C>A	ENSP00000360626:p.Arg167Leu	40	0		153	10	NM_002237	0	0	0	0	0	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874904	0.91664	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.65	4.7	0.59300	BTB/POZ-like (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.87547	2.89	0.53688	D	0.999975	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.96	T	0.75844	-0.3174	9	.	.	.	.	16.5941	0.84791	0.0:0.8696:0.1304:0.0	.	167;167	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	L	167	ENSP00000360626:R167L;ENSP00000379338:R167L;ENSP00000394075:R167L;ENSP00000394093:R167L	.	R	-	2	0	KCNG1	49059783	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.960000	0.63673	1.362000	0.46000	0.561000	0.74099	CGC	.		0.687	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237	
KCNQ2	3785	hgsc.bcm.edu	37	20	62038378	62038378	+	Silent	SNP	A	A	T	rs1801471	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:62038378A>T	ENST00000359125.2	-	17	2412	c.2238T>A	c.(2236-2238)ccT>ccA	p.P746P	KCNQ2_ENST00000354587.3_Silent_p.P754P|KCNQ2_ENST00000344462.4_Silent_p.P715P|KCNQ2_ENST00000370224.1_Silent_p.P754P|KCNQ2_ENST00000359689.1_Silent_p.P746P|KCNQ2_ENST00000357249.2_Silent_p.P728P|KCNQ2_ENST00000360480.3_Silent_p.P718P	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	746					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GCTCGTGGGCAGGCGGCGGCG	0.771													A|||	547	0.109225	0.003	0.1037	5008	,	,		11056	0.1319		0.0895	False		,,,				2504	0.2536				p.P746P		.											.	KCNQ2-92	0			c.T2238A						.	A	,,,	53,3435		0,53,1691	3.0	4.0	4.0		2154,2184,2238,2145	-9.9	0.0	20	dbSNP_89	4	477,6555		12,453,3051	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNQ2	NM_004518.4,NM_172106.1,NM_172107.2,NM_172108.3	,,,	12,506,4742	TT,TA,AA		6.7833,1.5195,5.038	,,,	718/845,728/855,746/873,715/842	62038378	530,9990	1744	3516	5260	SO:0001819	synonymous_variant	3785	exon17			GTGGGCAGGCGGC	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2238T>A	20.37:g.62038378A>T		0	0		10	5	NM_172107	0	0	0	0	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	CCDS13520.1																																																																																			A|0.189;T|0.811		0.771	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
HELZ2	85441	hgsc.bcm.edu	37	20	62194713	62194713	+	Missense_Mutation	SNP	A	A	C	rs3810486	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:62194713A>C	ENST00000467148.1	-	8	5531	c.5462T>G	c.(5461-5463)cTg>cGg	p.L1821R	HELZ2_ENST00000427522.2_Missense_Mutation_p.L1252R	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1821			L -> R (in dbSNP:rs3810486).		cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCACGGCCAGGGTGTGTGG	0.726													C|||	1226	0.244808	0.0575	0.1023	5008	,	,		15371	0.5923		0.1948	False		,,,				2504	0.2924				p.L1821R		.											.	.	0			c.T5462G						.	C	ARG/LEU,ARG/LEU	196,3498		4,188,1655	3.0	3.0	3.0		5462,3755	-2.5	0.0	20	dbSNP_107	3	895,6669		51,793,2938	no	missense,missense	PRIC285	NM_001037335.2,NM_033405.3	102,102	55,981,4593	CC,CA,AA		11.8324,5.3059,9.6909	benign,benign	1821/2650,1252/2081	62194713	1091,10167	1847	3782	5629	SO:0001583	missense	85441	exon9			ACGGCCAGGGTGT	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5462T>G	20.37:g.62194713A>C	ENSP00000417401:p.Leu1821Arg	3	0		52	27	NM_001037335	0	0	0	0	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	575	0.2632783882783883	23	0.046747967479674794	44	0.12154696132596685	352	0.6153846153846154	156	0.20580474934036938	C	7.173	0.588046	0.13812	0.053059	0.118324	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.79033	-1.23;-1.15	4.54	-2.49	0.06403	.	2.710140	0.01204	N	0.007649	T	0.00012	0.0000	N	0.00347	-1.61	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36261	-0.9755	9	0.18710	T	0.47	0.0741	1.1162	0.01714	0.3228:0.32:0.1009:0.2562	rs3810486	1821;1252	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	R	1252;1821	ENSP00000393257:L1252R;ENSP00000417401:L1821R	ENSP00000393257:L1252R	L	-	2	0	RP4-697K14.7	61665157	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.101000	0.15251	-0.351000	0.08249	-0.323000	0.08544	CTG	A|0.739;C|0.261		0.726	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
OPRL1	4987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62724242	62724242	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr20:62724242C>T	ENST00000349451.3	+	4	581	c.169C>T	c.(169-171)Ctc>Ttc	p.L57F	OPRL1_ENST00000355631.4_Missense_Mutation_p.L57F|OPRL1_ENST00000336866.2_Missense_Mutation_p.L57F	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	57					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CATCGTGGGGCTCTACCTGGC	0.647																																					p.L57F		.											.	OPRL1-69	0			c.C169T						.						82.0	76.0	78.0					20																	62724242		2199	4292	6491	SO:0001583	missense	4987	exon2			GTGGGGCTCTACC		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.169C>T	20.37:g.62724242C>T	ENSP00000336764:p.Leu57Phe	107	0		163	29	NM_000913	0	0	0	0	0	Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	ENST00000349451.3	37	CCDS13556.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875518	0.51695	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.41065	1.01;1.01;1.01	3.9	2.91	0.33838	.	0.153716	0.42548	D	0.000685	T	0.22975	0.0555	N	0.08118	0	0.43426	D	0.995583	P;B	0.43701	0.815;0.281	B;B	0.39531	0.302;0.076	T	0.17258	-1.0375	10	0.62326	D	0.03	.	11.7498	0.51841	0.0:0.6774:0.3226:0.0	.	57;57	P41146-2;P41146	.;OPRX_HUMAN	F	57	ENSP00000336843:L57F;ENSP00000347848:L57F;ENSP00000336764:L57F	ENSP00000336843:L57F	L	+	1	0	OPRL1	62194686	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.195000	0.42677	1.747000	0.51819	0.450000	0.29827	CTC	.		0.647	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647	
DOPEY2	9980	broad.mit.edu	37	21	37635944	37635944	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr21:37635944C>T	ENST00000399151.3	+	25	5501	c.5416C>T	c.(5416-5418)Ctc>Ttc	p.L1806F		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1806					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTTTCTGCTTCTCAGGTATCA	0.408																																					p.L1806F		.											.	DOPEY2-91	0			c.C5416T						.						104.0	106.0	105.0					21																	37635944		2203	4300	6503	SO:0001583	missense	9980	exon25			CTGCTTCTCAGGT	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.5416C>T	21.37:g.37635944C>T	ENSP00000382104:p.Leu1806Phe	52	0		53	4	NM_005128	0	0	0	0	0	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.992726	0.74703	.	.	ENSG00000142197	ENST00000399151	T	0.71698	-0.59	5.83	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.79393	0.4438	M	0.66939	2.045	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76503	-0.2935	10	0.39692	T	0.17	.	7.9914	0.30242	0.0:0.7305:0.1323:0.1373	.	1806;1806	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	F	1806	ENSP00000382104:L1806F	ENSP00000382104:L1806F	L	+	1	0	DOPEY2	36557814	1.000000	0.71417	0.988000	0.46212	0.932000	0.56968	5.257000	0.65473	0.811000	0.34303	0.650000	0.86243	CTC	.		0.408	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
TMPRSS3	64699	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43808632	43808632	+	Missense_Mutation	SNP	C	C	T	rs139484231		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr21:43808632C>T	ENST00000291532.3	-	5	1281	c.326G>A	c.(325-327)cGg>cAg	p.R109Q	TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R109Q|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R193Q|TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000398397.3_Missense_Mutation_p.R109Q|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R107Q	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	109	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		R -> W (in DFBN8; fails to undergo proteolytic cleavage and is unable to activate ENaC). {ECO:0000269|PubMed:11424922}.		cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						ACCACCCACCCGGACTGGCCG	0.562																																					p.R109Q		.											.	TMPRSS3-155	0			c.G326A						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	122.0	108.0	113.0		326,326	4.9	1.0	21	dbSNP_134	113	0,8600		0,0,4300	no	missense,missense	TMPRSS3	NM_024022.2,NM_032405.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	109/455,109/345	43808632	1,13005	2203	4300	6503	SO:0001583	missense	64699	exon5			CCCACCCGGACTG	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.326G>A	21.37:g.43808632C>T	ENSP00000291532:p.Arg109Gln	123	1		189	32	NM_001256317	0	0	0	0	0	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839426	0.71488	2.27E-4	0.0	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81	4.94	4.94	0.65067	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.64402	D	0.000001	D	0.86460	0.5938	M	0.78344	2.41	0.49798	D	0.999828	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.93	D	0.87095	0.2175	9	.	.	.	.	18.1654	0.89723	0.0:1.0:0.0:0.0	.	109;109;109	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	Q	109;109;107;193;109	ENSP00000291532:R109Q;ENSP00000411013:R109Q;ENSP00000381442:R107Q;ENSP00000369762:R193Q;ENSP00000381434:R109Q	.	R	-	2	0	TMPRSS3	42681701	1.000000	0.71417	0.974000	0.42286	0.025000	0.11179	6.243000	0.72384	2.279000	0.76181	0.491000	0.48974	CGG	C|1.000;T|0.000		0.562	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
CRYBB3	1417	bcgsc.ca	37	22	25601196	25601196	+	Missense_Mutation	SNP	C	C	G	rs9608378	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr22:25601196C>G	ENST00000215855.2	+	5	417	c.337C>G	c.(337-339)Cat>Gat	p.H113D	CRYBB3_ENST00000404334.1_Intron	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	113	Connecting peptide.		H -> D (in dbSNP:rs9608378). {ECO:0000269|PubMed:15461802, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2499686}.		visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						GGATAGTCCACATCACAAGCT	0.547													G|||	3326	0.664137	0.4213	0.732	5008	,	,		14457	0.9296		0.6402	False		,,,				2504	0.6953				p.A113A		.											.	CRYBB3-90	0			c.G337G						.	G	ASP/HIS	2059,2347	607.3+/-390.9	469,1121,613	99.0	81.0	87.0		337	5.3	0.4	22	dbSNP_119	87	5425,3175	482.4+/-370.9	1735,1955,610	yes	missense	CRYBB3	NM_004076.3	81	2204,3076,1223	GG,GC,CC		36.9186,46.7317,42.4573	benign	113/212	25601196	7484,5522	2203	4300	6503	SO:0001583	missense	1417	exon5			AGTCCACATCACA		CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.337C>G	22.37:g.25601196C>G	ENSP00000215855:p.His113Asp	134	0		59	6	NM_004076	0	0	0	0	0	Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Silent	SNP	ENST00000215855.2	37	CCDS13830.1	1475	0.6753663003663004	205	0.4166666666666667	260	0.7182320441988951	531	0.9283216783216783	479	0.6319261213720316	G	8.274	0.814062	0.16537	0.467317	0.630814	ENSG00000100053	ENST00000215855	T	0.73681	-0.77	5.3	5.3	0.74995	Beta/gamma crystallin (1);Gamma-crystallin-related (1);	0.271885	0.39687	N	0.001282	T	0.00012	0.0000	N	0.00315	-1.66	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39121	-0.9629	9	0.13470	T	0.59	.	14.878	0.70510	0.0:0.1444:0.8556:0.0	rs9608378;rs52798692;rs57008590;rs9608378	113	P26998	CRBB3_HUMAN	D	113	ENSP00000215855:H113D	ENSP00000215855:H113D	H	+	1	0	CRYBB3	23931196	1.000000	0.71417	0.367000	0.25926	0.053000	0.15095	7.097000	0.76967	1.242000	0.43836	-0.225000	0.12378	CAT	C|0.377;G|0.623		0.547	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		52	17	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	C	rs12159707	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr22:46449891G>C	ENST00000396008.2	-	1	133	c.83C>G	c.(82-84)cCc>cGc	p.P28R	C22orf26_ENST00000333761.1_Missense_Mutation_p.P28R|RP6-109B7.3_ENST00000416202.1_RNA|FLJ27365_ENST00000381051.2_Intron|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	242	0.0483227	0.1452	0.0245	5008	,	,		6433	0.001		0.0249	False		,,,				2504	0.0072				p.P28R		.											.	C22orf26-90	0			c.C83G						.						5.0	5.0	5.0					22																	46449891		1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>G	22.37:g.46449891G>C	ENSP00000379329:p.Pro28Arg	0	0		13	7	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	.	.	.	.	.	.	.	.	.	.	G	3.131	-0.178480	0.06380	.	.	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.38904	0.1058	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	D	0.71184	0.972	T	0.27054	-1.0085	8	0.87932	D	0	.	.	.	.	.	28	Q9NV39	CV026_HUMAN	R	28	ENSP00000379329:P28R;ENSP00000327764:P28R	ENSP00000327764:P28R	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
FAM19A5	25817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	49042499	49042499	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr22:49042499G>A	ENST00000402357.1	+	2	336	c.203G>A	c.(202-204)tGt>tAt	p.C68Y	FAM19A5_ENST00000358295.5_Missense_Mutation_p.C61Y|FAM19A5_ENST00000473898.1_Intron	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5	68						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		ACCGCCCGCTGTGCGTGTAGA	0.701																																					p.C68Y		.											.	FAM19A5-90	0			c.G203A						.						20.0	25.0	24.0					22																	49042499		2045	4175	6220	SO:0001583	missense	25817	exon2			CCCGCTGTGCGTG	AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.203G>A	22.37:g.49042499G>A	ENSP00000383933:p.Cys68Tyr	52	0		211	72	NM_001082967	0	0	0	0	0	A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	Missense_Mutation	SNP	ENST00000402357.1	37	CCDS46728.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753560	0.69648	.	.	ENSG00000219438	ENST00000402357;ENST00000336769;ENST00000358295	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	T	0.80110	0.4563	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82845	-0.0256	8	0.87932	D	0	.	17.3357	0.87280	0.0:0.0:1.0:0.0	.	61;68	Q7Z5A7-2;Q7Z5A7	.;F19A5_HUMAN	Y	68;68;61	.	ENSP00000336812:C68Y	C	+	2	0	FAM19A5	47428935	1.000000	0.71417	0.913000	0.36048	0.330000	0.28571	8.827000	0.92041	2.417000	0.82017	0.655000	0.94253	TGT	.		0.701	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317504.1	NM_015381	
ULK4	54986	bcgsc.ca	37	3	41756965	41756965	+	Missense_Mutation	SNP	C	C	T	rs61744388	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:41756965C>T	ENST00000301831.4	-	24	3013	c.2551G>A	c.(2551-2553)Gta>Ata	p.V851I		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	851					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TGAAGCACTACAGGCATCAGG	0.428													T|||	1330	0.265575	0.5348	0.1628	5008	,	,		17563	0.1478		0.1839	False		,,,				2504	0.18				p.V851I		.											.	ULK4-297	0			c.G2551A						.	T	ILE/VAL	1816,2052		436,944,554	103.0	104.0	104.0		2551	-10.1	0.0	3	dbSNP_129	104	1420,6868		128,1164,2852	yes	missense	ULK4	NM_017886.2	29	564,2108,3406	TT,TC,CC		17.1332,46.9493,26.6206	benign	851/1276	41756965	3236,8920	1934	4144	6078	SO:0001583	missense	54986	exon24			GCACTACAGGCAT	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2551G>A	3.37:g.41756965C>T	ENSP00000301831:p.Val851Ile	98	0		126	6	NM_017886	0	0	0	0	0	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	550	0.2518315018315018	262	0.532520325203252	57	0.1574585635359116	86	0.15034965034965034	145	0.19129287598944592	T	8.060	0.767962	0.15983	0.469493	0.171332	ENSG00000168038	ENST00000301831	T	0.62941	-0.01	5.72	-10.1	0.00402	Armadillo-type fold (1);	0.423778	0.22435	N	0.060092	T	0.00012	0.0000	N	0.24115	0.695	0.49915	P	1.6599999999999948E-4	B	0.09022	0.002	B	0.10450	0.005	T	0.36768	-0.9734	9	0.25106	T	0.35	.	25.2475	0.99993	0.0:0.8218:0.0:0.1782	.	851	Q96C45	ULK4_HUMAN	I	851	ENSP00000301831:V851I	ENSP00000301831:V851I	V	-	1	0	ULK4	41731969	0.000000	0.05858	0.000000	0.03702	0.404000	0.30871	-0.947000	0.03901	-2.451000	0.00543	-1.977000	0.00459	GTA	C|0.772;T|0.228		0.428	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
SETD2	29072	bcgsc.ca	37	3	47162661	47162661	+	Silent	SNP	A	A	G	rs6767907	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:47162661A>G	ENST00000409792.3	-	3	3507	c.3465T>C	c.(3463-3465)aaT>aaC	p.N1155N		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1155					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CAGGCAGGCGATTATCTATTT	0.403			"""N, F, S, Mis"""		clear cell renal carcinoma								G|||	3397	0.678315	0.7837	0.6816	5008	,	,		18708	0.6577		0.6074	False		,,,				2504	0.6278				p.N1155N		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.T3465C						.	G		3302,1104	376.1+/-321.9	1239,824,140	130.0	141.0	137.0		3465	-0.6	0.9	3	dbSNP_116	137	5084,3516	507.7+/-376.9	1505,2074,721	no	coding-synonymous	SETD2	NM_014159.6		2744,2898,861	GG,GA,AA		40.8837,25.0567,35.5221		1155/2565	47162661	8386,4620	2203	4300	6503	SO:0001819	synonymous_variant	29072	exon3			CAGGCGATTATCT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3465T>C	3.37:g.47162661A>G		91	0		74	5	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	ENST00000409792.3	37	CCDS2749.2																																																																																			A|0.343;G|0.657		0.403	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
PLXNA1	5361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126739102	126739102	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:126739102G>A	ENST00000393409.2	+	20	3953	c.3953G>A	c.(3952-3954)gGc>gAc	p.G1318D	PLXNA1_ENST00000251772.4_Missense_Mutation_p.G1295D	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1318					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GACGGTGCCGGCATCCCCTTC	0.617																																					p.G1318D		.											.	PLXNA1-93	0			c.G3953A						.						107.0	89.0	95.0					3																	126739102		2203	4300	6503	SO:0001583	missense	5361	exon20			GTGCCGGCATCCC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3953G>A	3.37:g.126739102G>A	ENSP00000377061:p.Gly1318Asp	119	0		126	41	NM_032242	0	0	0	0	0		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997092	0.74818	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.15372	2.43;2.43	3.96	3.96	0.45880	Plexin, cytoplasmic RasGAP domain (1);	0.000000	0.64402	D	0.000003	T	0.47040	0.1424	M	0.89214	3.015	0.58432	D	0.999999	D	0.57257	0.979	D	0.64877	0.93	T	0.60767	-0.7198	10	0.87932	D	0	.	16.5547	0.84482	0.0:0.0:1.0:0.0	.	1318	Q9UIW2	PLXA1_HUMAN	D	1318;1295	ENSP00000377061:G1318D;ENSP00000251772:G1295D	ENSP00000251772:G1295D	G	+	2	0	PLXNA1	128221792	1.000000	0.71417	0.992000	0.48379	0.688000	0.40055	7.719000	0.84751	2.187000	0.69744	0.585000	0.79938	GGC	.		0.617	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PRR23C	389152	hgsc.bcm.edu	37	3	138763343	138763343	+	Silent	SNP	T	T	G	rs6804898	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:138763343T>G	ENST00000413199.1	-	1	391	c.120A>C	c.(118-120)cgA>cgC	p.R40R	PRR23C_ENST00000502927.2_Silent_p.R40R|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	40										breast(2)|lung(7)|skin(2)	11						TGGGCGCCGCTCGGGATTCGG	0.761													G|||	852	0.170128	0.1301	0.2651	5008	,	,		10616	0.2718		0.0845	False		,,,				2504	0.1401				p.R40R		.											.	PRR23C-23	0			c.A120C						.						3.0	5.0	4.0					3																	138763343		573	1394	1967	SO:0001819	synonymous_variant	389152	exon1			CGCCGCTCGGGAT		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.120A>C	3.37:g.138763343T>G		2	0		50	12	NM_001134657	0	0	0	0	0		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			T|0.848;G|0.152		0.761	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
SAMD7	344658	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	169654233	169654233	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:169654233C>A	ENST00000428432.2	+	8	1537	c.1148C>A	c.(1147-1149)tCa>tAa	p.S383*	SAMD7_ENST00000335556.3_Nonsense_Mutation_p.S383*|RP11-379K17.4_ENST00000487580.1_RNA	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	383	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			AAAATTCAGTCACAGGTATGG	0.318																																					p.S383X		.											.	SAMD7-91	0			c.C1148A						.						65.0	67.0	66.0					3																	169654233		2203	4300	6503	SO:0001587	stop_gained	344658	exon8			TTCAGTCACAGGT	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.1148C>A	3.37:g.169654233C>A	ENSP00000391299:p.Ser383*	130	1		94	24	NM_182610	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000428432.2	37	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	C	37	6.204009	0.97371	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	.	.	.	5.34	4.47	0.54385	.	0.139418	0.50627	D	0.000101	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0889	10.8828	0.46948	0.0:0.8463:0.0:0.1537	.	.	.	.	X	383	.	ENSP00000334668:S383X	S	+	2	0	SAMD7	171136927	0.997000	0.39634	0.199000	0.23439	0.373000	0.29922	4.364000	0.59479	1.262000	0.44165	0.491000	0.48974	TCA	.		0.318	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610	
CLCN2	1181	ucsc.edu;bcgsc.ca;mdanderson.org|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184072696	184072697	+	Missense_Mutation	DNP	GA	GA	AC			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G|A	G|A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:184072696_184072697GA>AC	ENST00000265593.4	-	13	1562_1563	c.1391_1392TC>GT	c.(1390-1392)gTC>gGT	p.V464G	CLCN2_ENST00000475279.1_5'Flank|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.V464G|CLCN2_ENST00000434054.2_Missense_Mutation_p.V420G|CLCN2_ENST00000457512.1_Missense_Mutation_p.V464G|CLCN2_ENST00000423355.2_Intron	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	464					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	ACTCACCAATGACAAAGACAGG	0.614																																					p.V464V|p.V464G		.											.	CLCN2-90	0			c.C1392T|c.T1391G						.																																			SO:0001583	missense	1181	exon13			ACCAATGACAAAG|CCAATGACAAAGA	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1391_1392delinsAC	3.37:g.184072696_184072697delinsAC	ENSP00000265593:p.Val464Gly	480|478	4|1		474|473	131|129	NM_001171087	0	0	0	0	0	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Silent|Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1																																																																																			.		0.614	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
LRRC15	131578	hgsc.bcm.edu	37	3	194080017	194080213	+	Stop_Codon_Del	DEL	GCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	GCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	-	rs567104854|rs193006415|rs151038998|rs368488576|rs73081778|rs141299685|rs151033378|rs115511298|rs200303081|rs147820280|rs200049182|rs185768680|rs200634682|rs372437949|rs536890746|rs115716405|rs375418766|rs113394891|rs116019357|rs376719504|rs74795266	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	GCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr3:194080017_194080213delGCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	ENST00000347624.3	-	0	1645_1841				LRRC15_ENST00000428839.1_Stop_Codon_Del|LRRC15_ENST00000439944.2_Stop_Codon_Del	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15						negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.A542A(2)|p.C558C(2)|p.S554C(1)|p.G538W(1)|p.S568I(1)|p.S528R(1)|p.A542V(1)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		CCCTGCTCCAGCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATGGTAGTCAGAT	0.572																																					p.526_588del		.											.	LRRC15-71	9	Substitution - Missense(5)|Substitution - coding silent(4)	lung(5)|large_intestine(1)|ovary(1)|endometrium(1)|skin(1)	c.1578_1889del						.																																			SO:0001567	stop_retained_variant	131578	exon3			GCTCCAGCCTGCC	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	Exception_encountered	3.37:g.194080017_194080213delGCCTGCCTCTTTAACACTCATTGGGTGCCTTCATCTGCATCAGGACAGCTTGGCTCCTCTTCTTGCAGCAGCAACAGCCGACGCAGGCAGCCAGGGAGCAGGCCAGGGCGACAATGCCAATTACAATGGCGGCAATGGCCAGCCCGCTCTGGGCCTGGGTCATGCCCCAAACGCTGCGGTCATCAGTGACCTGAATG	Exception_encountered	89	0		97	0	NM_001135057	0	0	0	0	0	Q495Q6|Q7RTN7	Frame_Shift_Del	DEL	ENST00000347624.3	37	CCDS3306.1																																																																																			.		0.572	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2		
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	21	0		69	12	NM_175918	0	0	0	0	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		2	0		17	15	NM_175918	0	0	0	0	0	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	8	0		45	12	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
FAM200B	285550	broad.mit.edu	37	4	15689928	15689928	+	Missense_Mutation	SNP	G	G	A	rs4235380	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:15689928G>A	ENST00000422728.2	+	2	2166	c.1328G>A	c.(1327-1329)aGt>aAt	p.S443N	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	443							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						aatgaactgagtttaaaacta	0.303													G|||	1574	0.314297	0.2201	0.3602	5008	,	,		18299	0.4683		0.2763	False		,,,				2504	0.2894				p.S443N		.											.	.	0			c.G1328A						.	G	ASN/SER	319,1065		34,251,407	52.0	41.0	44.0		1328	2.5	1.0	4	dbSNP_111	44	961,2215		150,661,777	yes	missense	FAM200B	NM_001145191.1	46	184,912,1184	AA,AG,GG		30.2582,23.0491,28.0702	benign	443/658	15689928	1280,3280	692	1588	2280	SO:0001583	missense	285550	exon2			AACTGAGTTTAAA	BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.1328G>A	4.37:g.15689928G>A	ENSP00000393017:p.Ser443Asn	156	0		110	3	NM_001145191	0	0	0	0	0		Missense_Mutation	SNP	ENST00000422728.2	37	CCDS47028.1	712	0.326007326007326	116	0.23577235772357724	126	0.34806629834254144	260	0.45454545454545453	210	0.2770448548812665	G	0.141	-1.101788	0.01828	0.230491	0.302582	ENSG00000237765	ENST00000422728	T	0.80214	-1.35	2.48	2.48	0.30137	Ribonuclease H-like (1);	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.49798	P	1.7699999999998273E-4	B	0.09022	0.002	B	0.08055	0.003	T	0.35773	-0.9775	7	.	.	.	.	8.5475	0.33430	0.0:0.0:1.0:0.0	rs4235380;rs16898467;rs52818507;rs57685138;rs4235380	443	P0CF97	F200B_HUMAN	N	443	ENSP00000393017:S443N	.	S	+	2	0	FAM200B	15299026	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.988000	0.49386	1.712000	0.51347	0.484000	0.47621	AGT	G|0.679;A|0.321		0.303	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360100.1	NM_001145191	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		4	4	NM_001098634	0	0	0	0	0	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
AFP	174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74313330	74313330	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:74313330G>A	ENST00000395792.2	+	8	1095	c.995G>A	c.(994-996)aGg>aAg	p.R332K	AFP_ENST00000226359.2_Missense_Mutation_p.R332K	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	332	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AATCTAAACAGGTTTTTAGGA	0.358									Alpha-Fetoprotein, Hereditary Persistence of																												p.R332K		.											.	AFP-91	0			c.G995A						.						38.0	39.0	39.0					4																	74313330		2202	4300	6502	SO:0001583	missense	174	exon8	Familial Cancer Database	HPAFP	TAAACAGGTTTTT	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.995G>A	4.37:g.74313330G>A	ENSP00000379138:p.Arg332Lys	132	0		109	29	NM_001134	0	0	0	0	0	B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	G	9.595	1.127126	0.20959	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.72725	-0.68;-0.68	5.55	3.79	0.43588	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.518270	0.20181	N	0.097538	T	0.56934	0.2019	L	0.29908	0.895	0.09310	N	1	B;P	0.34462	0.004;0.454	B;B	0.38156	0.022;0.266	T	0.45131	-0.9282	10	0.27785	T	0.31	.	6.8732	0.24133	0.0938:0.1772:0.729:0.0	.	174;332	B4DMX4;P02771	.;FETA_HUMAN	K	332	ENSP00000379138:R332K;ENSP00000226359:R332K	ENSP00000226359:R332K	R	+	2	0	AFP	74532194	0.003000	0.15002	0.005000	0.12908	0.975000	0.68041	0.657000	0.24963	0.860000	0.35481	0.655000	0.94253	AGG	.		0.358	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		
CXCL9	4283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76926002	76926002	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:76926002G>C	ENST00000264888.5	-	3	274	c.236C>G	c.(235-237)tCa>tGa	p.S79*	RP11-630D6.5_ENST00000501239.2_RNA	NM_002416.1	NP_002407.1	Q07325	CXCL9_HUMAN	chemokine (C-X-C motif) ligand 9	79					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|defense response (GO:0006952)|defense response to virus (GO:0051607)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|regulation of cell proliferation (GO:0042127)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|cytokine activity (GO:0005125)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(1)	11			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CACATCTGCTGAATCTGGGTT	0.323																																					p.S79X		.											.	CXCL9-227	0			c.C236G						.						113.0	113.0	113.0					4																	76926002		2203	4300	6503	SO:0001587	stop_gained	4283	exon3			TCTGCTGAATCTG	X72755	CCDS34014.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000138755		"""Endogenous ligands"""	7098	protein-coding gene	gene with protein product		601704	"""monokine induced by gamma interferon"""	CMK, MIG		8476424, 9730616	Standard	NM_002416		Approved	SCYB9, Humig, crg-10	uc003hjh.1	Q07325		ENST00000264888.5:c.236C>G	4.37:g.76926002G>C	ENSP00000354901:p.Ser79*	60	0		35	10	NM_002416	0	0	0	0	0	Q503B4	Nonsense_Mutation	SNP	ENST00000264888.5	37	CCDS34014.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438581	0.43326	.	.	ENSG00000138755	ENST00000264888	.	.	.	4.09	2.33	0.28932	.	0.000000	0.53938	D	0.000047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-0.4828	6.8089	0.23792	0.2186:0.0:0.7814:0.0	.	.	.	.	X	79	.	ENSP00000354901:S79X	S	-	2	0	CXCL9	77145026	0.852000	0.29690	0.368000	0.25939	0.634000	0.38068	1.002000	0.29796	0.486000	0.27676	0.491000	0.48974	TCA	.		0.323	CXCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362819.1		
DSPP	1834	bcgsc.ca	37	4	88537151	88537151	+	Missense_Mutation	SNP	G	G	A	rs368984442		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:88537151G>A	ENST00000282478.7	+	4	3370	c.3337G>A	c.(3337-3339)Gat>Aat	p.D1113N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1113N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1113	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.537																																					p.D1113N		.											.	DSPP-90	0			c.G3337A						.						16.0	22.0	20.0					4																	88537151		1244	2351	3595	SO:0001583	missense	1834	exon5			AGCAGCGATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3337G>A	4.37:g.88537151G>A	ENSP00000282478:p.Asp1113Asn	78	1		185	63	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	G	5.178	0.218347	0.09810	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.89939	-2.59;-2.59	1.66	-0.214	0.13161	.	.	.	.	.	T	0.76154	0.3948	L	0.34521	1.04	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.59043	-0.7528	9	0.05351	T	0.99	.	4.3196	0.11011	0.3922:0.0:0.6078:0.0	.	1113	Q9NZW4	DSPP_HUMAN	N	1113	ENSP00000382213:D1113N;ENSP00000282478:D1113N	ENSP00000282478:D1113N	D	+	1	0	DSPP	88756175	0.327000	0.24678	0.020000	0.16555	0.068000	0.16541	1.439000	0.35013	-0.096000	0.12329	-0.791000	0.03333	GAT	.		0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537162	88537162	+	Silent	SNP	C	C	T	rs200745922	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:88537162C>T	ENST00000282478.7	+	4	3381	c.3348C>T	c.(3346-3348)gaC>gaT	p.D1116D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1116D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1116	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.537																																					p.D1116D		.											.	DSPP-90	0			c.C3348T						.						18.0	23.0	21.0					4																	88537162		1264	2371	3635	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3348C>T	4.37:g.88537162C>T		94	1		199	44	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537234	88537234	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:88537234C>T	ENST00000282478.7	+	4	3453	c.3420C>T	c.(3418-3420)aaC>aaT	p.N1140N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.N1140N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1140	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcaacagcagtgaca	0.557																																					p.N1140N		.											.	DSPP-90	0			c.C3420T						.																																			SO:0001819	synonymous_variant	1834	exon5			CAGCAACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3420C>T	4.37:g.88537234C>T		418	4		560	29	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	0	0		4	4	NM_152400	0	0	0	0	0	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123201033	123201033	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:123201033A>G	ENST00000264501.4	+	51	9068	c.8695A>G	c.(8695-8697)Atc>Gtc	p.I2899V	KIAA1109_ENST00000455637.1_Missense_Mutation_p.I2899V|KIAA1109_ENST00000388738.3_Missense_Mutation_p.I2899V			Q2LD37	K1109_HUMAN	KIAA1109	2899					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGCTATCAGTATCAACATTCC	0.448																																					p.I2899V		.											.	KIAA1109-80	0			c.A8695G						.						158.0	157.0	157.0					4																	123201033		2018	4200	6218	SO:0001583	missense	84162	exon49			ATCAGTATCAACA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8695A>G	4.37:g.123201033A>G	ENSP00000264501:p.Ile2899Val	92	0		109	39	NM_015312	0	0	0	0	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.38|19.38	3.815969|3.815969	0.70912|0.70912	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000419325	T;T;T|.	0.25414|.	2.39;2.39;1.8|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58963|0.58963	0.2159|0.2159	L|L	0.38175|0.38175	1.15|1.15	0.41491|0.41491	D|D	0.988229|0.988229	B;B|.	0.30236|.	0.106;0.274|.	B;B|.	0.26416|.	0.029;0.069|.	T|T	0.56257|0.56257	-0.8009|-0.8009	10|5	0.32370|.	T|.	0.25|.	.|.	15.9063|15.9063	0.79433|0.79433	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2899;2899|.	Q2LD37-6;Q2LD37|.	.;K1109_HUMAN|.	V|C	2899|856	ENSP00000264501:I2899V;ENSP00000373390:I2899V;ENSP00000389925:I2899V|.	ENSP00000264501:I2899V|.	I|Y	+|+	1|2	0|0	KIAA1109|KIAA1109	123420483|123420483	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.411000|7.411000	0.80078|0.80078	2.161000|2.161000	0.67846|0.67846	0.528000|0.528000	0.53228|0.53228	ATC|TAT	.		0.448	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
CCRN4L	25819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	139966424	139966424	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:139966424G>A	ENST00000280614.2	+	3	1285	c.1092G>A	c.(1090-1092)tgG>tgA	p.W364*	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	364					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					ACACTACCTGGAAGATCCGGA	0.512																																					p.W364X	Ovarian(144;566 1842 19130 21379 22209)	.											.	CCRN4L-91	0			c.G1092A						.						100.0	94.0	96.0					4																	139966424		2203	4300	6503	SO:0001587	stop_gained	25819	exon3			TACCTGGAAGATC	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.1092G>A	4.37:g.139966424G>A	ENSP00000280614:p.Trp364*	167	0		176	51	NM_012118	0	0	0	0	0	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Nonsense_Mutation	SNP	ENST00000280614.2	37	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	G	37	6.567158	0.97671	.	.	ENSG00000151014	ENST00000280614	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.8539	19.3328	0.94299	0.0:0.0:1.0:0.0	.	.	.	.	X	364	.	.	W	+	3	0	CCRN4L	140185874	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.778000	0.99011	2.589000	0.87451	0.484000	0.47621	TGG	.		0.512	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	
SMARCA5	8467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	144469148	144469148	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:144469148A>G	ENST00000283131.3	+	22	3302	c.2840A>G	c.(2839-2841)tAt>tGt	p.Y947C		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	947	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GGAAAAAACTATACTGAAGAA	0.313																																					p.Y947C		.											.	SMARCA5-227	0			c.A2840G						.						73.0	73.0	73.0					4																	144469148		2203	4299	6502	SO:0001583	missense	8467	exon22			AAAACTATACTGA	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.2840A>G	4.37:g.144469148A>G	ENSP00000283131:p.Tyr947Cys	91	0		65	11	NM_003601	0	0	0	0	0		Missense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.502041	0.85176	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	D	0.94184	-3.37	5.53	5.53	0.82687	SANT domain, DNA binding (1);SLIDE (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97511	0.9185	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.98600	1.0658	10	0.87932	D	0	-5.1544	15.6568	0.77144	1.0:0.0:0.0:0.0	.	947	O60264	SMCA5_HUMAN	C	947;890;890	ENSP00000283131:Y947C	ENSP00000283131:Y947C	Y	+	2	0	SMARCA5	144688598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.330000	0.96422	2.092000	0.63282	0.459000	0.35465	TAT	.		0.313	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
PALLD	23022	broad.mit.edu;bcgsc.ca	37	4	169606648	169606648	+	Missense_Mutation	SNP	A	A	T	rs140454899	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr4:169606648A>T	ENST00000505667.1	+	6	1446	c.1273A>T	c.(1273-1275)Act>Tct	p.T425S	PALLD_ENST00000512127.1_Missense_Mutation_p.T43S|PALLD_ENST00000333488.4_Missense_Mutation_p.T302S|PALLD_ENST00000261509.6_Missense_Mutation_p.T425S|RNU6-1336P_ENST00000383886.1_RNA|PALLD_ENST00000335742.7_Missense_Mutation_p.T43S			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	425					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TCACAGTCCAACTTCATATCT	0.403									Pancreatic Cancer, Familial Clustering of				A|||	5	0.000998403	0.0	0.0	5008	,	,		18801	0.0		0.001	False		,,,				2504	0.0041				p.T425S	Esophageal Squamous(109;1482 1532 18347 40239 51172)	.											.	PALLD-94	0			c.A1273T						.	A	SER/THR,SER/THR,SER/THR	3,4403	6.2+/-15.9	0,3,2200	217.0	211.0	213.0		1273,127,1273	4.6	1.0	4	dbSNP_134	213	50,8550	32.3+/-84.9	1,48,4251	yes	missense,missense,missense	PALLD	NM_001166108.1,NM_001166109.1,NM_016081.3	58,58,58	1,51,6451	TT,TA,AA		0.5814,0.0681,0.4075	probably-damaging,probably-damaging,probably-damaging	425/1124,43/778,425/1107	169606648	53,12953	2203	4300	6503	SO:0001583	missense	23022	exon6	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AGTCCAACTTCAT	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1273A>T	4.37:g.169606648A>T	ENSP00000425556:p.Thr425Ser	66	0		66	5	NM_001166108	0	0	0	0	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	18.00	3.524318	0.64747	6.81E-4	0.005814	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000508898;ENST00000333488;ENST00000504519;ENST00000512127;ENST00000513245;ENST00000503457	T;T;T;T;T;T;T;D	0.90788	-0.2;-0.22;0.07;-0.24;-0.09;-1.36;-0.15;-2.73	5.77	4.59	0.56863	.	0.000000	0.32901	U	0.005513	D	0.90584	0.7048	M	0.73598	2.24	0.29723	N	0.838517	D;P;D	0.63046	0.979;0.868;0.992	P;P;P	0.55785	0.628;0.504;0.784	D	0.87699	0.2559	10	0.46703	T	0.11	.	11.7512	0.51849	0.9313:0.0:0.0687:0.0	.	425;43;425	B7ZMM5;B3KTG2;B2RTX2	.;.;.	S	425;43;425;404;302;43;43;43;43	ENSP00000261509:T425S;ENSP00000336735:T43S;ENSP00000425556:T425S;ENSP00000423063:T404S;ENSP00000328945:T302S;ENSP00000424121:T43S;ENSP00000426947:T43S;ENSP00000424288:T43S	ENSP00000261509:T425S	T	+	1	0	PALLD	169843223	1.000000	0.71417	0.987000	0.45799	0.777000	0.43975	4.535000	0.60629	1.025000	0.39708	0.254000	0.18369	ACT	A|0.998;T|0.002		0.403	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	ADAMTS16_ENST00000511368.1_Silent_p.L18L|CTD-2297D10.2_ENST00000512155.1_RNA|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		0	0		6	6	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
ANKH	56172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	14758635	14758635	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:14758635C>T	ENST00000284268.6	-	3	716	c.386G>A	c.(385-387)aGa>aAa	p.R129K	ANKH_ENST00000503939.1_5'Flank	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	129					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GAAGGCCCTTCTCGTCTTGCT	0.448																																					p.R129K		.											.	ANKH-91	0			c.G386A						.						132.0	120.0	124.0					5																	14758635		2203	4300	6503	SO:0001583	missense	56172	exon3			GCCCTTCTCGTCT	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.386G>A	5.37:g.14758635C>T	ENSP00000284268:p.Arg129Lys	91	0		92	19	NM_054027	0	0	0	0	0	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Missense_Mutation	SNP	ENST00000284268.6	37	CCDS3885.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804996	0.90623	.	.	ENSG00000154122	ENST00000284268	D	0.95724	-3.79	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.96602	0.8891	L	0.47716	1.5	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	D	0.95632	0.8690	10	0.33141	T	0.24	-50.534	18.4049	0.90532	0.0:1.0:0.0:0.0	.	129	Q9HCJ1	ANKH_HUMAN	K	129	ENSP00000284268:R129K	ENSP00000284268:R129K	R	-	2	0	ANKH	14811635	1.000000	0.71417	0.979000	0.43373	0.962000	0.63368	7.757000	0.85209	2.588000	0.87417	0.563000	0.77884	AGA	.		0.448	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1	NM_054027	
ANKRD55	79722	broad.mit.edu	37	5	55407592	55407592	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:55407592G>T	ENST00000341048.4	-	10	1134	c.983C>A	c.(982-984)cCc>cAc	p.P328H	ANKRD55_ENST00000434982.2_Missense_Mutation_p.P40H|ANKRD55_ENST00000504958.2_Missense_Mutation_p.P285H|ANKRD55_ENST00000505970.2_5'UTR	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	328										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				GGAGGGAGGGGGTCGAGTAGG	0.493																																					p.P328H		.											.	ANKRD55-91	0			c.C983A						.						97.0	96.0	96.0					5																	55407592		2203	4300	6503	SO:0001583	missense	79722	exon10			GGAGGGGGTCGAG	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.983C>A	5.37:g.55407592G>T	ENSP00000342295:p.Pro328His	49	0		48	3	NM_024669	0	0	0	0	0	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	22.1|22.1	4.247982|4.247982	0.80024|0.80024	.|.	.|.	ENSG00000164512|ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000434982|ENST00000505970	T;T;T|.	0.41065|.	1.18;1.01;1.4|.	5.49|5.49	3.58|3.58	0.41010|0.41010	Ankyrin repeat-containing domain (1);|.	0.423639|0.423639	0.22860|0.22860	N|N	0.054757|0.054757	T|T	0.29491|0.29491	0.0735|0.0735	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	B;B|.	0.22276|.	0.009;0.067|.	B;B|.	0.21546|.	0.003;0.035|.	T|T	0.17077|0.17077	-1.0381|-1.0381	10|7	0.46703|0.09338	T|T	0.11|0.73	.|.	9.1643|9.1643	0.37041|0.37041	0.0801:0.0:0.7108:0.2091|0.0801:0.0:0.7108:0.2091	.|.	328;327|.	B3KVT8;Q3KP44|.	.;ANR55_HUMAN|.	H|T	328;328;285;40|73	ENSP00000342295:P328H;ENSP00000424230:P285H;ENSP00000429421:P40H|.	ENSP00000342295:P328H|ENSP00000422370:P73T	P|P	-|-	2|1	0|0	ANKRD55|ANKRD55	55443349|55443349	0.226000|0.226000	0.23696|0.23696	0.004000|0.004000	0.12327|0.12327	0.773000|0.773000	0.43773|0.43773	1.224000|1.224000	0.32539|0.32539	1.459000|1.459000	0.47892|0.47892	0.650000|0.650000	0.86243|0.86243	CCC|CCC	.		0.493	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669	
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	70819810	70819810	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:70819810T>G	ENST00000358731.4	+	25	5695	c.5432T>G	c.(5431-5433)cTg>cGg	p.L1811R	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1811					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAAATTGCCCTGGATGGGAAA	0.358																																					p.L1811R		.											.	BDP1-92	0			c.T5432G						.						83.0	79.0	80.0					5																	70819810		1847	4091	5938	SO:0001583	missense	55814	exon25			TTGCCCTGGATGG	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.5432T>G	5.37:g.70819810T>G	ENSP00000351575:p.Leu1811Arg	157	0		136	35	NM_018429	0	0	0	0	0	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	T	9.556	1.117261	0.20795	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.11495	2.77	4.94	-3.79	0.04320	.	1.308640	0.05361	N	0.533670	T	0.21347	0.0514	L	0.54323	1.7	0.09310	N	0.999997	P;D	0.76494	0.828;0.999	P;D	0.65010	0.495;0.931	T	0.31724	-0.9933	10	0.51188	T	0.08	.	5.9366	0.19169	0.1443:0.4848:0.0:0.3709	.	1811;1811	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	R	1811;1391	ENSP00000351575:L1811R	ENSP00000351575:L1811R	L	+	2	0	BDP1	70855566	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.457000	0.06745	-0.747000	0.04759	-1.082000	0.02213	CTG	.		0.358	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
ANKRD34B	340120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79855316	79855316	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:79855316C>G	ENST00000338682.3	-	5	1195	c.523G>C	c.(523-525)Gat>Cat	p.D175H		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	175						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		TGACACCCATCTATATCCACA	0.448																																					p.D175H		.											.	ANKRD34B-69	0			c.G523C						.						209.0	195.0	200.0					5																	79855316		2203	4300	6503	SO:0001583	missense	340120	exon5			ACCCATCTATATC		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.523G>C	5.37:g.79855316C>G	ENSP00000339802:p.Asp175His	57	0		71	25	NM_001004441	0	0	0	0	0	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	37	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536509	0.27475	.	.	ENSG00000189127	ENST00000338682	T	0.22743	1.94	5.6	4.72	0.59763	.	0.708561	0.11537	U	0.554149	T	0.29588	0.0738	M	0.62723	1.935	0.23524	N	0.997495	P	0.50710	0.938	B	0.43360	0.417	T	0.16100	-1.0414	10	0.62326	D	0.03	-8.2806	15.4077	0.74893	0.0:0.8605:0.1394:0.0	.	175	A5PLL1	AN34B_HUMAN	H	175	ENSP00000339802:D175H	ENSP00000339802:D175H	D	-	1	0	ANKRD34B	79891072	0.076000	0.21285	0.005000	0.12908	0.019000	0.09904	2.625000	0.46452	1.332000	0.45431	0.655000	0.94253	GAT	.		0.448	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	
CHSY3	337876	hgsc.bcm.edu	37	5	129240972	129240972	+	Silent	SNP	G	G	C	rs33917	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:129240972G>C	ENST00000305031.4	+	1	808	c.450G>C	c.(448-450)ccG>ccC	p.P150P	CTC-575N7.1_ENST00000515569.1_RNA|CTC-575N7.1_ENST00000503616.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ACGGCCGGCCGGGGAGTAGCC	0.766													G|||	2286	0.45647	0.2254	0.513	5008	,	,		7622	0.5833		0.5368	False		,,,				2504	0.5153				p.P150P		.											.	CHSY3-25	0			c.G450C						.						1.0	2.0	2.0					5																	129240972		822	2140	2962	SO:0001819	synonymous_variant	337876	exon1			CCGGCCGGGGAGT	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.450G>C	5.37:g.129240972G>C		0	0		7	7	NM_175856	0	0	0	0	0	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																			G|0.479;C|0.521		0.766	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
PWWP2A	114825	hgsc.bcm.edu	37	5	159546158	159546158	+	Missense_Mutation	SNP	G	G	A	rs200008605		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:159546158G>A	ENST00000307063.7	-	1	272	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	PWWP2A_ENST00000523662.1_Missense_Mutation_p.R80C|PWWP2A_ENST00000456329.3_Missense_Mutation_p.R80C	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	80	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTGGGCTGCGGGCGAGCTCC	0.751																																					p.R80C		.											.	PWWP2A-68	0			c.C238T						.						14.0	16.0	15.0					5																	159546158		1293	3057	4350	SO:0001583	missense	114825	exon1			GGCTGCGGGCGAG		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.238C>T	5.37:g.159546158G>A	ENSP00000305151:p.Arg80Cys	0	0		4	4	NM_052927	0	0	0	0	0	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	ENST00000307063.7	37	CCDS47332.1	.	.	.	.	.	.	.	.	.	.	g	13.58	2.279824	0.40294	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.56103	1.48;1.45;0.48	4.02	-0.0174	0.13968	.	0.674572	0.11808	U	0.527464	T	0.33614	0.0869	N	0.22421	0.69	0.26338	N	0.977406	B;B;B	0.10296	0.001;0.001;0.003	B;B;B	0.06405	0.0;0.001;0.002	T	0.20706	-1.0267	10	0.56958	D	0.05	1.2914	5.2472	0.15502	0.1946:0.3345:0.4709:0.0	.	80;80;80	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	C	80	ENSP00000390462:R80C;ENSP00000428143:R80C;ENSP00000305151:R80C	ENSP00000305151:R80C	R	-	1	0	PWWP2A	159478736	0.015000	0.18098	0.927000	0.36925	0.854000	0.48673	0.196000	0.17176	-0.227000	0.09884	-0.335000	0.08231	CGC	G|0.997;A|0.003		0.751	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
SPDL1	54908	bcgsc.ca	37	5	169021610	169021610	+	Silent	SNP	C	C	T	rs4493692	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:169021610C>T	ENST00000265295.4	+	7	1095	c.816C>T	c.(814-816)ctC>ctT	p.L272L	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AACGTCAGCTCATCAGTATGA	0.348													T|||	3199	0.638778	0.5257	0.5879	5008	,	,		18643	0.7331		0.673	False		,,,				2504	0.6953				p.L272L		.											.	.	0			c.C816T						.	T		2430,1976	555.7+/-379.3	674,1082,447	122.0	115.0	117.0		816	-2.2	0.8	5	dbSNP_111	117	5934,2666	427.9+/-355.7	2051,1832,417	no	coding-synonymous	CCDC99	NM_017785.4		2725,2914,864	TT,TC,CC		31.0,44.8479,35.6912		272/606	169021610	8364,4642	2203	4300	6503	SO:0001819	synonymous_variant	54908	exon7			TCAGCTCATCAGT	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.816C>T	5.37:g.169021610C>T		367	3		378	10	NM_017785	0	0	0	0	0		Silent	SNP	ENST00000265295.4	37	CCDS4370.1	1406	0.6437728937728938	261	0.5304878048780488	214	0.5911602209944752	410	0.7167832167832168	521	0.6873350923482849	t	3.217	-0.160356	0.06502	0.551521	0.69	ENSG00000040275	ENST00000505977	.	.	.	5.65	-2.19	0.07015	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	T	0.34329	-0.9833	3	.	.	.	-0.0911	4.6237	0.12467	0.0897:0.2881:0.454:0.1682	rs4493692;rs17845344;rs17858189;rs57393136;rs4493692	.	.	.	Y	201	.	.	H	+	1	0	CCDC99	168954188	0.923000	0.31300	0.845000	0.33349	0.400000	0.30750	-0.103000	0.10940	-0.607000	0.05738	-0.264000	0.10439	CAT	C|0.346;T|0.654		0.348	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
FAM153A	285596	bcgsc.ca	37	5	177171892	177171892	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:177171892C>T	ENST00000440605.3	-	4	388	c.105G>A	c.(103-105)atG>atA	p.M35I	FAM153A_ENST00000510276.1_Missense_Mutation_p.M35I|FAM153A_ENST00000513554.1_Missense_Mutation_p.M35I|FAM153A_ENST00000393518.3_Missense_Mutation_p.M35I	NM_173663.3	NP_775934.3	Q9UHL3	F153A_HUMAN	family with sequence similarity 153, member A	35										kidney(6)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	11	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCTGACCTTCATCGCCTCTT	0.438																																					p.M35I		.											.	FAM153A-23	0			c.G105A						.						45.0	56.0	53.0					5																	177171892		1930	3940	5870	SO:0001583	missense	285596	exon4			GACCTTCATCGCC	AB018295	CCDS34305.1	5q35.3	2010-05-12			ENSG00000170074	ENSG00000170074			29940	protein-coding gene	gene with protein product	"""NY REN 7 antigen"""					10508479, 9872452	Standard	NM_173663		Approved	NY-REN-7	uc003mic.3	Q9UHL3	OTTHUMG00000163394	ENST00000440605.3:c.105G>A	5.37:g.177171892C>T	ENSP00000411506:p.Met35Ile	1295	0		1415	129	NM_173663	0	0	0	0	0	A8K0F3|O94852	Missense_Mutation	SNP	ENST00000440605.3	37	CCDS34305.1	.	.	.	.	.	.	.	.	.	.	.	1.788	-0.480249	0.04383	.	.	ENSG00000170074	ENST00000440977;ENST00000393518;ENST00000510276;ENST00000440605;ENST00000513554;ENST00000505531;ENST00000504518	.	.	.	0.538	-1.08	0.09936	.	.	.	.	.	T	0.16896	0.0406	N	0.08118	0	0.09310	N	1	B;B	0.14805	0.0;0.011	B;B	0.23018	0.0;0.043	T	0.22452	-1.0216	7	0.87932	D	0	.	.	.	.	.	35;35	A8MWQ6;Q9UHL3	.;F153A_HUMAN	I	112;35;35;35;35;35;64	.	ENSP00000353887:M35I	M	-	3	0	FAM153A	177104498	0.990000	0.36364	0.001000	0.08648	0.017000	0.09413	0.638000	0.24674	-0.614000	0.05687	-1.045000	0.02358	ATG	.		0.438	FAM153A-022	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417242.1	NM_173663	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		29	29	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000379933.3_Missense_Mutation_p.G783V|RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	0	0		22	14	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
DPCR1	135656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30917535	30917535	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:30917535G>A	ENST00000462446.1	+	2	1322	c.1294G>A	c.(1294-1296)Gag>Aag	p.E432K	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	325						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						ACTGGCCAACGAGAACACCAC	0.507																																					p.E432K		.											.	DPCR1-90	0			c.G1294A						.						184.0	203.0	197.0					6																	30917535		692	1591	2283	SO:0001583	missense	135656	exon2			GCCAACGAGAACA	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1294G>A	6.37:g.30917535G>A	ENSP00000417182:p.Glu432Lys	231	0		252	68	NM_080870	0	0	0	0	0	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	10.64	1.406458	0.25378	.	.	ENSG00000168631	ENST00000462446	T	0.56444	0.46	1.72	-0.203	0.13204	.	.	.	.	.	T	0.13543	0.0328	L	0.45137	1.4	0.09310	N	0.999999	P	0.36065	0.535	B	0.18263	0.021	T	0.08700	-1.0709	9	0.25751	T	0.34	.	4.1581	0.10270	0.3965:0.0:0.6035:0.0	.	432	E9PEI6	.	K	432	ENSP00000417182:E432K	ENSP00000417182:E432K	E	+	1	0	DPCR1	31025514	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	0.083000	0.14871	-0.043000	0.13513	0.264000	0.19307	GAG	.		0.507	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
HLA-B	3106	hgsc.bcm.edu	37	6	31324602	31324604	+	In_Frame_Del	DEL	TCT	TCT	-	rs9266179|rs9266178|rs41562914|rs200186034	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:31324602_31324604delTCT	ENST00000412585.2	-	2	232_234	c.204_206delAGA	c.(202-207)agagag>agg	p.E70del		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	70	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*30(2)|p.E69fs*8(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCGCGGCTCCTCTCTCGGACTCG	0.675									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.68_69del		.											.	HLA-B-90	3	Insertion - Frameshift(2)|Deletion - Frameshift(1)	large_intestine(3)	c.204_206del						.																																			SO:0001651	inframe_deletion	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	GGCTCCTCTCTCG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.204_206delAGA	6.37:g.31324602_31324604delTCT	ENSP00000399168:p.Glu70del	150	0		223	0	NM_005514	0	0	0	0	0	Q29764	In_Frame_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.675	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
PNPLA1	285848	broad.mit.edu	37	6	36263170	36263170	+	Silent	SNP	C	C	T	rs139173161		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:36263170C>T	ENST00000394571.2	+	5	744	c.744C>T	c.(742-744)taC>taT	p.Y248Y	PNPLA1_ENST00000312917.5_Silent_p.Y162Y|PNPLA1_ENST00000388715.3_Silent_p.Y153Y	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	248					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						ACCGAGGGTACGAGGATGCAG	0.582																																					p.Y248Y		.											.	PNPLA1-137	0			c.C744T						.	C	,,	0,4406		0,0,2203	103.0	90.0	94.0		486,744,459	-3.4	0.4	6	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PNPLA1	NM_001145716.1,NM_001145717.1,NM_173676.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	162/447,248/533,153/438	36263170	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	285848	exon5			AGGGTACGAGGAT		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.744C>T	6.37:g.36263170C>T		132	0		245	6	NM_001145717	0	0	0	0	0	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Silent	SNP	ENST00000394571.2	37	CCDS54997.1																																																																																			C|1.000;T|0.000		0.582	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		0	0		26	26	NM_000287	0	0	0	0	0	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.C247G						.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	0	0		4	4	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A240C						.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		0	0		4	4	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
VNN3	55350	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	133047878	133047878	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:133047878G>C	ENST00000450865.2	-	3	519	c.447C>G	c.(445-447)caC>caG	p.H149Q	VNN3_ENST00000519686.2_3'UTR|VNN3_ENST00000392393.3_3'UTR|VNN3_ENST00000427187.2_Intron|VNN3_ENST00000414302.2_3'UTR|VNN3_ENST00000423615.2_Intron|VNN3_ENST00000275223.3_Intron|VNN3_ENST00000207771.3_Missense_Mutation_p.T270S|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000367927.5_Missense_Mutation_p.P271A|VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000417437.2_Intron|VNN3_ENST00000580813.1_5'Flank			Q9NY84	VNN3_HUMAN	vanin 3	0	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		GTGCATGCTGGTGTTGTGGGT	0.512																																					.		.											.	VNN3-90	0			.						.						234.0	190.0	205.0					6																	133047878		2203	4300	6503	SO:0001583	missense	55350	.			ATGCTGGTGTTGT	AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000450865.2:c.447C>G	6.37:g.133047878G>C	ENSP00000440245:p.His149Gln	181	0		262	57	.	0	0	0	0	0	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	RNA	SNP	ENST00000450865.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.30|11.30|11.30	1.598063|1.598063|1.598063	0.28445|0.28445|0.28445	.|.|.	.|.|.	ENSG00000093134|ENSG00000093134|ENSG00000093134	ENST00000450865|ENST00000367927|ENST00000207771	D|D|D	0.81659|0.85955|0.87650	-1.52|-2.05|-2.28	5.31|5.31|5.31	3.54|3.54|3.54	0.40534|0.40534|0.40534	.|.|.	.|.|0.000000	.|.|0.64402	.|.|U	.|.|0.000005	D|D|D	0.84800|0.84800|0.84800	0.5552|0.5552|0.5552	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	0.83265|0.83265|0.83265	-0.0046|-0.0046|-0.0046	6|6|7	0.17832|0.06494|0.39692	T|T|T	0.49|0.89|0.17	-35.6927|-35.6927|-35.6927	12.1098|12.1098|12.1098	0.53834|0.53834|0.53834	0.1407:0.0:0.8593:0.0|0.1407:0.0:0.8593:0.0|0.1407:0.0:0.8593:0.0	.|.|.	.|.|.	.|.|.	.|.|.	Q|A|S	149|271|270	ENSP00000440245:H149Q|ENSP00000438024:P271A|ENSP00000440594:T270S	ENSP00000440245:H149Q|ENSP00000438024:P271A|ENSP00000440594:T270S	H|P|T	-|-|-	3|1|2	2|0|0	VNN3|VNN3|VNN3	133089571|133089571|133089571	0.668000|0.668000|0.668000	0.27493|0.27493|0.27493	0.995000|0.995000|0.995000	0.50966|0.50966|0.50966	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	1.428000|1.428000|1.428000	0.34892|0.34892|0.34892	0.745000|0.745000|0.745000	0.32763|0.32763|0.32763	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	CAC|CCA|ACC	.		0.512	VNN3-013	NOVEL	NMD_exception|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398418.1	NR_028290	
SGK1	6446	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	134494667	134494669	+	In_Frame_Del	DEL	GAC	GAC	-			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GAC	GAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:134494667_134494669delGAC	ENST00000237305.7	-	4	352_354	c.264_266delGTC	c.(262-267)tcgtcc>tcc	p.88_89SS>S	SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000367857.5_In_Frame_Del_p.78_79SS>S|SGK1_ENST00000475719.2_In_Frame_Del_p.88_89SS>S|SGK1_ENST00000413996.3_In_Frame_Del_p.102_103SS>S|SGK1_ENST00000367858.5_In_Frame_Del_p.183_184SS>S|SGK1_ENST00000528577.1_In_Frame_Del_p.116_117SS>S	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	88					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ATGAGGATTGGACGACGGGCCAA	0.365																																					p.183_184del		.											.	SGK1-981	0			c.549_551del						.																																			SO:0001651	inframe_deletion	6446	exon6			GGATTGGACGACG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.264_266delGTC	6.37:g.134494670_134494672delGAC	ENSP00000237305:p.Ser89del	70	0		103	16	NM_001143676	0	0	0	0	0	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	In_Frame_Del	DEL	ENST00000237305.7	37	CCDS5170.1																																																																																			.		0.365	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
MTRF1L	54516	hgsc.bcm.edu	37	6	153323806	153323806	+	Silent	SNP	A	A	G	rs3818126	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:153323806A>G	ENST00000367233.5	-	1	14	c.15T>C	c.(13-15)gtT>gtC	p.V5V	MTRF1L_ENST00000367231.5_Silent_p.V5V|MTRF1L_ENST00000367230.1_Silent_p.V5V|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	5						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		CGCCCCACAGAACCCGGGACC	0.692													A|||	1188	0.23722	0.267	0.3012	5008	,	,		9940	0.1498		0.161	False		,,,				2504	0.32				p.V5V		.											.	MTRF1L-90	0			c.T15C						.	A	,	326,1946		13,300,823	1.0	2.0	2.0		15,15	-9.6	0.0	6	dbSNP_107	2	560,4588		15,530,2029	no	coding-synonymous,coding-synonymous	MTRF1L	NM_001114184.1,NM_019041.5	,	28,830,2852	GG,GA,AA		10.878,14.3486,11.9407	,	5/272,5/381	153323806	886,6534	1136	2574	3710	SO:0001819	synonymous_variant	54516	exon1			CCACAGAACCCGG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.15T>C	6.37:g.153323806A>G		6	0		12	4	NM_019041	0	0	0	0	0	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Silent	SNP	ENST00000367233.5	37	CCDS5243.1																																																																																			A|0.800;G|0.200		0.692	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		3	0		95	32	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		0	0		8	6	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	2	0		23	6	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
SP8	221833	hgsc.bcm.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	11	0		60	33	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GNB2	2783	broad.mit.edu	37	7	100274423	100274424	+	Splice_Site	DEL	GT	GT	-	rs138290543		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr7:100274423_100274424delGT	ENST00000303210.4	+	4	685		c.e4+1		GNB2_ENST00000427895.1_Intron|GNB2_ENST00000393926.1_Splice_Site|GNB2_ENST00000424361.1_Splice_Site|GNB2_ENST00000436220.1_Splice_Site|GNB2_ENST00000419828.1_Intron|GNB2_ENST00000393924.1_Splice_Site	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				CCGACTCAAGGTGTGTGTGTGT	0.634																																					.		.											.	GNB2-229	0			.						.			15,310,3909		0,0,15,2,306,1794						4.3	1.0		dbSNP_134	32	23,503,7706		0,0,23,2,499,3592	no	splice-5	GNB2	NM_005273.3		0,0,38,4,805,5386	A1A1,A1A2,A1R,A2A2,A2R,RR		6.3897,7.676,6.8266				38,813,11615				SO:0001630	splice_region_variant	2783	.			CTCAAGGTGTGTG	M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.203+1GT>-	7.37:g.100274433_100274434delGT		97	0		109	6	.	0	0	0	0	0	B3KPU1|P11016|P54312	Splice_Site	DEL	ENST00000303210.4	37	CCDS5703.1																																																																																			.		0.634	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	NM_005273	Intron
ZNF212	7988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	148951008	148951008	+	Silent	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr7:148951008G>A	ENST00000335870.2	+	5	1118	c.990G>A	c.(988-990)caG>caA	p.Q330Q		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			ATAAGCAGCAGCTGGCCACAC	0.587																																					p.Q330Q		.											.	ZNF212-91	0			c.G990A						.						35.0	35.0	35.0					7																	148951008		2203	4300	6503	SO:0001819	synonymous_variant	7988	exon5			GCAGCAGCTGGCC	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.990G>A	7.37:g.148951008G>A		70	0		78	19	NM_012256	0	0	0	0	0	B2RCF4|Q13396|Q8N664	Silent	SNP	ENST00000335870.2	37	CCDS5896.1																																																																																			.		0.587	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	NM_012256	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	1	0		25	5	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
RP1L1	94137	bcgsc.ca	37	8	10469233	10469233	+	Missense_Mutation	SNP	A	A	G	rs35602868	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:10469233A>G	ENST00000382483.3	-	4	2598	c.2375T>C	c.(2374-2376)cTg>cCg	p.L792P		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	792			L -> P (in dbSNP:rs35602868). {ECO:0000269|PubMed:12724644}.		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTCTTCCCCCAGGCTGGCAGC	0.692													A|||	1577	0.314896	0.3525	0.3602	5008	,	,		15992	0.0218		0.5567	False		,,,				2504	0.2853				p.L792P		.											.	RP1L1-139	0			c.T2375C						.	A	PRO/LEU	1358,2534		220,918,808	53.0	58.0	57.0		2375	-0.8	0.0	8	dbSNP_126	57	4444,3826		1223,1998,914	yes	missense	RP1L1	NM_178857.5	98	1443,2916,1722	GG,GA,AA		46.2636,34.8921,47.706	probably-damaging	792/2401	10469233	5802,6360	1946	4135	6081	SO:0001583	missense	94137	exon4			TCCCCCAGGCTGG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.2375T>C	8.37:g.10469233A>G	ENSP00000371923:p.Leu792Pro	137	1		239	8	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	721	0.3301282051282051	167	0.3394308943089431	138	0.3812154696132597	13	0.022727272727272728	403	0.5316622691292876	A	12.25	1.881182	0.33255	0.348921	0.537364	ENSG00000183638	ENST00000382483	T	0.07908	3.15	5.11	-0.8	0.10897	.	2.282260	0.02877	U	0.132403	T	0.00012	0.0000	N	0.19112	0.55	0.53688	P	2.6999999999999247E-5	P	0.38827	0.649	B	0.36186	0.219	T	0.41088	-0.9528	9	0.33940	T	0.23	-2.9284	5.5366	0.17016	0.4338:0.1325:0.0:0.4337	rs35602868	792	A6NKC6	.	P	792	ENSP00000371923:L792P	ENSP00000371923:L792P	L	-	2	0	RP1L1	10506643	0.000000	0.05858	0.018000	0.16275	0.014000	0.08584	-0.052000	0.11865	0.226000	0.20979	-0.695000	0.03696	CTG	A|0.605;G|0.395		0.692	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
FBXO16	157574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28309857	28309857	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:28309857G>A	ENST00000380254.2	-	6	792	c.644C>T	c.(643-645)gCa>gTa	p.A215V	RP11-181B11.2_ENST00000518819.1_RNA|FBXO16_ENST00000517436.1_5'UTR|FBXO16_ENST00000346498.2_Missense_Mutation_p.A203V|FBXO16_ENST00000518734.1_Missense_Mutation_p.A203V|RP11-181B11.2_ENST00000523935.1_RNA	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	215										large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		GGGTGGAAGTGCTTTCTCCCC	0.443																																					p.A215V		.											.	FBXO16-227	0			c.C644T						.						106.0	106.0	106.0					8																	28309857		2203	4300	6503	SO:0001583	missense	157574	exon6			GGAAGTGCTTTCT	AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.644C>T	8.37:g.28309857G>A	ENSP00000369604:p.Ala215Val	131	0		116	23	NM_172366	0	0	0	0	0	Q3T1B2|Q3T1B3|Q3T1B4	Missense_Mutation	SNP	ENST00000380254.2	37	CCDS6068.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.71|10.71	1.426310|1.426310	0.25726|0.25726	.|.	.|.	ENSG00000214050|ENSG00000214050	ENST00000380254;ENST00000346498;ENST00000518734;ENST00000517673|ENST00000518248	T;T;T;T|.	0.44881|.	2.47;2.47;2.47;0.91|.	5.53|5.53	-0.00126|-0.00126	0.14035|0.14035	.|.	0.446139|.	0.20559|.	U|.	0.089960|.	T|T	0.52933|0.52933	0.1765|0.1765	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B;B|.	0.28552|.	0.215;0.215;0.215|.	B;B;B|.	0.28784|.	0.094;0.094;0.094|.	T|T	0.41431|0.41431	-0.9509|-0.9509	10|5	0.66056|.	D|.	0.02|.	-29.4346|-29.4346	13.84|13.84	0.63432|0.63432	0.0:0.0:0.5244:0.4755|0.0:0.0:0.5244:0.4755	.|.	203;203;215|.	Q3T1B3;Q3T1B2;Q8IX29|.	.;.;FBX16_HUMAN|.	V|Y	215;203;203;160|60	ENSP00000369604:A215V;ENSP00000341416:A203V;ENSP00000429687:A203V;ENSP00000429390:A160V|.	ENSP00000341416:A203V|.	A|H	-|-	2|1	0|0	FBXO16|FBXO16	28365776|28365776	0.638000|0.638000	0.27225|0.27225	0.562000|0.562000	0.28370|0.28370	0.537000|0.537000	0.34900|0.34900	1.145000|1.145000	0.31577|0.31577	-0.228000|-0.228000	0.09869|0.09869	-0.582000|-0.582000	0.04134|0.04134	GCA|CAC	.		0.443	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219988.2	NM_172366	
GPR124	25960	hgsc.bcm.edu	37	8	37699516	37699516	+	Silent	SNP	C	C	T	rs7010546	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:37699516C>T	ENST00000412232.2	+	19	3673	c.3660C>T	c.(3658-3660)ggC>ggT	p.G1220G	GPR124_ENST00000315215.7_Silent_p.G1003G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1220					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCGAGAGCGGCAGTCTGCACA	0.746													C|||	2324	0.464058	0.3048	0.5144	5008	,	,		7503	0.6716		0.4165	False		,,,				2504	0.4785				p.G1220G		.											.	GPR124-157	0			c.C3660T						.	C		594,1854		106,382,736	2.0	3.0	2.0		3660	3.1	1.0	8	dbSNP_116	2	1524,3502		291,942,1280	no	coding-synonymous	GPR124	NM_032777.9		397,1324,2016	TT,TC,CC		30.3223,24.2647,28.3382		1220/1339	37699516	2118,5356	1224	2513	3737	SO:0001819	synonymous_variant	25960	exon19			GAGCGGCAGTCTG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3660C>T	8.37:g.37699516C>T		0	0		8	7	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	1050	0.4807692307692308	166	0.33739837398373984	169	0.46685082872928174	397	0.6940559440559441	318	0.41952506596306066	C	4.050	0.006880	0.07866	0.242647	0.303223	ENSG00000020181	ENST00000416514	.	.	.	3.95	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999997394	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-18.0593	4.3087	0.10960	0.1378:0.5532:0.2174:0.0916	rs7010546;rs59434562;rs7010546	.	.	.	X	1213	.	ENSP00000405145:Q1213X	Q	+	1	0	GPR124	37818674	0.843000	0.29541	1.000000	0.80357	0.388000	0.30384	-0.114000	0.10757	0.874000	0.35823	0.313000	0.20887	CAG	C|0.479;G|0.000;T|0.520		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		2	2		17	17	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		24	23	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MROH6	642475	hgsc.bcm.edu	37	8	144649601	144649601	+	Silent	SNP	A	A	G	rs13268196	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:144649601A>G	ENST00000398882.3	-	14	2224	c.1968T>C	c.(1966-1968)gcT>gcC	p.A656A	MROH6_ENST00000534459.1_5'UTR|MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000532704.1_Intron|MROH6_ENST00000524906.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	656																	CCGCGGCCACAGCCGGCTTGG	0.776													G|||	4732	0.944888	0.8018	0.9827	5008	,	,		8608	1.0		0.998	False		,,,				2504	1.0				p.A656A		.											.	.	0			c.T1968C						.						1.0	2.0	2.0					8																	144649601		1007	2126	3133	SO:0001819	synonymous_variant	642475	exon14			GGCCACAGCCGGC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1968T>C	8.37:g.144649601A>G		0	0		14	13	NM_001100878	0	0	0	0	0	A8MWB1	Silent	SNP	ENST00000398882.3	37	CCDS47928.1																																																																																			A|0.057;G|0.943		0.776	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000377533.3_Silent_p.P1369P|RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000356994.2_Silent_p.P1450P|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		0	0		8	8	NM_015356	0	0	0	0	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
OPLAH	26873	hgsc.bcm.edu	37	8	145106939	145106940	+	Splice_Site	DEL	CC	CC	-	rs60949781		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:145106939_145106940delCC	ENST00000426825.1	-	26	3580_3581	c.3499_3500delGG	c.(3499-3501)ggc>c	p.G1167fs	OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000528912.1_RNA|CTD-3065J16.6_ENST00000561181.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1167					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCCCCGAGCCCCCCGCCGCA	0.748														5008	1.0	1.0	1.0	5008	,	,		7120	1.0		1.0	False		,,,				2504	1.0				.		.											.	OPLAH-68	0			.						.			2721,11		1360,1,5						3.7	0.9		dbSNP_130	11	6356,8		3177,2,3	no	frameshift	OPLAH	NM_017570.3		4537,3,8	A1A1,A1R,RR		0.1257,0.4026,0.2089				9077,19				SO:0001630	splice_region_variant	26873	.			CCCGAGCCCCCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.3499-1GG>-	8.37:g.145106943_145106944delCC		0	0		10	10	.	0	0	0	0	0	A5PKY8|Q75W65|Q9Y4Q0	Splice_Site	DEL	ENST00000426825.1	37																																																																																				.		0.748	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	Frame_Shift_Del
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000322428.5_5'Flank|MAF1_ENST00000534585.1_5'Flank|SHARPIN_ENST00000533948.1_Intron	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		0	0		6	6	NM_030974	0	0	0	0	0	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		16	16	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
LMX1B	4010	broad.mit.edu	37	9	129376780	129376780	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr9:129376780C>A	ENST00000373474.4	+	1	59	c.52C>A	c.(52-54)Cag>Aag	p.Q18K	RP11-123K19.1_ENST00000451449.2_RNA|RP11-123K19.1_ENST00000425370.1_RNA|LMX1B_ENST00000526117.1_Missense_Mutation_p.Q18K|LMX1B_ENST00000355497.5_Missense_Mutation_p.Q18K|LMX1B_ENST00000425646.2_5'UTR|RP11-123K19.1_ENST00000432418.1_RNA|LMX1B_ENST00000561065.1_5'UTR			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	18					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CCCTCGCGGGCAGACGGACTG	0.721									Nail-Patella Syndrome																												p.Q18K	Pancreas(110;1796 2278 18357 20466)	.											.	LMX1B-90	0			c.C52A						.						19.0	17.0	18.0					9																	129376780		2195	4295	6490	SO:0001583	missense	4010	exon1	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	CGCGGGCAGACGG	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.52C>A	9.37:g.129376780C>A	ENSP00000362573:p.Gln18Lys	61	0		169	10	NM_001174146	0	0	0	0	0	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	c	12.88	2.070080	0.36566	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497	D;D;D	0.85258	-1.8;-1.79;-1.96	3.04	3.04	0.35103	.	0.120313	0.35262	U	0.003325	T	0.69771	0.3148	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.64859	-0.6308	8	0.07030	T	0.85	.	12.8315	0.57748	0.0:1.0:0.0:0.0	.	.	.	.	K	18	ENSP00000436930:Q18K;ENSP00000362573:Q18K;ENSP00000347684:Q18K	ENSP00000347684:Q18K	Q	+	1	0	LMX1B	128416601	0.998000	0.40836	1.000000	0.80357	0.948000	0.59901	1.351000	0.34022	1.569000	0.49696	0.388000	0.25769	CAG	.		0.721	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139360883	139360883	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr9:139360883C>T	ENST00000371706.3	-	5	3460	c.3427G>A	c.(3427-3429)Gat>Aat	p.D1143N	SEC16A_ENST00000431893.2_Missense_Mutation_p.D1143N|SEC16A_ENST00000290037.6_Missense_Mutation_p.D1143N|SEC16A_ENST00000313050.7_Missense_Mutation_p.D1321N			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1143	Required for endoplasmic reticulum localization.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		AAGCGAGGATCGTACCTCCAG	0.637																																					p.D1321N		.											.	.	0			c.G3961A						.						26.0	31.0	29.0					9																	139360883		2144	4264	6408	SO:0001583	missense	9919	exon7			GAGGATCGTACCT	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3427G>A	9.37:g.139360883C>T	ENSP00000360771:p.Asp1143Asn	100	0		183	40	NM_014866	0	0	0	0	0	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.305861|4.305861	0.81247|0.81247	.|.	.|.	ENSG00000148396|ENSG00000148396	ENST00000313050;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348|ENST00000433860	T;T;T;T;T|.	0.37915|.	1.68;1.17;1.66;1.66;1.67|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.052548|.	0.85682|.	D|.	0.000000|.	T|T	0.73900|0.73900	0.3646|0.3646	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;P|.	0.73380|.	0.974;0.98;0.94;0.873|.	T|T	0.71199|0.71199	-0.4663|-0.4663	10|5	0.42905|.	T|.	0.14|.	-41.3988|-41.3988	18.7827|18.7827	0.91941|0.91941	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1321;1143;1143;711|.	F1T0I1;O15027-5;O15027-4;A4QN19|.	.;.;.;.|.	N|Q	1321;43;1143;1143;1143;711;245|17	ENSP00000325827:D1321N;ENSP00000403525:D43N;ENSP00000360771:D1143N;ENSP00000290037:D1143N;ENSP00000387583:D1143N|.	ENSP00000290037:D1143N|.	D|R	-|-	1|2	0|0	SEC16A|SEC16A	138480704|138480704	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.446000|0.446000	0.32137|0.32137	6.015000|6.015000	0.70791|0.70791	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GAT|CGA	.		0.637	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
ARHGAP6	395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	11204435	11204435	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:11204435A>C	ENST00000337414.4	-	5	2066	c.1194T>G	c.(1192-1194)gaT>gaG	p.D398E	ARHGAP6_ENST00000380736.1_Missense_Mutation_p.D195E|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.D430E|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.D223E|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.D398E|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.D195E|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.D207E	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	398					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGAGTTTCTTATCTCTGGCTT	0.428																																					p.D398E		.											.	ARHGAP6-227	0			c.T1194G						.						167.0	144.0	152.0					X																	11204435		2203	4300	6503	SO:0001583	missense	395	exon5			TTTCTTATCTCTG	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1194T>G	X.37:g.11204435A>C	ENSP00000338967:p.Asp398Glu	123	0		80	32	NM_006125	0	0	0	0	0	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025198	0.54683	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.25250	1.81;1.9;1.9;1.82;1.81;1.81;1.89;1.95	5.51	3.01	0.34805	.	0.000000	0.56097	D	0.000034	T	0.19446	0.0467	L	0.36672	1.1	0.44745	D	0.997742	B;B;P;B;B	0.35011	0.06;0.274;0.48;0.397;0.397	B;B;B;B;B	0.38755	0.018;0.084;0.143;0.204;0.281	T	0.03739	-1.1008	10	0.49607	T	0.09	.	5.6475	0.17598	0.7053:0.1477:0.1471:0.0	.	207;195;398;398;398	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	E	223;195;195;398;234;398;207;430	ENSP00000438135:D223E;ENSP00000370112:D195E;ENSP00000302312:D195E;ENSP00000338967:D398E;ENSP00000370093:D234E;ENSP00000370094:D398E;ENSP00000389394:D207E;ENSP00000370108:D430E	ENSP00000302312:D195E	D	-	3	2	ARHGAP6	11114356	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.821000	0.48065	1.852000	0.53769	0.486000	0.48141	GAT	.		0.428	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
ATP6AP2	10159	hgsc.bcm.edu	37	X	40458870	40458870	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:40458870G>T	ENST00000378438.4	+	7	773	c.615G>T	c.(613-615)aaG>aaT	p.K205N	ATP6AP2_ENST00000535777.1_Missense_Mutation_p.K127N|ATP6AP2_ENST00000544975.1_Missense_Mutation_p.K129N|ATP6AP2_ENST00000486558.1_3'UTR|ATP6AP2_ENST00000535539.1_Missense_Mutation_p.K173N	NM_005765.2	NP_005756.2	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 2	205					angiotensin maturation (GO:0002003)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|eye pigmentation (GO:0048069)|head morphogenesis (GO:0060323)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of Wnt signaling pathway (GO:0030177)|proteolysis (GO:0006508)|regulation of MAPK cascade (GO:0043408)|rostrocaudal neural tube patterning (GO:0021903)	cell body (GO:0044297)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(2)	4						ATCTAGCCAAGGATCATTCTC	0.408																																					p.K205N		.											.	ATP6AP2-130	0			c.G615T						.						128.0	114.0	119.0					X																	40458870		2203	4300	6503	SO:0001583	missense	10159	exon7			AGCCAAGGATCAT	AF248966	CCDS14252.1	Xp11.4	2014-06-17	2003-08-28	2003-08-29	ENSG00000182220	ENSG00000182220			18305	protein-coding gene	gene with protein product	"""prorenin receptor"", ""renin receptor"""	300556	"""ATPase, H+ transporting, lysosomal interacting protein 2"""	ATP6IP2		9556572, 11590366	Standard	NM_005765		Approved	M8-9, APT6M8-9, ATP6M8-9, PRR, RENR	uc004det.3	O75787	OTTHUMG00000024103	ENST00000378438.4:c.615G>T	X.37:g.40458870G>T	ENSP00000367697:p.Lys205Asn	71	0		43	4	NM_005765	0	0	0	0	0	B7Z9I3|Q5QTQ7|Q6T7F5|Q8NBP3|Q8NG15|Q96FV6|Q96LB5|Q9H2P8|Q9UG89	Missense_Mutation	SNP	ENST00000378438.4	37	CCDS14252.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.73|17.73|17.73	3.462477|3.462477|3.462477	0.63513|0.63513|0.63513	.|.|.	.|.|.	ENSG00000182220|ENSG00000182220|ENSG00000182220	ENST00000423649|ENST00000535539;ENST00000378438;ENST00000544975;ENST00000535777|ENST00000447485	.|T;T;T;T|.	.|0.75589|.	.|-0.95;1.42;1.41;-0.95|.	5.23|5.23|5.23	3.06|3.06|3.06	0.35304|0.35304|0.35304	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	.|T|T	.|0.59514|0.59514	.|0.2199|0.2199	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.58432|0.58432|0.58432	D|D|D	0.999995|0.999995|0.999995	.|P;D;P;P|.	.|0.61080|.	.|0.925;0.989;0.698;0.698|.	.|B;P;B;B|.	.|0.52159|.	.|0.446;0.691;0.347;0.347|.	.|T|T	.|0.56523|0.56523	.|-0.7965|-0.7965	.|10|5	.|0.20046|.	.|T|.	.|0.44|.	-16.7994|-16.7994|-16.7994	6.1784|6.1784|6.1784	0.20457|0.20457|0.20457	0.4213:0.0:0.5786:0.0|0.4213:0.0:0.5786:0.0|0.4213:0.0:0.5786:0.0	.|.|.	.|127;173;129;205|.	.|B7Z1I9;B7Z9I3;B7Z413;O75787|.	.|.;.;.;RENR_HUMAN|.	X|N|M	146|173;205;129;127|180	.|ENSP00000438415:K173N;ENSP00000367697:K205N;ENSP00000440459:K129N;ENSP00000441536:K127N|.	.|ENSP00000367697:K205N|.	G|K|R	+|+|+	1|3|2	0|2|0	ATP6AP2|ATP6AP2|ATP6AP2	40343814|40343814|40343814	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	2.913000|2.913000|2.913000	0.48790|0.48790|0.48790	1.103000|1.103000|1.103000	0.41568|0.41568|0.41568	0.594000|0.594000|0.594000	0.82650|0.82650|0.82650	GGA|AAG|AGG	.		0.408	ATP6AP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060679.1	NM_005765	
PHF8	23133	broad.mit.edu;bcgsc.ca	37	X	54014243	54014243	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:54014243T>C	ENST00000357988.5	-	15	2331	c.1973A>G	c.(1972-1974)gAc>gGc	p.D658G	PHF8_ENST00000338154.6_Missense_Mutation_p.D622G|PHF8_ENST00000322659.8_Missense_Mutation_p.D622G|PHF8_ENST00000338946.6_Missense_Mutation_p.D521G	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	658					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						CAATCTCTCGTCAATCTGCAG	0.443																																					p.D658G		.											.	PHF8-133	0			c.A1973G						.						231.0	163.0	186.0					X																	54014243		2203	4300	6503	SO:0001583	missense	23133	exon15			CTCTCGTCAATCT	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1973A>G	X.37:g.54014243T>C	ENSP00000350676:p.Asp658Gly	153	0		109	5	NM_001184896	0	0	0	0	0	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	25.2|25.2|25.2	4.618034|4.618034|4.618034	0.87359|0.87359|0.87359	.|.|.	.|.|.	ENSG00000172943|ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000375189;ENST00000322659|ENST00000396282|ENST00000443302	T;T;T;T|.|.	0.33216|.|.	1.76;1.53;1.56;1.42|.|.	5.47|5.47|5.47	5.47|5.47|5.47	0.80525|0.80525|0.80525	.|.|.	0.102836|.|.	0.64402|.|.	D|.|.	0.000005|.|.	T|T|.	0.59797|0.59797|.	0.2220|0.2220|.	L|L|L	0.47190|0.47190|0.47190	1.495|1.495|1.495	0.37887|0.37887|0.37887	D|D|D	0.93058|0.93058|0.93058	D;D;D;D;D|.|.	0.89917|.|.	0.993;0.996;0.993;1.0;1.0|.|.	P;D;D;D;D|.|.	0.87578|.|.	0.84;0.99;0.984;0.998;0.994|.|.	T|T|.	0.62695|0.62695|.	-0.6800|-0.6800|.	10|5|.	0.62326|.|.	D|.|.	0.03|.|.	-10.9089|-10.9089|-10.9089	11.9972|11.9972|11.9972	0.53209|0.53209|0.53209	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	144;622;521;557;658|.|.	B3KMV4;Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.|.	.;.;.;.;PHF8_HUMAN|.|.	G|A|W	658;622;521;551;98;622|526|385	ENSP00000350676:D658G;ENSP00000338868:D622G;ENSP00000340051:D521G;ENSP00000319473:D622G|.|.	ENSP00000319473:D622G|.|.	D|T|X	-|-|-	2|1|3	0|0|0	PHF8|PHF8|PHF8	54030968|54030968|54030968	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.959000|0.959000|0.959000	0.39883|0.39883|0.39883	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	6.556000|6.556000|6.556000	0.73932|0.73932|0.73932	1.818000|1.818000|1.818000	0.53035|0.53035|0.53035	0.481000|0.481000|0.481000	0.45027|0.45027|0.45027	GAC|ACG|TGA	.		0.443	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
BEX4	56271	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	102471120	102471120	+	Silent	SNP	C	C	T			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:102471120C>T	ENST00000372695.5	+	3	274	c.39C>T	c.(37-39)aaC>aaT	p.N13N	BEX4_ENST00000372691.3_Silent_p.N13N	NM_001080425.3	NP_001073894.1	Q9NWD9	BEX4_HUMAN	brain expressed, X-linked 4	13						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.N339N(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	9						ACAATCTCAACGGGGAAAATG	0.517																																					p.N13N		.											.	BEX4-62	1	Substitution - coding silent(1)	large_intestine(1)	c.C39T						.						33.0	36.0	35.0					X																	102471120		2194	4272	6466	SO:0001819	synonymous_variant	56271	exon3			TCTCAACGGGGAA	AL035494	CCDS35355.1	Xq22.1-q22.3	2014-03-21	2008-11-04	2007-08-24	ENSG00000102409	ENSG00000102409			25475	protein-coding gene	gene with protein product		300692	"""brain expressed X-linked-like 1"", ""BEX family member 4"""	BEXL1		15958283, 16221301	Standard	NM_001080425		Approved	FLJ10097	uc004ejw.4	Q9NWD9	OTTHUMG00000022091	ENST00000372695.5:c.39C>T	X.37:g.102471120C>T		262	2		181	81	NM_001080425	0	0	0	0	0		Silent	SNP	ENST00000372695.5	37	CCDS35355.1																																																																																			.		0.517	BEX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057694.1	XM_043653	
MIR450A1	554214	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	133675462	133675462	+	RNA	SNP	G	G	C			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:133675462G>C	ENST00000362262.1	-	0	0				MIR450B_ENST00000401182.1_RNA|MIR542_ENST00000385050.1_RNA|MIR450A2_ENST00000385022.1_RNA	NR_029962.1				microRNA 450a-1																		AGATGTCTGAGATCTGTGCAT	0.423																																					.		.											.	.	0			.						.						175.0	141.0	151.0					X																	133675462		1568	3582	5150			664617	.			GTCTGAGATCTGT			Xq26.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000199132	ENSG00000199132		"""ncRNAs / Micro RNAs"""	28008	non-coding RNA	RNA, micro			"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1			Standard	NR_029962		Approved	hsa-mir-450, hsa-mir-450-1, hsa-mir-450a-1	uc011mvl.2				X.37:g.133675462G>C		42	0		44	26	.	0	0	0	0	0		RNA	SNP	ENST00000362262.1	37																																																																																				.		0.423	MIR450A1-201	KNOWN	basic	miRNA	miRNA		NR_029962	
GPR112	139378	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135432457	135432457	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:135432457A>G	ENST00000394143.1	+	6	6883	c.6592A>G	c.(6592-6594)Act>Gct	p.T2198A	GPR112_ENST00000287534.4_Missense_Mutation_p.T2135A|GPR112_ENST00000370652.1_Missense_Mutation_p.T2198A|GPR112_ENST00000412101.1_Missense_Mutation_p.T1993A|GPR112_ENST00000394141.1_Missense_Mutation_p.T1993A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2198					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTCATATCCACTGGGGTGAC	0.428																																					p.T2198A		.											.	GPR112-183	0			c.A6592G						.						198.0	166.0	177.0					X																	135432457		2203	4300	6503	SO:0001583	missense	139378	exon6			ATATCCACTGGGG	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6592A>G	X.37:g.135432457A>G	ENSP00000377699:p.Thr2198Ala	187	2		140	67	NM_153834	0	0	0	0	0	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	8.761	0.923607	0.18056	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.35973	1.48;1.48;1.44;1.28;1.44	2.82	2.82	0.32997	.	.	.	.	.	T	0.34774	0.0909	L	0.29908	0.895	0.09310	N	1	D;P;P	0.56035	0.974;0.95;0.62	P;P;B	0.53518	0.728;0.59;0.157	T	0.07809	-1.0753	9	0.42905	T	0.14	.	6.6654	0.23037	1.0:0.0:0.0:0.0	.	2135;1993;2198	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	A	2198;2198;1993;2135;1993	ENSP00000377699:T2198A;ENSP00000359686:T2198A;ENSP00000416526:T1993A;ENSP00000287534:T2135A;ENSP00000377697:T1993A	ENSP00000287534:T2135A	T	+	1	0	GPR112	135260123	0.030000	0.19436	0.043000	0.18650	0.333000	0.28666	1.666000	0.37460	1.375000	0.46248	0.352000	0.21897	ACT	.		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
ARHGAP4	393	ucsc.edu;bcgsc.ca	37	X	153174968	153174968	+	Silent	SNP	G	G	A	rs61749033	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chrX:153174968G>A	ENST00000350060.5	-	20	2477	c.2436C>T	c.(2434-2436)ggC>ggT	p.G812G	ARHGAP4_ENST00000537206.1_Silent_p.G789G|ARHGAP4_ENST00000467421.1_5'UTR|ARHGAP4_ENST00000370016.1_Silent_p.G791G|ARHGAP4_ENST00000370028.3_Silent_p.G852G|ARHGAP4_ENST00000393721.1_Silent_p.G634G	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	812					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGCCCTGCGCCCACCACCT	0.701													G|||	24	0.00635762	0.0182	0.0	3775	,	,		11149	0.0		0.0	False		,,,				2504	0.0				p.G852G		.											.	ARHGAP4-227	0			c.C2556T						.	G	,	52,3782		0,47,5,1585,565	29.0	27.0	28.0		2556,2436	-2.1	0.0	X	dbSNP_129	28	0,6727		0,0,0,2428,1871	no	coding-synonymous,coding-synonymous	ARHGAP4	NM_001164741.1,NM_001666.4	,	0,47,5,4013,2436	AA,AG,A,GG,G		0.0,1.3563,0.4924	,	852/987,812/947	153174968	52,10509	2202	4299	6501	SO:0001819	synonymous_variant	393	exon21			CCCTGCGCCCACC	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2436C>T	X.37:g.153174968G>A		229	3		392	239	NM_001164741	0	0	0	0	0	Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	37	CCDS14736.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	4.780	0.145016	0.09134	0.013563	0.0	ENSG00000089820	ENST00000454164	.	.	.	3.19	-2.14	0.07123	.	.	.	.	.	T	0.12518	0.0304	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22695	-1.0209	4	.	.	.	.	0.2203	0.00167	0.3472:0.2035:0.2426:0.2067	.	.	.	.	V	234	.	.	A	-	2	0	ARHGAP4	152828162	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	0.368000	0.20399	-0.297000	0.08934	0.525000	0.51046	GCG	G|0.996;A|0.004		0.701	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
NCOR2	9612	hgsc.bcm.edu	37	12	124824739	124824740	+	Frame_Shift_Ins	INS	-	-	GCCG			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr12:124824739_124824740insGCCG	ENST00000405201.1	-	37	5499_5500	c.5499_5500insCGGC	c.(5497-5502)cagagcfs	p.S1834fs	NCOR2_ENST00000397355.1_Frame_Shift_Ins_p.S1825fs|NCOR2_ENST00000404621.1_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000429285.2_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000356219.3_Frame_Shift_Ins_p.S1841fs|NCOR2_ENST00000404121.2_Frame_Shift_Ins_p.S1395fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1845					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ctgccgctgctctgctCTGTAC	0.713																																					p.S1834fs		.											.	NCOR2-229	0			c.5500_5501insCGGC						.																																			SO:0001589	frameshift_variant	9612	exon39			CGCTGCTCTGCTC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5499_5500insCGGC	12.37:g.124824739_124824740insGCCG	ENSP00000384018:p.Ser1834fs	7	0		110	20	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			GCCGCTGCT|1.000;|0.000		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
MEGF11	84465	broad.mit.edu	37	15	66209208	66209209	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr15:66209208_66209209insG	ENST00000409699.2	-	17	2344_2345	c.2172_2173insC	c.(2170-2175)gcctgcfs	p.C725fs	MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000395625.2_Frame_Shift_Ins_p.C650fs|MEGF11_ENST00000360698.4_Frame_Shift_Ins_p.C725fs|MEGF11_ENST00000288745.3_Frame_Shift_Ins_p.C650fs|MEGF11_ENST00000422354.1_Frame_Shift_Ins_p.C725fs|MEGF11_ENST00000478721.1_5'Flank			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	725	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						GTGCAGTGGCAGGCCCCGTCCT	0.673											OREG0023198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C725fs		.											.	MEGF11-69	0			c.2173_2174insC						.																																			SO:0001589	frameshift_variant	84465	exon17			AGTGGCAGGCCCC	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.2173dupC	15.37:g.66209210_66209210dupG	ENSP00000386908:p.Cys725fs	67	0	1090	148	9	NM_032445	0	0	0	0	0	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Frame_Shift_Ins	INS	ENST00000409699.2	37	CCDS10213.2																																																																																			.		0.673	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
VTN	7448	hgsc.bcm.edu	37	17	26699367	26699368	+	5'Flank	INS	-	-	C	rs11437594		TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:26699367_26699368insC	ENST00000226218.4	-	0	0				CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_Frame_Shift_Ins_p.A72fs|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000536498.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CCTGGCTGCTGCGGCCGTGGGC	0.743													CC|C|CC|deletion	5008	1.0	1.0	1.0	5008	,	,		10362	1.0		1.0	False		,,,				2504	1.0				p.A105fs		.											.	.	0			c.313_314insC						.			2410,14		1203,4,5						0.8	1.0		dbSNP_120	3	4457,19		2225,7,6	no	frameshift	SARM1	NM_015077.2		3428,11,11	A1A1,A1R,RR		0.4245,0.5776,0.4783				6867,33				SO:0001631	upstream_gene_variant	23098	exon2			GCTGCTGCGGCCG	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699368_26699368dupC	Exception_encountered	0	0		10	10	NM_015077	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			-|0.009;C|0.991		0.743	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346616	39346617	+	In_Frame_Ins	INS	-	-	AGCCTAGCTGTGGGTCCAGCTGCTGCC			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	ENST00000398470.1	+	1	478_479	c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC	c.(478-480)cag>cAGCCTAGCTGTGGGTCCAGCTGCTGCCag	p.160_160Q>QPSCGSSCCQ	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.77_77Q>QPSCGSSCCQ	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	160	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CAGCTGCTGCCAGCCTTGCTGC	0.599																																					p.Q160delinsQPSCGSSCCQ		.											.	.	0			c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	728318	exon1			TGCTGCCAGCCTT	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	Exception_encountered	109	0		241	0	NM_001190460	0	0	0	0	0		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.		0.599	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
AATK	9625	hgsc.bcm.edu;broad.mit.edu	37	17	79093270	79093271	+	In_Frame_Ins	INS	-	-	GGGCGT	rs55713566|rs541665071|rs376907005	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr17:79093270_79093271insGGGCGT	ENST00000326724.4	-	13	4017_4018	c.3993_3994insACGCCC	c.(3991-3996)cccgct>cccACGCCCgct	p.1330_1331insPT	AATK_ENST00000417379.1_In_Frame_Ins_p.1227_1228insPT	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1330					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.P1331_A1332insTP(1)		endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GAGAAGGGAGCGGGCGTGGGCG	0.713																																					p.A1332delinsTPA		.											.	AATK-933	1	Insertion - In frame(1)	ovary(1)	c.3994_3995insACGCCC						.		,	365,224,3171		3,1,358,21,181,1316					,	1.2	0.0			19	193,266,7379		3,0,187,18,230,3481	no	codingComplex,codingComplex	AATK	NM_004920.2,NM_001080395.2	,	6,1,545,39,411,4797	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8561,15.6649,9.036	,	,		558,490,10550				SO:0001652	inframe_insertion	9625	exon13			AGGGAGCGGGCGT	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3988_3993dupACGCCC	17.37:g.79093271_79093276dupGGGCGT	ENSP00000324196:p.Pro1329_Thr1330dup	12	0		86	14	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	In_Frame_Ins	INS	ENST00000326724.4	37	CCDS45807.1																																																																																			.		0.713	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
FBN2	2201	hgsc.bcm.edu;bcgsc.ca	37	5	127685053	127685054	+	Frame_Shift_Ins	INS	-	-	CAGTCCCATCCAA			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr5:127685053_127685054insCAGTCCCATCCAA	ENST00000508053.1	-	29	3948_3949	c.2974_2975insTTGGATGGGACTG	c.(2974-2976)ggcfs	p.G992fs	FBN2_ENST00000262464.4_Frame_Shift_Ins_p.G992fs|FBN2_ENST00000508989.1_Frame_Shift_Ins_p.G959fs			P35556	FBN2_HUMAN	fibrillin 2	992	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACATACACGGCCAGTCCCATCC	0.46																																					p.G992fs		.											.	FBN2-146	0			c.2975_2976insTTGGATGGGACTG						.																																			SO:0001589	frameshift_variant	2201	exon23			ACACGGCCAGTCC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2962_2974dupTTGGATGGGACTG	5.37:g.127685053_127685054insCAGTCCCATCCAA	ENSP00000424571:p.Gly992fs	134	0		113	4	NM_001999	0	0	0	0	0	B4DU01|Q59ES6	Frame_Shift_Ins	INS	ENST00000508053.1	37	CCDS34222.1																																																																																			.		0.460	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
TTLL11	158135	hgsc.bcm.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	2	0		43	15	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
COG8	84342	hgsc.bcm.edu;bcgsc.ca	37	16	69368962	69368963	+	Missense_Mutation	DNP	AT	AT	TC			TCGA-OR-A5LI-01A-11D-A30A-10	TCGA-OR-A5LI-10A-01D-A30A-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8ab58845-5c4f-49a5-89c4-b173303f0667	ad685e97-6dbd-4cf4-8afb-136bcec42297	g.chr16:69368962_69368963AT>TC	ENST00000306875.4	-	3	988_989	c.874_875AT>GA	c.(874-876)ATc>GAc	p.I292D	COG8_ENST00000562081.1_Missense_Mutation_p.I292D|RP11-343C2.12_ENST00000562949.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	292					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						GTCTGAGAAGATGGCACGGTAC	0.515																																					p.I292D		.											.	COG8-91	0			c.A874G						.																																			SO:0001583	missense	84342	exon3			AGAAGATGGCACG	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.874_875delinsTC	16.37:g.69368962_69368963delinsTC	ENSP00000305459:p.Ile292Asp	184	0		252	0	NM_032382	0	0	0	0	0	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	DNP	ENST00000306875.4	37	CCDS10876.1																																																																																			.		0.515	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
